An attenuated strain of pathogenic aeromonas hydrophila and its use in preparing a vaccine

Abstract

The application discloses an attenuated strain of pathogenic Aeromonas hydrophila and application of the attenuated strain in preparation of a vaccine, relates to the technical field of vaccines, and discloses the following technical scheme. exeA and pspA The attenuated strain is obtained by introducing a suicide plasmid pRE112 plasmid carrying a gene deletion fragment into wild-type Aeromonas hydrophila, the attenuated strain has significantly reduced virulence compared with the wild-type strain, has good immunoprotective capacity, and has a relative immunoprotective rate of 72.73%, which is significantly higher than the relative immunoprotective rate 53.03% of the immersion inactivated vaccine, and can effectively protect fish from the infection of the wild-type strain of Aeromonas hydrophila.

Description

Technical Field

[0001] This invention relates to the field of vaccine technology, specifically to an attenuated strain of Aeromonas hydrophila and its application in vaccine preparation. Background Technology

[0002] As the only country in the world where aquaculture production exceeds wild-caught production, China has maintained its position as the world's largest producer of farmed edible fish for over three decades since initiating its industrial transformation in the early 1990s. According to the latest 2025 China Fisheries Statistical Yearbook, in 2024, my country's total fisheries economic output was approximately 3.42 trillion yuan, with a total aquatic product output of 73.5759 million tons, of which aquaculture production reached 60.6003 million tons, accounting for approximately 82.36% of the total. However, in recent years, due to factors such as germplasm degradation and the proliferation of pathogenic microorganisms, disease problems in aquaculture have become increasingly prominent, seriously hindering the healthy and sustainable development of the aquaculture industry. Among these, bacterial diseases caused by Aeromonas hydrophila are particularly common in aquaculture.

[0003] Aeromonas hydrophila is a facultative anaerobic Gram-negative bacterium with a wide distribution, found in natural environments such as freshwater, seawater, swamps, silt, and soil. It infects a broad range of hosts, including most aquatic animals such as silver carp, common carp, grass carp, snakehead, bullfrog, zebrafish, and Chinese soft-shelled turtle. As a multi-host pathogen, in addition to infecting aquatic animals, Aeromonas hydrophila can also infect poultry and livestock. Furthermore, some immunocompromised individuals can also be infected with Aeromonas hydrophila, developing conditions such as acute gastroenteritis, necrotizing fasciitis, and pneumonia.

[0004] Aeromonas hydrophila is one of the main pathogens causing active septicemia in fish. Once an outbreak occurs in aquaculture, the disease is highly destructive and contagious, spreading rapidly and causing a very high mortality rate, resulting in significant economic losses to the aquaculture industry. Currently, antibiotics and traditional Chinese medicine are widely used to control Aeromonas hydrophila infection and are the main prevention and control methods. However, while antibiotics are highly effective, excessive use can damage the aquatic ecosystem, promote the development of drug-resistant strains, and, in addition, antibiotic residues in fish not only affect the quality and safety of aquatic products but may also enter the human body through the food chain, posing a potential threat to human life and public health. Traditional Chinese medicine is relatively safe, but its effects are short-lived and unstable. In contrast, fish vaccines are green and pollution-free. Compared to antibiotics, vaccines do not cause bacterial resistance or drug residues, provide immune protection to fish before pathogens infect them, have a good preventive effect against fish diseases, and can effectively control the spread of pathogens. Summary of the Invention

[0005] To address the aforementioned shortcomings of existing technologies, this invention provides an attenuated strain of the pathogen Aeromonas hydrophila and its application in vaccine preparation. This strain can effectively prevent bacterial septicemia in fish and has significant application value.

[0006] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows: Provides an attenuated strain of Aeromonas hydrophila Δ exeA / pspA -AH, characterized in that the attenuated strain Δ exeA / pspA -AH indicates a strain of Aeromonas hydrophila. exeA Genes and pspA Strains obtained by simultaneously deleting genes; exeA The sequence of the deleted gene fragment is shown in SEQ ID NO.1; pspA The sequence of the deleted gene fragment is shown in SEQ ID NO.2.

[0007] This invention also provides the above-mentioned attenuated strain Δ of the pathogen Aeromonas hydrophila. exeA / pspA Application of -AH in the preparation of live attenuated Aeromonas hydrophila vaccine for largemouth bass.

[0008] Furthermore, the attenuated strain Δ of Aeromonas hydrophila in the live attenuated Aeromonas hydrophila vaccine for largemouth bass immunization... exeA / pspA The concentration of -AH is 3×10 7 CFU / mL.

[0009] The present invention also provides an attenuated strain Δ of the above-mentioned pathogen Aeromonas hydrophila. exeA / pspA The construction method for -AH follows these steps: S1: Using the genomic DNA of Aeromonas hydrophila strain as a template, primers were used... exeA -1F exeA -1R amplification exeA upstream homologous arms of the gene, using primers exeA -2F exeA -2R amplification exeA Downstream homologous arms of the gene; and primers were used. exeA -1F and exeA -2R connects the upstream and downstream homologous arms to obtain a fusion fragment. exeA ; Primers exeA The sequence of -1F is shown in SEQ ID NO.3: TAGAGCTCTGCTGTTGAGGGCATTGAGG; Primers exeA The sequence of -1R is shown in SEQ ID NO.4: GGGTTGCAGGATGGTCCGGCAGAGGATGACGAT; Primers exeA The sequence of -2F is shown in SEQ ID NO.5: CATCCTCTGCCGGACCATCCTGCAACCCGTAGT; Primers exeA The sequence of -2R is shown in SEQ ID NO.6: CGTCTAGACTCCCTTGATAAACCTGTCCC; S2: Merge fragments exeA The recombinant plasmid pRE112-Δ was obtained by ligating it into the linear vector pRE112 plasmid. exeA ; S3: Using recombinant plasmid pRE112-Δ exeA Thermal shock conversion E.coli Recombinant Escherichia coli was obtained from SM10 λpir competent cells. E.coli SM10 λpir(pRE112-Δ exeA ); S4: Combine wild-type Aeromonas hydrophila with... E.coli SM10 λpir(pRE112-Δ exeA ) Perform conjugation transformation and screening to obtain exeA Gene deletion strains; S5: Using the genomic DNA of Aeromonas hydrophila strain as a template, primers were used... pspA -1F pspA -1R amplification pspA upstream homologous arms of the gene, using primers pspA -2F pspA -2R amplification pspA Downstream homologous arms of the gene; and primers were used. pspA -1F and pspA -2R connects the upstream and downstream homologous arms to obtain a fusion fragment. pspA ; Primers pspA The sequence of -1F is shown in SEQ ID NO.7: CGGAGCTCGGCGGTGAAGGTGATGAAA; Primers pspA The sequence of -1R is shown in SEQ ID NO.8: GATGGAAGACGAGCGATACCACGCCGAAACAGG; Primers pspA The sequence of -2F is shown in SEQ ID NO.9: TTCGGCGTGGTATCGCTCGTCTTCCATCTCCTGG; Primers pspAThe sequence of -2R is shown in SEQ ID NO.10: GCTTAGAGCCGTGGTCATAGTCATCCC; S6: Merge fragments pspA The recombinant plasmid pRE112-Δ was obtained by ligating it into the linear vector pRE112 plasmid. pspA ; S7: Using recombinant plasmid pRE112-Δ pspA Thermal shock conversion E.coli Recombinant Escherichia coli was obtained from SM10 λpir competent cells. E.coli SM10 λpir(pRE112-Δ pspA ); S8: Will exeA Gene deletion strains and E.coli SM10 λpir(pRE112-Δ pspA ) Perform conjugation transformation and screening to obtain exeA Genes and pspA Attenuated strain Δ of Aeromonas hydrophila with double gene deletion exeA / pspA -AH.

[0010] Furthermore, the thermal shock conversion step in step S3 or S7 is specifically as follows: A1: Take the frozen product stored at -80℃ E.coli SM10 λpir competent cells were thawed in an ice bath and recombinant plasmid pRE112-Δ was added. exeA or pRE112-Δ pspA Gently blow and mix well, then chill in an ice bath for 30 minutes; E.coli SM10 λpir competent cells and recombinant plasmid pRE112-Δ exeA or pRE112-Δ pspA The volume ratio is 10:1; A2: Adjust the water bath temperature to 45℃, heat shock for 90 seconds, then ice bath for 5 minutes; A3: Add BHI liquid medium, gently invert to mix, and incubate at 37℃ and 180 rpm for 3-4 hours; the amount of BHI liquid medium added should be the same as that of the recombinant plasmid pRE112-Δ. exeA or pRE112-Δ pspA The volume ratio is 800:6; A4: After culturing, centrifuge at 4000×g for 2 min, discard the supernatant, and resuspend the bacterial cells in fresh BHI liquid medium; the amount of fresh BHI liquid medium added should be the same as that of the recombinant plasmid pRE112-Δ. exeA or pRE112-Δ pspA The volume ratio is 100:6; A5: Spread the bacterial culture onto BHI solid medium containing chloramphenicol at a concentration of 35 ng / μL and incubate overnight in an inverted manner at 37°C. A6: Single colonies were validated by colony PCR using primers pRE112-F and pRE112-R. Successfully validated colonies were identified as recombinant *E. coli*. E.coli SM10 λpir(pRE112-Δ exeA or recombinant Escherichia coli E.coli SM10 λpir(pRE112-Δ pspA ); The sequence of primer pRE112-F is shown in SEQ ID NO.11: CGGGTTGAGAAGCGGTGTA; The sequence of primer pRE112-R is shown in SEQ ID NO.12: CAGCCAATCCCTGGGTGAG.

[0011] Furthermore, the specific steps of the conjugation transformation in step S4 are as follows: B1: Will E.coli SM10 λpir(pRE112-Δ exeA Both *Aeromonas hydrophila* and wild-type strains were inoculated into BHI liquid medium, and a second culture was performed the next day to obtain OD. 600 The values ​​are all between 0.4 and 0.6. E.coli SM10 λpir(pRE112-Δ exeA ) bacterial suspension and wild-type Aeromonas hydrophila suspension; B2: Mix the recombinant Escherichia coli culture and the wild-type Aeromonas hydrophila culture at a volume ratio of 3:1, centrifuge at 4000×g for 3 min, discard the supernatant, and resuspend the cells in BHI liquid medium. B3: Cover the surface of BHI solid culture medium with a sterile mixed cellulose filter membrane with a pore size of 0.45 μm, drop the resuspended bacterial solution onto the filter membrane, and incubate at 28°C for 48 h after drying. B4: Wash the filter membrane with attached colonies using BHI liquid medium, discard the filter membrane, and collect the bacterial suspension. Serially dilute the bacterial suspension and spread it separately onto BHI plates containing ampicillin (100 ng / μL) and chloramphenicol (35 ng / μL). Incubate in an inverted incubator at 28°C for 24 hours. Use primers... exeA -F and exeA -R is used to perform colony PCR verification on single colonies on the plate. Successfully verified colonies are then subjected to conjugation transformation. Primers exeAThe -F sequence is shown in SEQ ID NO.13: CGCCTGGGTTGTTCCTCTT; Primers exeA The sequence of -R is shown in SEQ ID NO.14: GGGTCTTTGACATCCCTTTGG.

[0012] Furthermore, the specific steps of the bonding transformation in step S8 are as follows: C1: Will E.coli SM10 λpir(pRE112-Δ pspA )and exeA Gene-deleted strains were inoculated into BHI liquid medium and cultured a second time the next day to obtain OD. 600 The values ​​are all between 0.4 and 0.6. E.coli SM10 λpir(pRE112-Δ pspA ) bacterial solution and exeA Gene-deleted bacterial culture; C2: Will E.coli SM10 λpir(pRE112-Δ pspA ) bacterial solution and exeA After the gene-deleted bacterial suspension was uniformly mixed at a volume ratio of 3:1, it was centrifuged at 4000×g for 3 min, the supernatant was discarded, and the bacterial cells were resuspended in BHI liquid medium. C3: Cover the surface of BHI solid medium with a sterile mixed cellulose filter membrane with a pore size of 0.45 μm, drop the resuspended bacterial solution onto the filter membrane, and incubate it upright in a constant temperature incubator at 28℃ for 48 h after drying. C4: Wash the filter membrane with attached colonies using BHI liquid medium, discard the filter membrane, and collect the bacterial suspension. Serially dilute the bacterial suspension and spread it separately onto BHI plates containing ampicillin (100 ng / μL) and chloramphenicol (35 ng / μL). Incubate in an inverted incubator at 28°C for 24 hours. Use primers... pspA -F and pspA -R is used to perform colony PCR verification on single colonies on the plate. Successfully verified colonies are then subjected to conjugation transformation. Primers pspA The -F sequence is shown in SEQ ID NO.15: CCCTTCACGACTGATGCTG; Primers pspA The sequence of -R is shown in SEQ ID NO.16: TGATCGTTGAAAGCTGGTC.

[0013] The beneficial effects of this invention are as follows: This invention carries exeA and pspAThe suicide-type plasmid pRE112, containing a gene deletion fragment, was introduced into wild-type Aeromonas hydrophila to obtain an attenuated strain. This attenuated strain showed significantly reduced virulence compared to the wild-type strain, while possessing good immunoprotective capabilities, with a relative immunoprotective rate of 72.73%, significantly higher than the relative immunoprotective rate of 53.03% for immersion-inactivated vaccines. It can effectively protect fish from infection by wild-type Aeromonas hydrophila. Attached Figure Description

[0014] Figure 1 The fusion fragment in Example 2 exeA Electrophoretic detection image; Figure 2 The fusion fragment in Example 2 pspA Electrophoretic detection image; Figure 3 The recombinant plasmid pRE112-Δ in Example 3 exeA The filtering results; Figure 4 The recombinant plasmid pRE112-Δ in Example 3 pspA The filtering results; Figure 5 pRE112-Δ in Example 5 exeA The results of the bonding and transfer; Figure 6 In Example 5 exeA Results of sucrose screening for the deletion strain; Figure 7 In Example 5 exeA Results of genetic stability verification of the deletion strain; Figure 8 pRE112-Δ in Example 6 pspA The results of the bonding and transfer; Figure 9 The double gene deletion strain Δ in Example 6 pspA / exeA -AH sucrose screening results; Figure 10 The double gene deletion strain Δ in Example 6 pspA / exeA The genetic stability verification results of -AH; Figure 11 For example, in Example 7, the WT-AH group and Δ pspA / exeA - Bacterial isolation verification results after challenge in the AH group; Figure 12 In Example 8, Δ pspA / exeA - Validation results of the immune protection rate of AH against largemouth bass. Detailed Implementation

[0015] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0016] Unless otherwise specified, all reagents used in the examples were of commercially available analytical grade.

[0017] Example 1: Strain activation and culture and bacterial genome extraction Wild-type aeromonas hydrophila was isolated from the ascites of largemouth bass with bacterial septicemia and is preserved in the Aquatic Disease Immunology Laboratory of Southwest University. Wild-type Aeromonas hydrophila strains preserved in glycerol at -80℃ were streaked onto BHI solid medium for activation. After incubation at 28℃ for 12 hours, single colonies of Aeromonas hydrophila were picked and inoculated into BHI liquid medium. The culture was then incubated overnight at 28℃ with shaking. Subsequently, a 1% inoculation was performed into fresh BHI liquid medium, and the culture was incubated at 28℃ with shaking until the OD reached [value missing]. 600 The concentration reached 0.5. Bacterial genomic DNA was extracted using a bacterial DNA extraction kit from Shanghai Sangon Biotech Co., Ltd., and stored at -20℃ for later use.

[0018] Example 2 exeA Genes and pspA Upstream and downstream homologous arm amplification and ligation of genes Using the Aeromonas hydrophila genomic DNA extracted in Example 1 as a template, primers were used... exeA -1F / exeA -1R、 exeA -2F / exeA -2R amplification exeA Upstream and downstream homologous arms of the gene; using primers pspA -1F / pspA -1R、 pspA -2F / pspA -2R amplification pspA Upstream and downstream homologous arms of the gene; the same PCR reaction system and reaction procedure were used for amplification; Primers pspA The sequence of -1F is shown in SEQ ID NO.7: CGGAGCTCGGCGGTGAAGGTGATGAAA; Primers pspAThe sequence of -1R is shown in SEQ ID NO.8: GATGGAAGACGAGCGATACCACGCCGAAACAGG; Primers pspA The sequence of -2F is shown in SEQ ID NO.9: TTCGGCGTGGTATCGCTCGTCTTCCATCTCCTGG; Primers pspA The sequence of -2R is shown in SEQ ID NO.10: GCTTAGAGCCGTGGTCATAGTCATCCC; The PCR reaction system is shown in Table 1 below; Table 1

[0019] The reaction procedure is shown in Table 2 below; Table 2

[0020] Using primers exeA -1F and exeA -2R connection exeA The upstream and downstream homologous arms of the gene were fused together. exeA Primers were used pspA -1F and pspA -2R connection pspA The upstream and downstream homologous arms of the gene were fused together. pspA ; The reaction system is shown in Table 3 below; Table 3

[0021] The reaction procedure is shown in Table 4 below; Table 4

[0022] The obtained fusion fragment exeA and fusion fragments pspA The fusion fragments were detected by 1% agarose gel electrophoresis and photographed using a gel imaging system. exeA The results are as follows Figure 1 As shown, fused fragments pspA The results are as follows Figure 2As shown, the expected bands were purified and recovered using the Gel Extraction Kit from Omega Bio-Tek (USA). The PCR product was eluted with 30 μL of ddH2O and stored at -20°C for later use. 4 Example 3 Construction of recombinant plasmids The fusion fragment prepared in Example 2 exeA and fusion fragments pspA The fusion fragment and the linear vector pRE112 were double-digested separately. Specifically, the Cycle Pure-Kit from Omega Bio-Tek was used to purify the digested fragment and the linear vector.

[0023] The enzyme digestion system is shown in Table 5 below; Table 5

[0024] Then, the fusion fragment Δ was ligated using T4 DNA ligase. exeA and Δ pspA The plasmids were ligated separately to pRE112 to obtain the recombinant plasmid pRE112-Δ. exeA and pRE112-Δ pspA .

[0025] The connection system is shown in Table 6 below; Table 6

[0026] Recombinant plasmid pRE112-Δ exeA The screening results are as follows Figure 3 As shown, the marker is DL 2000 DNA marker, and 1-6 are recombinant plasmid pRE112-Δ. exeA The PCR product, from Figure 3 It can be seen that clear bands were successfully generated at 1200bp, proving that the recombinant plasmid pRE112-Δ exeA Successfully built; Recombinant plasmid pRE112-Δ pspA The screening results are as follows Figure 4 As shown, the marker is the DL 2000 DNA marker, which is... Figure 4 It can be seen that products 1, 3, 8~10 successfully produced clear bands at 1147bp, proving that products 1, 3, 8~10 were successfully constructed.

[0027] Example 4: Preparation and heat shock conversion of competent cells Using the supercompetent cell preparation kit from Sangon Biotech (Shanghai) Co., Ltd. E.coli SM10 λpir was used to prepare competent cells and the quality of the competent cells was verified. After confirming that there were no quality problems, the cells were stored at -80°C for later use.

[0028] Take 60 μL of the sample stored at -80℃. E.coli SM10 λpir competent cells were thawed in an ice bath, and then 6 μL of the recombinant plasmid pRE112-Δ prepared in Example 3 was added. exeA and pRE112-Δ pspA Mix gently by blowing and blowing, then chill in an ice bath for 30 minutes.

[0029] Adjust the water bath temperature to 45℃, heat shock for 90 seconds, then ice bath for 5 minutes.

[0030] Add 800 μL of BHI liquid medium, gently invert to mix, and incubate at 37°C and 180 rpm for 3-4 hours.

[0031] Centrifuge at 4000×g for 2 min, discard the supernatant, and resuspend the bacterial cells in 100 μL of fresh BHI liquid medium to obtain the bacterial suspension.

[0032] The bacterial culture was spread onto BHI solid medium containing chloramphenicol (35 ng / μL) and incubated overnight in an inverted incubator at 37°C.

[0033] Single colonies were validated by colony PCR using primers pRE112-F and pRE112-R. The sequence of primer pRE112-F is shown in SEQ ID NO.11: CGGGTTGAGAAGCGGTGTA; the sequence of primer pRE112-R is shown in SEQ ID NO.12: CAGCCAATCCCTGGGTGAG.

[0034] The validation system is shown in Table 7 below, and the validation procedure is shown in Table 8 below. PCR products with expected band sizes were sent to a sequencing company (Sangon Biotech (Shanghai) Co., Ltd.) for sequencing. Successful sequence comparison confirmed that the recombinant plasmid had been successfully transformed into *E. coli*, yielding recombinant *E. coli*. E.coli SM10 λpir(pRE112-Δ exeA ) and recombinant Escherichia coli E.coli SM10 λpir(pRE112-Δ pspA ).

[0035] Table 7

[0036] Table 8

[0037] Example 5: Bonding Transfer The recombinant Escherichia coli prepared in Example 4 E.coli SM10 λpir(pRE112-Δ exeA Both *Aeromonas hydrophila* and wild-type strains were inoculated into BHI liquid medium, and a second culture was performed the next day to obtain OD. 600 The values ​​are all between 0.4 and 0.6. E.coli SM10 λpir(pRE112-Δ exeA ) bacterial suspension and wild-type Aeromonas hydrophila suspension; After uniformly mixing the recombinant Escherichia coli bacterial suspension and the wild-type Aeromonas hydrophila bacterial suspension at a volume ratio of 3:1, centrifuging at 4000×g for 3 min, discarding the supernatant, and resuspending the bacterial cells in BHI liquid medium; A sterile mixed cellulose filter membrane with a pore size of 0.45 μm was coated on the surface of BHI solid culture medium. The resuspended bacterial solution was dropped onto the filter membrane and incubated in a constant temperature incubator at 28°C for 48 h after drying. The filter membrane with attached colonies was washed with BHI liquid medium, and the membrane was discarded. The bacterial suspension was then serially diluted and spread onto BHI plates containing ampicillin (100 ng / μL) and chloramphenicol (35 ng / μL), respectively. The plates were incubated upside down at 28°C for 24 hours. Primers were then used to... exeA -F and exeA -R performs colony PCR verification on single colonies on the plate. The verification system and procedure are the same as in Example 4. If the agarose gel electrophoresis result shows two bands, namely a 346bp band and a 1816bp band, it indicates that the conjugation was successful and the first homologous recombination was completed. The conjugation result is as follows: Figure 5 As shown, by Figure 5 It can be seen that the method of this embodiment was successful in conjugation. The successfully conjugated Aeromonas hydrophila, that is, Aeromonas hydrophila carrying the recombinant plasmid, was inoculated into BHI liquid medium and cultured overnight, then streaked onto BHI plates and cultured overnight, and stored at 4°C for later use.

[0038] In practice, *Aeromonas hydrophila* carrying the recombinant plasmid were subjected to sucrose stress screening and genetic stability verification. Specifically, a single colony of successfully conjugated *Aeromonas hydrophila* was picked using an inoculation loop and inoculated into BHI liquid medium containing 15% (m / v) sucrose. After culturing for 24 hours, a small amount of the bacterial culture was streaked onto BHI solid medium containing 15% (m / v) sucrose. Primers were used. exeA -F / exeA -R was used to verify single colonies obtained from overnight culture using colony PCR. Results of sucrose stress screening are shown below. Figure 6The results showed that only one specific band of 346 bp was amplified, indicating that homologous recombination was successful and the desired homologous recombination was obtained. exeA Gene deletion strain.

[0039] Primers exeA The -F sequence is shown in SEQ ID NO.13: CGCCTGGGTTGTTCCTCTT; Primers exeA The sequence of -R is shown in SEQ ID NO.14: GGGTCTTTGACATCCCTTTGG.

[0040] Filtered exeA Single colonies of the gene-deleted strain were inoculated into BHI liquid medium and continuously passaged for 7 days, with the medium being changed to maintain freshness. The culture was streaked onto BHI agar plates at 24, 72, 120, and 168 hours and incubated upside down in a 28°C biochemical incubator until distinct colonies appeared. Primers were then used... exeA -F / exeA -R was used for colony PCR verification, and the obtained PCR products were analyzed by agarose gel electrophoresis. The results are as follows: Figure 7 As shown, the colonies grown at these four time points all amplified only a single 346bp band, indicating that a genetically stable structure was successfully constructed. exeA The gene deletion strain was named Δ. exeA- AH.

[0041] Example 6 pspA gene knockout The recombinant Escherichia coli prepared in Example 4 E.coli SM10 λpir(pRE112-Δ pspA ) and the preparation of Example 5 exeA Gene deletion strains underwent conjugation transfer using the same method as in Example 5, employing primers. pspA -F / pspA -R was used to verify single colonies on the plate using colony PCR. The verification system and procedure were the same as in Example 4. The agarose gel electrophoresis results are as follows: Figure 8 As shown, by Figure 8 As can be seen, the agarose gel electrophoresis showed two bands, one 590 bp and the other 1126 bp, indicating successful conjugation. After successful conjugation, sucrose pressure screening was performed using the method in Example 5. The sucrose screening method used primers... psp AF / psp AR was used to verify the single colonies grown overnight by colony PCR. The sucrose screening results were as follows: Figure 9 As shown; if a single band of 590bp is amplified, homologous recombination is successful, resulting in... psp A deletion strain.

[0042] Primers pspA The -F sequence is shown in SEQ ID NO.15: CCCTTCACGACTGATGCTG; Primers pspA The sequence of -R is shown in SEQ ID NO.16: TGATCGTTGAAAGCTGGTC.

[0043] After identifying single-deletion bands in sucrose screening, genetic stability was verified using the method described in Example 5. come out AF / come out AR and psp AF / psp The two pairs of AR primers were validated separately, and the results are as follows: Figure 10 As shown, successful verification means obtaining Aeromonas hydrophila. come out A and psp A double gene deletion strain was named Δ. come out A / psp A-AH.

[0044] Example 7: Median Lethal Dose (LD50) of Double Gene Deletion Strains 50 Measurement Take the Δ prepared in Example 6 come out A / psp A-AH and the wild-type strain of Aeromonas hydrophila WT-AH were inoculated into BHI liquid medium and cultured overnight at 28°C with a shaker at 180 rpm. The next day, they were inoculated into fresh BHI liquid medium at a ratio of 1% for a second culture, and cultured until the logarithmic growth phase. WT-AH and Δ... exeA / pspA The bacterial concentration of -AH was adjusted to 1.5×10⁻⁶. 9 The bacterial culture was then serially diluted 10-fold using fresh BHI liquid medium, with the lowest concentration group having a concentration of 1.5 × 10⁻⁶ CFU / mL. 5 CFU / mL.

[0045] Healthy largemouth bass were randomly divided into three groups: WT-AH, Δ exeA / pspA -AH and control group. WT-AH group and Δ exeA / pspA - The AH group had 180 tails each, and the control group had 36 tails. WT-AH group and Δ exeA / pspA The 180 fish in the -AH group were injected with bacterial solutions at five different concentration gradients, with 12 fish injected at each concentration gradient, repeated three times. Largemouth bass were anesthetized before injection using ethyl m-aminobenzoate methanesulfonate (MS-222). The WT-AH group and Δ exeA / pspA- In the AH group, each tail was injected intraperitoneally with 200 μL of bacterial solution of the corresponding concentration, while the control group was injected with an equal volume of sterile phosphate-buffered saline (PBS).

[0046] Injecting WT-AH and Δ exeA / pspA - After AH (Acute Hemorrhage), the dead largemouth bass were immediately removed. They were separately soaked in 75% ethanol for 5 minutes. In a clean bench, the abdomen of the largemouth bass was cut open with sterile scissors, and the peritoneal fluid was collected using a sterile inoculation loop. The fluid was streaked onto BHI (Biological High-Intensity Specimen) solid medium for separation. The cultures were incubated upside down at 28°C for 16 hours. The presence of colonies was observed in all three groups, and the morphological characteristics of the colonies were recorded. Simultaneously, [the text abruptly ends here]. come out AF / come out AR and psp AF / psp AR primer pair WT-AH group and Δ come out A / psp Single colonies of the A-AH group were validated by colony PCR. Results are as follows: Figure 11 As shown, lanes 1-8 are Δ come out A / psp Group A-AH come out Amplified fragment A, 346bp in size; lanes 9-16 are in the WT-AH group. come out Amplified fragment A, 1816bp in size; lanes 17-24 are Δ come out A / psp Group A-AH psp Amplified fragment A, 590bp in size; lanes 9-16 are in the WT-AH group. psp Amplified fragment A, 1126 bp in size. Figure 11 It can be seen that Δ come out A / psp The A-AH double gene deletion strain was successfully constructed, as expected.

[0047] The patients were observed for two consecutive weeks and mortality was recorded in each group. Analysis using the Kohl's method showed that intraperitoneal injection of WT-AH and Δ... come out A / psp The median lethal concentrations (LC50) of A-AH against largemouth bass were 1.10 × 10⁻⁶. 5 CFU / ml and 1.94×10 8 CFU / ml, Δ exe A / psp The toxicity of A-AH is significantly lower than that of WT-AH.

[0048] Example 8: Verification of the immunoprotective effect of the double gene deletion strain against largemouth bass Preparation of inactivated Aeromonas hydrophila vaccine: WT-AH single colonies were selected and inoculated into BHI liquid medium, and cultured overnight with shaking at 28°C. The next day, the bacterial suspension was inoculated into fresh BHI liquid medium at a ratio of 1% for a second culture. After the bacterial suspension reached the logarithmic growth phase (OD600=0.5), it was centrifuged at 6000 rpm for 10 minutes at room temperature, the supernatant was discarded, and the bacterial cells were collected. Subsequently, the bacterial cells were resuspended in sterile PBS buffer and washed again by centrifugation. This step was repeated twice to ensure thorough washing of the bacterial cells. After final collection, the bacterial cells were resuspended in PBS solution containing 0.5% (v / v) formaldehyde and inactivated at 4°C for 48 hours. After inactivation, the supernatant was removed by centrifugation again, and the bacterial cells were washed three times with sterile PBS. Finally, the final concentration of the bacterial suspension was adjusted to 3×10⁻⁶ with sterile PBS. 7 The concentration of CFU / mL was recorded and stored at 4℃ for later use. To verify the inactivation effect, 200 μL of the inactivated bacterial solution was evenly spread on BHI solid medium and incubated upside down at 28℃ for 24 hours. If no colony growth was observed, the inactivation treatment was successful.

[0049] Preparation of live attenuated vaccine: picking Δ exe A / psp A single colony of A-AH was inoculated into BHI liquid medium and cultured overnight at 28°C with shaking until the logarithmic growth phase. The next day, it was inoculated at a ratio of 1% into fresh BHI liquid medium for a second culture, and cultured until the logarithmic growth phase was reached. The bacterial concentration was then adjusted to 3 × 10⁻⁶. 7 CFU / mL.

[0050] Largemouth bass were randomly divided into three groups: a PBS control group, a Δ exe A / psp The A-AH live bacteria treatment group and the Inactive inactivated vaccine treatment group each had three parallel experimental groups, with each parallel group containing 20 fish. Before the experiment, the fish were subjected to hypertonic immersion in a 1% (m / v) sodium chloride solution for 10 minutes, and then each group of fish was transferred to a 3×10⁻⁶ sodium chloride solution. 7 ΔCFU / mL exe A / psp A-AH live bacteria solution, 3×10 7 The samples were further immersed in CFU / mL Aeromonas hydrophila inactivated vaccine solution and sterile PBS solution for 20 minutes.

[0051] Four weeks after immunization, three groups of largemouth bass were challenged with 2 times the LD50 solution via intraperitoneal injection. 50 The dosage is 2.2 × 10⁻⁶. 5CFU / tail AH-WT were observed for 2 weeks. Pathogen isolation was performed on the dying largemouth bass, and Aeromonas hydrophila infection was determined to be the cause of death. Mortality was recorded for each group, and the relative protection rate (RPS) was calculated. Results are as follows: Figure 12 As shown, the RPS calculation method is as follows: RPS = [1 - {mortality rate of the immunized group (%) / mortality rate of the control group (%)}] × 100%. The relative protection rate (RPS) of the live attenuated vaccine treatment group was 72.73%, and the RPS of the inactivated vaccine treatment group was 53.03%. Therefore, it can be seen that using the attenuated strain prepared in this invention as a live vaccine can effectively protect fish from infection by the wild-type Aeromonas hydrophila strain.

Claims

1. An attenuated strain of Aeromonas hydrophila Δ exeA / pspA -AH, characterized in that, The attenuated strain Δ exeA / pspA -AH indicates a strain of Aeromonas hydrophila. exeA Genes and pspA Strains obtained by simultaneously deleting genes; exeA The sequence of the deleted gene fragment is shown in SEQ ID NO.1; pspA The sequence of the deleted gene fragment is shown in SEQ ID NO.

2.

2. The attenuated strain Δ of Aeromonas hydrophila as described in claim 1. exeA / pspA Application of -AH in the preparation of live attenuated Aeromonas hydrophila vaccine for largemouth bass.

3. The application according to claim 2, characterized in that, The attenuated strain Δ of Aeromonas hydrophila in the live attenuated Aeromonas hydrophila vaccine for largemouth bass immunization exeA / pspA The concentration of -AH is 3×10 7 CFU / mL.

4. An attenuated strain Δ of Aeromonas hydrophila as described in claim 1. exeA / pspA The method for constructing -AH is characterized by, The following steps are used: S1: Using the genomic DNA of Aeromonas hydrophila strain as a template, primers were used... exeA -1F exeA -1R amplification exeA Upstream homologous arms of the gene, using primers exeA -2F exeA -2R amplification exeA Downstream homologous arms of the gene; and primers were used. exeA -1F and exeA -2R connects the upstream and downstream homologous arms to obtain a fusion fragment. exeA ; Primers exeA The sequence of -1F is shown in SEQ ID NO.3: TAGAGCTCTGCTGTTGAGGGCATTGAGG; Primers exeA The sequence of -1R is shown in SEQ ID NO.4: GGGTTGCAGGATGGTCCGGCAGAGGATGACGAT; Primers exeA The sequence of -2F is shown in SEQ ID NO.5: CATCCTCTGCCGGACCATCCTGCAACCCGTAGT; Primers exeA The sequence of -2R is shown in SEQ ID NO.6: CGTCTAGACTCCCTTGATAAACCTGTCCC; S2: Merge fragments exeA The recombinant plasmid pRE112-Δ was obtained by ligating it into the linear vector pRE112 plasmid. exeA ; S3: Using recombinant plasmid pRE112-Δ exeA Thermal shock conversion E. coli Recombinant Escherichia coli was obtained from SM10 λpir competent cells. E. coli SM10 λpir(pRE112-Δ exeA ); S4: Combine wild-type Aeromonas hydrophila with... E. coli SM10 λpir(pRE112-Δ exeA ) Perform conjugation transformation and screening to obtain exeA Gene deletion strains; S5: Using the genomic DNA of Aeromonas hydrophila strain as a template, primers were used... pspA -1F pspA -1R amplification pspA Upstream homologous arms of the gene, using primers pspA -2F pspA -2R amplification pspA Downstream homologous arms of the gene; and primers were used. pspA -1F and pspA -2R connects the upstream and downstream homologous arms to obtain a fusion fragment. pspA ; Primers pspA The sequence of -1F is shown in SEQ ID NO.7: CGGAGCTCGGCGGTGAAGGTGATGAAA; Primers pspA The sequence of -1R is shown in SEQ ID NO.8: GATGGAAGACGAGCGATACCACGCCGAAACAGG; Primers pspA The sequence of -2F is shown in SEQ ID NO.9: TTCGGCGTGGTATCGCTCGTCTTCCATCTCCTGG; Primers pspA The sequence of -2R is shown in SEQ ID NO.10: GCTTAGAGCCGTGGTCATAGTCATCCC; S6: Merge fragments pspA The recombinant plasmid pRE112-Δ was obtained by ligating it into the linear vector pRE112 plasmid. pspA ; S7: Using recombinant plasmid pRE112-Δ pspA Thermal shock conversion E. coli Recombinant Escherichia coli was obtained from SM10 λpir competent cells. E. coli SM10 λpir(pRE112-Δ pspA ); S8: Will exeA Gene deletion strains and E. coli SM10 λpir(pRE112-Δ pspA ) Perform conjugation transformation and screening to obtain exeA Genes and pspA Attenuated strain Δ of Aeromonas hydrophila with double gene deletion exeA / pspA -AH.

5. The construction method according to claim 4, characterized in that, The thermal shock conversion step in step S3 or S7 is specifically as follows: A1: Take the frozen product stored at -80℃ E. coli SM10 λpir competent cells were thawed in an ice bath and recombinant plasmid pRE112-Δ was added. exeA or pRE112-Δ pspA Gently blow and mix well, then chill in an ice bath for 30 minutes; E. coli SM10 λpir competent cells and recombinant plasmid pRE112-Δ exeA or pRE112-Δ pspA The volume ratio is 10:1; A2: Adjust the water bath temperature to 45℃, heat shock for 90 seconds, then ice bath for 5 minutes; A3: Add BHI liquid medium, gently invert to mix, and incubate at 37℃ and 180 rpm for 3-4 hours; the amount of BHI liquid medium added should be the same as that of the recombinant plasmid pRE112-Δ. exeA or pRE112-Δ pspA The volume ratio is 800:6; A4: After culturing, centrifuge at 4000×g for 2 min, discard the supernatant, and resuspend the bacterial cells in fresh BHI liquid medium; the amount of fresh BHI liquid medium added should be the same as that of the recombinant plasmid pRE112-Δ. exeA or pRE112-Δ pspA The volume ratio is 100:6; A5: Spread the bacterial culture onto BHI solid medium containing chloramphenicol at a concentration of 35 ng / μL and incubate overnight at 37°C with the culture inverted position. A6: Single colonies were validated by colony PCR using primers pRE112-F and pRE112-R. Successfully validated colonies were identified as recombinant Escherichia coli. E. coli SM10 λpir(pRE112-Δ exeA or recombinant Escherichia coli E. coli SM10 λpir(pRE112-Δ pspA ); The sequence of primer pRE112-F is shown in SEQ ID NO.11: CGGGTTGAGAAGCGGTGTA; The sequence of primer pRE112-R is shown in SEQ ID NO.12: CAGCCAATCCCTGGGTGAG.

6. The construction method according to claim 4, characterized in that, The specific steps of the bonding transformation in step S4 are as follows: B1: Will E. coli SM10 λpir(pRE112-Δ exeA Both *Aeromonas hydrophila* and wild-type strains were inoculated into BHI liquid medium, and a second culture was performed the next day to obtain OD. 600 The values ​​are all between 0.4 and 0.

6. E. coli SM10 λpir(pRE112-Δ exeA ) bacterial suspension and wild-type Aeromonas hydrophila suspension; B2: Mix the recombinant Escherichia coli culture and the wild-type Aeromonas hydrophila culture at a volume ratio of 3:1, centrifuge at 4000×g for 3 min, discard the supernatant, and resuspend the cells in BHI liquid medium. B3: Cover the surface of BHI solid culture medium with a sterile mixed cellulose filter membrane with a pore size of 0.45 μm, drop the resuspended bacterial solution onto the filter membrane, and after drying, incubate in a constant temperature incubator at 28℃ for 48 h. B4: Wash the filter membrane with attached colonies using BHI liquid medium, discard the filter membrane, and collect the bacterial suspension. Serially dilute the bacterial suspension and spread it separately onto BHI plates containing ampicillin (100 ng / μL) and chloramphenicol (35 ng / μL). Incubate in an inverted incubator at 28°C for 24 hours. Use primers... exeA -F and exeA -R is used to perform colony PCR verification on single colonies on the plate. Successfully verified colonies are then subjected to conjugation transformation. Primers exeA The -F sequence is shown in SEQ ID NO.13: CGCCTGGGTTGTTCCTCTT; Primers exeA The sequence of -R is shown in SEQ ID NO.14: GGGTCTTTGACATCCCTTTGG.

7. The construction method according to claim 4, characterized in that, The specific steps of the bonding transformation in step S8 are as follows: C1: Will E. coli SM10 λpir(pRE112-Δ pspA )and exeA Gene-deleted strains were inoculated into BHI liquid medium and cultured a second time the next day to obtain OD. 600 The values ​​are all between 0.4 and 0.

6. E. coli SM10 λpir(pRE112-Δ pspA ) bacterial solution and exeA Gene-deleted bacterial culture; C2: Will E. coli SM10 λpir(pRE112-Δ pspA ) bacterial solution and exeA After the gene-deleted bacterial suspension was uniformly mixed at a volume ratio of 3:1, it was centrifuged at 4000×g for 3 min, the supernatant was discarded, and the bacterial cells were resuspended in BHI liquid medium. C3: Cover the surface of BHI solid medium with a sterile mixed cellulose filter membrane with a pore size of 0.45 μm, drop the resuspended bacterial solution onto the filter membrane, and incubate it upright in a constant temperature incubator at 28℃ for 48 h after drying. C4: Wash the filter membrane with attached colonies using BHI liquid medium, discard the filter membrane, and collect the bacterial suspension. Serially dilute the bacterial suspension and spread it separately onto BHI plates containing ampicillin (100 ng / μL) and chloramphenicol (35 ng / μL). Incubate in an inverted incubator at 28°C for 24 hours. Use primers... pspA -F and pspA -R is used to perform colony PCR verification on single colonies on the plate. Successfully verified colonies are then subjected to conjugation transformation. Primers pspA The -F sequence is shown in SEQ ID NO.15: CCCTTCACGACTGATGCTG; Primers pspA The sequence of -R is shown in SEQ ID NO.16: TGATCGTTGAAAGCTGGTC.

Images