Application of OsALD1 gene in regulating rice resistance to rice leaf roller

Abstract

The application discloses application of an OsALD1 gene in regulating rice resistance to Cnaphalocrocis medinalis Guenee. The gene OsALD1 can be used for regulating rice resistance to Cnaphalocrocis medinalis Guenee, and an OsALD1 gene knockout strain shows a high resistance to Cnaphalocrocis medinalis Guenee and a stable phenotype. The application has great significance for solving yield loss caused by the rice pest Cnaphalocrocis medinalis Guenee and reducing pesticide use, and has a wide application prospect in plant breeding.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology and relates to the application of the gene OsALD1 in regulating rice resistance to rice leaf folder. Specifically, it relates to a method for improving rice resistance to rice leaf folder by mutating and inactivating the gene OsALD1. Background Technology

[0002] Rice is one of my country's main food crops, and more than half of the world's population relies on it for sustenance; its yield is directly related to basic livelihoods. Pests pose a significant threat to rice production, with the rice leaf folder being one of the major pests affecting rice growth and listed as a Class A crop pest by the Ministry of Agriculture. Currently, the control of the rice leaf folder mainly relies on chemical pesticides (organochlorine insecticides, etc.). The increasing use of pesticides year by year has led to a continuous increase in the rice leaf folder's resistance to pesticides, forcing the search for new methods to address this problem. With the growing awareness of ecological environmental protection and the increasing demand for green agricultural products, breeding insect-resistant rice has become an important way to control agricultural pests and protect the environment. However, very few rice leaf folder resistance genes have been identified at present, and resistance gene resources remain a bottleneck limiting rice resistance breeding.

[0003] OsALD1 belongs to the aminotransferase family and can reduce the double bond of adjacent α,β-unsaturated aldehydes or ketones, catalyzing the transfer of the amino group of lysine to an acceptor acid to generate 2,3-dehydropipecolic acid. 2,3-dehydropipecolic acid is then hydrogenated to pipecolic acid by SARD reductase, and further oxidized by flavin monooxygenase (FMO) to obtain nitrogen-hydroxylated pipecolic acid (NHP). Studies have found that NHP plays an important role in plant disease resistance immunity, especially in systemic acquired resistance; however, the role of NHP in plant insect resistance remains unclear.

[0004] In 2004, Professor Jean Greenberg's team at the University of Chicago published a research paper titled "Divergent roles in Arabidopsis thaliana development and defense of two homologous genes, and aberrant growth and death2 and AGD2-LIKE DEFENSE RESPONSE PROTEIN1, encoding novel aminotransferases" online in The Plant Cell, a renowned international journal in the field of plant science. This study found that the Arabidopsis plastid protein ALD1 plays an important role in Arabidopsis' defense against pathogens. In 2012, Professor Jurgen Zeier's team at the University of Düsseldorf, Germany, published a research paper titled "Pipecolic acid, an endogenous mediator of defense amplification and priming, is a critical regulator of inducible plant immunity" in The Plant Cell, revealing that the transient accumulation of ALD1 in the epidermis of local leaves in Arabidopsis activates its local disease resistance and the systemic acquired resistance (SAR) in distal leaves. Summary of the Invention

[0005] This research group explored the potential application of the OsALD1 gene in regulating rice resistance to pests and diseases. Experiments confirmed that the OsALD1 gene is associated with rice resistance to the rice leaf folder. Knocking out the OsALD1 gene using CRISPR / Cas9 resulted in mutant rice seedlings exhibiting stronger resistance to the rice leaf folder compared to the wild type. This result indicates that the OsALD1 gene and its encoded protein can be used to regulate rice resistance (insect) to the rice leaf folder, and the rice OsALD1 gene or protein can be applied to rice insect resistance breeding. Based on this, the present invention provides the following technical solution.

[0006] The first aspect of the invention provides the application of AGD2-like defense response protein 1, namely ALD1 (AGD2-like DEFENSERESPONSE PROTEIN 1), as a target in regulating plant resistance to rice leaf roller.

[0007] The above application is a method to improve the resistance of plants to rice leaf folder by targeting the ALD1 gene (abbreviated ALD1), which includes the following steps: downregulating, inactivating, weakening or knocking out the ALD1 gene expression in the chromosomes of wild-type plants, resulting in the inhibition or death of rice leaf folders that feed on plants such as rice.

[0008] For example, the ALD1 mentioned above is rice-derived ALD1, namely OsALD1 (NCBI accession number NM_001417311.1), whose amino acid sequence is SEQ ID NO:2, and the nucleotide sequence of the expression gene OsALD1 is SEQ ID NO:1.

[0009] The above applications can be implemented in the following ways:

[0010] (1) Knock out the ALD1 gene from the chromosomes of wild-type plants;

[0011] (2) Downregulate the expression level of gene ALD1 in chromosomes of wild-type plants;

[0012] (3) Replace the ALD1 gene in the chromosome of wild-type plants with a mutant of the ALD1 gene that has lost or downregulated coding function; and / or

[0013] (4) Block, inhibit or interfere with the expression of the ALD1 gene in the chromosomes of wild-type plants.

[0014] In one specific implementation, the above method (2) is selected from the group below:

[0015] (2-1) Mutations in the promoter region and / or coding region of the ALD1 gene lead to downregulation of the expression level of the ALD1 gene;

[0016] (2-2) Mutations in the upstream regulators of the ALD1 gene lead to downregulation of ALD1 expression; or

[0017] (2-3) Introduce ALD1 interacting proteins into wild-type plants to alter the function of the ALD1 gene.

[0018] Furthermore, the mutation in the coding region described in the above method (2-1) is a frameshift mutation, which leads to the inactivation or loss of function of AGD2-like defense response protein 1, namely ALD1.

[0019] Optionally, when the plant is rice, the mutation in the coding region in method (2-1) is a frameshift mutation, selected from the following group of forms:

[0020] (a) One C (cytosine) was inserted between positions 372 and 373 of the CDS nucleotide sequence SEQ ID NO:1 in the coding region of the OsALD1 gene, forming the ALD1 deletion mutant ald1-1, which caused premature termination of translation of the OsALD1 protein, which can only encode a length of 130 amino acids.

[0021] (b) The OsALD1 coding region, namely the CDS nucleotide sequence SEQ ID NO:1, is replaced by the insertion fragment AGTGTGACATTGCTCGTCTTC, forming the ALD1 deletion mutant ald1-2. This causes premature termination of translation of the OsALD1 protein, which can only encode a length of 132 amino acids.

[0022] (c) The sequence fragment from position 356 to 413 of the CDS nucleotide sequence SEQ ID NO:1, namely ACAAGGTGTACCCTGACATGGGGATAAAAGAGAGTGAAGTTTTCATTTCAGACG GAGC (58bp), is deleted in the OsALD1 coding region, forming the ALD1 deletion mutant ald1-3. This causes premature termination of translation of the OsALD1 protein, which can only encode a length of 150 amino acids.

[0023] In this case, the ALD1 mutant described in the above method (3) is the mutant ald1-1, ald1-2 or ald1-3 as described in claim 5-1.

[0024] While it is theoretically possible to improve plant resistance to rice leaf folder by overexpressing exogenous ALD1 mutants such as ald1-1, ald1-2, or ald1-3 in plants like rice, it is preferable to implement the above-mentioned steps of downregulating, inactivating, weakening, or knocking out ALD1 expression in the chromosomes of wild-type plants through gene editing technology, antisense nucleic acids, and transcriptional regulation, considering that overexpression of exogenous genes often leads to abnormal plant physiological homeostasis.

[0025] In one implementation, the gene editing technology described above may be selected from the group consisting of: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0026] The above method (3) is a traditional recombinant plasmid transformation scheme that enables plants, such as rice, to overexpress exogenous gene ALD1 mutants, such as ald1-1, ald1-2 or ald1-3.

[0027] The recombinant plasmid transformation scheme involves cloning the ALD1 gene mutant into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, and then transforming plants using the Agrobacterium-mediated transformation method to obtain transgenic plants that overexpress the ALD1 gene mutant.

[0028] Alternatively, conventional recombinant plasmid transformation protocols that enable plants, such as rice, to overexpress exogenous ALD1 mutant genes can be implemented in conjunction with gene editing technologies such as CRISPR systems.

[0029] The recombinant plasmid transformation scheme involves cloning the ALD1 gene mutant into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, and then transforming plants using the Agrobacterium-mediated transformation method to obtain transgenic plants that overexpress the ALD1 gene mutant.

[0030] In a preferred embodiment, the method for constructing transgenic plants may include the following steps: constructing a knockout vector for the ALD1 gene using a CRISPR / Cas9 genome editing system; then transferring the knockout vector into rice cells and integrating it into the chromosome by infecting rice callus tissue with Agrobacterium tumefaciens; and screening for cells, tissues, or organs that have successfully knocked out the OsALD1 gene to regenerate plants.

[0031] Preferably, the plant is a grass crop selected from the group consisting of rice, wheat, corn, barley, oats, rye, sorghum, and millet, with rice being the most preferred plant.

[0032] A direct method to test the insect resistance of the above-mentioned transgenic plants is to examine whether transgenic plant seeds, such as transgenic rice seeds, exhibit increased resistance to rice leaf rollers compared to wild-type seeds under water-flooded conditions.

[0033] A second aspect of the present invention provides a method for identifying rice varieties resistant to rice leaf roller, comprising the following steps:

[0034] Sequencing of the rice gene OsALD1 (NCBI accession number NM_001417311.1), and / or

[0035] The determination was made to determine whether the protein expressed by the rice cells contained a polypeptide with the amino acid sequence shown in SEQ ID NO:2.

[0036] When the detection results show that the coding region of the corresponding gene OsALD1 in the rice genome, i.e., the CDS nucleotide sequence, is not SEQ ID NO:1, or when the protein expressed by rice cells does not contain the amino acid sequence OsALD1 as shown in SEQ ID NO:2, it suggests that the rice variety has a tendency to resist rice leaf folder, and the rice variety is considered as a candidate for rice leaf folder resistant varieties.

[0037] The advantage of the aforementioned gene identification scheme lies in the fact that it is possible to pre-assess the potential resistance of candidate plant varieties to the rice leaf roller solely in the laboratory. Since the entire life cycle of crops such as rice is typically one year or six months, normally examining their biological traits and phenotypes through field cultivation would inevitably consume a significant amount of time and resources, including land and manpower. In contrast, the gene identification scheme can be completed in the laboratory, allowing for gene sequencing in a short period, such as on seedlings within a few weeks, or even just on seeds. This significantly improves efficiency and substantially saves time, space, and manpower costs, resulting in substantial economic benefits.

[0038] Accordingly, another aspect of the present invention also provides a kit for carrying out the identification method, comprising the following PCR primers for amplifying the OsALD1 gene:

[0039] Forward primer RT-OsALD1-F: ATGCCTGTCAATATGATCTCCAAG (SEQ ID NO:4)

[0040] Reverse primer RT-OsALD1-R: TCATGCGAGGAAGCTTTTGAGG (SEQ ID NO:5).

[0041] Preferably, the above kit also includes the following PCR primers for detecting the internal reference gene Actin2Ubi:

[0042] Forward primer RT-Ubi-F: AACCAGCTGAGGCCCAAGA (SEQ ID NO:6),

[0043] Reverse primer RT-Ubi-R: ACGATTGATTTAACCAGTCCATGA (SEQ ID NO:7).

[0044] Furthermore, the kit also includes an instruction manual that describes the steps and identification criteria for detecting the rice gene OsALD1.

[0045] For example, the instructions can be written on bottles, test tubes and similar objects, boards, or on a separate piece of paper, or on the outside or inside of a container, such as a paper document with an operation demonstration video app download window or a QR code. The instructions can also be in multimedia form, such as a CD, USB flash drive, or cloud storage.

[0046] This invention newly discovers that the OsALD1 gene and its encoded protein can be used to regulate rice resistance to the rice leaf folder, providing a valuable genetic resource for developing new crop varieties resistant to the rice leaf folder and showing promising application prospects. OsALD1 gene knockout lines exhibit inhibited growth of the rice leaf folder that feeds on rice seedlings, and a significantly reduced rate of leaf curling caused by rice leaf folder damage in the field. Therefore, the ALD1 gene is of great significance for addressing the damage caused by the rice leaf folder, one of the most important pests in rice production, reducing pesticide use, protecting rice yield, and ensuring food security. Attached Figure Description

[0047] Figure 1 The gene sequences of three OsALD1 mutants obtained using CRISPR / Cas9 are shown.

[0048] Figure 2 This chart shows the weight statistics of rice leaf roller larvae feeding on wild-type rice (Zh11) and ALD1 deletion mutants ald1-1, ald1-2, and ald1-3 ten days after seedling emergence. Wild-type (ZH11) and ALD1 deletion mutants ald1-1, ald1-2, and ald1-3 were hydroponically cultured in a greenhouse (14h / 10h light / dark, 28℃, 65% humidity) until tillering stage, then individually transferred to plastic cups containing hydroponic solution, with 12 biological replicates per line. Four days later, three newly hatched rice leaf roller larvae were inoculated onto each seedling and allowed to feed freely. Ten days later, the larvae were weighed. Different letters on each bar in the chart represent statistical differences between data points (one-way ANOVA).

[0049] Figure 3 This chart shows the statistical bar graphs of leaf curling rates in wild-type rice (Zh11) and the ALD1 deletion mutants ald1-1, ald1-2, and ald1-3 caused by rice leaf folder damage. Wild-type and ALD1 mutant rice were planted at the experimental base of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, in Poliu Village, Yelin Town, Lingshui County, Hainan Province, with 48 plants per line. The leaf curling rate caused by rice leaf folder damage was statistically analyzed during the grain-filling stage. Leaf curling rate = number of curled leaves / total number of leaves * 100; different letters on each bar in the chart represent statistical differences between data points (one-way ANOVA). Detailed Implementation

[0050] As mentioned earlier, Jean Greenberg's team studied ALD1, an aminotransferase located in the plastids of Arabidopsis thaliana. Arabidopsis-derived ALD1 plays a crucial role in Arabidopsis' resistance to the pathogenic bacterium *Pseudomonas syringae*, including defensive functions and systemically acquired resistance (SAR). However, this study did not report whether ALD1 could enhance Arabidopsis' resistance to insect pests.

[0051] In our study on rice resistance to the rice leaf folder, we found a negative correlation between the OsALD1 gene and rice resistance to this pest. Knocking out the OsALD1 gene using CRISPR / Cas9 improved the insect resistance of the mutant plants, which seems inconsistent with the findings of Jean Greenberg's team. The reasons for this require further investigation.

[0052] In the experiment, we constructed OsALD1 gene mutants ald1-1, ald1-2, and ald1-3 through frameshift mutation. The transgenic plants obtained showed improved agronomic traits compared with wild-type rice, such as inhibiting the growth and development of rice leaf roller larvae and reducing leaf rolling rate. This suggests that the ALD1 gene can be used as a target to improve the plant's resistance to harmful insects and to breed new insect-resistant plant varieties.

[0053] As used in this article, the term "wild-type (WT)" refers to native plants that have a normal phenotype and express the normal aminotransferase ALD1 gene, such as indica rice varieties Zh11 and Kasalath.

[0054] Correspondingly, the terms "transgenic plant" and "genetically engineered plant" in this article have the same meaning, referring to plants that have been genetically engineered to exhibit resistance to the rice leaf roller after being grown from wild-type plants or plants with normal biological phenotypes.

[0055] In some implementations, the terms “(resistance to rice leaf roller) improved” or “enhanced” can mean an improvement of at least 10% compared to a reference level (e.g., normal plants), such as an improvement of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any improvement between 10% and 100%, or an improvement of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a reference level.

[0056] In this document, for the sake of simplicity, the name of a protein, such as the aminotransferase ALD1, and its encoding gene (DNA) are sometimes used interchangeably. Those skilled in the art should understand that they refer to different substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, when describing the function or class of the aminotransferase OsALD1 (NCBI accession number NM_001417311.1), it refers to the protein; when described as a gene, it refers to the gene encoding the enzyme.

[0057] There are various techniques for inactivating, attenuating, and / or preventing the expression of ALD1 genes, such as OsALD1, in plants. These techniques can be used individually or in combination. For example, one inactivation method is to mutate the ALD1 encoding gene, causing an alteration in the amino acid sequence of the polypeptide and / or termination of translation.

[0058] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0059] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the invention.

[0060] Examples

[0061] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0062] In the embodiments, if the operating temperature is not specifically specified, it generally refers to room temperature (15-35°C).

[0063] Materials and general methods

[0064] The gene sequencing and primer synthesis in this embodiment were outsourced to Sangon Biotech (Shanghai) Co., Ltd.

[0065] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0066] Molecular biology methods, including gene editing technology, and methods for constructing transgenic plants are operated using techniques commonly used in the field.

[0067] plant materials

[0068] The wild-type (WT) used in this study was Zh11 (preserved in our laboratory). OsALD1 gene deletion mutants ald1-1, ald1-2, and ald1-3 were obtained using CRISPR / Cas9 technology and used for further experiments.

[0069] Genetic transformation

[0070] 1. Callus Induction: Select mature and plump rice seeds, remove the husk; disinfect with 75% alcohol for 1-2 minutes, then discard the alcohol; rinse twice with sterile distilled water; soak in 0.15% mercuric chloride (containing 0.1% Tween-20) for 15-18 minutes, shaking several times during this period; discard the mercuric chloride, and rinse 5 times with sterile distilled water. Inoculate the sterilized seeds into the callus induction medium and culture at 32℃ under light for 5-10 days.

[0071] 2. Agrobacterium streak activation: Two days before infection, Agrobacterium was streaked on LB medium containing 50 mg / L kanamycin and incubated at 28°C.

[0072] 3. Agrobacterium suspension, infection, and co-culture: Before infection, activated Agrobacterium was scraped into suspension medium and cultured at 28°C with shaking at 180 rpm for 3–3.5 h. The bacterial concentration was then adjusted to OD600 = 0.1–0.2 using suspension medium. Callus tissue induced for 5–10 days was placed in the Agrobacterium suspension and infected for 1.5 min. The bacterial suspension was discarded, and the surface of the callus was blotted dry with sterile filter paper. The callus surface was covered with sterile filter paper and dried in a laminar flow hood for 30 min. After drying, the callus was transferred to co-culture medium covered with a layer of sterile filter paper, incubated overnight at 20°C in the dark, and then transferred to a 25°C incubator for further dark incubation for 2 days.

[0073] 4. Cleaning: After co-culturing, transfer the callus tissue to an empty sterile container using forceps. Wash the callus repeatedly with sterile distilled water 7-8 times, with the first 3 washes being quick and the subsequent 3-4 washes involving soaking for 3-5 minutes each. Finally, soak the callus in sterile distilled water containing 500 mg / L Cn for 30 minutes. Discard the solution, blot the surface of the callus as dry as possible with sterile filter paper, cover the callus surface with another layer of sterile filter paper, and air dry in a laminar flow hood for 1 hour.

[0074] 5. Screening: Place the cleaned callus on the screening medium and incubate at 32°C under light for 14 days.

[0075] 6. Differentiation: After 14 days of screening, the resistant callus was transferred to differentiation medium and cultured at 28°C (photocycle of 14h light / 10h dark).

[0076] 7. Rooting: When the resistant callus forms a 3-4 cm tall regenerated seedling on the differentiation medium, transfer it to the rooting medium for culture until a complete plant is formed.

[0077] hydroponic experiment

[0078] Seeds of wild-type and mutant lines ald1-1, ald1-2, and ald1-3 were soaked in water at 37°C for 2 days, then transferred to a wire mesh containing 1 / 2 Kimura B nutrient solution at 25°C. After 2 weeks, the plants were transferred to 1 / 2 Kimura B nutrient solution for further cultivation. The pH of the nutrient solution was adjusted to 5.5, and the solution was changed every 3 days. The plants were then hydroponically cultured in a greenhouse (14h / 10h light / dark, 28°C, 65% humidity) until tillering. Individual plants were then transferred to plastic cups containing hydroponic solution and planted singly, with 12 biological replicates per line.

[0079] Feeding experiment of rice leaf roller larvae

[0080] Four days after the hydroponic experiment ended, three newly hatched rice leaf roller larvae were inoculated onto each seedling and allowed to feed freely. Ten days later, the rice leaf roller larvae were weighed.

[0081] Field survey of rice leaf roller damage

[0082] Wild-type and ALD1 mutant rice varieties were planted at the experimental base of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, in Poliu Village, Yelin Town, Lingshui County, Hainan Province, with 48 plants per line. During the grain-filling stage, the leaf-rolling rate caused by rice leaf roller damage was calculated. Leaf-rolling rate = (number of rolled leaves / total number of leaves) * 100.

[0083] Some of the PCR primers used in the examples are listed in Table 1.

[0084] Table 1. Some PCR primers used in the examples

[0085]

[0086]

[0087] In Table 1, "-F" in the name represents positive; "-R" represents negative.

[0088] Example 1: Construction of OsALD1 gene knockout mutant

[0089] To investigate the effect of OsALD1 gene knockout on rice disease and pest resistance, we used the sequence GACAAGGTGTACCCTGACATGGG (SEQ ID NO:3) from positions 355 to 377 of the OsALD1 coding region sequence as the sgRNA target, obtaining three mutants, such as... Figure 1 As shown: mutant ald1-1 inserts one C near the target sequence of the sgRNA; mutant ald1-2 replaces the original sequence CCTGACATGGGGAT with the inserted fragment AGTGTGACATTGCTCGTCTTC near the target sequence of the sgRNA; mutant ald1-3 deletes 58bp near the target sequence of the sgRNA.

[0090] The construction of the mutant ald1 involves the following steps.

[0091] 1. CRISPR vector construction and transformation

[0092] (1) Using online websites https: / / crispr.dbcls.jp / Knockout target sequences were designed and their specificity was validated using http: / / www.rgenome.net / cas-offinder / . GACAAGGTGTACCCTGACATGGG (SEQ ID NO:3) was selected as the target sequence.

[0093] (2) PCR was performed using ALD1_U6a_F and ALD1_U6a_R to introduce the target sequence between the gRNA of the pYLgRNA-OsU6a plasmid and the OsU6a promoter.

[0094] (3) Then, using BsaI (NEB, catalog number NEB#3733) and T4 ligase (Takara, catalog number 2011A), homologous recombination of the gRNA expression system into the Cas9 vector was performed by cutting and ligating simultaneously. The relevant vector sequence is referenced from the paper "CRISPR / Cas9-Based Multiplex Genome Editing in Monocot and Dicot Plants" published in Current Protocols in Molecular Biology.

[0095] (4) The vector was transformed into Agrobacterium EHA105 strain after being verified by sequencing.

[0096] (5) The vector was transformed into rice callus tissue using Agrobacterium-mediated transformation to obtain CRISPR transgenic rice.

[0097] 2. DNA was extracted from rice leaves using the TPS method for gene identification.

[0098] (1) Take 2-3 cm of rice leaves and put them into 2.0 mL EP tubes, and add 1 steel ball to each tube.

[0099] (2) Place the EP tube in liquid nitrogen for quick freezing for 60 to 90 seconds, then take it out and quickly place it in a grinder, and submerge it for 1 minute at a rate of 60 seconds / 60 Hz.

[0100] (3) After grinding, quickly draw 500 μL of TPS lysis solution into the EP tube, make sure to close the tube cap (to avoid evaporation during heating), and place it in an oven (65°C) for 60 min, shaking it vigorously every 20 min during this period.

[0101] (4) After the heating pyrolysis is completed, 300 μL of the solution in the EP tube is taken and placed in a 96-well plate. After balancing, the plate is centrifuged at 4000 rpm for 10 min in a large centrifuge.

[0102] (5) Transfer 150 μL of the supernatant to a new 96-well plate, add an equal volume of isopropanol in a fume hood, mix thoroughly by pipetting with a pipette tip, and place in a -20°C freezer for 30 min to allow DNA precipitation.

[0103] (6) After precipitation, balance the liquid, centrifuge at 4000 rpm for 10 min, and discard the supernatant;

[0104] (7) Add 300 μL of ethanol (75%) solution to a 96-well plate, balance the plate, centrifuge at 4000 rpm for 5 min, and discard the supernatant.

[0105] (8) Repeat the previous step and use a paper towel to absorb the remaining ethanol solution in the 96-well plate;

[0106] (9) Place the 96-well plate in an oven (65°C) for 30 minutes to allow the ethanol solution in the plate to evaporate completely.

[0107] (10) Take out the 96-well plate, add 50 μL of sterile water to dissolve the DNA, micro-incubate for 1 min and then store at -4℃ for short-term use or freeze at -20℃ for long-term storage for genotype detection.

[0108] 3. Detection of mutations in the rice gene ALD1

[0109] (1) Using ALD1_seq_F and ALD1_seq_R as amplification primers, the target gene fragment of transgenic rice was amplified using Phanta high-fidelity enzyme (Novizan, catalog number P505-d1) and then sent to Sangon Biotech for sequencing.

[0110] (2) Using Cas9_F and Cas9_R as amplification primers, Phanta high-fidelity enzyme was used to amplify Cas9 on the transgenic vector in transgenic rice. Individuals whose target genes had been edited and did not contain Cas9 transgenic events were selected for subsequent experiments.

[0111] The transgenic rice obtained through the above methods was identified at the genome level, yielding three OsALD1 knockout mutants: ald1-1, ald1-2, and ald1-3.

[0112] Example 2: Results of an experiment on rice seedling feeding by rice leaf roller larvae

[0113] Feeding experiments on rice leaf folder larvae revealed that, compared to wild-type rice leaf folder larvae, those feeding on mutants ald1-1, ald1-2, and ald1-3 experienced weight reductions of 35%, 19%, and 51%, respectively. (See [reference needed]). Figure 2 .

[0114] The results indicate that, compared to wild-type rice, the rice leaf roller larvae showed slower weight gain after feeding on mutants ald1-1, ald1-2, and ald1-3, suggesting that the growth and development of the rice leaf roller larvae were inhibited.

[0115] Example 2: Results of a field study on the invasiveness of rice leaf roller on rice.

[0116] Field surveys of rice leaf roller damage revealed that, compared to wild-type rice, the mutants ald1-1, ald1-2, and ald1-3 exhibited significantly lower incidence (leaf roller rate) rates in the field, with rates decreasing by 45%, 56%, and 35%, respectively. (See [reference needed]) Figure 3 .

[0117] The results indicate that, compared to wild-type rice, the leaf rolling rate of mutant lines ald1-1, ald1-2, and ald1-3 was reduced, suggesting that the damage caused by the rice leaf roller was mitigated to some extent.

[0118] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of AGD2-like defense response protein 1, namely ALD1, as a target in improving plant resistance to rice leaf roller.

2. The application as described in claim 1, which is a method for improving plant resistance to rice leaf folder by targeting the ALD1 gene, characterized in that, Includes the following steps: It causes downregulation, inactivation, weakening or knockout of ALD1 expression in the chromosomes of wild-type plants. In one embodiment, the ALD1 mentioned above is rice-derived AGD2-like defense response protein 1, namely OsALD1 (NCBI accession number is NM_001417311.1), whose amino acid sequence is SEQ ID NO:2, and the nucleotide sequence of the expression gene OsALD1 is SEQ ID NO:

1.

3. The application as described in claim 2, characterized in that, Implemented in the following manner: (1) Knock out the ALD1 gene in the chromosomes of wild-type plants; (2) Downregulate the expression level of gene ALD1 in chromosomes of wild-type plants; (3) Replace the ALD1 gene in the chromosome of wild-type plants with a mutant of the ALD1 gene that has lost or downregulated coding function; and / or (4) Block, inhibit or interfere with the expression of the ALD1 gene in the chromosomes of wild-type plants.

4. The application as described in claim 3, characterized in that, Method (2) is selected from the following group: (2-1) Mutations in the promoter region and / or coding region of the ALD1 gene lead to downregulation of the expression level of the ALD1 gene; (2-2) Mutations in the upstream regulators of the ALD1 gene lead to downregulation of ALD1 expression; or (2-3) Introduce ALD1 interacting proteins into wild-type plants to alter the function of the ALD1 gene.

5. The application as described in claim 4, characterized in that, The mutation in the coding region described in method (2-1) is a frameshift mutation, which leads to the inactivation or loss of function of ALD1.

6. The application as described in claim 5, characterized in that, When the plant is rice, the mutation in the coding region described in method (2-1) is a frameshift mutation, selected from the following group of forms: (a) A cytosine (C) was inserted between positions 372 and 373 of the CDS nucleotide sequence SEQ ID NO:1 in the coding region of the OsALD1 gene, forming an ALD1 deletion mutant ald1-1, which caused premature termination of translation of the OsALD1 protein, which can only encode a length of 130 amino acids. (b) The OsALD1 coding region, namely the CDS nucleotide sequence SEQ ID NO:1, is replaced by the insertion fragment AGTGTGACATTGCTCGTCTTC, forming the ALD1 deletion mutant ald1-2. This causes premature termination of translation of the OsALD1 protein, which can only encode a length of 132 amino acids. (c) The sequence fragment from position 356 to 413 of the CDS nucleotide sequence SEQ ID NO:1, namely ACAAGGTGTACCCTGACATGGGGATAAAAGAGAGTGAAGTTTTCATTTCAGACG GAGC (58bp), is deleted in the OsALD1 coding region, forming the ALD1 deletion mutant ald1-3. This causes premature termination of translation of the OsALD1 protein, which can only encode a length of 150 amino acids.

7. The application as described in claim 2, characterized in that, The steps are implemented through gene editing technology, antisense nucleic acids, and transcriptional regulation.

8. The application as described in claim 1, characterized in that, The plant is selected from the following grasses: rice, wheat, corn, barley, oats, rye, sorghum, and millet, with rice being the preferred plant.

9. A method for identifying rice varieties resistant to rice leaf roller, characterized in that, Includes the following steps: Sequencing of the rice gene OsALD1 (NCBI accession number NM_001417311.1), and / or The determination was made to determine whether the protein expressed by the rice cells contained a polypeptide with the amino acid sequence shown in SEQ ID NO:

2. When the test results show that the coding region of the corresponding gene OsALD1 in the rice genome, i.e., the CDS nucleotide sequence, is not SEQ ID NO:1, or when the protein expressed by rice cells does not contain the amino acid sequence OsALD1 as shown in SEQ ID NO:2, it suggests that the rice variety has a tendency to resist rice leaf roller.

10. A kit for performing the identification method as described in claim 9, characterized in that, The following PCR primers are included for amplifying the OsALD1 gene: Forward primer RT-OsALD1-F: ATGCCTGTCAATATGATCTCCAAG (SEQ ID NO:4), Reverse primer RT-OsALD1-R: TCATGCGAGGAAGCTTTTGAGG (SEQ ID NO:5). Preferably, the above kit also includes the following PCR primers for detecting the internal reference gene Ubi: Forward primer RT-Ubi-F: AACCAGCTGAGGCCCAAGA (SEQ ID NO:6), Reverse primer RT-Ubi-R: ACGATTGATTTAACCAGTCCATGA (SEQ ID NO:7).

Images