A primer probe combination, a detection method and a kit for detecting human polyomavirus

Abstract

This invention discloses a primer-probe combination, detection method, and kit for detecting human polyomaviruses, belonging to the field of molecular biology. The primer-probe combination includes primers with sequences as shown in SEQ ID NO. 1-28 and probes with sequences as shown in SEQ ID NO. 29-31. The detection method and kit constructed using this combination can simultaneously detect 14 human polyomaviruses (BKPyV, JCPyV, KIPyV, WUPyV, MCPyV, HPyV6, HPyV7, TSPyV, HPyV9, MWPyV, STLPyV, HPyV12, NJPyV, and LIPyV) in the same reaction tube. The human polyomavirus detection scheme provided by this invention has advantages such as wide coverage, high specificity, high sensitivity, and strong robustness, and is of great significance for the safety and quality control of biological products, especially cell products.

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology, specifically to a TaqMan probe-based real-time PCR primer and probe combination, kit, and detection method that can simultaneously detect 14 human polyomaviruses in the same reaction tube. Background Technology

[0002] Polyomaviruses are a class of small, non-enveloped, double-stranded DNA viruses. To date, 14 human polyomaviruses (HPyVs) have been identified: BKPyV, JCPyV, KIPyV, WUPyV, MCPyV, HPyV6, HPyV7, TSPyV, HPyV9, MWPyV, STLPyV, HPyV12, NJPyV, and LIPyV. HPyV infection is closely associated with a variety of diseases, such as polyomavirus-associated nephropathy (PyVAN), polyomavirus-associated hemorrhagic cystitis (PyVHC), polyomavirus-associated urothelial carcinoma (PyVUC), progressive multifocal leukoencephalopathy (PML), Merkel cell carcinoma (MCC), keratosis pilaris (TS), and pruritic hyperplastic keratosis, seriously threatening human health.

[0003] The 2025 edition of the Chinese Pharmacopoeia, Volume III, "Preparation and Quality Control of Animal Cell Matrix for the Production and Testing of Biological Products," stipulates the need for detection of human polyomaviruses (HPyVs) in human cell lines / strains or biological products that may be contaminated with human viruses during the production process. Real-time quantitative PCR (TaqMan probe method) has advantages such as high specificity, high sensitivity, simplicity, and speed, and is widely used for virus detection. This invention, based on TaqMan probe quantitative PCR technology, establishes a qPCR detection system and method capable of simultaneously detecting 14 HPyVs in the same reaction tube, which is of great significance for the safety and quality control of biological products. Summary of the Invention

[0004] To achieve the detection objective, the present invention specifically employs the following technologies and solutions: In a first aspect, the present invention provides a primer-probe combination for detecting human polyomaviruses, wherein the human polyomaviruses include BKPyV, JCPyV, KIPyV, WUPyV, MCPyV, HPyV6, HPyV7, TSPyV, HPyV9, MWPyV, STLPyV, HPyV12, NJPyV, and LIPyV. The primer-probe combination includes primers with sequences as shown in SEQ ID NO. 1-28 and probes with sequences as shown in SEQ ID NO. 29-31. Specifically, the primers and probes are as follows: The upstream and downstream primers used for detecting BKPyV are BKPyV FP and BKPyVRP with sequences as shown in SEQ ID NO.1-2; The upstream and downstream primers used for detecting JCPyV are JCPyV FP and JCPyVRP, with sequences shown in SEQ ID NO.3-4; The upstream and downstream primers used for detecting KIPyV are KIPyV FP and KIPyVRP with sequences as shown in SEQ ID NO.5-6; The upstream and downstream primers used for detecting WUPyV are WUPyV FP and WUPyVRP with sequences as shown in SEQ ID NO.7-8; The upstream and downstream primers used for detecting MCPyV are MCPyV FP and MCPyVRP, with sequences shown in SEQ ID NO. 9-10. The upstream and downstream primers used for detecting HPyV6 are HPyV6 FP and HPyV6RP, with sequences shown in SEQ ID NO.11-12; The upstream and downstream primers used for detecting HPyV7 are HPyV7 FP and HPyV7 RP, with sequences shown in SEQ ID NO.13-14; The upstream and downstream primers used for detecting TSPyV are TSPyV FP and TSPyVRP, with sequences shown in SEQ ID NO.15-16; The upstream and downstream primers used for detecting HPyV9 are HPyV9 FP and HPyV9RP, with sequences shown in SEQ ID NO.17-18; The upstream and downstream primers used for detecting MWPyV are MWPyV FP and MWPyVRP, with sequences shown in SEQ ID NO.19-20. The upstream and downstream primers used for detecting STLPyV are STLPyV FP and STLPyV RP, with sequences shown in SEQ ID NO.21-22; The upstream and downstream primers used for detecting HPyV12 are HPyV12 FP and HPyV12 RP, with sequences shown in SEQ ID NO.23-24. The upstream and downstream primers used for detecting NJPyV are NJPyV FP and NJPyVRP with sequences shown in SEQ ID NO.25-26; The upstream and downstream primers used for detecting LIPyV are LIPyV FP and LIPyVRP with sequences shown in SEQ ID NO.27-28; And the sequences Probe1, Probe1 and Probe3 as shown in SEQ ID NO.29-31 respectively.

[0005] For the probes Probe1, Probe2, and Probe3 described above, their 5' and 3' ends are respectively connected to a fluorescent group and a quenching group. The fluorescent group can be selected from commonly used fluorescent groups in the art, such as FAM, HEX, TET, ROX, TAMRA, Cy3, Cy5, and FITC. The quenching group can be selected from commonly used quenching groups in the art, such as BHQ1, BHQ2, BHQ3, MGB, and Eclipse. In some embodiments of the present invention, FAM is connected to the 5' end of Probe1, Probe2, and Probe3, and MGB or BHQ1 is connected to the 3' end of Probe1, Probe2, and Probe3 as a quenching group.

[0006] Secondly, the present invention provides a kit for simultaneous detection of 14 HPyVs, the kit comprising at least primers with sequences as shown in SEQ ID NO.1-28 and probes with sequences as shown in SEQ ID NO.29-31.

[0007] Preferably, the above kit also includes an internal control plasmid and an internal control probe to monitor the presence of inhibitory factors during sample extraction and qPCR reaction. The internal control plasmid contains a synthetically produced target fragment, which is an exogenous sequence that neither affects target detection nor hinders internal control. The term "inhibitor" refers to components in the sample that may interfere with reverse transcription or affect PCR amplification efficiency. The presence of inhibitors can lead to data distortion.

[0008] In some embodiments of the present invention, the sequence of the target fragment in the internal control plasmid is shown in SEQ ID NO. 32, and the sequence of the internal control probe designed for the internal control plasmid is shown in SEQ ID NO. 32. More preferably, the internal control plasmid is a pUC57 recombinant plasmid containing the above-mentioned target fragment.

[0009] Preferably, the above kit may also include BKPyV plasmid standards for sensitivity control, BKPyV pseudoviruses for positive control, and other reagents and / or consumables for qPCR.

[0010] Thirdly, the present invention provides the application of the above-mentioned primer-probe combination or kit in the detection of human polyomavirus.

[0011] Preferably, the above application is used to detect whether a biological product is contaminated with human polyomavirus, wherein the biological product includes cell samples, etc.

[0012] Preferably, the above application includes the following operations: preparing a reaction system containing primers and probes for detecting 14 HPyVs, internal control plasmids, internal control probes, and DNA of the sample to be tested, performing a qPCR reaction, and determining whether the sample to be tested contains human polyomavirus based on the Ct value.

[0013] More preferably, in the above reaction system, BKPyV FP, BKPyV RP, JCPyV FP, JCPyV RP, KIPyV FP, KIPyV RP, WUPyV FP, WUPyV RP, MCPyV FP, MCPyV RP, HPyV6 FP, HPyV6 RP, HPyV7 FP, HPyV7 RP, TSPyV FP, TSPyV RP, HPyV9 FP, HPyV9 RP, MWPyV FP, MWPyV RP, STLPyV FP, STLPyV RP, HPyV12 FP, HPyV12 RP, NJPyV FP, NJPyV RP, LIPyV FP, LIPyV The molar ratio of RP, Probe1, Probe1 and Probe3 is 1:1:1:1:2:2:1:1:2:2:1:1:2:2:1:1:2:2:1:1:1:1:1:1:1:1:1:1:1:6:0.8:0.8.

[0014] More preferably, in the above qPCR reaction, the reaction program is 95℃ for 5 min; 95℃ for 10 s, 55℃ for 20 s, 72℃ for 20 s, 45 cycles.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: It has a wide coverage and can simultaneously detect 14 HPyVs in a single reaction system.

[0016] It has high specificity and no cross-reaction with common engineered cell genomes such as 293, CHO-K1, and Vero, nor with common human viruses such as EBV, HCMV, and B19.

[0017] It has high sensitivity, with a detection limit of 5 copies / μL for each HPyV.

[0018] It is highly durable, and the introduction of common engineered cell genomes such as 293, CHO-K1, and Vero does not affect the detection of any HPyV. Attached Figure Description

[0019] To more clearly illustrate the technical solution of the present invention, the accompanying drawings used in the present invention will be briefly described below. Obviously, the drawings described below are merely some embodiments of the present invention, and those skilled in the art can obtain other drawings based on these drawings without any creative effort.

[0020] Figure 1 The standard curves and linear analysis results for Example 2 are obtained by using 14 HPyVs (BKPyV, JCPyV, KIPyV, WUPyV, MCPyV, HPyV6, HPyV7, TSPyV, HPyV9, MWPyV, STLPyV, HPyV12, NJPyV, LIPyV) plasmid standards as detection templates.

[0021] Figure 2 The results show the specificity analysis of the HPyVs qPCR detection method in Example 2.

[0022] Figures 3-4 The results show the robustness analysis of the HPyVs qPCR detection method in Example 2. Detailed Implementation

[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains; the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the invention; the terms “comprising” and “having”, and any variations thereof, in the specification and claims of this invention are intended to cover non-exclusive inclusion.

[0024] To address the technical challenge of detecting human polyomavirus contamination in the production of biopharmaceuticals (especially human cell-derived products), this invention, based on the TaqMan probe method, develops a primer-probe combination, kit, and detection method capable of simultaneously detecting all human polyomaviruses in the same reaction tube. Prior to this invention, there was no method that could simultaneously detect 14 human polyomaviruses in the same tube and be applicable to quality control of biopharmaceuticals containing cell matrices.

[0025] The primer-probe combination for detecting human polyomavirus provided in this embodiment of the invention includes qPCR primers and probes designed from BKPyV, JCPyV, KIPyV, WUPyV, MCPyV, HPyV6, HPyV7, TSPyV, HPyV9, MWPyV, STLPyV, HPyV12, NJPyV, and LIPyV. The qPCR primers include primers with sequences as shown in SEQ ID NO. 1-28, and the probes include Probe1-3 with sequences as shown in SEQ ID NO. 29-31.

[0026] The present invention also provides a kit for detecting human polyomavirus, the kit comprising at least: qPCR primers with sequences as shown in SEQ ID NO. 1-28, probes with sequences as shown in SEQ ID NO. 29-31, an internal control plasmid containing a target fragment with a sequence as shown in SEQ ID NO. 32, and an internal control probe with a sequence as shown in SEQ ID NO. 33.

[0027] This invention further provides a method for detecting human polyomavirus in a sample, comprising the following steps: Extract DNA from the sample to be tested (such as a cell sample); A reaction system containing primers and probes for detecting 14 HPyVs, internal control plasmids, internal control probes, and DNA from the sample to be tested was prepared, and a qPCR reaction was performed. The Ct value was used to determine whether the sample to be tested contained human polyomavirus.

[0028] Furthermore, in the reaction system of some embodiments, BKPyV FP, BKPyV RP, JCPyV FP, JCPyV RP, KIPyV FP, KIPyV RP, WUPyV FP, WUPyV RP, MCPyV FP, MCPyV RP, HPyV6 FP, HPyV6 RP, HPyV7 FP, HPyV7 RP, TSPyV FP, TSPyV RP, HPyV9 FP, HPyV9 RP, MWPyV FP, MWPyV RP, STLPyV FP, STLPyV RP, HPyV12 FP, HPyV12 RP, NJPyV FP, NJPyV RP, LIPyV FP, LIPyV The molar ratio of RP, Probe1, Probe1 and Probe3 is 1:1:1:1:2:2:1:1:2:2:1:1:2:2:1:1:2:2:1:1:1:1:1:1:1:1:1:1:1:6:0.8:0.8.

[0029] For multiplex detection systems, the more primers used, the greater the interference between them. However, the primer-probe combination provided by this invention can still meet the biopharmaceutical quality control sensitivity of 100 copies / reaction (i.e., 5 copies / µL). Moreover, this primer-probe combination does not cross-react with the cell genome in samples containing cell matrix. At the same time, the detection of each human polyomavirus in the system is not affected by cell matrix interference.

[0030] The following are some specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, they shall be performed in accordance with the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products that can be obtained commercially.

[0031] Example 1 This example provides a TaqMan probe-based real-time PCR primer-probe combination capable of simultaneously detecting 14 human polyomaviruses in the same reaction tube, and a human polyomavirus detection kit based on this primer-probe combination is prepared. Details are as follows: (1) HPyVs primers and probes.

[0032] The primer-probe combination capable of simultaneously and specifically detecting 14 HPyVs in the same reaction tube includes the primers and probes shown in Table 1. In this example, the primers were custom-made by Tianyi Huayu (PAGE purified), and the probes were custom-made by Sangon Biotech (HPLC purified).

[0033] Table 1. Primer and probe sequences for HPyVs qPCR

[0034] Note: Degenerate bases Y = C / T; N = A / G / T / C; H = A / T / C.

[0035] (2) Internal control plasmids and their probes.

[0036] The target fragment of the internal control plasmid, as shown in SEQ ID NO.32, was artificially synthesized. This target fragment was inserted into the basic plasmid pUC57 to construct the recombinant plasmid pUC57-IC, which is the internal control plasmid. An internal control probe IC Probe, as shown in SEQ ID NO.33, was designed and synthesized targeting the target fragment of the internal control plasmid. The resulting recombinant plasmid pUC57-IC and internal control probe IC Probe were used as quality control reagents in the preparation of a human polyomavirus detection kit. Specifically, the sequences of the target fragment of the internal control plasmid and the internal control probe IC Probe are as follows: CAAATCCTTTGATTCAGCCCCTCTATGCCTGCCTAGCTTAACACCAACTTGCCTAGGTGCTAGAGCTACACCTAGTTCAAAGGTT (SEQ ID NO. 32); HEX-CCTGCCTAGCTTAACACC-MGB (SEQ ID NO. 33).

[0037] (3) HPyVs kit.

[0038] In addition to the primers and probes provided in Part (1) and the internal control plasmids and internal control probes provided in Part (2), the kit may also contain other reagents and consumables for qPCR amplification / detection.

[0039] Example 2 Based on the HPyVs primers and probes, as well as the internal control plasmid and internal control probe provided in Example 1, this example establishes a method for the simultaneous detection of 14 human polyomaviruses, and systematically investigates this method as follows: (1) Establishment of qPCR reaction system and procedure.

[0040] After optimization by the inventors, the reaction systems and procedures in Tables 2 and 3 yielded the best results for HPyVs qPCR detection. The FAM channel is used to detect HPyVs, while the HEX channel is used for internal control to monitor the presence of inhibitory factors in the sample.

[0041] Table 2 HPyVs-qPCR detection reaction system

[0042] Table 3 HPyVs qPCR reaction procedure

[0043] (2) Linearity and sensitivity of HPyVs qPCR detection method.

[0044] The genome sequences of 14 human polyomaviruses (BKPyV, JCPyV, KIPyV, WUPyV, MCPyV, HPyV6, HPyV7, TSPyV, HPyV9, MWPyV, STLPyV, HPyV12, NJPyV, and LIPyV) were artificially synthesized, and recombinant plasmids (based on plasmid pUC57) were constructed to prepare standards. Standard curves were established through the following steps: For the 14 artificially constructed HPyVs standard plasmids and the internal control plasmid pUC57-IC, plasmid extraction was performed using the Plasmid Mini Kit I, and plasmid concentrations and copy numbers were measured. HPyVs plasmid standard solutions were diluted to 2 × 10⁻⁶. 6 copies / μL-2×10 2 Copies / μL were used as the points of the standard curve, 2×10 1 A plasmid standard solution of copies / μLHPyVs was used as a sensitivity control, and 500 copies of pUC57-IC plasmid were added to each reaction as an internal control of the reaction system.

[0045] qPCR was performed using the amplification systems and procedures shown in Tables 2 and 3. Three independent replicate experiments were conducted on different 3-day periods, with 8 wells used as a plasmid sensitivity control for each experiment.

[0046] Test results as follows Figure 1 As shown in Table 4: The qPCR detection system in this protocol used 14 HPyVs plasmid standards as templates, and their standard curve correlation coefficients R0 were obtained. 2 >0.99, with a sensitivity of 5 copies / μL.

[0047] Table 4. Detection results of HPyVs plasmid standards

[0048] (3) Specificity of HPyVs qPCR detection method.

[0049] ① Human and animal cell genomic DNA.

[0050] Genomic DNA was extracted from African green monkey kidney cells (Vero), Chinese hamster ovary cells (CHO-K1), and human embryonic kidney cells (293) using the QIAamp Mini kit (50) (QIAGEN, 51304).

[0051] ②Viral genomic DNA.

[0052] Genomic DNA was extracted from human herpesvirus EBV, human cytomegalovirus HCMV, and human parvovirus B19 using the ViralNucleic Acid purification kit (simgen, 4002050).

[0053] After nucleic acid extraction, working concentration genomic DNA was prepared: the concentration of the extracted cellular genomic DNA was measured using a micro-spectrophotometer. Based on the measured concentration, human and animal cell genomic DNA was diluted to 20 ng / μL with RNase-free water. Human herpesvirus EBV, human cytomegalovirus HCMV, and human parvovirus B19 were diluted to a physical titer of 10. 8 DNA was extracted from viral fluid at a concentration of copies / mL, and 5 μL was used as a template for qPCR.

[0054] 100 copies / reaction of pUC57-BKPyV plasmid standard were used as a qPCR sensitivity control. The reaction system and procedure were the same as those in Tables 2 and 3.

[0055] Test results as follows Figure 2As shown, the HPyVs qPCR detection system showed no cross-reactivity with common engineered cell genomes, human herpesvirus EBV, human cytomegalovirus HCMV, and human parvovirus B19 genomes. The amplification of non-HPyVs genomic DNA is summarized in Table 5. These results demonstrate the high specificity of this method.

[0056] Table 5. Specificity of HPyVs detection method

[0057] (4) Robustness of the HPyVs qPCR detection method.

[0058] Genomes were extracted from Vero, CHO, and 293 cells, and their concentrations were measured. The genomic DNA was then diluted to 80 ng / μL. A 100 copies / reaction pUC57-HPyV plasmid standard was used as a positive control. 400 ng / reaction Vero / CHO / 293 cell genomes were introduced into a 100 copies / reaction plasmid standard to validate cell matrix robustness. The qPCR reaction system and procedure were the same as those in Tables 2 and 3.

[0059] Test results as follows Figures 3-4 As shown, the introduction of the 293 / CHO / Vero cell genome does not affect the normal detection of HPyVs and internal controls in the qPCR reaction system, indicating that the method has good robustness.

[0060] Example 3 Based on the HPyVs qPCR detection method established in Example 2, this example uses 293 cells (10 6 The samples were examined to determine the presence of HPyVs contamination. The specific procedures included the following steps: (1) Pretreatment of samples and controls.

[0061] Negative control: 200 μL of PBS was used as a negative control; Sample to be tested: Take 10 6 200 μL of culture supernatant was added to each of the 293 cells as the test sample; Positive control: Take 200 μL and serially dilute with PBS to 10⁻⁶. 2 PFU / mL BKPyV pseudovirus served as a positive control; Applicability control: The same virus solution as the positive control was added to the sample to be tested; DNA was extracted from all the above samples using the Viral Nucleic Acid purification kit (simgen, 4002050), and 5 μL was used as working solution for qPCR detection.

[0062] Template-free control: Water without RNase; Sensitivity control: BKPyV plasmid standard was serially diluted to 20 copies / μL, and 5 μL was used as template, i.e., 100 copies / reaction, as a sensitivity control.

[0063] (2) qPCR detection and result interpretation.

[0064] The reaction system is the same as in Table 2, and the reaction procedure is the same as in Table 3.

[0065] The test results are shown in Table 6: According to the judgment criteria (see Table 7), the 293 cells were determined to be free of HPyVs contamination.

[0066] Table 6 Test Results

[0067] Table 7. Criteria for interpreting HPyVs qPCR detection results

[0068] Therefore, based on Table 7, the judgment criteria for each sample and control are as follows (the following requirements must be met simultaneously in the same experiment, otherwise the experiment is invalid): No template control: No Ct values ​​were found in either the FAM / HEX channels, and no obvious amplification curves were observed; Sensitivity control: Both FAM / HEX channels showed obvious amplification curves, and the Ct value was <38; Negative control: FAM channel showed no Ct value and no obvious amplification curve; HEX channel showed an obvious amplification curve and Ct value <38; Positive control: The FAM channel showed a clear amplification curve with a Ct value ≤ 35; the HEX channel showed a clear amplification curve with a Ct value < 38. Applicability control: There is a clear amplification curve. If the Ct value increases, the difference between the Ct value and the positive control should be within 3 Ct values.

[0069] In summary, this invention has successfully established a qPCR detection method that can simultaneously detect 14 HPyVs in the same reaction tube. It is highly specific, sensitive, and robust, and can be used for the quality control of biological products.

[0070] It should be noted that the present invention is not limited to the above-described embodiments. The above embodiments are merely examples, and any embodiments that have the same structure and perform the same effects as the technical concept within the scope of the present invention are included within the scope of the present invention. Furthermore, various modifications that can be conceived by those skilled in the art to the embodiments, and other ways of constructing by combining some of the constituent elements of the embodiments, without departing from the spirit of the present invention, are also included within the scope of the present invention.

Claims

1. A primer-probe combination for detecting human polyomavirus, characterized in that, The human polyomaviruses include BKPyV, JCPyV, KIPyV, WUPyV, MCPyV, HPyV6, HPyV7, TSPyV, HPyV9, MWPyV, STLPyV, HPyV12, NJPyV, and LIPyV. The primer-probe combination includes primers with sequences as shown in SEQ ID NO. 1-28 and probes with sequences as shown in SEQ ID NO. 29-31.

2. The primer-probe combination according to claim 1, characterized in that, The probe is attached with a fluorescent group and a quenching group.

3. A human polyomavirus detection kit, characterized in that, Includes the primer-probe combination as described in claim 1.

4. The human polyomavirus detection kit according to claim 3, characterized in that, It includes an internal control plasmid and an internal control probe, wherein the internal control plasmid contains a fragment with the sequence shown in SEQ ID NO.32, and the internal control probe has the sequence shown in SEQ ID NO.

32.

5. The human polyomavirus detection kit according to claim 3, characterized in that, This includes BKPyV plasmid standards for sensitivity control and / or BKPyV pseudoviruses for positive control.

6. The reagent kit according to claim 3, characterized in that, This includes other reagents and / or consumables used for qPCR.

7. The application of the primer-probe combination as described in claim 1 or the human polyomavirus detection kit as described in claim 3 in the detection of human polyomavirus contamination in biological products.

8. The application according to claim 7, characterized in that, The biological products include cell samples.

9. A method for detecting human polyomaviruses not intended for the diagnosis and treatment of diseases, characterized in that, The detection was performed using the human polyomavirus detection kit described in claim 4.

10. The method for detecting human polyomavirus according to claim 9, characterized in that, Includes the following steps: Prepare a reaction system containing primers, probes, internal control plasmids, internal control probes, and DNA from the sample to be tested, perform qPCR, and determine whether the sample to be tested contains human polyomavirus based on the Ct value.

Images