A strain of Bifidobacterium longum and its application

Abstract

This invention discloses a strain of *Bifidobacterium longum* and its applications. The invention provides a strain of *Bifidobacterium longum* FeiHeB18, which has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34752, dated June 4, 2025. The *Bifidobacterium longum* provided by this invention can colonize the intestine well, regulate the intestinal environment and flora, and significantly increase IFN-β levels and interferon-stimulated gene expression, thereby enhancing immunity. It has great application potential and can be used in products with related effects.

Description

Technical Field

[0001] This invention relates to a strain of Bifidobacterium longum and its applications, belonging to the field of microbial technology. Background Technology

[0002] The development of the human immune system is a complex and dynamic process. Starting in the embryonic stage, through the neonatal period and into childhood, the immune system gradually matures, reaching its peak function in adulthood, effectively recognizing and eliminating various pathogens. However, with age, the function of the immune system gradually declines, especially in old age, where its ability to respond to various pathogens weakens, making it more susceptible to infection. Besides age, environmental factors, lifestyle, disease, and genetics all affect the function of the immune system. These factors constantly impact the human immune system, leading to varying degrees of infection in different populations, especially susceptible individuals. Respiratory viral infections account for approximately 80% of respiratory disease cases. After entering the body through the respiratory tract, viruses multiply within the respiratory mucosal epithelial cells, causing local respiratory infections. Common respiratory viral infections include respiratory syncytial virus (RSV), influenza virus, adenovirus, coronavirus, and rhinovirus. In the body's anti-infection mechanisms, type I interferon (IFN-I), as a class of cytokines, can trigger the protective defense of the immune system and activate immune cells, playing a key role in responding to most viral infections and serving as a powerful first line of defense against pathogen invasion. Because interferon α / β receptors are expressed on all nucleated cells, IFN-I can effectively induce the expression of a wide range of interferon-stimulated genes (ISGs). This allows the body to enter an antiviral state by increasing cellular sensitivity to viral recognition, recruiting other immune cells, directly acting on viruses and blocking viral replication, or modulating interferon signaling pathways to prevent over-activation and maintain cellular homeostasis.

[0003] IFN-I was identified as a secretory protein with antiviral function in 1957. Subsequent studies have found that it also plays an important role in immune regulation and the invasion of non-viral pathogens. IFN-I is divided into different subclasses, including interferon alpha (IFN-α) and interferon beta (IFN-β), with IFN-α containing more than a dozen subtypes. IFN-α and IFN-β bind to a common receptor, IFNAR, activating the JAK-STAT pathway and inducing ISG gene expression, thus exerting antiviral, antiproliferative, antitumor, and immunomodulatory effects. Compared to IFN-α, IFN-β has a higher affinity for the receptor IFNAR, exhibiting greater antiproliferative and immunomodulatory activity. Furthermore, IFN-β is not associated with systemic diseases such as autoimmune diseases, but rather focuses on protective immunity against infection and inflammation. Therefore, regulating IFN-β may be a potential pathway for preventing and alleviating viral infections.

[0004] Probiotics can regulate the body's immunity by activating IFN-I related pathways through multiple levels of action. These mechanisms mainly involve immune regulation, microbiome interactions, and the gut-lung axis. Studies by Kim et al. have shown that palmitic acid, a metabolite of *Lactobacillus paracasei* MI29, can enhance IFN-I signaling and resist influenza virus infection in vivo, reduce weight loss, lung damage, and viral load in influenza virus-infected mice, thus protecting the host from influenza infection (cited in reference 1). A clinical trial involving 281 participants showed that LGG significantly reduced the risk of respiratory infections in children and shortened their duration (cited in reference 2).

[0005] Reference 3 discloses a strain of *Bifidobacterium breve* that can resist influenza infection by improving the degree of weight loss, blood indicators, respiratory tract inflammation status, and significantly enhancing antiviral proteins in the lungs of influenza mice. Reference 4 discloses a strain of *Bifidobacterium longum* that can beneficially modulate the immune response to respiratory viral infections by inhibiting type I interferon and enhancing the response of type III interferon to the virus, thereby treating viral infections.

[0006] Most studies on the antiviral effects of probiotics have focused on adults, with a lack of systematic research into their applicability and safety in children and other groups whose immune systems are not yet fully developed. Furthermore, infant-derived probiotics, because they originate from infants and young children whose immune systems are still developing, may have relatively higher safety profiles; however, research on infant-derived probiotics for the prevention of viral infections remains limited.

[0007] References 3 and 4 have certain limitations. Overall, these two patent documents only focus on certain aspects of the strain itself, without conducting a systematic and comprehensive evaluation of the strain's probiotic physiological characteristics. They do not address the evaluation of the strain's acid-producing capacity and intestinal epithelial cell adhesion ability, which are precisely the foundation for probiotics to exert their probiotic properties and regulate the intestinal flora. Furthermore, there is a very close relationship between the host flora and host health. The aforementioned patent documents also fail to further explore the applicability of the strains.

[0008] Reference 3 only explored the effect of a specific strain of Bifidobacterium breve on the expression of an antiviral protein, without further research into the specific mechanism by which this strain exerts its antiviral function.

[0009] The cited literature 4 explored the role of a specific strain of Bifidobacterium longum in reducing the risk of secondary bacterial infection after viral infection by inhibiting type I interferon response and promoting type III interferon response. However, it did not describe how Bifidobacterium longum directly inhibits the virus, nor did it describe the mechanism by which Bifidobacterium longum inhibits the virus. Furthermore, it is unknown what functions other strains of Bifidobacterium longum have.

[0010] References

[0011] Cited literature 1: Kim S, Lee S, Kim M N. Newly isolated Lactobacillus paracasei strain modulates lung immunity and improves the capacity to copewith influenza virus infection[J]. Microbiome, 2023, 11(1):260.

[0012] Cited literature 2: Hojsak I, Snovak N, Abdovi S, et al. Lactobacillus GG in the prevention of gastrointestinal and respiratory tract infections in children who attend day care centers: A randomized, double-blind, placebo-controlled trial[J]. Clinical Nutrition, 2010, 29(3):312-316.

[0013] Reference 3: CN110055185A

[0014] Reference 4: CN110352237A Summary of the Invention

[0015] The problem the invention aims to solve

[0016] The technical problem to be solved by this invention is to provide a strain of Bifidobacterium longum FeiHeB18 with good acid production capacity, intestinal epithelial cell adhesion capacity and intestinal flora regulation capacity, which promotes the secretion of IFN-β in the lungs after immune cells and viral infection and enhances immunity. It can be used to prepare products that effectively enhance the secretion of type I interferon, regulate the body's immune function, enhance immune defense capacity, improve the body's immune level, and further alleviate the symptoms after influenza virus infection.

[0017] Solution for solving the problem

[0018] [1]. A strain of Bifidobacterium longum FeiHeB18, wherein the strain of Bifidobacterium longum FeiHeB18 has been deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 34752 and deposit date of June 4, 2025.

[0019] [2]. A culture, wherein the culture is obtained by culturing the strain described in [1].

[0020] [3]. A microbial preparation, wherein the microbial preparation comprises the strain as described in [1], or the culture as described in [2].

[0021] [4]. A product comprising the strain described in [1], the culture described in [2], or the microbial preparation described in [3].

[0022] [5]. According to the product described in [4], wherein the viable count of Bifidobacterium longum FeiHeB18 strain in the product is not less than 1×10⁻⁶. 6 CFU / mL or 1×10 6 CFU / g.

[0023] [6]. The strain as described in claim [1], the culture as described in [2], or the microbial preparation as described in [3], in any of the following uses (1) to (4):

[0024] (1) Use in the preparation of products intended to help enhance immunity;

[0025] (2) Use in the preparation of products for regulating the secretion of cytokines;

[0026] (3) Use in the preparation of products that help regulate gut microbiota;

[0027] (4) Use in the preparation of products for improving gut health.

[0028] [7]. Use of the strains described in [1], the cultures described in [2], and the microbial preparations described in [3] in the preparation of products for the prevention of influenza virus infection and / or the improvement of symptoms caused by influenza virus infection.

[0029] [8]. According to the use described in [7], wherein the symptoms caused by the influenza virus infection include weight loss and / or inflammation; and / or,

[0030] The prevention of influenza virus infection includes reducing the incidence of infection; and / or,

[0031] The measures to improve influenza virus infection include reducing absenteeism and reducing antibiotic use.

[0032] [9]. According to the use described in [7], wherein the product reduces viral load, shortens the duration of infection, and enhances IFN-I response; and / or,

[0033] The product promotes the expression of interferon-stimulated gene-related proteins.

[0034]

[10] . According to the use described in [9], wherein the interferon-stimulated gene-related protein includes at least one of MxA, Oas1a, Irf7 and Rsad2; and / or,

[0035] The IFN-I includes IFN-β.

[0036] The effects of the invention

[0037] This invention provides a *Bifidobacterium longum* strain FeiHeB18, which exhibits good intestinal adaptability. Furthermore, this *Bifidobacterium longum* has the following beneficial effects:

[0038] (1) It can effectively alleviate various symptoms caused by influenza virus infection, such as alleviating weight loss in mice, reducing lung inflammation, and reducing viral load in the lungs.

[0039] (2) Good acid production capacity and intestinal epithelial cell adhesion capacity promote the maintenance of intestinal barrier function, thereby improving probiotic efficiency.

[0040] (3) It has a good inhibitory effect on intestinal pathogens and maintains a healthy intestinal microecological environment.

[0041] (4) Further systematically evaluate the probiotic physiological characteristics of the strain in animal experiments and human clinical trials.

[0042] (5) In animal experiments, activation of type I interferon response in mouse lungs significantly upregulated the level of IFN-β in the lungs and the expression of interferon-stimulated genes (ISGs).

[0043] (6) In clinical trials, Bifidobacterium longum strain FeiHeB18 reduced the incidence of respiratory infections in the population to a certain extent, reduced the occurrence of recurrent infections, and shortened the duration of infection.

[0044] (7) In clinical trials, Bifidobacterium longum strain FeiHeB18 can alleviate the symptoms caused by viral respiratory infection to a certain extent, significantly reduce the number of absentees, significantly reduce the number of people using antibiotics, effectively alleviate the negative emotions such as irritability, anger and pickiness that occur after viral respiratory infection, and reduce the impact on the population to a certain extent.

[0045] Therefore, the Bifidobacterium longum FeiHeB18 strain of the present invention has great application potential in the preparation of products that can prevent and alleviate symptoms caused by influenza virus infection, improve immune levels, regulate intestinal flora, and improve intestinal health. Attached Figure Description

[0046] Figure 1 This diagram illustrates the acid-producing ability and adhesion ability of the strain to intestinal epithelial cells (HT-29). Figure 1 (a) in the diagram is a schematic diagram of the acid production capacity of the strain; Figure 1 (b) in the figure is a schematic diagram of the adhesion ability of the strain to HT-29 cells.

[0047] Figure 2 This demonstrates the effect of the strain on promoting IFN-β secretion from mouse myeloid dendritic cells (BMDCs). The figure shows… "This represents p < 0.05", "This means p < 0.001.

[0048] Figure 3 This shows the change in body weight in mice after infection with the H1N1 influenza virus. The figure shows… "This means p < 0.05.

[0049] Figure 4 H&E stained pathological sections (magnification 10x) and pathological scores. Figure 4 (a) in the text represents the blank group; Figure 4 (b) in the table represents the H1N1 influenza virus infection group; Figure 4 (c) represents the Bifidobacterium longum FeiHeB18 intervention group; Figure 4 (d) in the figure represents the Bifidobacterium breve BB22M22 intervention group; Figure 4 (e) in the figure represents the pathological score. "This means p < 0.01.

[0050] Figure 5 This represents the viral load in the mouse lungs. (See figure "...") "This means p < 0.01.

[0051] Figure 6 This figure shows the expression of ISGs and the level of IFN-β in mouse lung tissue. "This represents p < 0.05", "This means p < 0.01", "This means p < 0.001. Figure 6 In the table, (a) represents the expression level of MxA; Figure 6 In the table, (b) represents the expression level of Oas1a; Figure 6 In the table, (c) represents the expression level of Rsad2; Figure 6 In the figure, (d) represents the expression level of Irf7; Figure 6 (e) in the figure represents the IFN-β level.

[0052] Figure 7 This shows the total score and scores for each indicator on the scale (divided into three aspects: symptoms, function, and impact on parents). The figure shows… "This means p < 0.01. Figure 7 (a) in the text represents the total score. Figure 7 (b) shows the symptom analysis scores; Figure 7 (c) in the figure represents the functional analysis score; Figure 7 (d) represents the impact rating on parents. Detailed Implementation

[0053] Various exemplary embodiments, features, and aspects of the present invention will be described in detail below. The term "exemplary" as used herein means "serving as an example, embodiment, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior to or better than other embodiments.

[0054] Furthermore, to better illustrate the present invention, numerous specific details are set forth in the following detailed embodiments. Those skilled in the art should understand that the present invention can be practiced without certain specific details. In other instances, methods, means, apparatus, and steps well known to those skilled in the art have not been described in detail in order to highlight the spirit of the present invention.

[0055] Unless otherwise stated, all units used in this specification are international standard units, and all numerical values ​​and ranges appearing in this invention should be understood to include systematic errors that are unavoidable in industrial production.

[0056] In this specification, the word "may" has two meanings: to perform a certain process and not to perform a certain process.

[0057] In this specification, references to "some specific / preferred embodiments or some specific / preferred implementations," "other specific / preferred embodiments or other specific / preferred implementations," "implementation or implementation," etc., refer to specific elements (e.g., features, structures, properties, and / or characteristics) related to the described implementation that are included in at least one of the embodiments described herein, and may or may not be present in other embodiments. Furthermore, it should be understood that these elements may be combined in any suitable manner in various embodiments.

[0058] In this specification, the range of values ​​referred to as "value A to value B" refers to the range including the endpoint values ​​A and B.

[0059] Preservation of biological materials

[0060] A strain of *Bifidobacterium longum*, FeiHeB18, has been taxonomically named *Bifidobacterium longum*. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCCNo. 34752, on June 4, 2025, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0061] strain

[0062] This invention provides a strain of Bifidobacterium longum, FeiHeB18, which is deposited at the China General Microbiological Culture Collection Center.

[0063] The *Bifidobacterium longum* FeiHeB18 strain was derived from a fecal sample of a healthy infant in Wuxi City, Jiangsu Province. Sequencing analysis of this strain and nucleic acid sequence alignment using NCBI Standard Nucleotide BLAST confirmed that the strain is *Bifidobacterium longum*, and it was named *Bifidobacterium longum* FeiHeB18 strain.

[0064] In this specification, the Bifidobacterium longum strain FeiHeB18 is also referred to as Bifidobacterium longum FeiHeB18.

[0065] In one embodiment of the present invention, the candidate strain was first evaluated through experiments on acid production capacity, adhesion to intestinal epithelial cells, ability to promote IFN-β production by mouse myeloid dendritic cells (BMDC), and inhibition of pathogens. It was found that the *Bifidobacterium longum* FeiHeB18 strain had a strong acid production capacity (e.g., ...). Figure 1 As shown in (a), it has a strong adhesion ability to intestinal epithelial cells (HT-29 cells) (e.g. Figure 1 As shown in (b)), the effect of promoting IFN-β production in mouse BMDC cells is more significant (e.g., Figure 2 As shown in Table 1), and with a more significant antibacterial ability. Subsequently, using a mouse model of influenza virus (H1N1) infection, the effect of the *Bifidobacterium longum* FeiHeB18 strain in preventing influenza virus infection was verified. The *Bifidobacterium longum* FeiHeB18 strain effectively alleviated various symptoms caused by viral infection, such as weight loss and pulmonary inflammation (e.g., ...). Figures 3-4 (As shown).

[0066] In one embodiment of the present invention, the *Bifidobacterium longum* strain FeiHeB18 can promote the expression of interferon-stimulated genes (ISGs) related proteins. In some specific embodiments, ISGs include MxA, Oas1a, Irf7, and Rsad2. In one embodiment of the present invention, the *Bifidobacterium longum* strain FeiHeB18 can significantly reduce viral load levels in the lungs after influenza virus infection (e.g., Figure 5 (As shown).

[0067] In one embodiment of the present invention, the *Bifidobacterium longum* FeiHeB18 strain can enhance the host's antiviral level by activating the host's IFN-I response (e.g., Figure 6 (As shown).

[0068] In one embodiment of the present invention, the Bifidobacterium longum strain FeiHeB18 reduces the incidence of respiratory tract infections in children to a certain extent, reduces the occurrence of recurrent infections to a certain extent, and reduces the occurrence of prolonged infections to a certain extent (as shown in Table 2).

[0069] In one embodiment of the present invention, the Bifidobacterium longum strain FeiHeB18 can significantly reduce the number of absent children and significantly reduce the number of children using antibiotics (as shown in Table 3).

[0070] In one embodiment of the present invention, the *Bifidobacterium longum* FeiHeB18 strain can alleviate symptoms caused by viral respiratory infections to a certain extent, effectively relieve emotional behaviors such as irritability, mood swings, and pickiness caused by viral respiratory infections, and to a certain extent reduce the decline in various functions of children caused by viral respiratory infections and the resulting impact on parents (such as...). Figure 7 (As shown).

[0071] Culture

[0072] In some aspects, the present invention provides a culture obtained from culturing the aforementioned Bifidobacterium longum FeiHeB18 strain.

[0073] In this invention, the term "culture" refers to a liquid or solid product (at least a portion of the substance within a culture container, such as supernatant) that has grown a microbial community after artificial inoculation and cultivation. That is, it is a product obtained by growing and / or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or it can contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process, or it can be a supernatant obtained by centrifugation.

[0074] In some embodiments, the culture is a product obtained by growing and / or amplifying microorganisms or a supernatant (cell-free supernatant) obtained by centrifuging the product.

[0075] Microbial preparations

[0076] In some aspects, the present invention also provides a microbial preparation comprising the above-described Bifidobacterium longum FeiHeB18 strain or the above-described culture.

[0077] In some embodiments, the microbial preparation of the present invention is a liquid, which may be a suspension or a culture. Furthermore, the microbial preparation may also contain a solvent, including but not limited to water or culture medium.

[0078] Furthermore, the microbial preparation may also contain a protectant (e.g., a lyophilization protectant), which includes, but is not limited to, skim milk powder, trehalose, monosodium glutamate, and / or glycerol.

[0079] In other embodiments, the microbial preparation of the present invention is a semi-solid, wherein the solid can be a bacterial sludge. The bacterial sludge refers to bacterial cells containing a small amount of moisture.

[0080] In some other embodiments, the microbial preparation of the present invention is a solid, which may be a lyophilized powder or the like.

[0081] product

[0082] The present invention further provides a product comprising a strain of Bifidobacterium longum FeiHeB18, the above-described culture, or the above-described microbial preparation.

[0083] In some embodiments, the viable count of the *Bifidobacterium longum* FeiHeB18 strain in the product is not less than 1 × 10⁻⁶. 6 CFU / mL or 1×10 6 Colony-forming units per gram (CFU / g).

[0084] In addition to the essential components described above, the products of this invention may also include other optional components as needed for the final product, such as:

[0085] The product contains milk or protein components. The milk components include dairy products such as fresh milk, milk powder, whey protein, or cheese derived from raw cow (sheep) milk. The protein components may be derived from plant proteins, such as soy protein or peanut protein.

[0086] Plants or plant extracts, including fruits such as fig, pomegranate, kiwi, orange, tangerine, pineapple, strawberry, apple, rubber, grape, pear, cherry, blueberry, blackberry, blackcurrant, cranberry, raspberry, melon, amla, and bilberry, or their extracts; fruits and vegetables such as onion, cucumber, tomato, cauliflower, carrot, spinach, kale, Brussels sprouts, garlic, basil, and oregano, or their extracts; grains such as rice (indica, japonica, glutinous rice), cereals (wheat, barley, oats, rye), corn, sorghum, millet, foxtail millet, yellow millet, buckwheat, soybean, broad bean, pea, mung bean, red bean, and kidney bean, or their extracts; nuts such as walnut, pistachio, cashew, hazelnut, almond, apricot kernel, pine nut, peanut, sunflower seed, chestnut, macadamia nut, and ginkgo, or their extracts; and coffee or its extracts.

[0087] Animal-derived ingredients, including meat products from cattle, sheep, fish, or poultry.

[0088] The fat component may include at least one of saturated fatty acids, polyunsaturated fatty acids, monounsaturated fatty acids, OPO structured lipids, DHA, EPA, ARA, and phospholipids. More specifically, the fat includes safflower seed oil, walnut oil, peanut oil, corn oil, soybean oil, argan oil, olive oil, tea oil, sacha inchi oil, coconut oil, perilla oil, deep-sea fish oil, cocoa butter, palm oil, tallow, cream, lard, medium-chain triglycerides, or lecithin, etc.

[0089] Functional additives include vitamins (one or more of vitamin A, beta-carotene, vitamin D3, vitamin E, vitamin K1, vitamin B1, vitamin B2, vitamin B6, vitamin B12, vitamin C, pantothenic acid, folic acid, niacin, choline, inositol, and biotin), starch, modified starch, amino acids (L-lysine-L-glutamic acid, L-glutamic acid, L-arginine, L-tryptophan, L-glutamine, taurine, L-valine, L-isoleucine, or L-leucine, etc.), traditional Chinese medicine or its extracts, and dietary fiber (inulin, konjac flour, galactooligosaccharides, fructooligosaccharides, isomaltooligosaccharides, soybean polysaccharides, cyclodextrin, resistant dextrin, or soybean fiber, etc.).

[0090] Micronutrient supplements may include metal ion salts of organic acids, such as one or more of the following: calcium citrate, L-calcium lactate, calcium hydrogen phosphate, potassium gluconate, sodium citrate, ferrous gluconate, potassium iodide, zinc gluconate, sodium selenite, copper gluconate, chromium sulfate, manganese gluconate, and magnesium gluconate.

[0091] Any acceptable excipients, including but not limited to solvents, antioxidants, antibacterial agents, thickeners, diluents, cosolvents, stabilizers, emulsifiers, fillers, disintegrants, lubricants, coating materials, anti-caking agents, flavoring agents, sweeteners, food flavorings, food colorings, etc.

[0092] The present invention does not specifically limit the type of the above-mentioned products.

[0093] In some implementations, the product is food.

[0094] In some implementations, the product is a nutritional food, a functional food, or a health food.

[0095] In some embodiments, the food products described in this invention may be infant formula, baby food, children's formula, children's snacks, formula milk powder for pregnant women, milk powder for middle-aged and elderly people, or nutritional or dietary supplements.

[0096] In some implementations, the product is a food additive.

[0097] In some implementations, the product is a drug.

[0098] In some embodiments of the present invention, the drug contains Bifidobacterium longum FeiHeB18 strain, a drug carrier, and / or pharmaceutical excipients.

[0099] In some embodiments of the present invention, the drug carrier comprises microcapsules, microspheres, nanoparticles and / or liposomes.

[0100] In some embodiments of the present invention, the pharmaceutical excipient comprises excipients and / or additives.

[0101] In some embodiments of the present invention, the excipient comprises a binder, a filler, a disintegrant, and / or a lubricant.

[0102] In some embodiments of the present invention, the additives comprise solubilizers, cosolvents, latent solvents, and / or preservatives.

[0103] In some embodiments of the present invention, the dosage form of the drug is powder, granules, capsules, tablets, pills, or oral liquid.

[0104] In other implementations, the product is non-food.

[0105] In other implementations, the product is a non-health food.

[0106] In some other implementations, the product is a non-pharmaceutical.

[0107] In some implementations, the product is a probiotic product.

[0108] In some specific implementations, the probiotic product is a probiotic product with good intestinal adaptability, and the product contains the above-mentioned Bifidobacterium longum FeiHeB18 strain, the above-mentioned culture, or the above-mentioned microbial preparation.

[0109] In some exemplary embodiments, the probiotic product may be a probiotic powder.

[0110] In some implementations, those skilled in the art can select an appropriate amount of Bifidobacterium longum FeiHeB18 strain contained in the product based on factors such as product type.

[0111] In some embodiments, the viable count of the *Bifidobacterium longum* FeiHeB18 strain in the product (e.g., probiotic products, milk powder, etc.) is not less than 1 × 10⁻⁶. 6 CFU / mL or 1×10 6 Colony-Forming Units per Gram (CFU / g).

[0112] In some preferred embodiments, the viable count of the *Bifidobacterium longum* FeiHeB18 strain in the product (e.g., probiotic products, milk powder, etc.) is approximately 1 × 10⁻⁶. 7 CFU / mL or 1×10 7 CFU / mL or higher, 1×10 8 CFU / mL or 1×10 8 CFU / mL or higher, or 1×10 9 CFU / g or 1×10 9 CFU / mL or higher, for example, 2.5 × 10⁻⁶. 9 CFU / g or 2.5×10 9 CFU / mL, 5×10 9 CFU / g or 5×10 9 CFU / mL, 2.5×10 10 CFU / g or 2.5×10 10 CFU / mL, 5×10 10 CFU / g or 5×10 10 CFU / mL and 2.5×10 11CFU / g or 2.5×10 11 CFU / mL, 5×10 11 CFU / g or 5×10 11 CFU / mL, etc.

[0113] In some exemplary embodiments, the viable count of the *Bifidobacterium longum* FeiHeB18 strain in the product (e.g., probiotic products, milk powder, etc.) is approximately 1 × 10⁻⁶. 6 CFU / g or 1×10 6 CFU / mL up to 5×10 11 CFU / g or 5×10 11 CFU / mL.

[0114] For different product categories, the present invention does not particularly limit the specific form of the product. For example, it can be in powder form or liquid form.

[0115] The present invention does not specifically limit the target population of the product. For example, the product can be used for infants, children, teenagers or adults.

[0116] In some specific implementations, the products described in this invention may be infant formula, baby food, children's formula, children's snacks, formula milk powder for pregnant women, milk powder for middle-aged and elderly people, or nutritional or dietary supplements.

[0117] In other specific embodiments, the products of the present invention may be powdered reconstituteable foods (solid beverages, instant coffee, grain powder, nut powder or lotus root powder, etc.), baked goods (bread, cake or biscuit baked goods, etc.), beverages (carbonated beverages, fruit and vegetable juice beverages, functional beverages, tea beverages, milk beverages or alcoholic beverages, etc.), candies (gel candies, hard candies, compressed candies, etc.), milk and dairy products (fresh milk, milk powder, whey powder, fermented milk, cheese or condensed milk, etc. derived from fresh cow (sheep) milk), pasta products (noodles, instant noodles, steamed buns, dumplings or wontons, etc.), etc.

[0118] In some other specific embodiments, the product of the present invention is an oral preparation, which includes, but is not limited to, tablets, pills, granules, powders, teas, capsules, or oral liquids.

[0119] Uses of enhancing immunity and regulating cytokines

[0120] The *Bifidobacterium longum* strain FeiHeB18 and its culture provided by this invention can significantly increase the secretion of IFN-β and significantly promote the expression of cytokines. Furthermore, *Bifidobacterium longum* FeiHeB18 can also exert immunomodulatory functions and enhance immunity.

[0121] In some specific implementations, treatment with Bifidobacterium longum FeiHeB18 strain significantly increased IFN-β in immune cells.

[0122] In some specific implementations, treatment with Bifidobacterium longum FeiHeB18 strain significantly increased the pulmonary cytokine IFN-β.

[0123] In some specific implementations, treatment with the Bifidobacterium longum FeiHeB18 strain significantly increased the levels of interferon-stimulated genes (ISGs) related proteins.

[0124] In some specific implementations, ISG-related proteins include MxA, Oas1a, Irf7, and Rsad2.

[0125] As used in this invention, "MxA" represents Myxovirus resistant protein A.

[0126] As used in this invention, “Oas1a” means 2′,5′-oligoadenylate synthetase 1.

[0127] As used in this invention, "Irf7" stands for interferon regulatory factor 7.

[0128] As used in this invention, "Rsad2" represents the radical S-adenosyl methionine domain containing 2.

[0129] Therefore, the *Bifidobacterium longum* FeiHeB18 strain, culture, and microbial preparation provided by this invention can be used to prepare products containing cytokines that help enhance and regulate immunity. The products described in this invention also contain cytokines that help enhance and regulate immunity.

[0130] This invention does not specifically limit the product categories of cytokines that help enhance and regulate immunity.

[0131] Furthermore, in some embodiments, the immune-boosting and cytokine-regulating products are not intended for the prevention and / or treatment of disease. In some embodiments, the immune-boosting and cytokine-regulating products are food products. In some embodiments, the immune-boosting and cytokine-regulating products are health food products. In some embodiments, the immune-boosting and cytokine-regulating products are probiotic products.

[0132] In other embodiments, the product is a drug. In some specific embodiments, the drug is used to prevent and / or treat influenza virus infection or symptoms caused by it. In some specific embodiments, the *Bifidobacterium longum* FeiHeB18 strain can specifically activate the IFN-I response in the lungs after influenza virus infection, increase the level of IFN-β in the lungs, and also promote the expression of ISGs.

[0133] Uses to relieve influenza virus infection and reduce inflammation

[0134] The Bifidobacterium longum strain FeiHeB18 and its culture provided by this invention can alleviate various symptoms caused by influenza virus infection, reduce inflammation, and lower viral load.

[0135] Therefore, the *Bifidobacterium longum* FeiHeB18 strain, culture, and microbial preparation provided by this invention can be used to prepare products that help alleviate influenza virus infection. The products described in this invention also help alleviate influenza virus infection.

[0136] In some specific embodiments, the influenza virus is the A / FM1 / 47 (H1N1) influenza virus.

[0137] The Bifidobacterium longum FeiHeB18 strain, culture, and microbial preparation provided by this invention can be used to prepare products that help reduce inflammation.

[0138] In some specific implementations, the reduction of inflammation includes reducing alveolar septal thickening and decreasing inflammatory cell infiltration of the alveolar walls; reducing alveolar structural damage and decreasing inflammatory cell infiltration within the alveolar cavity.

[0139] This invention does not specifically limit the category of products that help regulate gut microbiota. In some embodiments, the mitigation of influenza virus is not intended to prevent and / or treat disease. In some embodiments, the product that helps alleviate influenza virus is a food. In some embodiments, the product that helps alleviate influenza virus is a health food. In some embodiments, the product that helps alleviate influenza virus is a probiotic product.

[0140] In other embodiments, the product is a medicine. In some specific embodiments, the medicine is used to prevent and / or improve influenza virus infection and / or alleviate inflammation caused by influenza virus infection.

[0141] In some specific implementation schemes, influenza virus infection caused by treatment with Bifidobacterium longum FeiHeB18 significantly reduced the inflammatory response in lung tissue and significantly lowered the pathological score.

[0142] In some specific implementation schemes, treatment with Bifidobacterium longum FeiHeB18 significantly reduced viral load in the lungs and decreased the expression level of viral protein (NP) genes.

[0143] In some specific implementation schemes, the Bifidobacterium longum strain FeiHeB18 can reduce the incidence of respiratory infections to a certain extent, reduce the occurrence of recurrent infections, and reduce the number of long-term infections.

[0144] In some specific implementation schemes, the Bifidobacterium longum strain FeiHeB18 has been shown to significantly reduce the number of absent children and significantly reduce the number of children using antibiotics.

[0145] In some specific implementation schemes, the Bifidobacterium longum strain FeiHeB18 can reduce the number of children with fever and the number of children with sore throat to some extent.

[0146] In some specific implementation schemes, the Bifidobacterium longum FeiHeB18 strain can significantly alleviate emotional symptoms such as irritability, mood swings, and pickiness caused by viral respiratory infections.

[0147] Uses that help regulate gut microbiota and promote gut health

[0148] The present invention provides the Bifidobacterium longum FeiHeB18 strain and its culture, which inhibit the growth of intestinal pathogenic microorganisms, further regulate the intestinal flora, and promote intestinal health.

[0149] In some preferred embodiments, the Bifidobacterium longum FeiHeB18 strain and its culture provided by the present invention can inhibit the growth of Gram-negative intestinal pathogens, further regulate the intestinal flora, and promote intestinal health.

[0150] Therefore, the *Bifidobacterium longum* FeiHeB18 strain, culture, microbial preparation, and preparation method provided by this invention can be used to prepare products that help regulate the intestinal flora. The products described in this invention also help regulate the intestinal flora and promote intestinal health.

[0151] This invention does not specifically limit the categories of products that help regulate gut microbiota. In some embodiments, the regulation of gut microbiota is not intended to prevent and / or treat diseases. For example, in cases of gut microbiota dysbiosis, or the presence of intestinal pathogens (Salmonella and Escherichia coli) but not to the extent of causing disease, or in cases of gut microbiota dysbiosis or an increase in intestinal pathogens not caused by disease, the present invention is used in the case of Bifidobacterium longum FeiHeB18 strain, culture, microbial preparation, and microbial preparation prepared by the preparation method provided.

[0152] In some specific implementations, the Bifidobacterium longum FeiHeB18 has good antibacterial ability, especially in antagonizing the growth of Salmonella and Escherichia coli, regulating the intestinal flora, and promoting intestinal health.

[0153] In some embodiments, the product that helps regulate gut microbiota is a food. In some embodiments, the product that helps regulate gut microbiota is a health food. In some embodiments, the product that helps regulate gut microbiota is a probiotic product.

[0154] In other embodiments, the product is a drug. In some specific embodiments, the drug is used to inhibit intestinal pathogens.

[0155] The Bifidobacterium longum FeiHeB18 strain and its culture provided by this invention have good acid-producing ability and intestinal epithelial cell adhesion ability, which can reduce the pH value of the intestine, further regulate the intestinal flora, and promote intestinal health.

[0156] In some specific implementations, the Bifidobacterium longum FeiHeB18 reduces the pH of the culture medium from 6.0 to 4.16, exhibiting good acid-producing ability, regulating the intestinal flora, and promoting intestinal health.

[0157] In some specific implementations, the Bifidobacterium longum FeiHeB18 has an adhesion rate of 7.43% to intestinal epithelial cells (HT-29 cells), demonstrating good intestinal epithelial cell adhesion ability and promoting intestinal health.

[0158] In some embodiments, the product promoting gut health is a food product. In some embodiments, the product promoting gut health is a health food product. In some embodiments, the product promoting gut health is a probiotic product.

[0159] Example

[0160] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0161] The culture media involved in the following examples are as follows:

[0162] mMRS liquid medium: peptone 10 g / L, beef extract 10 g / L, glucose 20 g / L, anhydrous sodium acetate 2 g / L, yeast extract 5 g / L, diammonium hydrogen citrate 2 g / L, K2PO4·3H2O 2.6 g / L, MgSO4·7H2O 0.5 g / L, MnSO4·H2O 0.25 g / L, Tween 80 1 mL / L, L-cysteine ​​0.5 g / L; pH 6.8.

[0163] mMRS solid medium: Add 20 g / L agar to the mMRS (MRS containing L-cysteine) liquid medium.

[0164] The preparation method of Bifidobacterium longum cells involved in the following examples is as follows:

[0165] Bifidobacterium longum was streaked onto mMRS solid medium and cultured anaerobically at 37°C for 48 hours to obtain single colonies. A single colony was picked and inoculated into 5 mL of mMRS liquid medium and cultured anaerobically at 37°C for 18 hours to activate it. This activation was repeated for two generations to obtain an activated solution. The activated solution was inoculated into MRS liquid medium at a rate of 2% (v / v) and cultured anaerobically at 37°C for 18 hours to obtain a bacterial suspension. The bacterial suspension was centrifuged at 5000 rpm for 15 minutes, and the supernatant was discarded to obtain Bifidobacterium longum cells.

[0166] The following examples illustrate the data processing and statistical analysis: For categorical variables in clinical data analysis, the chi-square test and Fisher's exact test were used, and the data were corrected using Bonferroni. A p-value < 0.017 was used as the threshold to determine significant differences between groups. Continuous variable data were expressed as "mean ± standard error of mean" (Mean ± SEM). The Shapiro-Wilk test was used to analyze whether the experimental data conformed to a normal distribution, and the Brown-Forsythe test was used to test whether the data conformed to homogeneity of variance. If the data were normally distributed and had homogeneous variances, one-way analysis of variance (ANOVA) was used, with the Tukey test used as a post-hoc test. If the data were not normally distributed or had unequal variances, the Kruskal-Wallis test was used, with Dunn's test used as a post-hoc test. A p-value < 0.05 was used as the threshold to determine significant differences between groups.

[0167] Example 1: Isolation and Identification of Strains

[0168] The specific steps are as follows:

[0169] 1. Separation and identification

[0170] Take 0.5 mL of stool sample from a healthy infant and add it to 4.5 mL of sterile saline for serial dilution. Divide the sample into two portions, each 100 μL, with a dilution gradient of 10. -4 10 -5 10 -6 The diluted solution was plated on mMRS solid medium with added mupirocin at pH 6.8, and anaerobically incubated at 37°C for 48 h. The colony morphology was observed and recorded.

[0171] Different morphological colonies were picked from the solid culture medium and streaked for isolation. After anaerobic culture at 37℃ for 48 h, different morphological single colonies were picked from the solid culture medium again and streaked for isolation until pure single colonies with consistent morphology were obtained.

[0172] Pure colonies from the solid culture medium were inoculated into 5 mL of liquid culture medium and anaerobically cultured at 37℃ for 18 h. 1 mL of bacterial solution was placed in a sterile centrifuge tube, centrifuged at 5000 r / min for 15 min, and the upper culture medium was discarded. The bacterial sludge was resuspended in 30% glycerol solution and stored at -80℃.

[0173] The isolated strains were identified using PCR amplification of 16S rDNA. The sequencing results were then compared with the NCBI standard Nucleotide BLAST sequence, yielding two Bifidobacterium strains: *Bifidobacterium longum* FeiHeB18 and *Bifidobacterium breve* BB22M22.

[0174] 2. 16S rDNA sequence of Bifidobacterium longum FeiHeB18 (SEQ ID NO: 1)

[0175]

[0176] Example 2: Acid-producing ability and adhesion to intestinal epithelial cells of the strain

[0177] The specific steps for the measurement are as follows:

[0178] (1) Bifidobacterium longum FeiHeB18, Bifidobacterium breve BB22M22 and Bifidobacterium animalis BB-12 (Bifidobacterium animalis subsp. lactis BB-12 is a strain known to the public and available through public commercial channels. This strain has been widely used in the fields of food, dietary supplements and probiotic products for a long time. This strain can be commercially purchased by those skilled in the art.) were streaked on mMRS solid medium (with 0.5 g / L L-cysteine ​​added, the same below) and cultured at 37°C for 48 h to obtain single colonies; single colonies were picked and inoculated into mMRS liquid medium (with 0.5 g / L L-cysteine ​​added, the same below) and cultured at 37°C for 18 h for activation. The activation was repeated for two generations to obtain the activated solution.

[0179] (2) Determination of acid production capacity: The bacterial culture was inoculated into mMRS liquid medium at an inoculation rate of 2% (v / v) and cultured at 37℃ for 18 h until the growth stabilized. The initial pH value and the pH value during the stable period of the medium were measured.

[0180] (3) Determination of intestinal epithelial cell adhesion ability: The activation solution was inoculated into mMRS liquid medium at an inoculum of 2% (v / v) and cultured at 37℃ for 24 h. The bacterial cells were collected by centrifugation and resuspended in PBS to obtain a certain concentration (10). 8HT-29 cells (purchased from the National Model and Special Experimental Cell Resource Bank, catalog number: TCU103) were revived, passaged, and plated in advance. The HT-29 cells were washed twice with PBS, and 1 mL of DMEM basal medium and 1 mL of bacterial suspension were added to each well. The cells were co-cultured in the dark for 4 h. Simultaneously, 1 mL of bacterial suspension resuspended in DMEM basal medium with fluorescent dye was added to a brown centrifuge tube and incubated in a cell culture incubator in the dark for 4 h as a control. After co-culture, the solution from each well was collected by pipetting and centrifugation at 37°C for 15 min in the dark. The cells were then centrifuged at 8000 r / min, 4°C, for 10 min. The cells were washed three times with PBS to remove excess fluorescent dye, and the bacterial suspension was resuspended in 1 mL of DMEM basal medium. HT-29 cells (purchased from the National Model and Special Experimental Cell Resource Bank, catalog number: TCU103) were washed twice with PBS. HT-29 cells (purchased from the National Model and Special Experimental Cell Resource Bank, catalog number: TCU103) were resuspended twice with PBS. The cells were co-cultured in the dark for 4 h. Simultaneously, 1 mL of bacterial suspension with fluorescent dye resuspended in DMEM basal medium was added to a brown centrifuge tube and incubated in a cell culture incubator in the dark for 4 h as a control. After co-culture, the solution from each well was collected by pipetting and centrifugation at 1000 r / min for 15 min in the dark. Centrifuge at 1000 rpm for 5 min, discard the supernatant, and resuspend in DMEM basal medium. The control group was similarly centrifuged, the supernatant discarded, and resuspended in DMEM basal medium. 200 μL of the suspension from both the control and co-culture groups was transferred to a 96-well plate, and the fluorescence OD was measured. 488 The value was used to calculate the adhesion rate of the strain to intestinal epithelial cells.

[0181] The results showed that after culturing the three Bifidobacterium strains for 18 hours, the pH values ​​of the culture media for *Bifidobacterium longum* FeiHeB18, *Bifidobacterium breve* BB22M22, and *Bifidobacterium animalis* BB-12 decreased from 6.0 to 4.16, 4.33, and 4.20, respectively. Figure 1 As shown in (a) of the figure. This shows that *Bifidobacterium longum* FeiHeB18 and *Bifidobacterium animalis* BB-12 have comparable acid-producing abilities, which are superior to *Bifidobacterium breve* BB22M22. Acid-producing ability is one of the important characteristics of probiotics. Probiotics produce organic acids such as lactic acid and acetic acid through sugar metabolism, which can lower the pH value of the intestine. An acidic environment directly inhibits pathogenic bacteria, while simultaneously promoting the colonization of beneficial bacteria, thus playing a role in regulating the intestinal flora. The results of the intestinal epithelial adhesion test are shown below. Figure 1 As shown in (b), the adhesion rate of Bifidobacterium longum FeiHeB18 to intestinal epithelial cells was 7.43%, which was higher than that of Bifidobacterium breve BB22M22 (5.51%) and Bifidobacterium animalis BB-12 (5.72%). This indicates that Bifidobacterium longum FeiHeB18 has better adhesion ability to intestinal epithelial cells, and is more likely to colonize after entering the host intestine, thereby exerting the health benefits of probiotics.

[0182] Example 3: Antagonistic ability of the strain against four pathogenic bacteria

[0183] During their growth and reproduction, lactic acid bacteria can secrete substances such as organic acids, hydrogen peroxide, and bacteriocins. These antibacterial substances can inhibit the growth of certain pathogenic bacteria, thereby preventing some diseases. In this invention, four pathogenic bacteria were selected to determine the antibacterial activity of Bifidobacterium. The specific experimental steps are as follows:

[0184] 1. Strains culture

[0185] Bifidobacterium longum FeiHeB18, Bifidobacterium breve BB22M22, and Bifidobacterium animalis BB-12 were taken from the preservation tubes and streaked onto MRS solid medium and mMRS solid medium, respectively, and incubated at 37°C for 48 h. A single colony was picked and transferred to 5 mL of MRS liquid medium and mMRS liquid medium, and incubated at 37°C for 24 h. Then, 2% of the colony was transferred to 5 mL of MRS liquid medium and mMRS liquid medium and incubated at 37°C for 24 h.

[0186] Take pathogenic bacteria (such as Staphylococcus aureus) from the preservation tube and streak them onto LB solid medium. Incubate at 37°C for 48 hours. Pick a single colony and transfer it to 5 mL of LB liquid medium. Incubate at 37°C for 24 hours. Transfer the colony to 5 mL of LB liquid medium at a 2% inoculation rate. Incubate at 37°C for 24 hours.

[0187] 2. In vitro antibacterial activity assay: Oxford cup method

[0188] (1) Preparation of fermentation supernatant of the strains: The activated third-generation Bifidobacterium longum FeiHeB18, Bifidobacterium shortum BB22M22 and Bifidobacterium animalis BB-12 were inoculated into MRS liquid medium and mMRS liquid medium, respectively, and cultured at 37℃ for 24h. 4 mL of bacterial culture was taken into 5 mL centrifuge tubes and centrifuged at 8000 rpm for 20 min. The supernatant was collected and filtered through a 0.22 μm microporous membrane. The filtrate was collected to obtain cell-free fermentation supernatant of Bifidobacterium longum FeiHeB18, Bifidobacterium shortum BB22M22 and Bifidobacterium animalis BB-12, respectively.

[0189] (2) Pour 10 mL of sterile agar solid medium into a sterile Petri dish. After it has completely solidified, use it as the bottom layer medium. Place four sterile Oxford cups at appropriate distances on the Petri dish. Add 0.1 mL of 10... 8 Add CFU / mL of Staphylococcus aureus, Salmonella, Escherichia coli, or Listeria monocytogenes bacterial suspension to LB solid medium that has been melted and cooled to 40-50°C. Carefully mix the mixture and pour it onto the bottom layer of medium, being careful not to add it into the Oxford cup. Allow it to solidify completely to form the bacterial layer medium.

[0190] (3) Carefully remove the Oxford cup, being careful not to damage the formed holes. Add 0.2 mL of cell-free fermentation supernatant of Bifidobacterium longum FeiHeB18, Bifidobacterium breve BB22M22 and Bifidobacterium animalis BB-12 to the four holes with a diameter of about 8 mm, respectively. Add 0.2 mL of MRS medium to the negative control. Then incubate at 37℃ for 24 h. Measure the size of the inhibition zone with a ruler. The measurement results are shown in Table 1.

[0191] Table 1. Inhibitory effects of the strain on four pathogenic bacteria.

[0192]

[0193] Note: " / " indicates no inhibitory effect.

[0194] The results showed that Bifidobacterium breve BB22M22 and Bifidobacterium animalis BB-12 had no inhibitory effect on the four pathogenic bacteria, while Bifidobacterium longum FeiHeB18 had a significant inhibitory effect on Salmonella and Escherichia coli. Therefore, the antibacterial effect of Bifidobacterium longum FeiHeB18 was significantly better than that of Bifidobacterium breve BB22M22 and Bifidobacterium animalis BB-12, and it had a good inhibitory effect on pathogenic bacteria.

[0195] Example 4: The effect of the strain on promoting the secretion of the immunomodulatory factor IFN-β by immune cells

[0196] 1. Obtaining myeloid-derived dendritic cells (BMDC cells)

[0197] (1) Bone marrow cells were collected from the tibia and femur of 4-week-old mice, passed through a 200-mesh cell sieve, centrifuged at 1000 revolutions per minute (rpm) for 5 min, and the supernatant was discarded. 3 mL of erythrocyte lysis buffer was added to the centrifuged cell pellet, the pellet was quickly dispersed, and after standing for 10 min, 10 mL of complete culture medium was added to neutralize. The pellet was centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. Complete culture medium containing 20 ng / mL granulocyte-macrophage colony-stimulating factor (GM-CSF) was added, and the cells were resuspended (2 × 10⁻⁶ cells / mL). 6 (1 cell / dish) were seeded into 10 cm cell culture dishes and incubated in a 37°C 5% CO2 incubator.

[0198] (2) On the 3rd day, half of the medium was changed (centrifuged at 1000 rpm for 5 min, discarded half of the medium, and replenished with half of the new medium). The medium was changed every other day until the 9th day, and suspended and loosely adhered cells were obtained, which are BMDC cells.

[0199] 2. IFN-β concentration was measured by co-culturing the strain and BMDC.

[0200] (1) Culture of bacterial strains: Take 1 mL of bacterial solution and inoculate it into 5 mL of MRS liquid medium. Incubate at 37℃ and 5% CO2 for 1-2 days. Take 200 µL of bacterial solution from each of the three strains and inoculate it into 5 mL of MRS liquid medium. Incubate at 37℃ and 5% CO2 for 24 hours.

[0201] (2) Bacterial pretreatment: Resuspend the bacterial culture, take 200 μL of each culture and put it into a 96-well plate, and measure the OD. 600 Centrifuge 1 mL of bacterial culture and adjust the concentration to 10 using 1640 basal medium. 8 Then dilute 1 mL of bacterial culture 10 times. After dilution, wash the bacterial culture 2-3 times with 1640 basal medium and centrifuge (8000 r / min, 4℃, 3 min). Take 500 µL for co-culture of live bacteria and cells.

[0202] (3) Co-culture: After centrifuging BMDC cells, discard the supernatant, resuspend in 1640 complete medium, blow well, and add 200 µL to each well of a 96-well cell culture plate. Add bacterial solution to each well at a rate of 20 µL, with 3 replicates per group. After adding, incubate at 37℃ in a 5% CO2 incubator for 24 h.

[0203] (4) After co-culturing for 24 h, the 96-well plate was centrifuged (2000 r / min, 20 min), the supernatant was collected, and the IFN-β level was determined by ELISA.

[0204] The ELISA results of IFN-β produced by co-culturing two Bifidobacterium strains and Bifidobacterium animalis BB-12 with BMDC derived from 4-week-old mice are as follows: Figure 2 As shown.

[0205] The results showed that different Bifidobacterium strains had significant differences in their effects on promoting IFN-β production in mouse-derived BMDC cells. Among them, Bifidobacterium longum FeiHeB18 was significantly better than Bifidobacterium shortum BB22M22 and also significantly better than Bifidobacterium animalis BB-12.

[0206] Example 5: Effect of Bifidobacterium on body weight in mice infected with influenza virus

[0207] The following is the protocol for an experiment on the antiviral effect of infant-derived probiotics based on a mouse model of influenza virus infection:

[0208] I. Bacterial strain culture and preparation of oral bacterial suspension

[0209] Bacterial culture from the preservation tube was streaked onto an mMRS plate using a sterile inoculation loop. The plates were then incubated upside down at 37°C for 48 h. Next, single colonies were selected and inoculated into mMRS liquid medium. After incubation at 37°C for 18 h, the culture was activated for three generations with a 2% inoculation rate. A portion of the culture was collected and the bacterial concentration was calculated using the pour plate count method. The remaining culture was centrifuged at 8000 × g at 4°C for 10 min, the supernatant was discarded, and the cells were collected in glycerol tubes and stored at -80°C. Based on the counting results, the cells were washed with 0.9% physiological saline, and the bacterial concentration was adjusted to 5 × 10⁻⁶. 9 CFU / mL (colony-forming units per milliliter) is used for subsequent experiments.

[0210] II. Animal Experiment Design

[0211] Three-week-old female C57BL / 6J mice were selected for the experiment. Mice had free access to food and water. After a one-week acclimatization period, the mice were randomly divided into four groups: a blank group, an A / FM1 / 47 (H1N1) influenza virus infection group, a Bifidobacterium breve BB22M22 intervention group, and a Bifidobacterium longum FeiHeB18 intervention group, with 10 mice in each group. From day 8 to 28, mice in the blank group and the virus infection group were administered 200 μL of PBS solution by gavage. The two probiotic intervention groups were administered 200 μL of probiotic solution by gavage. The dosage per mouse was 1 × 10⁻⁶ mg / day. 9 CFU. From day 22 to 28, except for the control group, the other three groups of mice were anesthetized on day 22 and administered a sublethal dose (1×10⁻⁶ CFU). 3 Intranasal infection was performed using influenza A / FM1 / 47 (H1N1) in PBS containing PFU (Plaque Forming Unit). Mice were anesthetized with isoflurane on day 29, and blood was collected from the eyeballs. Mice were then euthanized by dislocation for sampling. The experimental protocol and procedures were approved by the Animal Ethics Committee of Yangzhou University (No. 202406009).

[0212] Mice were infected with influenza virus on day 22 of the experiment, and their weight was measured daily until day 29 when the mice were sacrificed. The results are as follows: Figure 3As shown, compared with the control group, mice in the H1N1 group began to lose weight continuously from the second day after infection. Within a week after infection, both Bifidobacterium groups showed varying degrees of relief from influenza-induced weight loss in mice. At the time of mouse sacrifice, the weight loss rate in the *Bifidobacterium longum* FeiHeB18 group (11.99%) was significantly lower than that in the H1N1 group (16.57%), while the relief effect of *Bifidobacterium shortum* BB22M22 was not significant. This indicates that the intervention effect of Bifidobacterium is strain-specific, and that *Bifidobacterium longum* FeiHeB18 is more effective than the other *Bifidobacterium shortum* strain.

[0213] Example 6: Effects of Bifidobacterium on Lung Inflammatory Response in Influenza Virus-Infected Mice

[0214] The animal experimental protocol was the same as steps one and two in Example 5. After euthanasia, the left lung lobe of mice was harvested, fixed with 4% paraformaldehyde, then embedded in paraffin, and sectioned to a thickness of 5 micrometers (μm). After HE staining, destaining, clearing, and mounting, microscopic images were acquired using a digital scanner (Pannoramic, 3DHISTECH, Hungary) and pathological scoring was performed. A blinded scoring method was used, with the scoring system based on the degree of lung tissue destruction, epithelial cell layer damage, and polymorphonuclear cell infiltration.

[0215] Pathological scoring criteria (Reference: Liu Guoxing, Huang Yuanming, Cheng Miao, et al. Effects of H1N1 influenza virus infection on lung injury and gut microbiota in mice [J]. Disease Surveillance, 2021, 36(7): 689-695.):

[0216] 0 points—Intact alveolar walls without thickening, inflammatory infiltration, or congestion; 1 point—Mild diffuse inflammatory cell infiltration (neutrophils) in the alveolar walls, with no significant thickening; 2 points—Significant and widespread inflammatory cell infiltration (neutrophils and monocytes), with slight thickening of the alveolar walls (1-2 times); 3 points—Severe inflammatory cell infiltration, with alveolar walls thickened to 3-5 times in some areas; 4 points—Severe inflammatory cell infiltration, with significant thickening of the alveolar walls, and 25%-50% lung tissue consolidation; 5 points—Severe inflammatory cell infiltration, with significant thickening of the alveolar walls, and >50% lung tissue consolidation.

[0217] Lung pathological sections showed ( Figure 4In the sections (a)-(d) of the normal mice (blank group), the lungs showed intact alveolar structure, thin alveolar walls, clear alveolar cavities, no obvious inflammatory infiltration or tissue lesions, and intact airway structure. In contrast, the sections of the H1N1 group showed obvious pathological changes, specifically: thickened alveolar septa, significant inflammatory cell infiltration in the alveolar walls, mainly lymphocytes and monocytes; partial alveolar structural damage, with local alveolar cavities showing inflammatory cell infiltration, accompanied by mild to moderate interstitial edema and fibrosis; and obvious inflammatory infiltration around the airways, indicating a relatively significant inflammatory response. In the intervention groups, the lungs of the FeiHeB18 and BB22M22 mice showed mild lesions, with mild thickening of the alveolar walls and mild inflammatory cell infiltration. The overall alveolar structure remained relatively clear, with local mild inflammatory responses and mild thickening of the pulmonary interstitium. The overall degree of lesions was milder than that of the H1N1 group. According to the pathological scores of the tissue sections, the inflammatory response was significantly reduced after intervention with Bifidobacterium breve BB22M22 and Bifidobacterium longum FeiHeB18. Compared with the H1N1 group, the pathological scores of both groups were significantly lower. Figure 4 (e)). In addition, compared with the blank group, the H1N1 group of mice showed significantly increased inflammatory response and interstitial fibrosis, indicating that influenza virus infection has a significant damaging and inflammatory-inducing effect on lung tissue, and the influenza virus infection model was successfully established.

[0218] Example 7: Effect of Bifidobacterium on viral load in the lungs of influenza virus-infected mice

[0219] 1. Experimental reagents

[0220] RNA extraction kit, Novizan Biotechnology FastPure Complex Tissue / Cell Total RNA Isolation Kit, catalog number RC113-01, specification 50 rxns; RNA reverse transcription kit, Novizan Biotechnology HiScript IV All-in-One Ultra RT SuperMix for qPCR, catalog number R433-01, specification 100 rxns; SYBR Green I fluorescent dye, Novizan Biotechnology SYBR Green I nucleotide colloidal dye, catalog number JC2002-00.

[0221] 2. Experimental Methods

[0222] The animal experimental protocol was the same as steps one and two in Example 5. Mice were sacrificed on day 29, and mouse lung tissue was collected and placed in 1 mL of cryoprotectant, then frozen at -80°C for later use. Viral nucleoprotein (NP) protein in mouse lung tissue was detected using qPCR. Specifically, the lung tissue sample was thawed on ice, and total RNA was extracted from the mouse lung tissue using an RNA extraction kit. cDNA was then obtained by reverse transcription. Based on SYBR Green I fluorescent dye, the expression level of the target gene was detected by real-time quantitative PCR, with GADPH as an internal control gene. -ΔΔ CT scans were used for data standardization analysis.

[0223] GADPH primer sequence (5'-3')

[0224] Forward (SEQ ID NO: 2): AATGGTGAAGGTCGGTGTGAAC,

[0225] Reverse (SEQ ID NO: 3): GCCTTGACTGTGCCGTTGAA.

[0226] NP primer sequence (5'-3')

[0227] Forward (SEQ ID NO: 4): GGCACCAAACGGTCTTACGA,

[0228] Reverse (SEQ ID NO: 5): TCACCTGATCAACTCCATTACCA.

[0229] 3. Experimental Results

[0230] Following influenza virus infection, viral load in the lungs can characterize the degree of viral infection and replication. This experiment used qPCR to detect the expression level of the H1N1 viral protein (NP) gene (NP sequence UniProt ID: P03466), and the results are as follows: Figure 5 The results showed that compared with the virus-infected group (H1N1), the reduction in viral load in the lungs of mice in the *Bifidobacterium longum* FeiHeB18 group was significant, indicating that this strain can better inhibit the replication of H1N1 virus than *Bifidobacterium breve* BB22M22, thus exerting an antiviral effect.

[0231] Example 8: Effect of Bifidobacterium on IFN-I response in influenza virus-infected mice

[0232] 1. Experimental reagents

[0233] RIPA lysis buffer, catalog number P0013B, purchased from Beyotime; IFN-β ELISA kit, catalog number SBJ-M0047, specification 96T, purchased from Nanjing Senbega Biotechnology Co., Ltd.; Enhanced BCA kit, catalog number P0010, purchased from Beyotime.

[0234] 2. Experimental Methods

[0235] The animal experimental protocol was the same as steps one and two in Example 5. The methods for RNA extraction and reverse transcription from mouse lung tissue were the same as in Example 7. The expression levels of interferon-stimulated genes MxA, Oas1a, Irf7, and Rsad2 in mouse lung tissue were detected using qPCR. GADPH was used as an internal reference gene, and 2... -ΔΔ CT scans were used for data standardization analysis.

[0236] MxA (Gene accession number: NM_010846) primer sequence (5'-3'):

[0237] Forward (SEQ ID NO: 6): CCAACTGGAATCCTCCTGGAA,

[0238] Reverse (SEQ ID NO: 7): GCCGCACCTTCTCCTCATAG;

[0239] Oas1a (Gen sequence accession number: NM_001424706) primer sequence (5'-3'):

[0240] Forward (SEQ ID NO: 8): GAAGAGGCTGATGTGTGGCT,

[0241] Reverse (SEQ ID NO: 9): TGTCCAGTTCTCTTCTACCTGC.

[0242] Irf7 (Genome accession number: NM_001252601) primer sequence (5'-3'):

[0243] Forward (SEQ ID NO: 10): GCCAGGAGCAAGACCGTGTT,

[0244] Reverse (SEQ ID NO: 11): TGCCCCACCACTGCCTGTA.

[0245] Rsad2 (Genome accession number: NM_021384) primer sequence (5'-3'):

[0246] Forward (SEQ ID NO: 12): AACAGGCTGGTTTGGAGAAG,

[0247] Reverse (SEQ ID NO: 13): TGCCATTGCTCACTATGCTC.

[0248] Simultaneously, the level of the mouse lung cytokine IFN-β was measured: 100 mg of lung tissue was mixed with 1 mL of RIPA lysis buffer, homogenized using a tissue homogenizer, and centrifuged at 12000 r / min for 15 min at 4℃. The supernatant was collected and stored at -20℃ for later use. The IFN-β level in the supernatant was detected by ELISA, and the protein concentration was measured using an enhanced BCA kit to correct for cytokine levels.

[0249] 3. Experimental Results

[0250] like Figure 6 As shown, the experimental results indicate that, compared with the H1N1 group, intervention with *Bifidobacterium longum* FeiHeB18 significantly upregulated the expression of interferon-stimulated genes MxA, Oas1a, and Irf7 in mice, and to some extent upregulated the expression of Rsad2. Similarly, intervention with *Bifidobacterium longum* FeiHeB18 also significantly increased the level of IFN-β. However, there was no statistically significant difference between *Bifidobacterium breve* BB22M22 and the H1N1 group. Interferon stimulation of the expression of genes MxA, Oas1a, Irf7, and Rsad2 produces corresponding effector proteins MxA, Oas1a, Irf7, and Rsad2, which play important roles in the body's antiviral and immune regulation processes. For example, MxA's main function is to inhibit the replication of RNA viruses. It binds to the viral nucleocapsid, interfering with its transcription and assembly, and plays an important role in combating influenza viruses. Oas1a is a key immunomodulatory protein, whose main functions include antiviral defense and regulation of cellular stress responses. Irf7 is an important member of the interferon regulatory factor family, whose main functions include regulating the production of type I interferon, participating in immune responses, and inflammatory responses. Rsad2 inhibits influenza viruses by suppressing viral budding, affecting viral RNA replication, and producing antiviral analogs. Therefore, the experimental results show that Bifidobacterium longum FeiHeB18 can specifically activate the IFN-I response in the lungs after H1N1 infection and increase the level of IFN-β in the lungs. This induces the expression of interferon-stimulated genes and produces a variety of antiviral and immunomodulatory effector molecules, thereby enabling cells to quickly enter an antiviral state and improve the host's resistance to influenza virus.

[0251] Example 9: Clinical application of Bifidobacterium in the prevention of viral respiratory infections in children

[0252] In a mouse model of influenza virus infection, *Bifidobacterium longum* FeiHeB18 exhibited antiviral activity. Therefore, this strain was selected for clinical trial efficacy evaluation. The specific protocol is as follows:

[0253] I. Clinical Trial Design

[0254] Sixty healthy children aged 3-7 years (preschool children) were randomly recruited for a 2-month intervention. Volunteers were randomly assigned to two groups using a computer-generated random number table: a placebo group (Placebo) and a Bifidobacterium longum (FeiHeB18) group. Each group of 30 participants received two sachets of the probiotic product daily (probiotic dose of 5 x 10^6 ml). 9 (CFU / strip, 2g / strip). During the 2-month intervention period, weekly online follow-ups will be conducted. Parents of children who develop respiratory infections are required to complete the Acute Respiratory Illness and Influenza Scale (CARIFS).

[0255] II. Analysis of the Acute Respiratory Disease and Influenza Scale (CARIFS)

[0256] During the clinical trial intervention, children developed respiratory infections, and parents assessed their symptoms using the Canadian Acute Respiratory Disease and Influenza Scale (CARIFS), an effective children's respiratory infection scale. CARIFS consists of 18 items, each rated on a 4-point scale (no problem = 0, mild problem = 1, moderate problem = 2, severe problem = 3). The onset of a respiratory infection was defined as the appearance of at least two symptoms with a score higher than 0 on the first day of at least two consecutive days, while the end was defined as the last day of symptoms followed by at least two days with a score of 0. In this trial, the scale additionally assessed three items: "decreased parental sleep quality," "use of antibiotics," and "absence from school due to illness." The first item was scored the same as the previous one, while the latter two were answered with "yes" or "no."

[0257] The results of the clinical trial are as follows:

[0258] This clinical trial recruited 64 healthy children and randomly assigned them to a placebo group or a Bifidobacterium longum (FeiHeB18) group, with 32 children in each group. A two-month clinical trial was conducted, and 59 children completed the trial (29 in the placebo group and 30 in the FeiHeB18 group). During the two-month probiotic supplementation period, online follow-ups were conducted weekly, and parents of children with infection symptoms completed questionnaires. A total of 102 questionnaires were received, and 77 were included in the analysis after processing (43 in the placebo group and 34 in the Bifidobacterium longum (FeiHeB18) group).

[0259] 1. Analysis of key results indicators

[0260] As shown in Table 2, during the 2-month probiotic supplementation period, Bifidobacterium longum FeiHeB18 was able to reduce the incidence of respiratory infections in children to some extent (83.3% in the probiotic group vs. 89.7% in the control group), reduce the number of 2, 3, and 4 respiratory infections in children to some extent (the incidence rates in the probiotic group and the placebo group were 32% vs. 48%, 3.3% vs. 10.3%, and 0% vs. 6.9%, respectively), shorten the duration of infection to some extent, and reduce the number of children with prolonged infections (infection days ≥ 7 days) to some extent (56.7% in the probiotic group vs. 75.9% in the placebo group).

[0261] Table 2 Analysis of Key Results Indicators

[0262]

[0263] Note: All data were analyzed using chi-square and Fisher's exact tests, with p < 0.017 considered statistically significant. Duration of each infection is expressed as mean ± standard error.

[0264] 2. Analysis of secondary outcome indicators

[0265] As shown in Table 3, within two months of probiotic supplementation, *Bifidobacterium longum* FeiHeB18 significantly reduced the number of absent children. In the placebo group, 22 out of 29 children were absent, representing 75.9% of the total, significantly higher than the FeiHeB18 group (only 13 out of 30 children were absent, representing 43.3%). Simultaneously, the number of children using antibiotics in the FeiHeB18 group was also significantly lower than in the placebo group (p < 0.017, statistically significant). Only 30% of children in the FeiHeB18 group used antibiotics, compared to 69% in the placebo group. Furthermore, *Bifidobacterium longum* FeiHeB18 also reduced the number of children with fever (40% in the FeiHeB18 group vs. 62.1% in the placebo group) and the number of children with sore throat (83.3% in the FeiHeB18 group vs. 89.7% in the placebo group).

[0266] Table 3 Analysis of Secondary Outcome Indicators

[0267]

[0268] Note: All quantities were measured using the chi-square test and Fisher's exact test. "" indicates that p < 0.017, which means there is a significant difference.

[0269] 3. Total score and scores for each indicator of the scale

[0270] For children, reducing the severity of influenza may be just as important as reducing its incidence. Studies have shown that, in addition to reducing the incidence of viral respiratory infections, probiotics can also alleviate symptoms of respiratory infections. Scale analysis ( Figure 7 The results showed that, in this study, Bifidobacterium longum FeiHeB18 could reduce the total score of the CARIFS scale to some extent after children developed respiratory infections, which means it could alleviate the negative impact of viral infections on children to some extent. Figure 7 (a) in the text). Specifically, regarding symptoms ( Figure 7 In (b) of this study, *Bifidobacterium longum* FeiHeB18 can alleviate symptoms such as fever, sore throat, muscle aches, cough, and vomiting to some extent. When children have respiratory infections, in addition to various symptoms, the functional impact on children and the impact on parents are also important indicators for assessing the negative effects of viral infections. Regarding the impact on children's functioning (… Figure 7 In (c) of the study, *Bifidobacterium longum* FeiHeB18 significantly alleviated children's irritability, mood swings, and pickiness after infection. Furthermore, it had positive effects on appetite, sleep, comfort after illness, fatigue, play, interest in things, and bed rest. Additionally, *Bifidobacterium longum* FeiHeB18 reduced and alleviated various indicators of the impact of children's respiratory infections on parents. Figure 7 (d) in the context of children's crying after a cold, need for extra care, clinginess, and parents' poor sleep quality.

[0271] The above clinical trial results show that Bifidobacterium longum FeiHeB18 can reduce the incidence of respiratory infections in children to a certain extent, reduce the number of repeated infections, reduce the proportion of children with prolonged infections, significantly reduce the number of absent children, significantly reduce the number of children using antibiotics, alleviate various respiratory infection symptoms such as fever and sore throat to a certain extent, significantly alleviate "irritability, mood swings, and pickiness" after illness, and has a certain positive effect on various functions of children such as appetite and sleep, as well as the impact of children's respiratory infections on parents.

[0272] It should be noted that although the technical solution of the present invention has been described with specific examples, those skilled in the art will understand that the present invention should not be limited thereto.

[0273] The various embodiments of the present invention have been described above. These descriptions are exemplary and not exhaustive, nor are they limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is chosen to best explain the principles, practical application, or technical improvements to the embodiments in the market, or to enable others skilled in the art to understand the embodiments disclosed herein.

Claims

1. A strain of Bifidobacterium longum FeiHeB18, characterized in that, The Bifidobacterium longum FeiHeB18 strain has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34752 and deposit date of June 4, 2025.

2. A culture, characterized in that, The culture is obtained by culturing the strain as described in claim 1.

3. A microbial preparation, characterized in that, The microbial preparation comprises the strain as described in claim 1, or the culture as described in claim 2.

4. A product characterized in that, The product comprises the strain as described in claim 1, the culture as described in claim 2, or the microbial preparation as described in claim 3.

5. The product according to claim 4, characterized in that, The product contains a viable count of at least 1 × 10⁻⁶ Bifidobacterium longum strain FeiHeB18. 6 CFU / mL or 1×10 6 CFU / g.

6. The strain as described in claim 1, the culture as described in claim 2, or the microbial preparation as described in claim 3, for any of the following uses (1) to (4): (1) Use in the preparation of products intended to help enhance immunity; (2) Use in the preparation of products for regulating the secretion of cytokines; (3) Use in the preparation of products that help regulate gut microbiota; (4) Use in the preparation of products for improving gut health.

7. Use of the strain of claim 1, the culture of claim 2, and the microbial preparation of claim 3 in the preparation of products for the prevention of influenza virus infection and / or the improvement of symptoms caused by influenza virus infection.

8. The use according to claim 7, characterized in that, Symptoms caused by the influenza virus infection include weight loss and / or inflammation; and / or, The prevention of influenza virus infection includes reducing the incidence of infection; and / or, The measures to improve influenza virus infection include reducing absenteeism and reducing antibiotic use.

9. The use according to claim 8, characterized in that, The product reduces viral load, shortens the duration of infection, and enhances IFN-I response; and / or, The product promotes the expression of interferon-stimulated gene-related proteins.

10. The use according to claim 9, characterized in that, The interferon-stimulated gene-related protein includes at least one of MxA, Oas1a, Irf7, and Rsad2; and / or, The IFN-I includes IFN-β.

Images