Use of protein GhRD21A in improving biological drought resistance

By expressing or overexpressing the cotton protein GhRD21A in organisms, the problem of improving plant drought resistance, especially the drought resistance of cotton, has been solved, achieving the drought resistance effect of genetic engineering improvement and enhancing the drought resistance of yeast strains.

CN122128281APending Publication Date: 2026-06-02XINJIANG ACAD OF AGRI SCI (XINJIANG BRANCH OF CHINESE ACAD OF AGRI SCI)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610371266.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-25
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the drought resistance of plants, especially cotton. Traditional breeding methods are difficult, and the isolation of highly efficient drought-resistant genes in genetic engineering has become a limiting factor.

Method used

By expressing or overexpressing the cotton protein GhRD21A, genetic engineering techniques were used to enhance its expression level and activity in organisms, including amino acid sequence modification and tag linking. Genetic improvement was achieved using recombinant vectors and yeast strains to enhance the drought resistance of organisms.

Benefits of technology

It significantly improved the drought resistance of yeast strains, demonstrating that the expression level and activity of the GhRD21A gene were enhanced under drought conditions, thereby improving the organism's drought resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses the application of protein GhRD21A in improving biological drought resistance. The amino acid sequence of protein GhRD21A is shown in SEQ ID No. 2. The plasmid pYES2-NTB- GhRD21A Transform the yeast strain to obtain GhRD21A Yeast BY4741-pYES2-NTB- with significantly increased gene expression levels GhRD21A The pYES2-NTB vector was transformed into a yeast strain to obtain yeast BY4741-pYES2-NTB containing the pYES2-NTB vector. GhRD21A Both *Bacillus subtilis* and yeast BY4741-pYES2-NTB can grow in medium containing PEG3350, but the former shows significantly stronger growth than the latter. Therefore, overexpression... GhRD21A GhRD21A Genes can enhance the drought resistance of yeast. This invention has significant application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of protein GhRD21A in improving the drought resistance of organisms. Background Technology

[0002] Plants constantly face various biotic and abiotic stresses during their growth and development. To survive, they have evolved complex molecular mechanisms to sense and respond to these stresses. Drought is the most significant environmental factor affecting plant growth and crop yield. Drought has become a serious problem impacting agricultural production, and improving the drought resistance of crops and enhancing the adaptability of crops and economic crops to adversity through genetic engineering is a crucial and critical issue that urgently needs to be addressed in the breeding of new varieties. In recent years, extensive research has been conducted on the mechanisms of plant responses to drought and other abiotic stresses from physiological, biochemical, metabolic, ecological, genetic, and evolutionary perspectives, accumulating a wealth of data. In particular, with the development of molecular biology, researchers have been able to understand the mechanisms of plant resistance to drought stress at the molecular level, including gene composition, expression regulation, and signal transduction, opening new avenues for improving plant stress resistance through genetic engineering. Due to the complexity of plant drought resistance traits, improving plant drought resistance using traditional breeding methods is extremely difficult. While genetic engineering has opened up new avenues for plant drought resistance breeding with the development of molecular biology, the isolation of highly efficient drought-resistant genes remains a major limiting factor in plant stress resistance genetic engineering.

[0003] cotton( Gossypium hirsutum Linn. Cotton is an important economic crop, playing a vital role in the economic development of my country and other countries. Currently, cotton production in the Northwest inland cotton-producing areas is rapidly becoming more mechanized. However, the main producing areas face a series of external environmental problems, such as drought and water shortages, high salinity, and frequent extreme weather events. Simultaneously, they face long-standing internal variety problems, including insufficient high-quality raw cotton production capacity, limited potential for further yield increases, and poor suitability for mechanized harvesting, posing serious challenges to the industry's security. To achieve stable cotton production and supply in my country under the new circumstances, it is urgent to explore a range of cotton germplasm and genetic resources, create and utilize a batch of new germplasm resources suitable for the current main cotton-producing areas, and fundamentally meet the pressing needs of my country's cotton production. Summary of the Invention

[0004] The purpose of this invention is to improve the drought resistance of organisms, such as cotton and yeast.

[0005] This invention first protects the protein GhRD21A, which can be a1), a2), a3), or a4).

[0006] a1) The amino acid sequence is that of the protein shown in SEQ ID No. 2; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2; a3) A cotton-derived protein that is associated with drought resistance, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein shown in a1) or a2). a4) A protein derived from cotton and associated with drought resistance, which has 90% or more identity with the amino acid sequence defined by SEQ ID No. 2.

[0007] Of these, SEQ ID No.2 consists of 512 amino acid residues.

[0008] To facilitate the purification of the protein in a1), a tag can be attached to the amino or carboxyl terminus of the protein shown in a1).

[0009] The protein in a3) above, wherein the substitution and / or deletion and / or addition of one or more amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0010] The proteins mentioned in a3) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0011] The coding gene for the protein in a3) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID No. 1, and / or by performing a missense mutation on one or more base pairs, and / or by attaching a tag coding sequence to its 5′ end and / or 3′ end.

[0012] The substitution of any of the amino acid residues mentioned above can be a conservative substitution of the amino acid residue.

[0013] The tags described above include, but are not limited to: GST (glutathione thioredoxin) tag protein, Trx (thioredoxin) tag protein, nitrogen utilization substrate A (NusA) tag protein, His tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA (influenza hemagglutinin) tag protein, Myc tag protein, LacZ tag protein, CBD (cellulose-binding domain) tag protein, phage T7 protein kinase (T7PK) tag protein, GFP (green fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow-green fluorescent protein), eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein. Those skilled in the art know how to select appropriate tag proteins according to the desired purpose. The use of tags does not alter the function of the target protein; its purpose is to isolate, purify, detect, or trace it. Therefore, the tag proteins applicable to this invention are not limited to a specific type. The tag can be separated from the target protein by chemical cleavage methods or enzymatic methods known in the art (such as introducing protease cleavage sites to remove the tag by TEV protease cleavage).

[0014] This invention also protects nucleic acid molecules encoding any of the proteins described above, GhRD21A.

[0015] Any of the above-mentioned nucleic acid molecules may be b1), b2), b3), or b4). b1) The coding region is the DNA molecule shown in SEQ ID No. 1; b2) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 1; b3) A DNA molecule that has 90% or more identity with the nucleotide sequence defined in b1) or b2) and is derived from cotton and encodes any of the proteins GhRD21A described above; b4) Hybridizes under stringent conditions to the nucleotide sequence defined in b1) or b2) a DNA molecule derived from cotton that encodes any of the proteins GhRD21A described above.

[0016] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0017] Of these, SEQ ID No. 1 consists of 1539 nucleotides, and the nucleotides shown in SEQ ID No. 1 encode the amino acid sequence shown in SEQ ID No. 2.

[0018] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein GhRD21A of this invention using known methods, such as directed evolution and point mutation. Any artificially modified nucleotides that have 90% or higher identity with the nucleotide sequence of the protein GhRD21A isolated according to this invention, as long as they encode the protein GhRD21A, are derived from and equivalent to the nucleotide sequence of this invention.

[0019] This invention also protects biological materials containing any of the nucleic acid molecules described above, which may be c1), c2), c3), c4), c5), c6), or c7). c1) An expression cassette containing any of the nucleic acid molecules described above; c2) A recombinant vector containing any of the nucleic acid molecules described above or a recombinant vector containing any of the expression cassettes described above; c3) Recombinant cells containing any of the above-described nucleic acid molecules, recombinant cells containing any of the above-described expression cassettes, or recombinant cells containing any of the above-described recombinant vectors; c4) Recombinant microorganisms containing any of the above-described nucleic acid molecules, recombinant microorganisms containing any of the above-described expression cassettes, or recombinant microorganisms containing any of the above-described recombinant vectors; c5) A transgenic cell line containing any of the above-described nucleic acid molecules, a transgenic cell line containing any of the above-described expression cassettes, or a transgenic cell line containing any of the above-described recombinant vectors; c6) Transgenic biological tissue containing any of the above-described nucleic acid molecules, transgenic biological tissue containing any of the above-described expression cassettes, or transgenic biological tissue containing any of the above-described recombinant vectors; c7) A transgenic organ containing any of the above-described nucleic acid molecules, a transgenic organ containing any of the above-described expression cassettes, or a transgenic organ containing any of the above-described recombinant vectors.

[0020] The expression cassette may include a promoter, a nucleic acid molecule encoding any of the proteins described above, GhRD21A, and a terminator.

[0021] The recombinant vector can be a recombinant plasmid obtained by inserting a nucleic acid molecule encoding any of the aforementioned proteins GhRD21A into an expression vector. Specifically, the expression vector can be the pYES2-NTB vector. The recombinant vector can specifically be the recombinant plasmid pYES2-NTB mentioned in the examples. GhRD21A .

[0022] The recombinant microorganism can be obtained by introducing any of the above-described recombinant vectors into the starting microorganism.

[0023] The starting microorganism may be yeast, bacteria, algae, or fungi. The bacteria may be Gram-positive or Gram-negative. The Gram-negative bacteria may be Agrobacterium tumefaciens. The Agrobacterium tumefaciens may be Agrobacterium tumefaciens GV3101.

[0024] This invention also protects the application of any of the aforementioned proteins GhRD21A, any of the aforementioned nucleic acid molecules, or any of the aforementioned biological materials, which may be d1) or d2). d1) Improve the drought resistance of organisms; d2) Cultivate transgenic organisms with improved drought resistance.

[0025] The present invention also protects a biological breeding method, which may include the following steps: increasing the expression level and / or activity of any of the above-described proteins GhRD21A in an organism, thereby improving the drought resistance of the organism.

[0026] The present invention also protects a method for cultivating transgenic organisms, which may include the following steps: increasing the expression level and / or activity of any of the proteins GhRD21A described above in a recipient organism to obtain a transgenic organism; the transgenic organism exhibits improved drought resistance compared to the recipient organism.

[0027] The expression level and / or activity of the protein GhRD21A described above in organisms can be increased by methods well known in the art, such as transgenic technology, multiple copying, alteration of promoters, and regulatory factors, to achieve the effect of increasing the expression level and / or activity of the protein GhRD21A described above in organisms.

[0028] In the above method, the increase in the expression level and / or activity of any of the above-mentioned proteins GhRD21A in the recipient organism can be achieved by introducing a nucleic acid molecule encoding any of the above-mentioned proteins GhRD21A into the recipient organism.

[0029] The introduction of a nucleic acid molecule encoding any of the aforementioned proteins GhRD21A into the recipient organism can be achieved by introducing any of the aforementioned recombinant vectors containing the nucleic acid molecule into the recipient organism.

[0030] This invention also protects a drought-resistant organism. The drought-resistant organism may express or overexpress any of the proteins described above, GhRD21A.

[0031] The organism described above may be any one of the following e1) to e9): e1) plant; e2) dicotyledonous plant; e3) Malvaceae plant; e4) Gossypium plant; e5) cotton; e6) microorganism; e7) eukaryote; e8) yeast; e9) Saccharomyces cerevisiae.

[0032] The brewing yeast mentioned above can specifically be yeast strain BY4741.

[0033] Experiments have shown that recombinant plasmid pYES2-NTB- GhRD21A Transformed yeast strain BY4741 to obtain GhRD21A Recombinant yeast BY4741-pYES2-NTB- with significantly increased gene expression levels GhRD21A The pYES2-NTB vector was transformed into yeast strain BY4741 to obtain recombinant yeast BY4741-pYES2-NTB containing the pYES2-NTB vector. Recombinant yeast BY4741-pYES2-NTB GhRD21A Both recombinant yeast BY4741-pYES2-NTB and SG-U liquid medium containing 0 mM PEG3350, 30 mM PEG3350, 60 mM PEG3350, 90 mM PEG3350, 120 mM PEG3350, and 135 mM PEG3350 can grow, but recombinant yeast BY4741-pYES2-NTB... GhRD21A The growth of this yeast was significantly stronger than that of recombinant yeast BY4741-pYES2-NTB, exhibiting the characteristics of recombinant yeast BY4741-pYES2-NTB. GhRD21A The colony count of the [specific type of yeast] was significantly higher than that of the recombinant yeast BY4741-pYES2-NTB. This indicates that overexpression of [specific type of yeast] in yeast [is effective / effective]. GhRD21A Genes can enhance the drought resistance of yeast. This invention has significant application value.

[0034] Terminology Definition In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, to better understand this invention, definitions and explanations of relevant terms are provided below.

[0035] The term "expression cassette" generally refers to a nucleic acid construct containing sufficient nucleic acid elements to express a target gene. A typical expression cassette includes a promoter, a multiple cloning site (MCS), and / or a terminator. Expression cassettes may also include the target gene, marker genes (such as TK, DHFR, CAT, and NEO genes), ribosome recognition and binding sites (SDs), transcription factor binding sites (TFBSs), enhancers, silencers, repressors, introns, poly(A) signal sequences, and / or mRNA splicing signal sequences. Elements within an expression cassette can be directly linked or indirectly linked through adapters.

[0036] The term "vector" generally refers to a vector capable of delivering exogenous DNA or a target gene into host cells for amplification and / or expression. This vector can be a cloning vector or an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material they carry to be amplified and / or expressed within the host cells. Those skilled in the art can select appropriate vectors based on the purpose of genetic engineering and the properties of the recipient cells. The vectors include, but are not limited to: plasmids, phages (such as λ phage or M13 phage), cosmids (i.e., Cosmids), phagemids, shuttle vectors (such as yeast expression vectors), Ti plasmids, artificial chromosomes (such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), P1 artificial chromosomes (PAC), or Ti plasmid artificial chromosomes (TAC)), and viral vectors (such as baculovirus vectors, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, poxviruses, papillomaviruses, papillomaviruses (such as SV40), and herpesviruses (such as herpes simplex virus)). A vector may contain multiple elements controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancement sequences, selection elements, and reporter genes. Additionally, the vector may also contain a replication initiation site.

[0037] The term "microorganism" generally includes bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasmas, chlamydiae, spirochetes, algae, etc. For example, the bacteria mentioned could be from the genus *Escherichia* (…). Escherichia sp. (such as Escherichia coli), Erwinia spp. Erwinia sp. ), Agrobacterium ( Agrobacterium sp. (such as Agrobacterium tumefaciens), Flavobacterium ( Flavobacterium sp. ), Alcaligenes ( Alcaligenes sp. ), Pseudomonas spp. Pseudomonas sp. ) and Bacillus spp. ( Bacillus sp. (e.g., Bacillus subtilis). The viruses may include rotavirus, baculovirus, retrovirus (e.g., lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, influenza virus, papillomavirus (e.g., SV40), and herpesvirus (e.g., herpes simplex virus). The fungi may be derived from yeasts (e.g., Bacillus subtilis). Saccharomyces sp. (such as Saccharomyces cerevisiae, Saccharomyces methylbenzene, Pichia pastoris), Fusarium genus ( Fusarium sp. ), Rhizoctonia spp. Rhizoctonia sp. Verticillium ( Verticillium sp. ), Penicillium ( Penicillium sp. Aspergillus ( ) Aspergillus sp. ) and Cephalosporin (Cephalosporium sp. The actinomycetes may originate from the genus Streptomyces (…). Streptomyces sp. (e.g., Streptomyces). The algae may originate from the phylum Cyanophyta (e.g., cyanobacteria), genus Fucus (e.g., fucus vesiculosus). Fucus sp. ), genus *Cyclocarya* ( Achnanthes sp. ), genus *Codonopsis* ( Amphiprora sp. ), genus Dipterocarpa ( Amphora sp. ), Fiber Algae ( Ankistrodesmus sp. ), genus Styracula ( Asteromonas sp. ) and the genus *Golden Color Algae* ( Boekelovia sp. )wait.

[0038] The term "recombinant vector" generally refers to a recombinant DNA molecule constructed by linking a foreign target gene to a vector in vitro. It can be constructed in any suitable way, as long as the constructed recombinant vector can carry the foreign target gene into the recipient cell and provide the foreign target gene with the ability to replicate, integrate, amplify and / or express in the recipient cell.

[0039] The term "linkage" generally refers to the association of two or more molecules. Linkages can be covalent or non-covalent. The linkages described herein can be direct peptide bonds or linkages via linkers (connectors).

[0040] The term "identity" generally refers to the degree to which two (nucleotide or amino acid) sequences have identical residues at the same position in an alignment, and is usually expressed as a percentage. The identity described herein can refer to the identity of an amino acid sequence or a nucleotide sequence. Two copies having completely identical sequences have 100% identity. Those skilled in the art will recognize that the identity of an amino acid sequence or nucleotide sequence can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, the identity of an amino acid sequence can be calculated by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residuegap cost, and Lambda ratio to 11, 1, and 0.85 (default values), and performing a search, thus obtaining the identity value (%). Alternatively, sequence analysis software such as CLC MainWorkbench and MegAlign can be used. TM The determination can be performed, for example, using a computer program BLAST with default parameters, especially BLASTP or TBLASTN. The 90% or higher identity mentioned herein can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher identity.

[0041] The term "conservative substitution" generally refers to the replacement of one amino acid residue with another amino acid residue in a side chain that has similar physicochemical properties. For example, conservative substitutions can occur between hydrophobic side chain amino acid residues (e.g., Met, Ala, Val, Leu, and Ile), between neutral hydrophilic side chain residues (e.g., Cys, Ser, Thr, Asn, and Gln), between acidic side chain residues (e.g., Asp, Glu), between basic side chain amino acids (e.g., His, Lys, and Arg), or between aromatic side chain residues (e.g., Trp, Tyr, and Phe). It is known in the art that conserved substitutions generally do not cause significant changes in protein conformation and structure, and essentially do not alter the protein's biological activity. Conservative substitutions in the protein sequence that are expected to have only a minimal or no effect on protein structure or function can be readily designed by those skilled in the art.

[0042] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "comprising" and "including" are used interchangeably. Attached Figure Description

[0043] Figure 1 For testing GhRD21A Relative expression levels of genes in different tissues of upland cotton TM-1.

[0044] Figure 2 For testing GhRD21A Relative expression levels of genes in upland cotton TM-1 at different times of drought stress.

[0045] Figure 3 In Example 2 GhRD21A Growth phenotypes of gene-silenced cotton plants before and after drought stress treatment, and images of leaf chlorophyll fluorescence detected by a chlorophyll fluorescence imaging device.

[0046] Figure 4 To overexpress in yeast GhRD21A Genes can enhance yeast's tolerance to drought. Detailed Implementation

[0047] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0048] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0049] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0050] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0051] The upland cotton genetic standard line TM-1 is described in the following literature: Wang Junjuan, Lu Xuke, Wang Yanqin, Wang Shuai, Yin Zujun, Fu Xiaoqiong, Wang Delong, Chen Xiugui, Guo Lixue, Chen Chao, Zhao Lanjie, Han Yingchun, Sun Liangqing, Han Mingge, Zhang Yuexin, Fan Yapeng, Ye Wuwei. Characteristics and cold tolerance of upland cotton genetic standard line TM-1 [J]. Chinese Agricultural Science, 2022, 55(08):1503-1517. The public can obtain upland cotton genetic standard line TM-1 from the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. This biological material is only used for repeating the relevant experiments of this invention and cannot be used for other purposes. In the following text, upland cotton genetic standard line TM-1 is referred to as upland cotton TM-1.

[0052] The PNC-TRV1, PNC-TRV2, and PNC-TRV2::GhCLA1 vectors were developed by Researcher Yan Pu of the Institute of Tropical Biotechnology, Chinese Academy of Tropical Agricultural Sciences, and donated through a signed PNC vector transfer agreement. The public can obtain one or more types of vectors in the PNC series (including PNC-TRV1, PNC-TRV2, and PNC-TRV2::GhCLA1) in the same way. The PNC series vectors were developed by Researcher Yan Pu's team. PNC-TRV1, PNC-TRV2, and PNC-TRV2::GhCLA1 vectors are part of the PNC series vectors. The vector development process is described in the following literature: Yan P, Zeng Y, Shen W, Tuo D, Li X and Zhou P (2020) Nimble Cloning: A Simple, Versatile, and Efficient System for Standardized Molecular Cloning. Front. Bioeng. Biotechnol. 7:460. doi:10. 3389 / fbioe.2019.00460.

[0053] The Nimble Cloning kit required for constructing target genes using PNC series vectors is a product of Hainan NC Biotech Co., Ltd.

[0054] The pYES2-NTB vector and yeast strain BY4741 are both products of Nanjing Ruiyuan Biotechnology Co., Ltd.

[0055] Example 1 GhRD21A Gene cloning and specific expression analysis one, GhRD21A Cloning of genes 1. Total RNA was extracted from upland cotton TM-1 and then reverse transcribed to obtain cDNA of upland cotton TM-1.

[0056] 2. Using the cDNA of upland cotton TM-1 obtained in step 1 as a template, PCR amplification was performed using primer pair consisting of primer GhRD21A-F: 5'-ATGCTTCTCCGCTGTACTTTTATT-3' and primer GhRD21A-R: 5'-TCAATGTGCCCAGAACGGTTTAGC-3' to obtain the PCR amplification product.

[0057] The reaction program was as follows: 98℃ for 1 min; 98℃ for 15 s, 55℃ for 15 s, 72℃ for 60 s, 30 cycles; 72℃ for 10 min; store at 4℃.

[0058] 3. Perform agarose gel electrophoresis on the PCR amplification product obtained in step 2, and then recover the DNA fragment of about 1539 bp using a DNA gel recovery kit.

[0059] 4. Ligate the DNA fragment recovered in step 3 to the pYES2-NTB vector, then transform it into yeast strain BY4741. Based on the antibiotic carried by the pYES2-NTB vector, culture the mixture on YPDA plates and pick different clones to detect positive clones. For detailed procedures, refer to the Yeast Stress Screening Kit (Nanjing Ruiyuan Biotechnology Co., Ltd., RY8013). Extract the plasmid from the positive clones and name it recombinant plasmid pYES2-NTB- GhRD21A .

[0060] The recombinant plasmid pYES2-NTB- GhRD21A Sequencing was performed. Sequencing results showed that the recombinant plasmid pYES2-NTB- GhRD21A The nucleotide sequence is shown in SEQ ID No. 3. The nucleotide sequence of the DNA fragment recovered in step 3 is shown in SEQ ID No. 1. The DNA fragment recovered in step 3 is named... GhRD21A Gene. GhRD21AThe gene encodes protein GhRD21A, the amino acid sequence of which is shown in SEQ ID No. 2.

[0061] two, GhRD21A Gene-specific expression analysis 1. Sow the seeds of Upland Cotton TM-1 in nutrient pots containing a nutrient substrate (the nutrient substrate is a mixture of nutrient soil, vermiculite and perlite; the volume ratio of nutrient soil:vermiculite:perlite is 1:1:1). Culture at 29-30℃ with alternating light and dark conditions (photocycle of 16h light and 8h darkness) for 75-90 days to obtain Upland Cotton TM-1 plants.

[0062] 2. After completing step 1, collect roots, stems, leaves, flowers, bolls, ovules 5 days after flowering, cotton fibers 15 days after flowering, and cotton fibers 25 days after flowering from the upland cotton TM-1 plants obtained in step 1 as samples. Extract total RNA from each sample, then reverse transcribe it into cDNA to obtain the sample's cDNA. Real-time quantitative PCR is then used to detect the cDNA in the samples. GhRD21A Relative gene expression levels (based on upland cotton) Ghhiston3 (Genes used as internal reference genes).

[0063] Test results are shown Figure 1 The results showed that... GhRD21A The relative expression levels of genes vary considerably in different cotton tissues, with the highest expression level in the boll, followed by the flower, then the stem and leaves, while the expression levels in other tissues are relatively low.

[0064] 3. Sow the seeds of Upland Cotton TM-1 in a nutrient substrate (the nutrient substrate is a mixture of nutrient soil, vermiculite and perlite; the volume ratio of nutrient soil:vermiculite:perlite is 1:1:1) in a nutrient pot and culture it at 29-30℃ with alternating light and dark conditions (photocycle of 16h light and 8h darkness) for 15-20 days to obtain Upland Cotton TM-1 plants with 4 true leaves.

[0065] 4. The upland cotton TM-1 plants obtained in step 3 were transferred to half Hogland medium containing 15% PEG6000 (for drought stress), and then cultured under alternating light and dark conditions (16h light, 8h dark). Leaf samples were collected at 0h, 1h, 3h, 6h, 12h, and 24h of culture. Total RNA was extracted from each sample and then reverse transcribed into cDNA to obtain the cDNA of the sample. Real-time quantitative PCR was then used to detect the cDNA in the sample. GhRD21A Relative gene expression levels (based on upland cotton) Ghhiston3 (Genes used as internal reference genes).

[0066] Test results are shownFigure 2 The results showed that in the initial stages of drought stress treatment (1 h and 3 h), GhRD21A The relative expression level of the gene increased slowly, at 6 hours of treatment. GhRD21A The relative expression level of the gene decreased after 12 hours of treatment. GhRD21A The relative expression level of the gene reaches its peak.

[0067] Example 2 GhRD21A Obtaining and phenotypically analyzing gene-silenced cotton plants I. Recombinant plasmid PNC-TRV2:: GhRD21A Construction 1. According to GhRD21A The nucleotide sequence of the gene was designed and primers GhRD21A-VF and GhRD21A-VR were synthesized.

[0068] Primer GhRD21A-VF: 5'- agtggtctctgtccagtcct GAATCAAGAAACCCAACC-3' (Underlined part indicates a universal connector sequence) Primer GhRD21A-VR: 5'- ggtctcagcagaccacaag GCATAATCCATGAGACCC-3' (underlined indicates a universal connector sequence) 2. The recombinant plasmid pYES2-NTB- constructed according to step one of Example 1. GhRD21A Using the template, PCR amplification was performed using primer pairs consisting of primers GhRD21A-VF and GhRD21A-VR to obtain PCR amplification products.

[0069] The reaction system was 50 μL, consisting of 1 μL of recombinant plasmid pYES2-NTB- GhRD21A The mixture consisted of 1 μL of primer GhRD21A-VF aqueous solution, 1 μL of primer GhRD21A-VR aqueous solution, 25 μL of 2×PrimSTAR PCR Mix (Dalian Takara Bio) and ddH2O.

[0070] The reaction program was as follows: 98℃ for 1 min; 98℃ for 15 s, 57℃ for 10 s, 72℃ for 10 s, 30 cycles; 72℃ for 10 min; stored at 4℃.

[0071] 3. Perform agarose gel electrophoresis on the PCR amplification products obtained in step 2, and then use a DNA gel recovery kit to recover the 322bp VIGS fragment.

[0072] 4. The VIGS fragment recovered in step 3 was ligated into the PNC-TRV2 vector according to the Nimble Cloning kit instructions to obtain the recombinant plasmid PNC-TRV2:: GhRD21A .

[0073] The recombinant plasmid PNC-TRV2:: GhRD21A Sequencing was performed. Sequencing results showed that the recombinant plasmid PNC-TRV2:: GhRD21A The recombinant plasmid was obtained by replacing the NC cloning frame of the PNC-TRV2 vector with the DNA molecule shown in SEQ ID No. 1 from position 506 to 788 from the 5' end, while keeping other nucleotides unchanged.

[0074] Recombinant plasmid PNC-TRV2:: GhRD21A The nucleotide sequence is shown in SEQ ID No. 4.

[0075] II. Obtaining Recombinant Agrobacterium The recombinant plasmid PNC-TRV2:: was used separately. GhRD21A, PNC-TRV1, PNC-TRV2, and PNC-TRV2::GhCLA1 vectors were transformed into Agrobacterium strain GV3101 (Shanghai Weidi Biotechnology Co., Ltd., CAT#:AC1001) using the freeze-thaw method, sequentially yielding PNC-TRV2::GhCLA1 vectors containing recombinant plasmids. GhRD21A The recombinant Agrobacterium (named Recombinant Agrobacterium GV3101 / PNC-TRV2::) GhRD21A ) 、 Recombinant Agrobacterium containing the PNC-TRV1 vector (named Recombinant Agrobacterium GV3101 / PNC-TRV1) 、 Recombinant Agrobacterium containing the PNC-TRV2 vector (named Recombinant Agrobacterium GV3101 / PNC-TRV2) and Recombinant Agrobacterium containing the PNC-TRV2::GhCLA1 vector (named Recombinant Agrobacterium GV3101 / PNC-TRV2::GhCLA1).

[0076] three, GhRD21A Obtaining gene-silenced cotton plants 1. Three days before inoculation, recombinant Agrobacterium GV3101 / PNC-TRV2:: GhRD21A Streaking was performed on LB solid medium containing 50 μg / ml kanamycin and 25 μg / ml gentamicin, and the medium was incubated at 28°C for 48 hours to obtain several Agrobacterium single colonies.

[0077] 2. Inoculate the single Agrobacterium colony obtained in step 1 into 5 ml LB liquid medium containing 50 μg / ml kanamycin and 25 μg / ml gentamicin, and incubate overnight at 28°C and 50 rpm to obtain Agrobacterium culture solution 1.

[0078] 3. Transfer the Agrobacterium tumefaciens culture 1 obtained in step 2 to 50 ml of LB liquid medium containing 50 μg / ml kanamycin, 25 μg / ml gentamicin, 10 mM MES and 20 μM acetylsyl syringone, and incubate overnight at 28°C and 150 rpm to obtain Agrobacterium tumefaciens culture 2.

[0079] 4. Take the Agrobacterium tumefaciens bacterial suspension obtained in step 3, centrifuge at 4000 rpm for 5 min, and collect the precipitate. Then add the precipitate to LB liquid medium containing 10 mM MgCl2, 10 mM MES, and 200 μM acetylsyleugenol, resuspend, and incubate at room temperature for 3 hours to obtain OD. 600nm The GhRD21A suspension was 1.5.

[0080] Following the steps described above, recombinant Agrobacterium GV3101 / PNC-TRV2:: GhRD21A The bacteria were replaced with recombinant Agrobacterium GV3101 / PNC-TRV1, recombinant Agrobacterium GV3101 / PNC-TRV2, and recombinant Agrobacterium GV3101 / PNC-TRV2::GhCLA1, respectively, to obtain TRV1 suspension, TRV2 suspension, and GhCLA1 suspension in sequence.

[0081] 5. Mix TRV1 suspension and GhRD21A suspension at a ratio of 1:1 (v / v) to obtain dye solution 1. This will serve as the experimental group.

[0082] TRV1 and TRV2 suspensions were mixed at a ratio of 1:1 (v / v) to obtain staining solution 2, which served as a negative control.

[0083] TRV1 suspension and GhCLA1 suspension were mixed at a ratio of 1:1 (v / v) to obtain staining solution 3. This served as a positive control.

[0084] 6. Use a needle to prick 1-2 small holes below the cotyledons of the upland cotton TM-1 seedling. Use a syringe to inject the dye solution (dye solution 1, dye solution 2 or dye solution 3) obtained in step 5 into the cotton cotyledons. Then, culture the injected upland cotton TM-1 seedlings overnight in a dark environment at room temperature.

[0085] 7. After completing step 6, transfer the upland cotton TM-1 seedlings to 23℃ and culture them in alternating light and dark conditions until the true leaves of the upland cotton TM-1 seedlings injected with dye solution 3 (i.e., the positive control seedlings) begin to show leukoplakia (approximately 10 days). The alternating light and dark culture is conducted in a cycle of 16 hours of light and 8 hours of darkness, with a light intensity of 120 μE / m² during the light culture period. -2 S -1 .

[0086] The appearance of leukoplakia in the true leaves of upland cotton TM-1 seedlings injected with dye solution 3 indicates the emergence of gene silencing effect, suggesting the success of the gene silencing experiment.

[0087] 8. After completing step 7, leaves from both the negative control and experimental groups of *Cotton Upland TM-1* were collected as samples. Total RNA was then extracted from the samples using the Trizol method, followed by reverse transcription into cDNA to obtain the cDNA of the samples. Real-time quantitative PCR was then used to detect the presence of RNA in the cDNA of the samples. GhRD21A Relative gene expression levels (using the upland cotton Ghhiston3 gene as an internal reference gene).

[0088] The test results showed that, compared with the negative control, the leaves of Upland Cotton TM-1 in the experimental group contained [a certain amount of something]. GhRD21A The relative expression level of the gene was significantly reduced. This indicates that at the transcriptional level, GhRD21A Gene silencing occurred in upland cotton TM-1 that was injected with dye solution 1.

[0089] This will occur in upland cotton TM-1 that has been injected with dye solution 1. GhRD21A Gene-silenced upland cotton TM-1 plants named GhRD21A Gene-silenced cotton plants.

[0090] Upland cotton TM-1 plants, which were injected with dye solution 2, served as the negative control.

[0091] Four, GhRD21A Phenotypic analysis of gene-silenced cotton plants Take a negative control plant that has grown 4 true leaves in about 15-20 days or GhRD21A Gene-silenced cotton plants were observed and photographed for phenotype. They were then transferred to half-Hogland medium containing 15% PEG6000 (to induce drought stress) and cultured under alternating light and dark conditions (16h light, 8h dark) for 24h. Phenotypes of the plants under drought treatment were observed and photographed. Simultaneously, chlorophyll fluorescence imaging was used to detect the negative control plants and... GhRD21A Changes in chlorophyll fluorescence in the leaves of gene-silenced cotton plants.

[0092] Test results are shown Figure 3 (TRV2:: GhRD21A for GhRD21A Gene-silenced cotton plants (TRV2::00 was a negative control). Phenotypic results showed that... GhRD21A Gene-silenced cotton plants were more sensitive to drought stress than negative control plants, with leaves wilting earlier and the damage caused by drought stress being more severe. Chlorophyll fluorescence imaging results showed that... GhRD21AThe leaves of gene-silenced cotton plants showed more severe chlorophyll attenuation than those of the negative control plants. The chlorophyll fluorescence imaging results were largely consistent with the phenotypic results.

[0093] Therefore, it can be seen that reducing GhRD21A Gene expression levels are even suppressed. GhRD21A Gene expression will reduce the drought resistance of cotton.

[0094] Example 3: Overexpression in yeast GhRD21A Genes can improve yeast's tolerance to drought stress. 1. Using a yeast stress selection kit (Nanjing Ruiyuan Biotechnology Co., Ltd., catalog number: RY8013), the nucleotide sequence is as shown in SEQ ID No. 1. GhRD21A Genes were constructed into the pYES2-NTB vector to obtain the recombinant plasmid pYES2-NTB- GhRD21A .

[0095] The recombinant plasmid pYES2-NTB- GhRD21A Sequencing was performed. Sequencing results showed that the recombinant plasmid pYES2-NTB- GhRD21A The nucleotide sequence is shown in SEQ ID No. 3.

[0096] 2. The recombinant plasmid pYES2-NTB- GhRD21A Transforming yeast strain BY4741 yielded a product containing the recombinant plasmid pYES2-NTB- GhRD21A Recombinant yeast BY4741-pYES2-NTB- GhRD21A The pYES2-NTB vector was transformed into yeast strain BY4741 to obtain recombinant yeast BY4741-pYES2-NTB containing the pYES2-NTB vector (as a negative control).

[0097] 3. Extraction of recombinant yeast (recombinant yeast BY4741-pYES2-NTB- GhRD21A Total RNA from recombinant yeast (BY4741-pYES2-NTB) was extracted and reverse transcribed into cDNA to obtain recombinant yeast cDNA. Real-time quantitative PCR was then used to detect the presence of cDNA in the recombinant yeast cDNA. GhRD21A The relative expression level of genes.

[0098] The test results showed that, compared with recombinant yeast BY4741-pYES2-NTB, recombinant yeast BY4741-pYES2-NTB- GhRD21A cDNA in GhRD21A The relative expression level of the gene was significantly increased.

[0099] 4. Add the recombinant yeast (recombinant yeast BY4741-pYES2-NTB-)GhRD21A Alternatively, single clones of recombinant yeast BY4741-pYES2-NTB were resuspended in SG-U liquid medium (Nanjing Ruiyuan Biotechnology Co., Ltd., catalog number: PM22725) to obtain OD. 600nm The recombinant yeast resuspension was 0.2.

[0100] 5. Add 200µl of the recombinant yeast resuspension obtained in step 4 to 10ml of drought stress treatment medium (SG-U liquid medium containing 0mM PEG3350, SG-U liquid medium containing 30mM PEG3350, SG-U liquid medium containing 60mM PEG3350, SG-U liquid medium containing 90mM PEG3350, SG-U liquid medium containing 120mM PEG3350, or SG-U liquid medium containing 135mM PEG3350), and incubate at 30℃ for 24h to obtain the treated bacterial culture. Then perform a 10-fold serial dilution to obtain 10... -2 Diluent, 10 -3 Diluent and 10 -4 Diluent.

[0101] 6. Take the diluted solution obtained in step 5 (10 -2 Diluent, 10 -3 Diluent or 10 -4 The diluent was spotted onto SG-Ura plates (product of Nanjing Ruiyuan Biotechnology Co., Ltd., product catalog number PM22725), and the plates were observed and photographed after incubation at 30℃ for 7 days.

[0102] Test results are shown Figure 4 (pYES2-NTB-) GhRD21A Recombinant yeast BY4741-pYES2-NTB- GhRD21A (pYES2-NTB is recombinant yeast BY4741-pYES2-NTB). The results showed that recombinant yeast BY4741-pYES2-NTB... GhRD21A Both recombinant yeast BY4741-pYES2-NTB and PEG3350 can grow in SG-U liquid medium containing 0 mM PEG3350, 30 mM PEG3350, 60 mM PEG3350, 90 mM PEG3350, 120 mM PEG3350, and 135 mM PEG3350. GhRD21A The growth of this yeast was significantly stronger than that of recombinant yeast BY4741-pYES2-NTB, exhibiting the characteristics of recombinant yeast BY4741-pYES2-NTB.GhRD21A The number of colonies was significantly higher than that of recombinant yeast BY4741-pYES2-NTB.

[0103] The above results indicate that overexpression in yeast GhRD21A Genes can improve the drought resistance of yeast.

[0104] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Protein GhRD21A, which may be a1), a2), a3), or a4. a1) The amino acid sequence is that of the protein shown in SEQ ID No. 2; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2; a3) A cotton-derived protein that is associated with drought resistance, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein shown in a1) or a2). a4) A protein derived from cotton and associated with drought resistance, which has 90% or more identity with the amino acid sequence defined by SEQ ID No.

2.

2. A nucleic acid molecule encoding the protein GhRD21A of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is b1), b2), b3), or b4. b1) The coding region is the DNA molecule shown in SEQ ID No. 1; b2) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 1; b3) A DNA molecule that has 90% or more identity with the nucleotide sequence defined in b1) or b2) and is derived from cotton and encodes the protein GhRD21A of claim 1; b4) Hybridizes under stringent conditions to the nucleotide sequence defined in b1) or b2) a DNA molecule derived from cotton and encoding the protein GhRD21A of claim 1.

4. Biological material containing the nucleic acid molecule of claim 2 or 3, wherein c1), c2), c3), c4), c5), c6), or c7): c1) An expression cassette containing the nucleic acid molecule of claim 2 or 3; c2) A recombinant vector containing the nucleic acid molecule of claim 2 or 3, or a recombinant vector containing the expression cassette of c1); c3) Recombinant cells containing the nucleic acid molecule of claim 2 or 3, recombinant cells containing the expression cassette of c1), or recombinant cells containing the recombinant vector of c2); c4) Recombinant microorganisms containing the nucleic acid molecule of claim 2 or 3, recombinant microorganisms containing the expression cassette of c1), or recombinant microorganisms containing the recombinant vector of c2); c5) A transgenic cell line containing the nucleic acid molecule of claim 2 or 3, a transgenic cell line containing the expression cassette of c1), or a transgenic cell line containing the recombinant vector of c2; c6) A transgenic biological tissue containing the nucleic acid molecule of claim 2 or 3, a transgenic biological tissue containing the expression cassette of c1), or a transgenic biological tissue containing the recombinant vector of c2); c7) A transgenic organ containing the nucleic acid molecule of claim 2 or 3, a transgenic organ containing the expression cassette of c1), or a transgenic organ containing the recombinant vector of c2).

5. The application of the protein GhRD21A of claim 1, the nucleic acid molecule of claim 2 or 3, or the biomaterial of claim 4, for d1) or d2). d1) Improve the drought resistance of organisms; d2) Cultivate transgenic organisms with improved drought resistance.

6. A biological breeding method, comprising the following steps: increasing the expression level and / or activity of the protein GhRD21A of claim 1 in an organism, thereby improving the drought resistance of the organism.

7. A method for cultivating transgenic organisms, comprising the following steps: increasing the expression level and / or activity of the protein GhRD21A of claim 1 in a recipient organism to obtain a transgenic organism; the transgenic organism exhibits improved drought resistance compared to the recipient organism.

8. The method according to claim 7, characterized in that: The enhancement of the expression level and / or activity of the protein GhRD21A of claim 1 in the recipient organism is achieved by introducing a nucleic acid molecule encoding the protein GhRD21A into the recipient organism.

9. A drought-resistant organism, characterized by: The drought-resistant organism expresses or overexpresses the protein GhRD21A of claim 1.

10. The application according to claim 5, the method according to claim 6, 7 or 8, or the drought-resistant organism according to claim 9, characterized in that: The organism is any one of the following e1) to e9): e1) plant; e2) dicotyledonous plant; e3) Malvaceae plant; e4) Gossypium plant; e5) cotton; e6) microorganism; e7) eukaryote; e8) yeast; e9) Saccharomyces cerevisiae.