Specific snp markers for discriminating nicotiana tabacum from nicotiana rustica and use thereof
By developing the specific SNP marker NOsnp001 and using PCR amplification and electrophoresis detection, the gap in the identification of aromatic tobacco types was solved, realizing rapid, accurate, and simple identification of aromatic tobacco types within the Tobacco genus, with high specificity and stability.
Patent Information
- Application Number
- CN202610493883.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-15
- Publication Date
- 2026-06-02
AI Technical Summary
Existing technologies lack molecular markers that can specifically identify the types of aromatic tobacco, making it impossible to accurately distinguish aromatic tobacco from other types of tobacco at the molecular level. Furthermore, research on the types of aromatic tobacco has not been reported, resulting in a research gap in planting, processing, and market demand.
A specific SNP marker, NOsnp001, was developed. It was amplified by PCR and detected by electrophoresis. The primer sequence SEQ ID No. 1-3 was used to identify the type of aromatic smoke. The results were analyzed by polyacrylamide gel electrophoresis or capillary electrophoresis.
It enables rapid, accurate, and convenient identification of aromatic tobacco types within the Tobacco genus, with 100% specificity and accuracy. It lowers the operational threshold and the risk of misjudgment, and is suitable for the identification of large-scale tobacco germplasm resources.
Smart Images

Figure CN122128459A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to a specific SNP marker for identifying tobacco aromatic tobacco types and its application. Background Technology
[0002] Tobacco is a leaf-based economic crop. According to the characteristics of tobacco leaf quality, biological traits, and cultivation and processing methods, it can be divided into five types: flue-cured tobacco, cigar tobacco, aromatic tobacco, burley tobacco, and sun-cured tobacco. Each type of tobacco has a large number of cultivated varieties selected according to production and processing needs.
[0003] Aromatic tobacco, also known as Oriental or Turkish tobacco, is a type of tobacco that developed after ordinary tobacco was introduced to the Mediterranean coast and cultivated and processed under the specific ecological conditions of that region. A key characteristic of aromatic tobacco or its varieties is its slender plant structure, with numerous small leaves that are broadly ovate or heart-shaped, and may be petiolate or sessile. The leaves possess an aromatic fragrance, good taste, easy combustion, and strong filling power, making it a primary flavoring ingredient in blended cigarettes and a common addition to pipe tobacco. The aromatic quality of aromatic tobacco is closely related to the ecological conditions of its origin and cultivation methods. The top leaves are considered the best in quality, with lower nicotine content and other chemical components falling between those of flue-cured and sun-cured tobacco. Due to the extremely small scale of its cultivation, processing, and market demand, no molecular-level research on aromatic tobacco varieties has been reported.
[0004] Numerous studies have been reported on the molecular-level differentiation / identification of tobacco resources (varieties). These studies utilize markers such as RFLP, RAPD, SSR, ISSR, DArT, and SNP, or combinations of these markers, to conduct genetic diversity analysis and fingerprinting of specific varieties (resources) within various tobacco types of the *Tobacco* genus. A few studies have also been reported on the rapid identification of varieties in uncured tobacco leaves (non-fresh tobacco samples; processed tobacco samples) using SSR, SCAR, and RAPD markers, provided the sample is known to be tobacco material. Furthermore, patents have been reported on the use of molecular markers to differentiate / identify a limited number of tobacco varieties. However, all of these studies and reports focus on differentiation or identification between varieties (resources) within various tobacco types of the *Tobacco* genus; that is, different varieties within the same tobacco type are differentiated, rather than specifically distinguishing between different tobacco types within the *Tobacco* genus. Specifically, the existing technologies have the following shortcomings: (1) Lack of type-specific identification markers: Existing molecular marker technologies mainly address the problem of "variety identification," that is, distinguishing different varieties within the same type (such as flue-cured tobacco variety A and flue-cured tobacco variety B), but cannot solve the problem of "type identification," that is, determining which type of tobacco an unknown tobacco sample belongs to (flue-cured tobacco, cigar tobacco, aromatic tobacco, burley tobacco, or sun-cured tobacco). (2) Blank in molecular research on aromatic tobacco types: Due to the small planting area, processing and production, and market demand of aromatic tobacco, there are no reports on molecular-level research on aromatic tobacco types, and there is a lack of molecular markers that can be used to specifically identify aromatic tobacco types. (3) Existing markers cannot meet the needs of type identification: Existing molecular markers are developed based on the polymorphism between specific varieties, and their allelic variations are cross-distributed among different tobacco types, making it impossible to clearly distinguish a tobacco type from other types. To date, there are no reports at home and abroad on molecular-level identification and detection studies between aromatic tobacco types and non-aromatic tobacco types (flue-cured tobacco, cigar tobacco, burley tobacco, and sun-cured tobacco) within the tobacco genus.
[0005] Therefore, developing a molecular marker that can specifically identify the types of aromatic tobacco, enabling rapid, accurate, and convenient identification of aromatic tobacco types within the Tobacco genus, has significant theoretical and practical value for the identification of aromatic tobacco germplasm resources, the detection of variety authenticity, the differentiation of tobacco types, and the quality control of blended cigarette raw materials. Summary of the Invention
[0006] To address the shortcomings of existing technologies and practical needs, this invention provides a specific SNP marker for identifying aromatic tobacco types within the Tobacco genus and its application, enabling simple, rapid, and stable identification of aromatic tobacco types within the Tobacco genus.
[0007] To achieve this objective, the present invention adopts the following technical solution: In a first aspect, the present invention provides a specific SNP marker for identifying aromatic tobacco types within the tobacco genus, wherein the nucleotide sequence of the PCR amplification product of the specific SNP marker includes the sequence shown in SEQ ID No. 1.
[0008] This invention is the first to screen and obtain the SNP marker NOsnp001, which can specifically identify the type of aromatic tobacco, filling the gap in molecular identification technology for aromatic tobacco types within the Tobacco genus.
[0009] Preferably, the primer nucleotide sequences used to amplify the specific SNP marker include sequences as shown in SEQ ID No. 2-SEQ ID No. 3.
[0010] The sequence SEQ ID No. 1 of the SNP marker NOsnp001: CTATTATTAATTGTACACGTAATACTTAACCAATATTTGACTGTAGATGTAGTGGAACCATTAATAGGCAGAAGCCTATCTTAAAGAATTAAGGTGATGGACCACACAAATGGGATTCATTGATCAATAGACTGATAACTACGTTAGGAGGTGTTATTTGACATTCCTACATAGGCCTTCTCAGTCTGGTGAGGATCTTAGGCTAACAACTTTATTTATAAATTGCTAAAGACATAGTTTCT.
[0011] SEQ ID No. 2: CTATTATTAATTGTACACGTAATACTT.
[0012] SEQ ID No. 3: AGAAACTATGTCTTTAGCAATTTAT.
[0013] Secondly, the present invention provides the application of the specific SNP markers described in the first aspect for identifying tobacco genus aromatic tobacco types in tobacco variety identification.
[0014] Thirdly, the present invention provides a method for identifying tobacco varieties, the method comprising: extracting genomic DNA from a tobacco sample to be tested; using the extracted genomic DNA as a template, performing PCR amplification using the primers described in the first aspect; detecting the PCR amplification product; determining the type of the tobacco sample to be tested based on the detection results; if the PCR amplification product contains the sequence shown in SEQ ID NO.1 (PCR amplification product size is 243 bp), it indicates that the tobacco sample to be tested is an aromatic tobacco variety; if no PCR amplification product is generated, it indicates that the tobacco sample to be tested is a non-aromatic tobacco variety.
[0015] Preferably, the annealing temperature for the PCR amplification is 56℃-58℃, for example, 56℃, 57℃ or 58℃.
[0016] Preferably, the detection includes polyacrylamide gel electrophoresis or capillary electrophoresis.
[0017] Preferably, the non-spice tobacco type includes any one or a combination of at least two of flue-cured tobacco, cigar tobacco, burley tobacco, and sun-cured tobacco.
[0018] Fourthly, the present invention provides a kit for identifying tobacco aromatic tobacco types, the kit comprising the primers described in the first aspect.
[0019] Preferably, the kit further includes dNTPs, Taq DNA polymerase, PCR buffer, and Mg. 2+ Solution.
[0020] Fifthly, the present invention provides the application of the specific SNP markers for identifying tobacco aromatic tobacco types as described in the first aspect or the kits described in the fourth aspect in tobacco breeding.
[0021] Compared with the prior art, the present invention has the following beneficial effects: (1) Existing molecular marker technologies are all aimed at differentiating different varieties within the genus Tobacco, but cannot achieve specific identification of different tobacco types (flue-cured tobacco, cigar tobacco, aromatic tobacco, burley tobacco, sun-cured tobacco) within the genus Tobacco. This invention is the first to screen and obtain the SNP marker NOsnp001 that can specifically identify aromatic tobacco types, filling the gap in molecular identification technology for aromatic tobacco types within the genus Tobacco. (2) Unlike conventional molecular markers that require the difference in the size of amplified products to distinguish different varieties (requiring comparison of multiple standards), the SNP marker NOsnp001 of this invention adopts a "present / absent" judgment method: the presence of the 243 bp amplified product shown in SEQ ID NO.1 indicates the aromatic tobacco type, while the absence of the amplified product indicates the non-aromatic tobacco type (including flue-cured tobacco, cigar tobacco, burley tobacco and sun-cured tobacco). This judgment method is simpler and more intuitive, without the need for complex comparison and result interpretation, which greatly reduces the operational threshold and the risk of misjudgment. (3) The present invention was verified by 156 germplasm resources covering all 5 types of tobacco (including 36 flue-cured tobacco, 30 cigar tobacco, 30 aromatic tobacco, 30 burley tobacco and 30 sun-cured tobacco). The marker amplified the target band of 243 bp only in 30 aromatic tobacco varieties, and no amplification products were found in the remaining 126 non-aromatic tobacco varieties, showing 100% specificity and accuracy. (4) Based on whole-genome resequencing data of 2101 large-scale tobacco germplasm resources, this invention uses a self-developed AI algorithm software (pick_snps_for_A.py) to screen specific SNP sites. The screening strategy is scientific and rigorous, and the data foundation is solid and reliable, ensuring the stability and representativeness of the markers. Attached Figure Description
[0022] Figure 1 PAGE plot of the type-specific SNP marker NOsnp001 for aromatic tobacco in 156 tobacco resources, where lanes 1-36 represent 36 flue-cured tobacco varieties / resources; lanes 37-66 represent 30 cigar tobacco varieties / resources; lanes 67-96 represent 30 aromatic tobacco varieties / resources; lanes 97-126 represent 30 burley tobacco varieties / resources; and lanes 127-156 represent 30 sun-cured tobacco varieties / resources. Note: Each PAGE gel has 48 lanes (48 samples). The rightmost lane of the PAGE gel is the 100 bp marker. From bottom to top, these are 200, 300, 400, 500, 600, 700, 800, 900, 1000 and 1500 bp. The sampling order is from left to right. A total of 156 samples were sampled from 4 PAGE gels (48 samples / pAGE gel × 3 gels + 12 samples / 4th PAGE gel). Detailed Implementation
[0023] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.
[0024] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0025] Example 1 This embodiment screens for fragrance smoke type-specific SNP markers.
[0026] I. Experimental Materials The 2101 tobacco germplasm resources and their resequencing data were provided by the Yunnan Academy of Tobacco Agricultural Sciences. The 2101 tobacco germplasm resources include 1320 flue-cured tobacco varieties / resources, 321 sun-cured tobacco varieties / resources, 165 cigar tobacco varieties / resources, 129 aromatic tobacco varieties / resources, and 166 burley tobacco varieties / resources.
[0027] II. Processing of Genome Resequencing Data The raw genome resequencing data of the above 2101 tobacco germplasm resources were filtered and processed according to the standard processing method for raw data to remove adapter contamination and low-quality reads, resulting in high-quality Clean Data for subsequent comparative analysis.
[0028] III. Detection of SNP variant information SNP variant detection was performed on the 2101 resource datasets processed above using the GATK (GATK 4.2.0) workflow. First, the "HaplotyperCaller" tool was used to detect individual SNP variants in the alignment results files after quality control processing, obtaining a gVCF file for each chromosome in each sample (specific parameters: gatk HaplotyperCaller --sample-ploidy 2 –emit-ref-confidence GVCF –min-base-quality-score 20). Second, the "GeomicsDBImport" tool was used to merge the gVCF files of all samples (merging parameters: gatkGenomicsDBImport --batch-size 120 –reader-threads 40 --genomicsdb-workspace-path chr01 --intervals). Finally, the "GenotypeGVCFs" tool was used to integrate the variant information for each chromosome of all individuals in the resource population, generating a vcf format file of the population variant (including SNP and Indel variants) results.
[0029] IV. SNP Locus Statistics and Preliminary Quality Control First, the "Select Variants" and "Variant Filtration" functions in the GATK workflow were used to extract and filter SNP variants, obtaining highly reliable population variant information. Second, based on the requirements of allotetraploid tobacco mating types, PLINK2 was used to filter population SNP variants, selecting high-quality variants that met the requirements. Then, PLINK2 was used to filter samples with a genotype deletion rate greater than 0.2, resulting in the rejection of 59 samples and leaving 2042 samples. Finally, quality control was performed based on a minimum allele frequency (MAF) greater than 0.01 and an SNP deletion rate less than 0.2, yielding a total of 5,810,283 SNP loci from the 2042 samples (the number of variant loci before quality control was 59,922,554). Statistical analysis of the SNP distribution on each chromosome revealed that chromosome 4 had the most SNPs, totaling 1,431,101; followed by chromosome 23 with 518,263 SNPs; chromosome 3 had 411,986 SNPs; and the remaining chromosomes had fewer SNPs, all below 210,000.
[0030] V. Screening of SNP sites specific to the type of aromatic smoke 1. Screening of homogeneous SNP sites within aromatic tobacco types Using the SNP locus information obtained after quality control of the resequencing data of the above 2042 tobacco germplasm resources, we screened for SNP loci specific to aromatic tobacco types. The specific method is as follows: Within the aromatic tobacco category, all samples (varieties / resources) were screened for sites where the genotypes were completely identical at the same SNP locus. Specifically, to screen for aromatic tobacco type-specific SNP loci, firstly, identical SNP loci were identified in all 129 aromatic tobacco varieties / resources. Secondly, resequencing data from the remaining 1913 non-aromatic tobacco resource materials (2042-129) were compared to the identical SNP loci identified in the 129 aromatic tobacco varieties / resources. This further allowed for the identification of SNP loci present in the aromatic tobacco resource materials but absent in the remaining 1913 non-aromatic tobacco resource materials (i.e., ensuring that all 129 aromatic tobacco resource materials possess the same SNP locus while the remaining 1913 non-aromatic tobacco resource materials do not). To ensure the stability and interpretability of the screened loci, this invention only considers homozygous reference genotypes (0 / 0) and homozygous non-reference genotypes (1 / 1), excluding heterozygous genotypes (0 / 1 or 1 / 0) from the analysis. For example, when the genotype of the 363rd base site on Chr21 is 0 / 0 or 1 / 1 in all 129 aromatic tobacco type samples, the site is defined as a consistent SNP site for aromatic tobacco type and is retained.
[0031] After the above screening process, a VCF subset file of consistent SNPs within the same aromatic tobacco type was finally obtained, which contains 5096 consistent SNP sites of aromatic tobacco type, as the basis data for subsequent screening of aromatic tobacco type-specific SNPs.
[0032] 2. Redundancy removal processing for samples within the aromatic smoke type Since the SNP loci obtained from the above screening are genotypes completely identical in the corresponding 129 aromatic tobacco type samples (variety / resource), to avoid sample redundancy affecting subsequent comparative analysis, it is necessary to perform sample deduplication on the VCF subset of identical SNPs within the aromatic tobacco type. Specifically, in the subset of identical SNPs for aromatic tobacco types, 5096 SNP loci are genotypes completely identical in the 129 aromatic tobacco samples, and only one sample is retained as a representative of the aromatic tobacco type.
[0033] 3. Screening of SNP sites specific to aromatic tobacco types After completing the screening of consistent sites within the aromatic tobacco type and the sample redundancy removal process, the AI algorithm-based software (pick_snps_for_A.py) developed in this invention was further run on the obtained VCF data. This software can systematically compare all SNP sites in all 2042 tobacco samples (variety / resource), thereby screening out aromatic tobacco type-specific SNP sites.
[0034] The pick_snps_for_A.py program is described in detail below: (1) Method name: A greedy algorithm for identifying the minimum SNP combination to distinguish target samples.
[0035] (2) Overview of the method's functions: This method is used to screen a set of minimal SNP loci combinations for a specified target sample (Sample A) in population genotyping data, ensuring that its genotyping pattern is distinguishable from all other samples. This method can identify a single SNP that uniquely distinguishes a sample, or it can achieve distinction through combinations of multiple SNPs when no single SNP exists.
[0036] (3) Input file: a. gt.tsv A genotype matrix file exported from a VCF file, generated using bcftools query, has the following format: ; Genotypes are in VCF standard format (e.g., 0 / 0, 0 / 1, 1 / 1, 0|1), and missing genotypes are represented by ., . / ., or .|. No header is required.
[0037] b. samples.list The sample name list file contains one sample name per line, and the order must match the order of the sample columns in gt.tsv.
[0038] c. Target sample name (SampleA) Specify the target samples that need to be distinguished. In this invention, the target samples are the representative samples of the fragrance smoke types retained after redundancy removal in each VCF subset.
[0039] (4) Operating mode: ; Parameter description: gt.tsv: Genotype matrix file; samples.list: Sample list; SampleA: Target sample; 100 (optional): Maximum number of SNPs to select (default 100).
[0040] (5) Output results (example): # Greedy SNP panel to distinguish A from all others # A = C1593 # panel_size = 3 # unresolved_samples = 0 # SNP_panel_for_A (CHROM POS REF ALT): chr2 127086134 CT chr14 40123703 CT chr11 28771852 AT This result indicates that the three SNPs output are the smallest combination that distinguishes sample C1593 from all other samples.
[0041] When no SNP combination exists that can completely and specifically distinguish the target sample (Sample A), the program will further filter and output the SNP combination that can best differentiate the target sample from other samples. Simultaneously, the program will explicitly list the names of samples that still cannot be distinguished from Sample A under this combination condition, as shown below: # Greedy SNP panel to distunguish A from all others # A = C1154 # panel_size = 8 # unresolved_samples = 3 # SNP_panel_for_A (CHROM POS REF ALT): chr20 100753228 TG chr24 118262985 TC chr2 140985572 GA chr1 127865724 CT chr6 109728181 CT chr4 69907409 TC chr10 21107328 GT chr24 110031763 GC # WARNING: could not fully distinguish A using current candidates. # unresolved_sample_names: # C1702 # C1890 # C1971 4. Sequence extraction flanking the type-specific SNP marker sites in aromatic tobacco For the aromatic tobacco type-specific SNP sites obtained in the final screening, 300 bp sequences upstream and downstream of the site were extracted from the NtaSR1 reference genome to form a 601 bp sequence fragment containing the SNP site, which was used for the design of aromatic tobacco type-specific SNP primers.
[0042] VI. Experimental Verification of Type-Specific SNP Markers in Aromatic Tobacco 1. Materials A total of 156 tobacco materials were used for the validation of type-specific SNP markers in aromatic tobacco, including 36 flue-cured tobacco materials (numbered 1-36), 30 cigar tobacco materials (numbered 37-66), 30 aromatic tobacco materials (numbered 67-96), 30 burley tobacco materials (numbered 97-126), and 30 sun-cured tobacco materials (numbered 127-156). Detailed information is shown in Table 1.
[0043] Table 1 2. SNP marker analysis Tobacco genomic DNA extraction: The plant tissue DNA extraction kit (TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0; Takara Bio Engineering (Dalian) Co., Ltd.) was used, and the method was in accordance with the instructions in the kit.
[0044] PCR amplification and electrophoresis detection: The PCR amplification system was based on the published literature (Tong Zhijun, Jiao Fangchan, Xiao Bingguang. SSR locus analysis of common tobacco and its ancestral species genome. Chinese Journal of Agricultural Science, 2015, 48(11): 2108-2117.); In the PCR amplification program, the annealing temperature of the primers (SEQ ID NO.2-SEQ ID NO.3) was 57℃, and the PCR amplification program was based on the literature (Tong Zhijun, Jiao Fangchan, Xiao Bingguang. SSR locus analysis of common tobacco and its ancestral species genome. Chinese Journal of Agricultural Science, 2015, 48(11): 2108-2117.); Electrophoresis detection was based on the literature (Sanguinetti CJ, Dias NE, Simpson AJ. Rapid silver staining and recovery of PCR products separated on polyacrylamide gels). Biotechniques , 1994, 17: 915-919.).
[0045] 3. Detection of aromatic tobacco types using type-specific SNP markers in 156 tobacco samples. Using the primer sequences (SEQ ID NO.2-SEQ ID NO.3) of the aromatic tobacco type-specific SNP marker NOsnp001 of the present invention, genomic DNA of 156 tested tobacco materials was amplified by PCR, and the size and presence of the PCR amplification products of the above tobacco materials were analyzed. If the PCR amplification product contained the sequence shown in SEQ ID NO.1 (the size of the PCR amplification product was 243 bp), it indicated that the tested tobacco was an aromatic tobacco type; if no PCR amplification product was generated, it indicated that the tested tobacco was a non-aromatic tobacco type.
[0046] Because the 156 tobacco samples tested included all five tobacco types—flue-cured, cigar, aromatic, burley, and sun-cured—only 30 aromatic tobacco samples were detected by PCR amplification using the aromatic tobacco type-specific SNP marker NOsnp001. Figure 1The PCR amplification products (lanes 67-96) obtained the sequence shown in SEQ ID NO.1 (PCR amplification product size is 243bp), as shown in SEQ ID NO.1. Figure 1 As shown; while the remaining 126 samples of other types of tobacco varieties ( Figure 1 Lanes 1-66 and 97-156 in the sampled swim swabs showed no PCR amplification products. No products were observed during PCR amplification. Figure 1 As shown.
[0047] Analysis of the PCR amplification products of 156 different types of tobacco materials by the above-mentioned aromatic tobacco type-specific SNP marker NOsnp001 shows that the aromatic tobacco type-specific SNP marker provided by the present invention has the specificity to distinguish aromatic tobacco types within the Tobacco genus. It can not only scientifically and accurately realize the identification and detection of aromatic tobacco types within the Tobacco genus and other tobacco types, but also has the characteristics of stability, reliability, simplicity, speed and low cost.
[0048] In summary, the specific SNP marker for identifying aromatic tobacco types within the Tobacco genus described in this invention is stable, reliable, simple, and low-cost. This molecular marker can effectively identify and detect the presence of aromatic tobacco types within the Tobacco genus.
[0049] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.
Claims
1. A specific SNP marker for identifying aromatic tobacco types within the tobacco genus, characterized in that, The nucleotide sequence of the PCR amplification product of the specific SNP marker includes the sequence shown in SEQ ID No.
1.
2. The specific SNP marker according to claim 1, characterized in that, The primer nucleotide sequences used to amplify the specific SNP marker include those shown in SEQ ID No. 2-SEQ ID No.
3.
3. The application of the specific SNP markers for identifying the type of aromatic tobacco in tobacco as described in claim 1 or 2 in tobacco variety identification.
4. A method for identifying tobacco varieties, characterized in that, The method for identifying tobacco varieties includes: extracting genomic DNA from the tobacco sample to be tested; using the extracted genomic DNA as a template, performing PCR amplification using the primers described in claim 2; detecting the PCR amplification product; determining the type of the tobacco sample to be tested based on the detection results; if the PCR amplification product contains the sequence shown in SEQ ID NO.1, it indicates that the tobacco sample to be tested is an aromatic tobacco variety; if no PCR amplification product is generated, it indicates that the tobacco sample to be tested is a non-aromatic tobacco variety.
5. The method for identifying tobacco varieties according to claim 4, characterized in that, The annealing temperature for the PCR amplification was 56℃-58℃.
6. The method for identifying tobacco varieties according to claim 4 or 5, characterized in that, The detection includes polyacrylamide gel electrophoresis or capillary electrophoresis.
7. The method for identifying tobacco varieties according to any one of claims 4-6, characterized in that, The non-spice tobacco types include any one or a combination of at least two of the following: flue-cured tobacco, cigar tobacco, burley tobacco, and sun-cured tobacco.
8. A reagent kit for identifying aromatic tobacco types within the tobacco genus, characterized in that, The kit includes the primers described in claim 2.
9. The reagent kit according to claim 8, characterized in that, The kit also includes dNTPs, Taq DNA polymerase, PCR buffer, and Mg. 2+ Solution.
10. The application of the specific SNP marker for identifying aromatic tobacco types within the genus Tobacco as described in claim 1 or 2, or the kit as described in claim 8 or 9, in tobacco breeding.