Use of cytokinin response factor in improving cold stress resistance of potato

By overexpressing StCRF3a in potatoes, the problem of insufficient resistance to low temperature stress in potatoes was solved, and its low temperature tolerance and recovery function were improved, as well as the stability of biofilms and soluble sugar content were enhanced.

CN122128356APending Publication Date: 2026-06-02YUNNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610598561.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-30
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

The resistance mechanism of potatoes under low temperature stress is still unclear, and existing technologies are insufficient to effectively improve their resistance to low temperature stress.

Method used

By identifying and overexpressing the potato cytokinin response factor StCRF3a, we enhanced its biofilm stability under low temperature stress, inhibited the increase of reactive oxygen species content, and increased soluble sugar content. We used Agrobacterium-mediated genetic transformation to overexpress StCRF3a in potatoes.

Benefits of technology

It significantly enhanced the low-temperature tolerance and recovery function of potatoes after stress, improved biofilm stability, reduced malondialdehyde content, increased soluble sugar content, and enhanced low-temperature resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128356A_ABST
    Figure CN122128356A_ABST
Patent Text Reader

Abstract

This invention provides the application of cytokinin-responsive factors in improving the resistance of potatoes to low-temperature stress, relating to the field of biotechnology. This invention is the first to identify the CRF family in potatoes. Through collinearity analysis and conserved domain screening, nine CRF family members were successfully identified from the potato genome. Functional studies of the CRF family members in potatoes revealed that StCRF3a plays a functional role in low-temperature stress in potatoes. Specifically, StCRF3a is induced by low temperature, and its promoter region contains a low-temperature responsive element.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to the application of cytokinin response factors in improving the resistance of potatoes to low-temperature stress. Background Technology

[0002] potato( Solanum tuberosum Potato (L.) is a globally important food crop and an ideal model system for studying the morphogenesis of underground tuber organoids. Its tubers serve a dual function of nutrient storage and asexual reproduction. In-depth research into the molecular mechanisms of genes related to tuber development not only has significant theoretical value but also provides potential superior gene resources for high-yield and high-quality potato breeding. Plant hormones play a core regulatory role in tuber development, with cytokinins, as one of the key hormones, regulating tuber formation by influencing cell division and enlargement. Cytokinin response factors (CRFs), as important transcriptional regulators downstream of the cytokinin signaling pathway, play a crucial role in mediating hormone signal output and coordinating plant growth and development; however, their functional mechanism in the potato's response to low-temperature stress remains unclear. Summary of the Invention

[0003] Based on this, this study systematically identified members of the potato CRF family and focused on analyzing... StCRF3a Biological functions in response to low temperature stress.

[0004] On the one hand, this application provides the application of cytokinin response factor in improving the resistance of potatoes to low temperature stress, wherein the cytokinin response factor is StCRF3a.

[0005] Furthermore, the amino acid sequence of StCRF3a is shown in SEQ ID No. 2.

[0006] Furthermore, the nucleotide sequence encoding StCRF3a is shown in SEQ ID No. 1.

[0007] This application discloses for the first time that members of the potato CRF family include the cytokinin response factor StCRF3a, and experimentally verifies that this cytokinin response factor is related to the low-temperature stress resistance of potatoes, and that increasing its expression can effectively improve the low-temperature stress resistance of potatoes.

[0008] Furthermore, the low-temperature stress includes chilling injury and / or freezing injury; Preferably, the chilling injury includes an environment of 0°C to 10°C, and the freezing injury includes an environment of 0°C to 0°C. Currently, the prior art considers -4°C to be the lethal temperature for potatoes.

[0009] Therefore, the low temperature includes environments of 10°C or less.

[0010] Preferably, the low temperature and the upper or lower limit of the temperature range can refer to any value or range among 10℃, 9℃, 8℃, 7℃, 6℃, 5℃, 4℃, 3℃, 2℃, 1℃, 0℃, -1℃, -2℃, -3℃, -4℃, -5℃, -6℃, -7℃, -8℃, -9℃, and -10℃.

[0011] Preferably, the low temperature includes -10℃ to 10℃; more preferably, -4℃ to 10℃.

[0012] Furthermore, the improvement of potato resistance to low temperature stress includes improving the low temperature tolerance of potatoes and / or improving the recovery function of potatoes after low temperature stress.

[0013] Furthermore, improving the low-temperature tolerance of potatoes and / or enhancing their recovery function after low-temperature stress includes enhancing the stability of potato biofilms, inhibiting the increase in reactive oxygen species content in potatoes caused by low-temperature stress, and / or increasing the soluble sugar content in potatoes; preferably, the reactive oxygen species include hydrogen peroxide (H2O2) and / or superoxide anions (H2O2). ).

[0014] Preferably, the enhanced potato biofilm stability is achieved by reducing the malondialdehyde (MDA) content.

[0015] In a preferred embodiment, the cytokinin response factor StCRF3a can enhance the low-temperature tolerance of potatoes and / or improve their recovery function after low-temperature stress by strengthening the stability of potato biofilms, inhibiting the increase of reactive oxygen species content in potatoes caused by low-temperature stress, and / or increasing the soluble sugar content in potatoes.

[0016] Furthermore, the method for improving the low-temperature stress resistance of potatoes includes upregulating the level of the cytokinin response factor StCRF3a; preferably, the method includes overexpressing the cytokinin response factor. StCRF3a .

[0017] Preferably, the upregulation of the level of cytokinin response factor StCRF3a is to increase the content of cytokinin response factor StCRF3a.

[0018] Preferably, those skilled in the art can use known gene editing methods or genetic engineering systems to regulate the level of StCRF3a in potatoes.

[0019] Preferably, the overexpression of cytokinin response factor StCRF3a The method is to use a strong starter to boot. StCRF3aThe expression of the virus can be improved to achieve a higher expression level than the wild type or to achieve heterologous expression.

[0020] In a preferred embodiment, a method for constructing a potato overexpressing the cytokinin response factor StCRF3a (upregulating the level of the cytokinin response factor StCRF3a) includes: Step 1: Construction StCRF3a Overexpression vector; preferably, the StCRF3a Strong promoters are used in overexpression vectors. StCRF3a Express; Step 2, StCRF3a The overexpression vector was transformed into potatoes.

[0021] In a preferred embodiment, the overexpression vector is a pEASY-Blunt zero vector and / or pCAMBIA1305×FLAG and / or pCAMBIA2301×FLAG.

[0022] In a preferred embodiment, construct StCRF3a Overexpression vectors include those that will express the expression of ... StCRF3a The gene was ligated into the pEASY-Blunt zero vector, digested with enzymes, and then ligated into the intermediate vector pCAMBIA1305×FLAG. Finally, the gene was obtained by ligating into the final vector pCAMBIA2301×FLAG via homologous recombination.

[0023] Those skilled in the art can also select a suitable overexpression vector system based on the actual situation, as long as it can achieve the desired result. StCRF3a The expression can be overstated.

[0024] Preferably, the transformation method is Agrobacterium-mediated potato genetic transformation. Those skilled in the art can use known genetic transformation systems to complete the transformation; specific methods are not specified in this application.

[0025] In a preferred embodiment, the genetic transformation method includes the following steps: Step 1: Construct StCRF3a The overexpression vector is transferred into Agrobacterium, the Agrobacterium is activated, and an infection solution is obtained; preferably, the infection solution also includes AS. Step 2: Place the genetic transformation recipient in the infection solution for infection; Step 3: Transfer the infected genetic transformation recipients to a co-culture medium and co-culture in the dark; Step 4: After co-culture, the genetic transformation recipient is transferred to the callus induction medium. After callus grows, it is transferred to the shoot induction medium for further culture. After the growth point grows, the callus tissue is cut off, and the seedlings with the growth point are transferred to the rooting medium to promote rooting, thus obtaining the transgenic potato.

[0026] Preferred, Step 1: Construct StCRF3a The overexpression vector was transferred into Agrobacterium, activating Agrobacterium (OD). 600 = 0.5-0.8), to obtain the infiltration solution; preferably, the infiltration solution also includes 5-20 μL AS; Step 2: Place the genetic transformation recipient in the infection solution for infection at 25-30℃ and 10-50 rpm for 10-20 minutes. Step 3: Transfer the infected genetic transformation recipients to a co-culture medium and co-culture in the dark at 20-25℃ for 1-3 days; Step 4: After co-culture, the genetic transformation recipient is transferred to callus induction medium for culture. After callus growth, it is transferred to shoot induction medium for further culture. After the growth point grows, the callus tissue is cut off, and the seedlings with the growth point are transferred to rooting medium to promote rooting, thus obtaining transgenic potatoes. The culture conditions include: photoperiod: 16 h light / 8 h dark; light intensity: 2000 Lx; humidity: 60-70%; temperature: 21-23℃.

[0027] Preferably, the step of incubating the genetic transformation recipient in the dark before infection is further included, wherein the dark culture is carried out at 21-23°C in the dark for 1-2 days.

[0028] Preferably, the genetic transformation receptor may be a potato stem segment and / or tuber.

[0029] Preferably, the Agrobacterium is Agrobacterium. GV3101.

[0030] On the other hand, this application also provides a method for improving the resistance of potatoes to low temperature stress, the method comprising regulating the level of the cytokinin response factor StCRF3a.

[0031] Furthermore, the method includes upregulating cytokinin response factors. StCRF3a The level; preferably, the method includes overexpression of cytokinin response factor. StCRF3a The genes.

[0032] In a preferred embodiment, a method for improving the low-temperature stress resistance of potatoes includes: Step 1: Construction StCRF3a Overexpression vector; preferably, the StCRF3aStrong promoters are used in overexpression vectors. StCRF3a Express; Step 2, StCRF3a The overexpression vector is transformed into potatoes to obtain potatoes with resistance to low temperature stress; preferably, the transformation method is Agrobacterium-mediated potato genetic transformation.

[0033] Furthermore, the amino acid sequence of StCRF3a is shown in SEQ ID No. 2.

[0034] Furthermore, the low temperature includes an environment of less than or equal to 10°C.

[0035] On the other hand, this application also provides the application of the method in the preparation of potatoes resistant to low-temperature stress and / or with high soluble sugar content.

[0036] Furthermore, the low temperature includes an environment of less than or equal to 10°C.

[0037] On the other hand, this application also provides the application of cytokinin response factor in increasing the soluble sugar content of potatoes, wherein the cytokinin response factor is StCRF3a; preferably, the potato is a potato subjected to low temperature stress.

[0038] Furthermore, the low temperature includes an environment of less than or equal to 10°C.

[0039] Furthermore, the method for increasing the soluble sugar content of potatoes includes upregulating cytokinin response factors. StCRF3a The level; preferably, the method includes overexpression of cytokinin response factor. StCRF3a The genes.

[0040] Furthermore, the amino acid sequence of StCRF3a is shown in SEQ ID No. 2.

[0041] The present invention has the following beneficial effects: This application marks the first identification of the CRF family in potato. Through collinearity analysis and conserved domain screening, nine CRF family members were successfully identified from the potato genome.

[0042] This application conducted a functional study on CRF family members in potatoes and found that StCRF3a, a member of the CRF family, plays a role in low-temperature stress in potatoes. Specifically, StCRF3a It is induced by low temperature, and its promoter region contains low temperature response elements.

[0043] Furthermore, this application found that, compared to the wild type, overexpression StCRF3a It enhanced the resistance of potatoes to low-temperature stress, and under low-temperature stress, overexpression...StCRF3a The plant enhanced the stability of the biofilm, alleviated the accumulation of reactive oxygen species in the plant, and increased the content of soluble sugars in the plant, thereby enhancing the low-temperature resistance of potatoes. This provides a new theoretical basis and scheme for potato genetic engineering modification and provides important genetic resources and theoretical guidance for potato molecular breeding. Attached Figure Description

[0044] The accompanying drawings, which are included to provide a further understanding of this application and form part of this application, illustrate exemplary embodiments and are used to explain this application, but do not constitute an undue limitation of this application. In the drawings: Figure 1 A diagram showing the distribution of StCRF family members on chromosomes; Figure 2 Phylogenetic and domain analysis diagrams of Arabidopsis CRF, tomato CRF, and potato CRF proteins, including (A) phylogenetic tree of Arabidopsis CRF, tomato CRF, and potato CRF; and (B) analysis of conserved domains of Arabidopsis CRF, tomato CRF, and potato CRF proteins. Figure 3 A schematic diagram of the low-temperature induced expression pattern of the nine members of the potato CRF family; Figure 4 for StCRF3a Gene cloning and expression vector enzyme digestion identification, of which (A) StCRF3a Full-length gene cloning; (B) StCRF3a -GFP restriction enzyme digestion identification; Maker (2K plus II); Figure 5 This is a spectrum of RNAi vectors; Figure 6 This is a schematic diagram of a potato genetic transformation system, in which (A) stem segments are placed in a pre-culture medium; (B) stem segments are transferred to a callus induction medium to form callus; (C) seedlings are formed on the callus (bud induction medium); (D) roots are formed in a rooting medium. Figure 7 for StCRF3a - Screening and identification diagram of FLAG transgenic lines, where (A) StCRF3a PCR screening of overexpressing plants; (B) StCRF3a GUS staining analysis of overexpressing plants; (C) StCRF3a qRT-PCR identification of overexpressing plants; (D) StCRF3a Western blot analysis of overexpressing plants; Figure 8 for StCRF3a - Screening and identification of RNAi silencing lines, where (A) PCR screening of silencing plants; (B) qRT-PCR identification of silencing plants; Figure 9 Under low temperature stress StCRF3a Graph showing the induced expression; Figure 10 for StCRF3a Phenotypic diagrams of transgenic lines and wild-type lines before and after -3℃ treatment, and the restored phenotype; Figure 11 for StCRF3a Phenotypic diagrams of transgenic lines and wild-type lines treated at 4 ℃, with the left side showing... StCRF3a Phenotypes of overexpression lines and wild-type (WT) at 22°C and 4°C; right side shows... StCRF3a Phenotypic results of silent strains and wild-type (WT) at 22°C and 4°C; Figure 12 For overexpression StCRF3a The results of the study show that the low-temperature tolerance of potato plants can be enhanced. (A) Before and after low-temperature treatment. StCRF3a MDA content in transgenic lines and wild-type (WT); (B, C) before and after low-temperature treatment StCRF3a Transgenic lines and wild-type (WT) and changes in H2O2 content; (D) before and after low-temperature treatment StCRF3a Changes in soluble sugar content between transgenic lines and wild-type (WT) lines; P<0.05 (one-way ANOVA). Detailed Implementation

[0045] Technical terms: Recombination: In a broad sense, any gene exchange process that causes a change in genotype is called recombination.

[0046] To more clearly illustrate the overall concept of this application, a detailed description is provided below with reference to the accompanying drawings and embodiments. Numerous specific details are set forth in the following description to provide a more thorough understanding of the invention. However, it will be apparent to those skilled in the art that the invention can be practiced without one or more of these details. In other instances, certain technical features well-known in the art have not been described to avoid confusion with the invention.

[0047] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0048] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention.

[0049] Unless otherwise specified, all reagents or instruments used in the following embodiments, unless otherwise indicated by the manufacturer, are commercially available products. Where specific conditions are not specified in the embodiments, they are performed under standard conditions or conditions recommended by the manufacturer.

[0050] The plasmids, restriction enzymes, PCR enzymes, plasmid extraction kits, and DNA gel recovery kits used in the following examples are commercial products. The specific operations were performed according to the kit instructions.

[0051] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. Specifically, they can be performed according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0052] In this specification, the amino acids at the corresponding sites are represented by the recognized IUPAC single-letter abbreviations, where each amino acid and its abbreviation are as follows: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).

[0053] The bases include adenine (A), thymine (T), guanine (G), cytosine (C), and urazine (U).

[0054] In addition, the "water" mentioned in this invention includes any feasible water that can be used in the art, such as deionized water, distilled water, ion-exchanged water, double-distilled water, high-purity water, and purified water.

[0055] In the following embodiments, unless otherwise specified, % means wt%, i.e., weight percentage.

[0056] The culture media involved in the following examples are as follows: Table 1 LB medium

[0057] Table 2 YEP culture medium

[0058] Note: LB and YEP media should be autoclaved at 121 °C for 20 min before use.

[0059] Table 3. Culture media required for genetic transformation of potato

[0060] Note: MS solid culture medium was autoclaved at 115 °C for 20 min. After slightly cooling to room temperature, hormone antibiotics such as NAA, 6-BA, As, ZT, Cef, and Kan were added and mixed well for subsequent use.

[0061] The plant material used is potato ( Solanum tuberosum L. cv. Désirée); The plant total RNA extraction kit used in this study was purchased from Takara Biotechnology Co., Ltd. (Beijing); total RNA was extracted using the TOYOBO reverse transcription kit (ReverTra Ace). ® Reverse transcription was performed using qPCR RT Master Mix with gDNA Remover; cDNA first strand synthesis kit and KOD-Plus-Neo enzyme were purchased from Toyobo (Shanghai) Biotechnology Co., Ltd.; qRT-PCR kit was purchased from Beijing Qidi Litai Technology Co., Ltd.

[0062] Agarose gel extraction kits and plasmid extraction kits were purchased from Omega Biotechnology, Inc., USA; various restriction endonucleases and T4 DNA ligases were purchased from Thermo Fisher Scientific, Inc., USA; and DNA Marker (2K plus) was purchased from TransGen Biotech Ltd., Beijing.

[0063] Example 1: Identification of CRF Family Members in Potato In this embodiment, the CRF amino acid sequence of Arabidopsis was downloaded from the Arabidopsis Information Resource (TAIR, https: / / www.arabidopsis.org / ) and the CRF amino acid sequence of tomato was downloaded from the Sol Genomics Network (https: / / solgenomics.net / ). Then, the potato genome protein sequence file (reference genome DM v 6.1) was downloaded from the Phytozome database (https: / / phytozome-next.jgi.doe.gov / ). Collinearity analysis was performed to obtain some members of the potato CRF family. Meanwhile, cytokinin-responsive factors (CRFs) belong to the AP2 / ERF (APETALA2 / ethylene-responsive element binding factor) transcription factor superfamily. They mainly contain a conserved APETALA2 (AP2) domain, a CRF domain, an N-terminal TEH domain, and a C-terminal region with unknown function. Therefore, based on the conserved structure, the obtained candidate sequences were further screened, and repetitive genes and short sequences were removed, finally resulting in 9 members of the potato CRF family. These family members are mainly concentrated on chromosomes 1, 3, 4, 5, 6, and 8. Figure 1 There are also 12 Arabidopsis species. CRFs Genes and 11 tomatoes CRFs The protein sequence encoded by the gene.

[0064] Then, the above 9 potatoes CRFs Genes, 12 Arabidopsis thaliana species CRFs Genes and 11 tomatoes CRFsThe protein sequences encoded by the genes were used to construct phylogenetic trees using neighbor-joining in MEGA 5.05, and 1000 bootstrap tests were performed to assess the reliability of evolutionary relationships. Then, these protein sequences were used to predict conserved sequences. The results showed that most CRF families contain an N-terminal TEH / CRF domain (DPDATDSSSDRIVRIIVTDPDATDSSSDEEEERRRVKRYVNEI) and an AP2 domain (AAEIRD**RR*R*WLGT*DTAEEAA, where * represents any amino acid at this position). A few members contain multiple TEH / CRF and AP2 domains, such as AtCRF10 and SlCRF3. AtCRF10 contains two AP2 domains and one TEH / CRF domain; SlCRF3 contains two AP2 domains and two TEH / CRF domains. All members of the potato CRF family contain one AP2 domain and one TEH / CRF domain. However, the study found that not all CRF family members contain a phosphorylation site at the C-terminus. Specifically, Arabidopsis CRF has 12 members, 6 of which contain phosphorylation sites (AtCRF1, AtCRF2, AtCRF3, AtCRF4, AtCRF5, AtCRF6); tomato CRF has 11 members, 8 of which contain phosphorylation sites (SlCRF1, SlCRF2, SlCRF4, SlCRF5, SlCRF6, SlCRF9, SlCRF10, SlCRF11); and potato CRF has 9 members, 8 of which contain phosphorylation sites (StCRF1, StCRF7, StCRF3a, StCRF3b, StCRF8, StCRF9, StCRF10, StCRF11). Despite the conserved core domain, different members exhibit significant differences in protein length, C-terminal region, and phosphorylation site distribution, suggesting that CRF members may undergo functional differentiation at the levels of signal response, protein-protein interaction, or post-translational regulation. Therefore, the C-terminal variable region and its potential phosphorylation sites may be an important structural basis for driving functional differences among CRF subfamilies. Figure 2 ).

[0065] Furthermore, nine members of the potato CRF family were identified to investigate whether they play a role in the response to low temperature stress. Therefore, wild-type potato plants (Désirée) were subjected to low temperature treatment to detect the expression level of CRF family genes in potato plants under low temperature conditions.

[0066] The nucleotide sequence of StCRF1 is shown in SEQ ID No. 5, and the amino acid sequence is shown in SEQ ID No. 6; the nucleotide sequence of StCRF3b is shown in SEQ ID No. 7, and the amino acid sequence is shown in SEQ ID No. 8; the nucleotide sequence of StCRF7 is shown in SEQ ID No. 9, and the amino acid sequence is shown in SEQ ID No. 10; the nucleotide sequence of StCRF8 is shown in SEQ ID No. 11, and the amino acid sequence is shown in SEQ ID No. 12; the nucleotide sequence of StCRF9 is shown in SEQ ID No. 13, and the amino acid sequence is shown in SEQ ID No. 14; the nucleotide sequence of StCRF10 is shown in SEQ ID No. 15, and the amino acid sequence is shown in SEQ ID No. 16; the nucleotide sequence of StCRF11 is shown in SEQ ID No. 17, and the amino acid sequence is shown in SEQ ID No. 18; the nucleotide sequence of StCRF12 is shown in SEQ ID No. 19, and the amino acid sequence is shown in SEQ ID No. 20; and the nucleotide sequence of StCRF3a is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 2.

[0067] The steps are as follows: (1) Cultivation and low-temperature treatment of plant materials Culture of potato tissue culture seedlings: Under sterile conditions, potato Désirée test-tube seedlings with axillary buds were cut with a knife and inoculated into solid medium containing 50 mL of Murashige and Skoog (pH = 5.8). Five stem segments were inoculated into each bottle and placed in an incubator (22 ± 1℃; photoperiod: 16 h light / 8 h dark; light intensity: 2000 Lx; humidity: 60-70%) for about 30 days.

[0068] Potato seedling cultivation: Désirée seedlings in tissue culture bottles were transferred into seedling bags with a diameter of approximately 5 cm for cultivation and placed in a greenhouse incubator (photoperiod: 16 h light / 8 h dark; light intensity: 200 µmol photons m -2 s -1 Seedlings were raised for 15 days in a greenhouse (humidity: 60-70%; temperature: 22℃). They were then transferred to a culture room (photoperiod: 16 h light / 8 h dark; light intensity: 300 µmol photons m). -2 s -1After being cultured for 15 days in a humid environment (humidity: 60-70%; temperature: 22℃), wild-type potato plants (Désirée) with uniform growth were selected for low-temperature treatment. The wild-type potato plants were placed in a low-temperature environment of 4℃ for 0 h, 3 h, 6 h, 9 h, 12 h, and 24 h, respectively. Then, the third or fourth leaf of the plant was taken for the experiment.

[0069] (2) Extraction of total RNA from potatoes: Potato leaves treated at 4℃ for 0 h, 3 h, 6 h, 9 h, 12 h, and 24 h were collected and immediately placed in liquid nitrogen. Total RNA was extracted from the potatoes using the TaKaRa MiniBEST Plant RNA Extraction Kit. After extraction, the RNA was aliquoted, with 10 μL transferred to PCR tubes. 2 μL was used for gel electrophoresis, and the remaining 8 μL was used for concentration measurement and reverse transcription. The remaining RNA was stored at -80℃.

[0070] (3) Potato RNA reverse transcription to synthesize cDNA strand Take 0.5 μg of total RNA and use the TOYOBO Reverse Transcription Kit (ReverTra Ace). ® Reverse transcription was performed using qPCR RT Master Mixwith gDNA Remover, following the instructions of the Toyobo Reverse Transcription Kit (No. FSQ-301).

[0071] (4) qRT-PCR The reverse transcription product was diluted 10-fold and qRT-PCR was performed using a kit from Beijing Qidi Litai Technology Co., Ltd. (SYBR Fast Universal qRT Kit, Cat: F0107). Potato Actin was used as an internal control gene. The expression levels of CRF family genes in potato plants under low-temperature conditions were detected. The primers used are shown in Table 4 below.

[0072] Table 4

[0073] The results are as follows Figure 3 As shown, StCRF1 , StCRF3a , StCRF3b , StCRF7 , StCRF8 , StCRF9 , StCRF10 , StCRF11 , StCRF12 middle, StCRF1 , StCRF3b , StCRF7 ,StCRF9 , StCRF11 , StCRF12 It is unrelated to the low temperature response, but StCRF3a , StCRF8 , StCRF10 Related to low-temperature response, select those with obvious low-temperature response. StCRF3a Further research will be conducted on the genes.

[0074] Example 2 StCRF3a Cloning of the full-length cDNA sequence of the gene In this embodiment, StCRF3a The gene was studied systematically. To obtain the gene, its full-length cDNA sequence was cloned. Total RNA was extracted from potatoes using the TaKaRa total RNA extraction kit, and cDNA was synthesized via reverse transcription. Specific amplification primers were designed (…). StCRF3a -GFP-F / R, StCRF3a -GFP-F:GGATCCATGGATCATCACAATATGCTTT, StCRF3a -GFP-R: GTCGACTAATGCCATTAGAACATCAACAC), using the cDNA obtained by reverse transcription as a template, PCR amplification and 1% agarose gel electrophoresis were performed, yielding a target band of approximately 1125 bp ( Figure 4 A). The target band was excised, weighed, and gel recovered. The recovered product was ligated into the pEASY-Blunt zero vector (TransGen Biotech) and transformed into E. coli. Trans- T1 Positive clones were screened and identified, and their plasmids were activated and extracted. After sequencing and alignment confirmed, the plasmids were then expressed with the expression vector pCAMBIA1300-GFP. BamH I 、Sal The sample was digested with enzyme I, the target band was recovered, and ligated into the corresponding expression vector using T4 ligase. The resulting product was then transformed into *E. coli*. Trans-T1 Screening for positive clones, activating and extracting plasmids, and performing... BamH I 、Sal I. Double enzyme digestion identification: If the obtained fragment is the same size as the target fragment... StCRF3a -GFP expression vector successfully constructed ( Figure 4 B). That is, cloning. StCRF3a The gene, as shown in SEQ ID No. 1, has an amino acid sequence as shown in SEQ ID No. 2.

[0075] Example 3 StCRF3a Overexpression and construction of RNAi plants This embodiment is constructed StCRF3a Overexpression vector StCRF3a -FLAG、 StCRF3a Gene knockdown vectorStCRF3a -RNAi was used for genetic transformation of potato (Désirée). After pre-culture, callus induction, shoot induction, and finally, the growing shoots were removed and placed in rooting medium for rooting induction. Then, qRT-PCR or WB experiments were used to determine the genetic makeup of the potato. StCRF3a The overexpression lines were determined by qRT-PCR experiments. StCRF3a Silent strain.

[0076] 1. StCRF3a Overexpression vector StCRF3a - FLAG Construction The amplification obtained in Example 2 StCRF3a Gene (CDS) fragments were ligated into the pEASY-Blunt zero vector (Beijing TransGen Biotech Co., Ltd.), and the ligation product was transformed into E. coli. Trans-T1 Plasmids were extracted and sequenced. Once the sequencing was correct, [the results were processed]. BamH I and Kpn I represents the restriction enzyme site ligated into the intermediate vector pCAMBIA1305×FLAG. After correct sequencing, the plasmid was extracted to obtain pCAMBIA1305- StCRF3a ×FLAG. Then, specific primers pCAMBIA-35SF and pCAMBIA-NR were designed, pCAMBIA-35SF: ACGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTCAAC; pCAMBIA-NR: TATGACCATGATTACGAATTCCCGATCTAGTAACATAG, with plasmid pCAMBIA1305- StCRF3a PCR amplification was performed using ×FLAG as a template. The gel-recovered products were ligated into the final vector pCAMBIA2301×FLAG via homologous recombination. Ligation conditions included incubation at 37°C for 30 min. The ligation process was performed using the ClonExpress® II One Step Cloning Kit C112 (Nanjing Novizan Biotechnology Co., Ltd.). After successful sequencing, the constructed final vector was transferred into… GV3101 Agrobacterium-mediated potato genetic transformation.

[0077] 2. StCRF3a -Construction of RNAi vectors Select StCRF3a A specific sequence of approximately 300 bp in the gene coding region was used to construct the forward (SEQ ID No. 3) and reverse complementary (SEQ ID No. 4) sequences of this target fragment into the silencing vector pBWA(V)KS( Figure 5 The loop ends of the ) are used. After successful sequencing, the constructed final vector is transferred into GV3101Agrobacterium-mediated potato genetic transformation.

[0078] 3. Genetic transformation of potatoes In this embodiment, Agrobacterium-mediated transformation was used to explant Désirée stem segments that had grown for about four weeks in tissue culture bottles for genetic transformation of potatoes.

[0079] (1) Cut a stem segment of about 1.5 cm with an axillary bud in a clean bench and culture it for subculture. After about 4 weeks of culture, prepare for infection.

[0080] (2) Agrobacterium activation: Remove frozen samples containing Agrobacterium at -80℃ StCRF3a -FLAG or StCRF3a For the RNAi Agrobacterium tumefaciens culture, take a small amount of the culture and place it in 1 mL of liquid YEP (Kana 50 mg / L + Rif 50 mg / L), and incubate at 28℃ and 180 rpm for about 12-14 h.

[0081] (3) Pre-culture: Cut a stem segment of about 1.5 cm from the Désirée tissue culture seedlings prepared in step (1) and place it on the pre-culture medium. Incubate in the dark at 22℃ for 1-2 days.

[0082] (4) Large shake: Take 300 μL of the activated Agrobacterium tumefaciens culture from step (2) and add it to 15 mL of liquid YEP (containing 50 mg / L Kana + 50 mg / L Rif), and incubate at 28℃ and 180 rpm for 16 h (OD). 600 = 0.6).

[0083] (5) Agrobacterium infection: Centrifuge at 5000 rpm for 5 min at room temperature and collect the bacterial cells from step (4). After discarding the supernatant, wash the bacterial cells with liquid MS, and then resuspend the precipitate in 10 mL MS (with 10 uL AS) solution. Place the dark-treated stem segments in the infection solution and gently shake at 28℃ and 30 rpm for 15 min to ensure that the infection solution is in full contact with the stem segments. Then, remove the stem segments and place them on the co-culture medium and co-culture in the dark at 22℃ for 2 days.

[0084] (6) After two days of co-culture, the stem segments were transferred to callus induction medium and placed in a 22℃ light incubator (photocycle: 16 h light / 8 h dark; light intensity: 2000 Lx; humidity: 60-70%; temperature: 22℃).

[0085] (7) After 14 days, callus will grow and the seedlings will be transferred to the bud induction medium for further culture. The bud induction medium will be changed every 14 days. After the growth point grows, the callus tissue will be cut off and the seedlings with the growth point will be transferred to the rooting medium to promote rooting. After rooting, transgenic screening and identification will be carried out.

[0086] The process is as follows Figure 6 As shown, with StCRF3a Taking FLAG-transformed plants as an example, (A) is a schematic diagram of stem segments placed in pre-culture medium; (B) is a schematic diagram of stem segments transferred to callus induction medium to form callus; (C) is a schematic diagram of seedlings formed on callus (bud induction medium); (D) is a schematic diagram of rooting in rooting medium.

[0087] 4. StCRF3a Screening of overexpression plants After the seedlings have taken root, the obtained transgenic potatoes will be screened and their properties will be determined. StCRF3a Gene expression levels. After obtaining transgenic plants, genomes were extracted using the CTAB method, and PCR amplification was performed using Kan primers (Kan-3F: GCACAATCCCACTATCCTTCG; Kan-3R: TCCCGCTTCAGTGACAACG). Positive seedlings were screened by 1% agarose gel electrophoresis. Figure 7 A). The results show that, StCRF3a Overexpression lines (F3, F8, F11, F14, F22, F26, F27, F31) showed the target band, while wild-type (WT) lines did not, indicating that lines integrated into the potato genome were preliminarily screened. StCRF3a -FLAG overexpression strain.

[0088] Simultaneously, since the overexpression vector contains a GUS tag, detection can also be performed via GUS staining. Small amounts of plant leaves and stems were cut and placed in GUS staining solution, then incubated in a 37°C incubator in the dark for approximately 2-3 hours, followed by destaining with graded ethanol. The results showed... StCRF3a Overexpressing lines showed blue leaves and stems (F3, F8, F11, F14, F22, F26, F27, F31), while wild-type (WT) did not. Preliminary screening identified lines integrated into the potato genome. StCRF3a Overexpression plants ( Figure 7 B).

[0089] The eight selected transgenic lines were further identified, and total RNA was extracted and detected by qRT-PCR. StCRF3a Expression levels in transgenic plants. For example... Figure 7 As shown in C, the overexpressing plants StCRF3a The expression level of the β-carotene was significantly higher than that of the wild-type plant. We selected the four lines with the highest expression levels (F14, F3, F27, and F11), which showed upregulation of expression levels by 55.5, 42, 32, and 25 times, respectively, compared to the wild-type. Therefore, we selected F14, F3, F27, and F11, which had the highest expression levels, for subsequent experiments. The Western blot validation results were consistent with the quantitative results.Figure 7 D).

[0090] 5. StCRF3a Screening of RNAi plants After obtaining transgenic plants, genomes were extracted using the CTAB method, and preliminary screening and identification were performed using primers on the vector (RNAi T-F1 / R1, RNAi-T-F1: GCAGATCTAGTTTTTCTCCTTCATT; RNAi-T-R1: GAAATTCGAGCTGGTCAGTC). Positive seedlings were screened by 1% agarose gel electrophoresis, and the results showed that... StCRF3a Silent lines (R3, R4, R17, R19, R20, R21, R22, R25) showed the target band, while the wild-type (WT) showed no band. Preliminary screening identified lines integrated into the potato genome. StCRF3a -RNAi silencing lines ( Figure 8 A).

[0091] The eight selected transgenic lines were then further identified, and total RNA was extracted from tubers and detected by qRT-PCR. StCRF3a Expression levels in transgenic plants. For example... Figure 8 As shown in B, the silent plant StCRF3a The expression level of the α-type was significantly lower than that of the wild-type plant. Therefore, R4, R25, and R22, which had relatively low expression levels (70%, 59%, and 55% of their expression levels, respectively), were selected for subsequent experiments.

[0092] Example 4 StCRF3a Functional analysis of regulating potato low temperature tolerance This embodiment refers to Example 3. StCRF3a Transgenic plants ( StCRF3a Overexpressing plants and StCRF3a Functional analysis of low-temperature tolerance was conducted on RNAi plants by subjecting them to freezing stress and low-temperature stress treatments.

[0093] Freezing stress treatment: Before freezing treatment, the material to be treated... StCRF3a Transgenic and wild-type plants were placed in a photoincubator (photoperiod: 16 h light / 8 h dark; light intensity: 300 µmol photons m -2 s -1 (Humidity: 60-70%; Temperature: 22℃) Pre-culture for 3 days, then treat at -3℃ for 3 hours under the same conditions for phenotypic observation, and then recover at 22℃ for 3 days.

[0094] Low-temperature stress treatment: Before freezing, the material to be treated... StCRF3aTransgenic and wild-type plants were placed in a photoincubator (photoperiod: 16 h light / 8 h dark; light intensity: 300 µmol photons m -2 s -1 (Humidity: 60-70%; Temperature: 22℃) Pre-culture for 3 days, then treat under the same conditions at 4℃ for 7 days for phenotypic observation.

[0095] Wild-type (Désirée) plants were subjected to low-temperature stress treatment, and the results were analyzed by qRT-PCR. StCRF3a Expression levels at 4℃. The results indicate that under low-temperature stress, StCRF3a Gene expression peaked at 9 h, and then gradually decreased to the level of untreated cells with increasing treatment time. Figure 9 This means StCRF3a It may play an important role in the response to low temperature stress.

[0096] In addition, you can use the PlantCare website (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html) StCRF3a Gene promoter element analysis revealed that it contains not only LTR (low-temperature response element) but also multiple CRT / DRE elements (ACCGAC). These results indicate that... StCRF3a Genes may play an important role in low temperature stress (Table 5).

[0097] Table 5 StCRF3a Gene promoter element analysis

[0098] Overexpression lines (F14, F3, F27), silenced lines (R4, R22, R25), and wild-type plants with uniform growth after four weeks of seedling cultivation were selected and subjected to freezing stress (-3℃). The results showed that after 3 hours of freezing treatment, both wild-type and silenced lines exhibited varying degrees of wilting, with silenced plants showing more severe wilting compared to wild-type plants. Figure 10 The overexpression lines showed the opposite trend; then, the transgenic plants and wild-type plants were treated at 22℃ for 3 days, and the recovery of the phenotype was observed. The overexpression plants basically recovered to normal growth, while the wild-type and silent plants completely wilted and lost water.

[0099] Cultivated potatoes are more sensitive to low temperatures / frost, and leaves often show wilting and necrotic damage after frost. Therefore, referring to the previous method of evaluating and classifying tolerance based on the percentage of leaf damage after frost, this study uses the size of the area of ​​whitening / necrotic patches (or necrotic spots) on leaves after low-temperature treatment as a phenotypic indicator of low-temperature tolerance, and uses it as a standard to measure the low-temperature tolerance of potatoes (Cabrera, H., Otiniano, R., Pando, R., Garcia, HS, Rodriguez, WH, Pérez, JM, de Haan, S., & Gastelo, M. (2025). INIA 333 -CHUGAYNA new potato variety resilient to climate change for the familyfarming system with tolerance to frost, resistant to late blight and highquality for fresh consumption. American Journal of Potato Research, 102(2),119-128. Stegner, M., Buchner, O., Schäfernolte, T., Holzinger, A., & Neuner, G. (2022). Responses to Ice Formation and Reasons of Frost Injury in Potato Leaves. Crops, 2(4), 378-389. Tu, W., Li, J., Dong, J., Wu, J., Wang, H., Zuo, Y., Cai, X., & Song, B. (2023). Molecular Marker-Assisted Selection for Frost Tolerance in a Diallel Population of Potato. Cells, 12(9), 1226.). Wild-type potato plants, StCRF3a -OE (F14, F3, F27, F11) plants, StCRF3a -RNAi (R4, R22, R25) and wild-type plants were treated at 4°C for 7 days, and phenotypic observations were performed. After 7 days of treatment at 4°C, compared with wild-type, overexpression of RNAi (R4, R22, R25) was significantly higher. StCRF3a The white necrotic spots on the leaves of the dormant strains were smaller, while those on the leaves of the silent strains were the opposite. (Explanation)StCRF3a Genes may play a positive role in enhancing the low-temperature tolerance of potatoes. Figure 11 ).

[0100] Studies have shown that when plants are subjected to low-temperature stress, the cell membrane is the first part to be damaged. Malondialdehyde (MDA) content is an important indicator for detecting the degree of membrane lipid peroxidation; higher MDA content indicates greater cell membrane damage. The MDA content in plants was determined using the G0109W48 MDA kit from Greens Biotech. The MDA content in overexpressing lines, silent lines, and wild-type plants was measured before and after 7 days of treatment at 4°C. Figure 12 As shown in Figure A, before low-temperature treatment, the MDA content of overexpressing lines, silenced lines, and wild-type cells was not significantly different. However, after 7 days of low-temperature treatment, the MDA content of overexpressing lines (F14, F3, F27, F11), silenced lines (R4, R22, R25), and wild-type cells were all significantly increased. However, compared with wild-type cells, StCRF3a The MDA content was significantly increased in the silent strains, while that in the overexpressing strains was significantly increased. StCRF3a The MDA content of the strain was lower than that of the wild type and the silent strain, which indicates that StCRF3a Low temperature stress helps maintain cell membrane stability.

[0101] The content of reactive oxygen species (ROS) in plant tissues is closely related to plant stress resistance. Low temperature stress can lead to excessive accumulation of ROS in plants, triggering oxidative stress and causing cell damage. Therefore, maintaining the dynamic balance between ROS production and scavenging in plant cells is of great significance for enhancing plant tolerance to low temperature stress. Hydrogen peroxide (H2O2) and superoxide anion (… These are two important components of reactive oxygen species. To investigate the effects of low-temperature conditions... ​ Whether it affects the antioxidant capacity of transgenic potato plants was investigated using the G0168W48 hydrogen peroxide (H2O2) content kit from Greens Biotechnology - colorimetric method; and the G0116W48 superoxide anion content kit from Greens Biotechnology. The kit measured H2O2 and H2O2 levels in overexpressing, silent, and wild-type lines before and after 4°C treatment for 7 days. Content. Results showed that before low-temperature treatment, the H2O2 content of overexpressing lines, silenced lines, and wild-type lines was significantly higher. The content was basically the same, with no significant difference; however, after low-temperature treatment, the H2O2 content of overexpression lines, silenced lines, and wild-type lines was significantly higher. The contents of all three increased significantly, especially the overexpression. StCRF3a H2O2 and genetically modified potato leaves Accumulation was less than in wild-type plants, while the opposite was true for silent lines. Figure 12B, C). Therefore, under low temperature stress, overexpression StCRF3a The gene alleviates the accumulation of reactive oxygen species in the plant, thereby enhancing the low-temperature resistance of potato plants.

[0102] When plants experience cold stress, they accumulate soluble sugars to lower their freezing point and enhance their frost resistance. Soluble sugars act as important osmotic regulators, effectively mitigating the damage caused by low-temperature stress. Therefore, the soluble sugar content before and after treatment was determined using the G0501W48 soluble sugar content kit from Greens Biotech. Under low-temperature stress, StCRF3a The soluble sugar content was significantly increased in the overexpression lines, silenced lines, and wild type. Among them, the soluble sugar content of the overexpression lines was higher than that of the wild type, while that of the silenced lines was lower than that of the wild type. Figure 12 D). This indicates that under low temperature stress, overexpression StCRF3a This increases the soluble sugar content, thereby enhancing the low-temperature tolerance of potatoes.

[0103] The results are shown in Tables 6 and 7.

[0104] Table 6 22℃ (before 4℃ treatment)

[0105] Table 74℃ after treatment

[0106] In summary, this study found that, compared with the wild type, overexpression StCRF3a It enhanced the resistance of potatoes to low-temperature stress, while the silenced lines were less tolerant of low temperatures; and under low-temperature stress, overexpression... StCRF3a The plant enhanced the stability of the biofilm, alleviated the accumulation of reactive oxygen species in the plant, and increased the content of soluble sugars in the plant, which means... StCRF3a It may play an important role in the low-temperature tolerance of potatoes.

[0107] The above description is merely an embodiment of this application and is not intended to limit the scope of this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the scope of the claims of this application.

Claims

1. The application of cytokinin-responsive factors in improving the resistance of potatoes to low-temperature stress, characterized in that, The cytokinin response factor is StCRF3a.

2. The application according to claim 1, characterized in that, The amino acid sequence of StCRF3a is shown in SEQ ID No.

2.

3. The application according to claim 1, characterized in that, The improvement of potato resistance to low temperature stress includes improving the low temperature tolerance of potatoes and / or improving the recovery function of potatoes after low temperature stress.

4. The application according to claim 3, characterized in that, The improvement of the low-temperature tolerance of potatoes and / or the improvement of the recovery function of potatoes after low-temperature stress includes enhancing the stability of potato biofilm, inhibiting the increase of reactive oxygen species content in potatoes caused by low-temperature stress and / or increasing the soluble sugar content in potatoes; preferably, the reactive oxygen species include hydrogen peroxide and / or superoxide anions.

5. The application according to claim 1, characterized in that, The method for improving the resistance of potatoes to low-temperature stress includes upregulating the level of the cytokinin response factor StCRF3a.

6. A method for improving the resistance of potatoes to low-temperature stress, characterized in that, The method includes regulating the level of the cytokinin response factor StCRF3a.

7. The method according to claim 6, characterized in that, The method includes upregulating the level of the cytokinin response factor StCRF3a; preferably, the method includes overexpressing the cytokinin response factor. StCRF3a The genes.

8. The method according to claim 6, characterized in that, The amino acid sequence of StCRF3a is shown in SEQ ID No.

2.

9. The application of the method according to any one of claims 6-8 in the preparation of potatoes resistant to low-temperature stress and / or with high soluble sugar content.

10. The application of cytokinin response factor in increasing the soluble sugar content of potatoes, characterized in that, The cytokinin response factor is StCRF3a; preferably, the potato is a potato subjected to low-temperature stress.