A nucleic acid molecule preparation and its use in the preparation of a medicament for the treatment of depression

By using nucleic acid molecular formulations based on the redesign of the DYM gene exon sequence and utilizing a nanoliposome delivery system to target the brain and increase the expression of circDYM, the problems of slow onset of action, large side effects, and diminishing efficacy of existing antidepressants are solved, achieving rapid relief of depressive symptoms and improvement of neurological function.

CN122124085APending Publication Date: 2026-06-02NEURODAWN PHARM CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NEURODAWN PHARM CO LTD
Filing Date
2026-03-11
Publication Date
2026-06-02

Smart Images

  • Figure CN122124085A_ABST
    Figure CN122124085A_ABST
Patent Text Reader

Abstract

This invention discloses a nucleic acid molecular formulation and its application in the preparation of a medicament for treating depression. The nucleic acid molecular formulation comprises a nucleic acid molecular construct containing a sequence having at least 80% homology to the sequence shown in SEQ ID NO:1. The circRNADYMΔ1 molecule of this invention can efficiently target the brain via a lipid nanoparticle (LNP) delivery system, significantly reducing neuroinflammation in depressed mice and improving depressive and anxiety-like behaviors. Experiments show that LNP formulations containing circDYM and circDYMΔ1, administered intranasally, can effectively improve synaptic plasticity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a nucleic acid molecular preparation based on the redesign of the DYM gene exon sequence and its application in the preparation of drugs for the treatment of depression. Background Technology

[0002] Depression is a serious mental illness characterized by persistent low mood, anhedonia, and hopelessness, significantly impacting patients' emotions, cognitive function, and even physical health. As one of the most prevalent central nervous system disorders, depression has become a major global health challenge, often characterized by a protracted and recurrent course, requiring many patients to undergo long-term or even lifelong maintenance therapy to prevent relapse. Despite advancements in treatment methods for depression, current clinical interventions are far from ideal. Existing first-line antidepressant medication regimens have significant limitations. Data shows that only about 30% of patients achieve symptom relief after initial treatment, meaning that up to 70% of patients do not respond well to initial treatment, facing ineffective or insufficient treatment. Further examination of long-term treatment reveals even more significant shortcomings of existing medications. First, most medications have a slow onset of action, typically requiring several weeks to show effects, failing to meet patients' urgent need for rapid relief. Second, long-term medication use is often accompanied by significant side effects (such as metabolic disorders, sexual dysfunction, and drowsiness), leading to decreased patient adherence. More importantly, about 30%-50% of patients experience a decline in efficacy or drug resistance during long-term treatment, which ultimately leads to disease relapse.

[0003] circRNAs (circRNAs), a class of closed circRNA molecules formed through backsplicing of precursor RNA, have seen significant progress in biological function research in recent years. The understanding of circRNA function has shifted from "transcriptional noise" to a regulatory hub. Early studies classified them as byproducts of RNA splicing, but recent breakthroughs have revealed their multidimensional regulatory mechanisms: 1) capturing microRNAs (miRNAs) through sequence complementarity, relieving their inhibitory effect on target mRNAs; 2) forming a spatial interaction network with RNA-binding proteins (RBPs), regulating mRNA stability and subcellular localization; 3) containing ribosome entry sites in specific circular structures, translating functional micropeptides. These mechanisms collectively constitute a multidimensional regulatory network for circRNAs in physiological and disease regulation. Multiple studies have shown that, based on their high stability and multidimensional regulatory capabilities, circRNAs can persist long-term in the nervous system and participate in biological processes closely related to depressive pathology, such as synaptic plasticity and neuroinflammation, by continuously regulating the expression of downstream target genes. These multidimensional regulatory mechanisms lay a solid molecular foundation for their application in the treatment of depression.

[0004] Studies have shown that circRNAs are involved in the development and progression of depression. Among them, circRNA DYM (circDYM) is considered a highly promising endogenous molecule for treating depression. Previous studies by our group and other independent studies have found that circDYM expression is significantly downregulated in the plasma of patients with depression and in the plasma and hippocampus of depressive-like mouse models, suggesting that changes in its expression level are closely related to the pathological process of depression. Further mechanistic studies have shown that circDYM can effectively inhibit the overactivation of microglia by binding to TATA-box-binding protein-associated factor 1 (TAF1) or miRNA-9, thereby exerting a neuroprotective effect. Upregulating circDYM expression using lentivirus (LV) or extracellular vesicle (EV) technology can significantly improve depressive-like behaviors in lipopolysaccharide (LPS)-induced inflammation models and chronic unpredictable stress (CUS)-induced depression mouse models. These findings strongly demonstrate the great potential of circDYM as a therapeutic target for depression. Summary of the Invention

[0005] The purpose of this invention is to provide a novel nucleic acid molecular preparation based on the redesign of the DYM gene exon sequence and its application in the treatment of depression, so as to overcome the problems of slow onset of action, large side effects, diminishing efficacy, and insufficient expression or limited function of endogenous circDYM in existing antidepressants.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The present invention provides a nucleic acid molecular formulation comprising a nucleic acid molecular construct containing a sequence having at least 80% homology with the sequence shown in SEQ ID NO:1.

[0008] In one preferred embodiment, the nucleic acid molecular construct comprises the sequence shown in SEQ ID NO:1. In a further preferred embodiment, the nucleic acid molecular construct is composed of the sequence shown in SEQ ID NO:1.

[0009] SEQ ID NO:1:

[0010] TTGAAAACAACCCTCGAACAGGAAATCTTGCTGCGCTAACTAAGGTCTTCCTATCTAGAACCAGGGAGCTCAGGCTCCTTCATCTGGCAGACACACAATGCTCTGTTTATTTGCTGCTTGCTGAATTGAAAACAACCCTCGAACAGGAAATCTTGCTGCGCT AACTAAGGTCTTCCTATCTAGAACCAGGGAGCTCAGGCTCCTTCATCTGGCAGACACACAATGCTCTGTTTATTTGCTGCTTGCTGAAGTTCTGACTCTGAAGACCTTCTGGAAGAGTTGCTCTGCAGCTTGGTACAGTTAATCACTGATACTCCACTCTT.

[0011] The nucleic acid molecule construct can be in the form of RNA or DNA. As one embodiment, the nucleic acid molecule construct is a circular RNA molecule or a linear RNA molecule. As another embodiment, the nucleic acid molecule construct is a circular DNA molecule or a linear DNA molecule. Alternatively, the nucleic acid molecule construct can also be a DNA molecule encoding the aforementioned RNA molecule.

[0012] The nucleic acid molecular construct is derived from the DYM gene of mammals or amphibians. As a preferred embodiment, the mammals include, but are not limited to, humans, mice, rhesus monkeys, rats, cynomolgus monkeys, chimpanzees, hamsters, ferrets, cattle, and dogs; the amphibians include, but are not limited to, Xenopus laevis. The DYM gene contains exon 4, exon 5, and exon 6.

[0013] In a preferred embodiment, the nucleic acid molecule construct comprises sequences formed by artificially modifying exons 4, 5, and 6. The artificial modification is selected from one or more combinations of the following: nucleotide substitution, nucleotide deletion, exon sequence rearrangement, nucleic acid sequence tandem, and interspecies exon splicing. In a further preferred embodiment, the nucleotide substitution includes adding a TFR aptamer sequence or a spacer sequence. In a further preferred embodiment, the nucleotide deletion refers to deleting one or more exons selected from the group consisting of exons 4, 5, and 6.

[0014] The formulation can be in the form of a naked nucleic acid molecule or may contain a pharmaceutically acceptable carrier. As one embodiment, the formulation is in the form of a naked nucleic acid molecule. As another preferred embodiment, the formulation further contains a pharmaceutically acceptable carrier in which the nucleic acid molecule construct is encapsulated. The pharmaceutically acceptable carrier includes, but is not limited to: nanoliposomes, mammalian extracellular vesicles, viral vectors, cationic polymers, inorganic nanoparticles, and small molecule compounds with targeted delivery capabilities. As one preferred embodiment, the carrier is selected from nanoliposomes, mammalian extracellular vesicles, or viral vectors. As a further preferred embodiment, the carrier is a nanoliposome.

[0015] In a preferred embodiment, the carrier is a nanoliposome particle, and the nucleic acid molecule construct is encapsulated in the nanoliposome particle after obtaining an RNA precursor through in vitro transcription from a DNA template. The raw materials for in vitro transcription include natural nucleotides or at least one modified nucleotide. The DNA template is obtained from genomic DNA by PCR or synthesized industrially. In a preferred embodiment, the nanoliposome particle comprises ionizable lipids, cholesterol, 1,2-distearate-sn-glycerol-3-phosphorylcholine (DSPC), and PEG lipids. In a further preferred embodiment, the molar percentages of each component are: ionizable lipids 20-60%, DSPC 20-55%, cholesterol 19.5-55%, and PEG lipids 0.5-5%.

[0016] The present invention also provides the use of the nucleic acid molecular preparations described in any of the foregoing embodiments in the preparation of a drug. As a preferred embodiment, the drug is used to treat depression. As another alternative embodiment, the drug is used to prevent depression.

[0017] As a preferred embodiment, the drug is administered via nasal administration. As other alternative embodiments, the drug may also be administered via one or more of the following methods: intravenous injection, arterial injection, intraventricular injection, intramuscular injection, intraosseous injection, oral administration, intraperitoneal injection, subcutaneous injection, or transcerebral microinjection. As a preferred embodiment, the treatment regimen of the drug includes single-dose or multiple-dose administration. As an optional clinical embodiment, the administration time is from 1 hour to 7 days after the completion of the depression model.

[0018] The present invention also provides a nucleic acid molecule construct. As a preferred embodiment, the nucleic acid molecule construct is composed of the sequence shown in SEQ ID NO:1. As a further preferred embodiment, the nucleic acid molecule construct is a circular RNA molecule, named circDYM Δ1.

[0019] Beneficial effects: The circRNADYMΔ1 molecule of this invention can efficiently target the brain via a lipid nanoparticle (LNP) delivery system, significantly reducing neuroinflammation in depressed mice and improving depressive and anxiety-like behaviors. Experiments show that LNP formulations containing circDYM and circDYMΔ1, administered intranasally, can effectively improve synaptic plasticity. Attached Figure Description

[0020] Figure 1 To validate in vivo the effects of LNP-encapsulated circDYM and circDYMΔ1 on treating depressive-like behavior in CSDS mice; A shows the structural diagrams of circDYM and circDYMΔ1, B shows the behavioral experimental procedure, C shows the sucrose preference test, D shows the forced swimming test, and E shows the tail suspension test results. The results indicate that LNP encapsulation of both circDYM and circDYMΔ1 significantly improved depressive-like behavior in CSDS mice.

[0021] Figure 2 To validate in vivo the effects of LNP-coated circDYM and circDYM Δ1 on anxiety-like behavior in CSDS mice; where: A represents the total distance moved by the mice in the open field test, B represents the number of times the mice entered the central region in the open field test, C represents the time the mice spent in the central region in the open field test, and D represents the movement trajectory of the mice. The results showed that both LNP-coated circDYM and circDYM Δ1 significantly improved anxiety-like behavior in CSDS mice. Detailed Implementation

[0022] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] Unless otherwise stated, the molecular biology experimental methods used in this invention, such as PCR amplification, plasmid construction, in vitro transcription, RNA purification, and gel electrophoresis, are all conventional techniques in the art. Specific operations can be performed in accordance with classic experimental guidelines in the field (such as *Molecular Cloning: A Laboratory Manual*) or relevant kit instructions. Those skilled in the art, based on the technical solutions provided in the embodiments of this invention and combined with conventional experimental methods in the art, can achieve the preparation of circDYM Δ1 described in this invention.

[0024] Unless otherwise specified, the raw materials and reagents used in the examples are commercially available conventional products; experimental methods not specified in the examples are generally performed under conventional conditions in the art or under conditions recommended by the manufacturer.

[0025] Information regarding some of the components involved in the embodiments of this application is as follows:

[0026] Dilinoleylmethyl 4-(dimethylamino)butanoate (DLin-MC3-DMA, CAS No. 1224606-06-7).

[0027] Bis(2-(decyldithio)ethyl)3,3'-[(2-(1H-indol-3-yl)ethyl)azadiyl]dipropionate (NT1-O14B, CAS No. 2739805-64-0);

[0028] 8-[(2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino]octanoic acid-1-octylnonyl ester (SM-102, CAS No. 2089251-47-6);

[0029] 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS No. 816-94-4).

[0030] 1,2-Dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2000, CAS No. 160743-62-4).

[0031] LNP (Lipid Nanoparticle) is a lipid nanoparticle with multiple charged lipids coexisting. This delivery system has the characteristics of high load and high stability, and can efficiently deliver circDYM and circDYM Δ1. After entering the cell, it can escape from the endosome and has a higher brain targeting ability compared with ordinary lipid nanoparticles.

[0032] Example 1: Preparation of LNP-circDYM and circDYM Δ1

[0033] Design of circDYM Δ1

[0034] Bioinformatics analysis predicted the key structural domains for the core function of circDYM, specifically the bases 1-77 of exon 4 and the bases 101-151 of exon 5. Based on this, these two key base segments were spliced ​​together, and the spliced ​​sequence was tandemly repeated twice to form a core functional module. Subsequently, the sequence of exon 6 was fused to the end of this module, thereby constructing a circDYM mutant that retains the natural core biological activity and has enhanced function, named circDYM△1.

[0035] In vitro synthesis of circDYM and circDYM Δ1

[0036] Circular RNA was synthesized in vitro using type I intron self-splicing. The specific preparation process is as follows:

[0037] The target exon (E1 / E2) is fused with a modified type I intron (e.g., from *Anabaena* or T4 phage). A "Permuted Intron-Exon" (PIE) strategy is employed: the intron is split into two parts, located at opposite ends of the exon, forming a linear precursor RNA. Using linearized DNA as a template, precursor RNA containing the type I intron and the target exon is generated through in vitro transcription. This precursor RNA is then processed in GTP (or GMP) and Mg... 2+In the presence of [specific ingredient], the following two-step transesterification reaction occurs: Step 1: The 3′-OH of the exogenous guanosine nucleophilically attacks the phosphodiester bond at the 5′ splice site, breaking the connection between the 5′ exon and the intron, forming an intron-guanosine intermediate, and releasing the 5′ exon (with free 3′-OH). Step 2: The 3′-OH of the 5′ exon attacks the 3′ splice site, completing the exon connection, and simultaneously releasing the intron (usually in a linear or cyclic form), thus obtaining the target product. The sequence of circDYM Δ1 is shown in SEQ ID NO:1.

[0038] SEQ ID NO:1:

[0039] TTGAAAACAACCCTCGAACAGGAAATCTTGCTGCGCTAACTAAGGTCTTCCTATCTAGAACCAGGGAGCTCAGGCTCCTTCATCTGGCAGACACACAATGCTCTGTTTATTTGCTGCTTGCTGAATTGAAAACAACCCTCGAACAGGAAATCTTGCTGCGCT AACTAAGGTCTTCCTATCTAGAACCAGGGAGCTCAGGCTCCTTCATCTGGCAGACACACAATGCTCTGTTTATTTGCTGCTTGCTGAAGTTCTGACTCTGAAGACCTTCTGGAAGAGTTGCTCTGCAGCTTGGTACAGTTAATCACTGATACTCCACTCTT.

[0040] Take circDYM and circDYM Δ1 respectively, and prepare circDYM and circDYM Δ1 sodium acetate solutions with pH=5.0, circDYM and circDYM Δ1 concentrations of 10 uM and sodium acetate concentration of 25 mM using sodium acetate buffer (pH=5.0);

[0041] Ionizable lipids, DSPC, cholesterol, and DMG-PEG2000 were dissolved in anhydrous ethanol to prepare a lipid ethanol solution with a total lipid concentration of 4 mg / mL. The lipid components, by molar percentage, contained 1.5% DOTAP, 50% SM-102, 8.5% DSPC, 38.5% cholesterol, and 1.5% DMG-PEG2000. 0.1 mL of the lipid ethanol solution was injected into 1 mL of sodium acetate buffer using a 1 mL BD Rejuvenate insulin syringe to prepare an empty nanoparticle suspension (LNP).

[0042] 0.2 mL of sodium acetate solution containing circDYM and circDYM Δ1 prepared in step (1) was injected into 0.2 mL of empty nanoparticle solution prepared in step (2) using a 1 mL BD Reliable insulin syringe. The solution was incubated for 1 minute under vortex stirring to obtain initial LNP solutions containing circDYM and circDYM Δ1 respectively. Steps (1)-(3) above can be repeated to obtain more initial LNP solutions containing circDYM and circDYM Δ1 respectively.

[0043] Ethanol was removed from the initial LNP solution using an ultrafiltration tube with a molecular weight cutoff of 100 kDa and centrifugation at 13000 g. The concentrations of circDYM and circDYM Δ1 were adjusted to 300 μM with denuclease-free water, and the pH was adjusted to 7.0 with 0.1 M sodium hydroxide or hydrochloric acid solution to obtain LNP suspensions coated with circDYM and circDYM Δ1, respectively.

[0044] Example 2: In vivo verification of the therapeutic effects of LNP delivery of circDYM and circDYM Δ1 on depressed mice.

[0045] Mice were divided into five groups after CSDS (Chronic Social Defeat Stress) modeling was established: Control group, CSDS group, CSDS+LNP-circDYM group, CSDS+LNP-circDYM Δ1 group, and CSDS+Fluoxetine group. LNP-circDYM and LNP-circDYM Δ1 were administered intranasally as a single dose after successful CSDS modeling. Specific tests for depressive-like behaviors included the sucrose preference test (SPT), forced swimming test (FST), and tail suspension test (TST). Anxiety-like behaviors were assessed using the open field test (OFT).

[0046] The results are as follows Figure 1 As shown in the figure, the LNP-DYM and LNP-DYM Δ1 treatment groups significantly improved the depressive-like behavior in mice, and this improvement was statistically significant.

[0047] The results are as follows Figure 2 As shown in the figure, the LNP-DYM and LNP-DYM Δ1 treatment groups significantly improved anxiety-like behavior in mice, and this improvement was statistically significant.

[0048] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0049] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A nucleic acid molecular preparation, characterized in that, The formulation comprises a nucleic acid molecule construct containing a sequence having at least 80% homology to the sequence shown in SEQ ID NO:

1.

2. The nucleic acid molecular preparation according to claim 1, characterized in that, The nucleic acid molecule construct is a circular RNA molecule, a linear RNA molecule, a circular DNA molecule, or a linear DNA molecule.

3. The nucleic acid molecular preparation according to claim 1, characterized in that, The nucleic acid molecular construct contains the sequence shown in SEQ ID NO:

1.

4. The nucleic acid molecular preparation according to claim 1, characterized in that, The nucleic acid molecular construct is derived from the DYM gene of mammals or amphibians; The mammals include humans, mice, rhesus monkeys, rats, cynomolgus monkeys, chimpanzees, hamsters, ferrets, cattle, and dogs; the amphibians include clawed frogs. The DYM gene contains exon 4, exon 5 and exon 6.

5. The nucleic acid molecular preparation according to claim 4, characterized in that, The nucleic acid molecular construct comprises a sequence formed by artificially modifying exon 4, exon 5 and exon 6; The artificial modification is selected from one or more of the following methods: nucleotide substitution, nucleotide deletion, exon sequence adjustment, nucleic acid sequence tandem, and exon splicing between different species. The nucleotide substitution includes the addition of a TFR aptamer sequence or a spacer sequence; The nucleotide deletion refers to the deletion of one or more exons selected from the group consisting of exon 4, exon 5, and exon 6.

6. The nucleic acid molecular preparation according to claim 1, characterized in that, The formulation is in the form of naked nucleic acid molecules, or may also contain a pharmaceutically acceptable carrier; The carrier is selected from nanoliposome particles, extracellular vesicles of mammalian cells, or viral vectors; the nucleic acid molecule construct is encapsulated in the carrier.

7. The nucleic acid molecular preparation according to claim 6, characterized in that, The carrier is a nanoliposome particle, and the nucleic acid molecule construct is obtained by in vitro transcription of an RNA precursor from a DNA template and then encapsulated in the nanoliposome particle. The raw materials for the in vitro transcription include natural nucleotides or at least one modified nucleotide; the DNA template is obtained from genomic DNA by PCR or by industrial synthesis. The nanoliposome particles contain ionizable lipids, cholesterol, 1,2-distearate-sn-glycerol-3-phosphorylcholine (DSPC), and PEG lipids; the molar percentages of each component are: ionizable lipids 20-60%, DSPC 20-55%, cholesterol 19.5-55%, and PEG lipids 0.5-5%.

8. The use of the nucleic acid molecular preparation according to any one of claims 1 to 7 in the preparation of a medicament for treating depression.

9. The application according to claim 8, characterized in that, The drug is administered via one or more of the following methods: intranasal injection, intravenous injection, arterial injection, intraventricular injection, intramuscular injection, and intraosseous injection; the treatment regimen of the drug includes single administration or multiple repeated administrations.

10. A nucleic acid molecular construct, characterized in that, The nucleic acid molecular construct consists of the sequence shown in SEQ ID NO:1.