Molecular markers related to crude protein content in alfalfa and their applications

Abstract

This invention belongs to the field of molecular biology, specifically relating to molecular markers related to crude protein content in alfalfa and their applications. The purpose of this invention is to screen molecular markers suitable for the rapid breeding of alfalfa varieties with superior quality traits. The technical solution of this invention is a molecular marker related to crude protein content in alfalfa, with the following specific information: Chromosome: Chr5; Location: 64978172; SNP genotyping: C / A. This invention also designs KASP genotyping primers for this locus, enabling genotyping screening at the seedling stage, allowing selection without waiting for plant maturity, significantly shortening the breeding cycle.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to molecular markers related to crude protein content in alfalfa and their applications. Background Technology

[0002] Alfalfa, hailed as the "King of Forage," is highly valued for its high crude protein content and balanced amino acid composition, making it an irreplaceable source of high-quality protein for dairy cows and other herbivores. Crude protein content is a key indicator of alfalfa's feed value, directly determining the amount of concentrate supplementation in dairy cow diets. For every 1% increase in alfalfa crude protein, the amount of protein feed such as soybean meal can be reduced, effectively lowering feed costs while maintaining milk production performance. High-quality alfalfa typically requires a crude protein content of over 18%, while first-grade alfalfa needs over 20%. However, genetic improvement of this trait has long faced technological bottlenecks. Traditional breeding methods rely on chemical testing for phenotypic screening, requiring Kjeldahl nitrogen determination or near-infrared spectroscopy analysis for each breeding material. This is not only costly and low-throughput, but a complete breeding cycle takes 8 to 10 years, making it difficult to quickly respond to the industry's urgent demand for high-protein varieties. More importantly, crude protein content is greatly affected by environmental factors, and the performance of the same variety varies significantly across different plots and years. Traditional breeding methods struggle to effectively distinguish between genotype and environmental effects, leading to low selection efficiency. Molecular marker-assisted selection (MTA) identifies molecular markers closely related to crude protein content, enabling efficient screening of breeding populations at the seedling stage. This significantly shortens the breeding cycle and provides precise and efficient technical support for accelerating the development of new alfalfa varieties with high protein and high nutritional value. Summary of the Invention

[0003] The purpose of this invention is to screen molecular markers suitable for the rapid breeding of alfalfa varieties with excellent quality traits.

[0004] The technical solution of this invention is a molecular marker related to crude protein content in alfalfa, with the following specific information: Chromosome: Chr5; Location: 64978172; SNP type: C / A.

[0005] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0006] The present invention also provides primer combinations for KASP detection and genotyping of the molecular markers, the nucleotide sequences of which are shown in SEQ ID No. 3-5.

[0007] The present invention also provides a molecular marker detection kit, comprising primers shown in SEQ ID No. 3-5.

[0008] The present invention also provides a molecular marker chip, comprising primers shown in SEQ ID No. 3-5.

[0009] The present invention also provides the use of the molecular marker, the primer combination for amplifying the molecular marker, the kit and / or the molecular marker chip in any one of the following: a. Predict the crude protein content of alfalfa; b. Identification and screening of alfalfa with different crude protein contents; c. Molecular marker-assisted breeding of alfalfa; d. Alfalfa breeding; e. Prepare products for alfalfa breeding.

[0010] This invention also provides a method for screening alfalfa materials with different crude protein contents or predicting the crude protein content of alfalfa, comprising the following steps: extracting genomic DNA from the alfalfa material to be tested, amplifying molecular markers using primers described in SEQ ID No. 3~5, sequencing the amplified products, and screening by typing.

[0011] Specifically, the amplification program is as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by -0.8℃ in each cycle; 94℃ for 20 sec, 57℃ for 60 sec, 10 cycles.

[0012] Specifically, the genotyping criteria are as follows: if the genotyping result is CC, it is a material with low crude protein content; if the genotyping result is AA or AC, it is a material with high crude protein content.

[0013] The beneficial effects of this invention are as follows: This invention, through sequencing and analysis of 165 alfalfa germplasm materials, identified a SNP locus located near chromosome 64.98 Mb on chromosome Chr5 of the alfalfa genome that is significantly associated with crude protein content. KASP genotyping primers were designed targeting this locus, and 70 materials were analyzed. The results showed significant differences in crude protein content among different genotypes. The KASP primer combination developed in this invention can complete genotype screening at the seedling stage, eliminating the need to wait for plant maturity, significantly shortening the breeding cycle, and eliminating interference from environmental factors, thus significantly improving the accuracy and efficiency of target trait selection. The molecular markers of this invention have excellent application value, enabling pre-selection of crude protein content in test materials and molecular-assisted breeding. Attached Figure Description

[0014] Figure 1 1. Identification of sites significantly associated with crude protein content.

[0015] Figure 2KASP marker typing results at Chr5_64978172 site.

[0016] Figure 3 Comparative analysis of crude protein content in materials with different allelic genotypes. Detailed Implementation

[0017] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0018] Example 1: Obtaining Significantly Associated Sites The experimental population consisted of 165 alfalfa germplasm materials, representing different regions and phenotypes. Considering the variability among individual plants of the same alfalfa variety, cuttings were taken from the germplasm resource nursery in 2022 and propagated by cuttings in a greenhouse. After successful rooting, these germplasm materials were transplanted to experimental fields in Langfang, Hebei Province, and Changping, Beijing. In these experimental sites, a randomized block design was used to establish the experimental population, with three replicates, each containing 15 cuttings. To ensure sufficient growing space, the interval between replicates was 150 cm, and the distance between rows and plants was set to 150 cm and 60 cm, respectively. During the growing season, no fertilization or irrigation was applied; only manual weeding was performed. Winter watering was provided to help the plants overwinter.

[0019] Alfalfa was harvested at the initial flowering stage at two experimental plots. After harvesting, whole alfalfa plants were placed in nylon mesh belts and air-dried in a well-ventilated and shaded greenhouse, avoiding direct sunlight, until the stems became brittle and easily broken. These samples were then placed in a constant-temperature oven and dried thoroughly at 60°C for 6 hours. After drying, the samples were crushed using a cyclone mill to a particle size that could pass through a 40-mesh sieve, and packaged in resealable bags (keeping them dry and avoiding direct sunlight) for subsequent analysis. The crude protein content was then determined using a NIRS D2500F near-infrared spectroscopy system (FOSS, Denmark) with three technical replicates, and the average value was taken.

[0020] 100 mg of young alfalfa leaves were selected, flash-frozen in liquid nitrogen, and then total plant DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were detected using a micro spectrophotometer (Nano Photometer NP80, Germany), and then sequenced on the BGIDNBSEQ next-generation sequencing platform (BGI, Shenzhen, China).

[0021] Each material yielded approximately 30.5 GB of raw data. The raw sequencing data was processed using Trimmomatic (version 0.39) (Bolger et al., 2014) software to remove the adapter and filter out low-quality base sequences. The cleaned sequencing data was then aligned to the haplotype reference genome of 'Zhongmu 1' alfalfa using BWA-MEM. SAMtools (version 1.13) was used to filter multiple alignments and low-quality sequences, resulting in filtered BAM files, which were then sorted. PCR repetitive sequences were marked using the Mark Duplicates function in the Picard toolkit (version 2.23.0). Finally, the processed BAM files were used for variant detection using GATK Haplotype Caller (version 4.2.3.062). The following parameters were set as screening criteria in the SNP filtering strategy: Quality By Depth (QD) less than 2.0, Fisher Strand (FS) greater than 60.0, MQ Rank Sum Test less than -12.5, Read PosRank Sum less than -8.0, SOR (Strand Odds Ratio) greater than 3.0, and Mapping Qualities (MQ) less than 40.0. Subsequently, the selection criteria for a subset of alfalfa SNP markers were defined, including: (1) using VCFtools (version 0.1.16) to remove SNP markers with a deletion rate greater than 20% and a minor allele frequency (MAF) less than 0.05%, thereby creating a basic SNP set containing only biallelic SNP markers; (2) using Plink (version 1.90b6.21) to filter the basic SNP set based on linkage disequilibrium (LD), setting the LD filter window size to 100 SNPs, the window step size to 50 SNPs, and the r2 threshold to 0.2, to obtain a core SNP marker set. The missing genotypes in the LD-filtered SNP marker set were then filled using Beagle software with default parameters. Similarly, VCFtools was used to filter Indel markers, retaining only biallelic markers with a deletion rate less than 20% and a MAF greater than 0.05%.

[0022] GWAS analysis was performed using 2,821,247 high-quality SNP markers. To ensure the accuracy and reliability of the analysis, various software and statistical models were used: TASEEL 5.0 (GLM and MLM) (Bradbury PJ et al., 2007), BLINK (v1.01) (Huang et al., 2019). QQ plots (quantile-quantile plots) are used to measure the reliability of the model. By comparing QQ plots generated by different models, the MLM model in TASSEL 5.0 performed better. Therefore, the MLM model in TASSEL 5.0 was selected to present the final results. Principal component analysis was performed on the SNP data, and the first three principal component variables were used as covariates to correct for population structure. The Manhattan plot visualization was performed using the R package CMplot (Yin et al., 2021). A locus significantly associated with crude protein content was found on chromosome 5, with a LOD value of 9.85 and an explainable phenotypic contribution of 6.52% (…). Figure 1 ).

[0023] Example 2: Development of the KASP marker at the Chr5_64978172 locus The Chr5_64978172 locus is located near chromosome 64.98 Mb on the Chr5 chromosome of the alfalfa genome. The upstream and downstream reference sequences are shown in SEQ ID No. 1 and SEQ ID No. 2. Specific information for the Chr5_64978172 locus is as follows: Chromosome: chr5; Location: 64978172; SNP genotype: A / C.

[0024] SEQ ID No. 1, where lowercase letters represent SNP sites; CTCTTAATTAGGCGTATATTCAGTTCACATTGGGATGAACCTTAACAAAGACATTCTAACATTATGTACCATCTCTCACTGCTCTCTATGTAATTAATTCCAAGGATTGATAAAATAATTAAAAAGTTAAGGTATTCTTCTTTTTTAAGAAAAGTGGCAGATAATAGATAAGTCGTCTCGTTGGCAATCACCAGTAATAGGGCGTCTaAAGTGCAGCATCAACGCTTCCTTTTCCATCATGCTGAACTGTACAAGGTTTGACATGTGATTAAGGGATAATGAAGAAAAATTTGTTCTTCACTTCTTGCCCGACGCTTTGGTCACAACCTATTTGCTCCATGGAAATTGGTGGGGCCTTAGGATTGCTTCATGCTATCAATTGGGTGCATGATCTACAAGTTCACCATTTGGATTTGGAGTTAGATGCGAAGATAGTTG。

[0025] SEQ ID No.2, where the lowercase letters represent SNP sites; CTCTTAATTAGGCGTATATTCAGTTCACATTGGGATGAACCTTAACAAAGACATTCTAACATTATGTACCATCTCTCACTGCTCTCTATGTAATTAATTCCAAGGATTGATAAAATAATTAAAAAGTTAAGGTATTCTTCTTTTTTAAGAAAAGTGGCAGATAATAGATAAGTCGTCTCGTTGGCAATCACCAGTAATAGGGCGTCTcAAGTGCAGCATCAACGCTTCCTTTTCCATCATGCTGAACTGTACAAGGTTTGACATGTGATTAAGGGATAATGAAGAAAAATTTGTTCTTCACTTCTTGCCCGACGCTTTGGTCACAACCTATTTGCTCCATGGAAATTGGTGGGGCCTTAGGATTGCTTCATGCTATCAATTGGGTGCATGATCTACAAGTTCACCATTTGGATTTGGAGTTAGATGCGAAGATAGTTG。

[0026] KASP primers were designed for the Chr5_64978172 site and flanking sequence using Bacthprimer 3 software. Each KASP marker consisted of two specific primers and one universal primer. Fluorescent adapter sequences were ligated to the 5' end of the specific primers (GAAGGTGACCAAGTTCATGCT is the FAM fluorescent adapter sequence; GAAGGTCGGAGTCAACGGATT is the HEX fluorescent adapter sequence).

[0027] Specific primer 1 (SEQ ID No. 3): GAAGGTGACCAAGTTCATGCTGCAATCACCAGTAATAGGGCGTCTA; Specific primer 2 (SEQ ID No. 4): GAAGGTCGGAGTCAACGGATTGCAATCACCAGTAATAGGGCGTCTC; Universal primer (SEQ ID No. 5): AAAGGAAGCGTTGATGCTGCACTT.

[0028] Example 3: Application of Chr5_64978172 site Seventy alfalfa germplasm materials were planted (using the same planting method as in Example 1). Then, 100 mg of young alfalfa leaves were selected, flash-frozen in liquid nitrogen, and total plant DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were then determined using a Nano Photometer NP80 (Germany).

[0029] KASP marker validation and detection were performed using Douglas Scientific's ArrayTape system. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for signal scanning, and INTELLICS for data analysis.

[0030] The PCR system was assembled using NEXAR, and the PCR reaction system is shown in Table 1.

[0031] Table 1 KASP Reaction System .

[0032] Primer C represents a universal primer, while Primer X and Primer Y represent specific primers 1 and 2, respectively. PCR amplification was performed using a SOELLEX instrument. The touch-down PCR amplification conditions were as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by -0.8℃ per cycle; 94℃ for 20 sec, 57℃ for 60 sec, 10 cycles.

[0033] After the PCR reaction was completed, the fluorescence signal of the reaction system was scanned using ARAYA; then, data analysis and genotyping were performed using INTELLICS. A schematic diagram of the marker genotyping is shown below. Figure 2 As shown in Table 2, red represents the AA allele at this locus, blue represents the CC allele, and purple represents the C / A heterozygous type. The allele types of the 70 germplasm materials at this locus are shown in Table 2. Statistical analysis of the crude protein content of the materials with the three allele types using the t-test method revealed that the crude protein content of the AA allele was significantly lower than that of the C / A and CC types (P<0.01) (see Table 2). Figure 3 ).

[0034] Table 2. Allelic types of 70 germplasm materials at this locus. .

[0035] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. Molecular markers related to crude protein content in alfalfa, characterized by: The specific information is as follows: Chromosome: Chr5; Location: 64978172; SNP type: C / A.

2. The molecular marker according to claim 1, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No.

2.

3. A primer combination for KASP detection and genotyping of the molecular marker described in claim 1, characterized in that: Its nucleotide sequence is shown in SEQ ID No. 3~5.

4. A molecular marker detection kit, characterized in that: Includes the primers shown in SEQ ID No. 3~5.

5. A molecular marker chip, characterized in that: Includes the primers shown in SEQ ID No. 3~5.

6. The use of the molecular marker of claim 1 or 2, the primer combination of claim 3, the kit of claim 4, and / or the molecular marker chip of claim 5, in any one of the following: a. Predict the crude protein content of alfalfa; b. Identification and screening of alfalfa with different crude protein contents; c. Molecular marker-assisted breeding of alfalfa; d. Alfalfa breeding; e. Prepare products for alfalfa breeding.

7. A method for screening alfalfa materials with different crude protein contents or predicting the crude protein content of alfalfa, characterized in that: The procedure includes the following steps: extracting genomic DNA from the alfalfa material to be tested, amplifying molecular markers using primers described in SEQ ID No. 3~5, sequencing the amplified products, and screening by typing.

8. The method according to claim 7, characterized in that: The amplification program is as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by -0.8℃ in each cycle; 94℃ for 20 sec, 57℃ for 60 sec, 10 cycles.

9. The method according to claim 7, characterized in that: The criteria for genotyping and screening are as follows: if the genotyping result is CC, it is a material with low crude protein content; if the genotyping result is AA or AC, it is a material with high crude protein content.

Images