Application of rice WRKY transcription factor OsWRKY36 in regulating plant absorption and transport of pesticides

Abstract

The application provides application of rice WRKY transcription factor OsWRKY36 in regulation of plant absorption and transportation of pesticides. Through gene engineering means such as CRISPR gene targeting editing technology and construction of overexpression vectors, the OsWRKY36 gene is subjected to gene knockout or up-regulation of expression, and rice mutants with deficiency of OsWRKY36 gene function or up-regulation of expression are obtained, it is found that knockout of OsWRKY36 can significantly improve the absorption and transportation of rice to pesticides, and the transportation of improved rice varieties to pesticides is improved, and overexpression can inhibit the absorption of rice to pesticides. Therefore, OsWRKY36 has important significance in regulation of absorption and transportation of rice to pesticides, reduction of use amount of pesticides in rice field, breeding of new rice varieties with high efficiency of utilization of pesticides and the like, and also provides a new clue for research on utilization mechanism of rice to pesticides.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically relating to the application of rice WRKY transcription factor OsWRKY36 in regulating the absorption and transport of pesticides in plants. Background Technology

[0002] Rice (Oryza sativa L.) is one of the world's most important food crops. Rice planthoppers are pests that threaten both the yield and quality of rice. There are three main types of rice planthoppers: the brown planthopper (Nilaparvata lugens). The rice planthopper *Laodelphaxstriatellus* (Fallén) and the white-backed planthopper *Sogatella furcifera* (Horváth) are two common species. Rice planthoppers can multiply rapidly after their appearance, causing widespread and devastating damage to rice paddies if not controlled promptly. They can also differentiate into migratory forms to spread further, seriously jeopardizing rice production in my country. To control this pest, farmers often use various pesticides, among which thiamethoxam is a commonly used insecticide. Thiamethoxam belongs to the neonicotinoid class of pesticides and has broad-spectrum insecticidal efficacy, effectively controlling rice planthoppers and other insects. Furthermore, thiamethoxam has a relatively short residual period, effectively reducing its impact on the environment and non-target organisms. In rice cultivation management, the rational use of thiamethoxam helps increase rice yield and ensure food security. Through scientific control measures, farmers can better cope with the challenges posed by rice planthoppers and promote healthy rice growth.

[0003] However, in practical applications, the effectiveness of thiamethoxam is not only related to its own efficacy but also influenced by many factors, including application method, timing, and crop absorption capacity. Studies have shown that improving pesticide utilization is crucial to ensuring ideal control effects while reducing pesticide dosage. Strategies for improving pesticide utilization include precision application, selecting appropriate application timing, and strengthening research related to pesticide transport proteins. OsATL15, a thiamethoxam transport protein in rice, is involved in the transport and distribution of thiamethoxam. Regulating the expression of OsATL15 can improve the absorption and utilization of thiamethoxam in rice, thereby enhancing its control effect. A rational pesticide application strategy, combined with functional research on OsATL15, can improve pesticide utilization, achieve more precise pest and disease control, and ensure healthy rice growth and high yield. Therefore, in-depth research on the crop absorption mechanism of thiamethoxam and the function of related transport proteins can not only effectively control rice pests and safeguard food security, but also reduce the burden on the environment. This will help improve the effective utilization rate of pesticides, reduce the negative impact of pesticide use, and achieve sustainable agricultural development.

[0004] Transcription factors (TFs) are proteins that specifically bind to cis-acting elements in the promoter regions of eukaryotic genes; they are also called trans-acting factors. WRKY transcription factors are an important class of transcriptional regulators that play a crucial role in plant growth and development, stress response, and physiological regulation. This type of transcription factor exists in a rich gene family in rice and plays a key role in various biological processes. The structural features of WRKY transcription factors mainly include an N-terminal WRKY domain and a C-terminal zinc finger domain. The main function of the WRKY domain is to specifically bind to the W-box element of the target gene promoter, thereby regulating the transcription of the target gene, while the zinc finger domain plays an important role in the stability and function of WRKY transcription factors. Based on the number of WRKY domains and the type of zinc finger domains, WRKY transcription factors can be divided into three categories: Group I transcription factors contain two WRKY domains and one C2H2 type zinc finger structure; Group II contains one WRKY domain and one C2H2 type zinc finger structure; and Group III contains one WRKY domain and one C2HC type zinc finger structure. This classification can explain the functional diversity of WRKY transcription factors and provides an important theoretical basis for subsequent research.

[0005] WRKY transcription factors play crucial roles in rice growth, development, stress response, and metabolic regulation. Studies have shown that WRKY transcription factors not only regulate plant resistance to pathogens but also play a key role in plant responses to environmental stresses such as drought, salinity, and cold. For example, WRKY45 is an important transcription factor involved in rice disease resistance; it enhances plant resistance to pathogens by regulating the expression of a series of defense genes. WRKY26 and WRKY40 also show important roles in regulating rice disease resistance. Furthermore, complex interactions exist among WRKY transcription factors. Some WRKY transcription factors may enhance or inhibit the function of other WRKY transcription factors by forming heterodimers or homodimers. For example, the interaction between WRKY11 and WRKY15 is considered to play an important role in regulating plant responses to drought stress. In the future, with the development of gene editing technologies (such as CRISPR-Cas9), researchers will be able to more precisely regulate the expression of WRKY transcription factors, explore their mechanisms of action, and understand their multiple roles in complex physiological processes. Specifically, WRKY transcription factors appear to have evolved to cope with numerous different stresses and play an important role in transcriptional reprogramming related to plant immune responses. Patent CN118459566A discloses a pleiotropic transcription factor OsWRKY36, its encoding gene, and its applications. It has been found that knocking out or reducing the expression of this protein-encoding gene can lead to enhanced resistance in susceptible plants, thereby enabling the breeding of transgenic plants resistant to diseases and pests. The protein and its encoding gene can be applied to plant genetic improvement. However, research on the role of WRKY transcription factor OsWRKY36 in regulating pesticide absorption and transport in plants has not yet been reported. Summary of the Invention

[0006] The purpose of this invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide the application of rice WRKY transcription factor OsWRKY36 in regulating the absorption and transport of pesticides by plants.

[0007] The second objective of this invention is to provide the application of rice OsWRKY36 gene expression cassettes, recombinant vectors or recombinant strains containing rice OsWRKY36 gene in regulating the absorption and transport of pesticides by plants.

[0008] A third objective of this invention is to provide the application of reagents for knocking out or inhibiting the expression of the rice OsWRKY36 gene in the cultivation of transgenic plants that efficiently utilize pesticides.

[0009] The fourth objective of this invention is to provide the application of molecular marker detection primers for the rice OsWRKY36 gene in identifying plants that efficiently utilize pesticides.

[0010] The fifth objective of this invention is to provide the application of rice WRKY transcription factor OsWRKY36 as a pesticide absorption enhancer in regulating plant height.

[0011] The above-mentioned objective of this invention is achieved through the following technical solution:

[0012] Because the OsATL15 gene can enhance the absorption and translocation of pesticides in rice, allowing them to reach the sites of pest damage and reducing the amount of pesticides used in paddy fields; it can also genetically improve the pesticide transportability of rice varieties, leading to the breeding of rice varieties with high pesticide utilization efficiency. This invention discovers that the rice transcription factor OsWRKY36 can bind to the OsATL15 promoter, regulating OsATL15. The inventors used CRISPR gene-targeted editing technology and gene engineering techniques such as constructing overexpression vectors to knock out or upregulate the expression of the OsWRKY36 gene, obtaining rice mutants with OsWRKY36 gene loss of function or upregulated expression. They found that OsWRKY36 knockout also significantly improved the absorption and translocation of pesticides such as thiamethoxam, chlorantraniliprole, acephate, cartap, carbofuran, methomyl, bensulfuron-methyl, and tricyclazole in rice, improving the pesticide transportability of rice varieties. Simultaneously, overexpression of OsWRKY36 inhibited the absorption of these pesticides by rice.

[0013] Therefore, the present invention provides the application of rice WRKY transcription factor OsWRKY36 in regulating the absorption and transport of pesticides in plants, wherein the amino acid sequence of rice WRKY transcription factor OsWRKY36 is shown in SEQ ID No. 1.

[0014] The present invention also provides the application of the rice OsWRKY36 gene or expression cassettes, recombinant vectors or recombinant strains containing the rice OsWRKY36 gene in regulating the absorption and transport of pesticides by plants, wherein the amino acid sequence of the protein encoded by the rice OsWRKY36 gene is shown in SEQ ID No. 1.

[0015] The present invention also provides the application of reagents for knocking out or inhibiting the expression of the rice OsWRKY36 gene in the cultivation of transgenic plants that utilize pesticides efficiently, wherein the amino acid sequence of the protein encoded by the rice OsWRKY36 gene is shown in SEQ ID No. 1.

[0016] This invention also provides the application of molecular marker detection primers for the rice OsWRKY36 gene in identifying plants that efficiently utilize pesticides. The molecular marker detection primers are used to identify the expression level of OsWRKY36 to determine the sensitivity of plants to pesticide treatment. The amino acid sequence of the protein encoded by the rice OsWRKY36 gene is shown in SEQ ID No. 1.

[0017] Furthermore, the nucleotide sequences of the molecular marker detection primers are shown in SEQ ID No. 3 and SEQ ID No. 4.

[0018] Furthermore, the nucleotide sequence of the rice OsWRKY36 gene is any one of the following A) to C):

[0019] A. A nucleotide sequence as shown in SEQ ID No. 2;

[0020] B. Under strict conditions, it hybridizes with the nucleotides specified in A and encodes a nucleotide sequence of the amino acid shown in SEQ ID No. 1;

[0021] C. Has at least 70% homology with the nucleotide sequence defined by A, and encodes a nucleotide sequence consisting of the amino acids shown in SEQ ID No. 1.

[0022] This invention demonstrates that the contents of thiamethoxam (THX), chlorantraniliprole, acephate, cartap, carbofuran, methomyl, bensulfuron-methyl, and tricyclazole in both the aboveground and underground parts of OsWRKY36 knockout mutant rice lines are higher than those in the wild type. Conversely, the contents of thiamethoxam (THX), chlorantraniliprole, acephate, cartap, carbofuran, methomyl, bensulfuron-methyl, and tricyclazole in both the underground and aboveground parts of OsWRKY36 overexpression rice lines are lower than those in the wild type. In conclusion, the ability of rice varieties to transport pesticides can be genetically improved, leading to the breeding of rice varieties with high pesticide utilization efficiency. Therefore, the OsWRKY36 gene can be applied to cultivate rice varieties with high pesticide utilization efficiency.

[0023] Furthermore, the pesticide is a systemic pesticide.

[0024] Furthermore, the systemic pesticide is one or more of the following: neonicotinoid insecticides, diamide insecticides, organophosphate insecticides, nereistoxin insecticides, carbamate insecticides, sulfonylurea herbicides, or thiazole fungicides.

[0025] Preferably, the neonicotinoid insecticide is thiamethoxam, the diamide insecticide is chlorantraniliprole, the organophosphate insecticide is acephate, the nereistoxin insecticide is cartap, the carbamate insecticide is carbofuran or methomyl, the sulfonylurea herbicide is bensulfuron-methyl, and the thiazole fungicide is tricyclazole.

[0026] This study also found that the plant height (aboveground parts) and root length (belowground parts) of OsWRKY36 knockout mutant rice lines did not change significantly compared to the wild type; however, the plant height and root length of OsWRKY36 overexpressing lines were shorter than those of the wild type, while the root length showed no significant difference. This indicates that OsWRKY36 can regulate rice plant height.

[0027] Therefore, the present invention also provides the application of rice WRKY transcription factor OsWRKY36 as a pesticide absorption enhancer in regulating plant height, wherein the amino acid sequence of rice WRKY transcription factor OsWRKY36 is shown in SEQ ID No. 1.

[0028] Furthermore, the aforementioned plant is rice.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] This invention provides the application of the rice WRKY transcription factor OsWRKY36 in regulating pesticide absorption and transport in plants. This invention discovers that the rice transcription factor OsWRKY36 can bind to the OsATL15 promoter, regulating OsATL15. Through gene engineering techniques such as CRISPR gene targeting editing and constructing overexpression vectors, the OsWRKY36 gene can be knocked out or its expression upregulated, obtaining rice mutants with OsWRKY36 gene loss of function or upregulated expression. It was found that OsWRKY36 knockout significantly improves the absorption and transport of pesticides in rice, improving the pesticide delivery capabilities of rice varieties. Therefore, OsWRKY36 is of great significance in regulating pesticide absorption and transport in rice, reducing pesticide use in paddy fields, and breeding new rice varieties with high pesticide utilization efficiency. It also provides new clues for studying the mechanism of pesticide utilization in rice. Attached Figure Description

[0031] Figure 1 The image shows the results of yeast single hybridization between the OsWRKY36 and Nipponbare OsATL15 promoters.

[0032] Figure 2 This image shows the subcellular localization of the OsWRKY36 protein-GFP in rice protoplasts. Figure 2 a, b, c, and d in the figure are the subcellular localization results of the protein GFP; e, f, g, and h are the subcellular localization results of the fusion protein OsWRKY36-GFP; a and e are the results under bright field; b and f are the green fluorescence under dark field; c and g are the red fluorescence of the nuclear localization protein mCherry-1008; d and h are the overlapping fields of view; scale bar = 20 μm.

[0033] Figure 3Figure showing the alignment results of the OsWRKY36 sequence between CRISPR knockout mutant plants and wild-type plants.

[0034] Figure 4 The image shows the results of real-time quantitative fluorescence PCR detection of OsWRKY36 expression levels in OsWRKY36-overexpressing rice lines.

[0035] Figure 5 The image shows the results of detecting thiamethoxam content in the underground and aboveground parts of OsWRKY36 mutant rice.

[0036] Figure 6 The image shows the results of detecting chlorantraniliprole content in the underground and aboveground parts of OsWRKY36 mutant rice.

[0037] Figure 7 The results of detecting acephate content in the underground and aboveground parts of OsWRKY36 mutant rice are shown in the figure.

[0038] Figure 8 The image shows the results of detecting the insecticide content in the underground and aboveground parts of OsWRKY36 mutant rice.

[0039] Figure 9 The image shows the results of detecting carbofuran content in the underground and aboveground parts of OsWRKY36 mutant rice.

[0040] Figure 10 The image shows the results of detecting the content of methomyl in the underground and aboveground parts of OsWRKY36 mutant rice.

[0041] Figure 11 The image shows the results of detecting the content of bensulfuron-methyl in the underground and aboveground parts of OsWRKY36 mutant rice.

[0042] Figure 12 The image shows the results of detecting tricyclazole content in the underground and aboveground parts of OsWRKY36 mutant rice.

[0043] Figure 13 The figure shows the results of detecting the content of thiamethoxam in the underground and aboveground parts of OsWRKY36 overexpressing rice lines.

[0044] Figure 14 The image shows the results of detecting chlorantraniliprole in the underground and aboveground parts of rice lines overexpressing OsWRKY36.

[0045] Figure 15 The results of detecting acephate in the underground and aboveground parts of OsWRKY36-overexpressing rice lines are shown in the figure.

[0046] Figure 16The results of detecting the presence of insecticide in the underground and aboveground parts of rice lines overexpressing OsWRKY36 are shown in the figure.

[0047] Figure 17 The results of detecting carbofuran in the underground and aboveground parts of OsWRKY36-overexpressing rice lines are shown in the figure.

[0048] Figure 18 The results of detecting methomyl in the underground and aboveground parts of OsWRKY36-overexpressing rice lines are shown in the figure.

[0049] Figure 19 The figure shows the results of detecting the content of bensulfuron-methyl in the underground and aboveground parts of OsWRKY36-overexpressing rice lines.

[0050] Figure 20 The figure shows the results of detecting tricyclazole content in the underground and aboveground parts of OsWRKY36-overexpressing rice lines.

[0051] Figure 21 Phenotypes of rice lines with OsWRKY36 gene knockout or overexpression (scale bar = 10cm). Note: Wild type is Nipponbare rice, Crispr is a mutant, and OX is overexpression.

[0052] Figure 22 Statistical graph of underground and aboveground lengths for rice lines with OsWRKY36 gene knockout or overexpression. Note: Wild type is Nipponbare rice, Crispr is a mutant, and OX is overexpression. Detailed Implementation

[0053] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0054] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0055] In the examples, Escherichia coli DH5α and Agrobacterium EHA105 are commonly used strains, which are preserved in most molecular biology laboratories; the rice variety is wild-type Nipponbare (a publicly used rice variety, commercially available).

[0056] All chemical reagents used in the examples were imported or domestically produced analytical grade.

[0057] The primers used in the examples were synthesized by Beijing Qingke Biotechnology Co., Ltd., and sequencing was performed by Beijing Qingke Biotechnology Co., Ltd. in Shenzhen.

[0058] Example 1: Yeast monohybrid verification of the interaction between the OsWRKY36 and OsATL15 promoters

[0059] I. Obtaining the coding region sequence of the OsWRKY36 gene

[0060] RNA (OMEGA R6827-01) was extracted from seedlings of the wild-type japonica rice variety Nipponbare, and reverse transcribed (Takara cat#6210A) to obtain gDNA-free cDNA. This cDNA was used as a template for PCR amplification using forward primer F1 (5'-ATGTATGCGTGCATGGAAGG-3') and reverse primer R1 (5'-TCAGAAGGAGGTGAAGGCGCA-3'). A 753 bp PCR product was obtained.

[0061] Sequencing revealed that the 753 bp PCR product contained the nucleotides shown in SEQ ID No. 2, encoding 251 amino acids. The encoded protein was named OsWRKY36, and its amino acid sequence is shown in SEQ ID No. 1.

[0062] II. Yeast monohybridization verification of the interaction between the OsWRKY36 and OsATL15 promoters

[0063] Using the (AbA) yeast monohybrid system, the predicted OsWRKY36 and OsATL15 promoter binding site (named Wbox3) was cloned into the pAbAi vector, and OsWRKY36 was cloned into the pGADT7 vector.

[0064] 1. Construction of the pBait-AbAi vector:

[0065] (1) Design and synthesize two antiparallel oligonucleotide sequences containing the target sequence, and add sticky ends at both ends that are consistent with the pAbAi vector digestion product.

[0066] (2) Dissolve oligonucleotides in TE buffer to a final concentration of 100 μmol / L.

[0067] (3) Mix the forward and reverse strands in a 1:1 ratio (the maximum concentration of the double-stranded oligonucleotide after annealing is 50 μmol / L).

[0068] (4) Keep warm at 95℃ for 30 seconds to remove the secondary structure.

[0069] (5) Hold at 72℃ for 2 min, 37℃ for 2 min, and 25℃ for 2 min. Note: Slow annealing helps the formation of double-stranded oligonucleotides.

[0070] (6) Place on ice. The annealed product can be stored in a -20°C refrigerator for later use.

[0071] (7) Digest 1 μL of pAbAi vector with enzymes, and purify the digested product by gel recovery or column purification.

[0072] (8) Dilute the annealed oligonucleotides 100 times to a final concentration of 0.5 μmol / L.

[0073] (9) Add the following components to the connecting reaction tube:

[0074] pAbAi vector (50ng / μL) 1.0μL, annealed oligonucleotide (0.5μmol / L) 1.0μL, 10×T4 DNA ligase buffer 1.5μL, BSA (10mg / mL) 0.5μL, Nuclease-free H2O 10.5μL, T4 DNAligase (400U / μL) 0.5μL, total volume 15μL.

[0075] (10) The reaction system was placed at room temperature for 3 hours to connect the E coli and positive clones were detected by conventional methods.

[0076] 2. Plasmid transformation of yeast cells to generate Bait-Reporter yeast strain:

[0077] (1) Digest 2 μL of pBait-AbAi, pMutant-AbAi, and p53-AbAi plasmids with BstB I or Bbs I to break them at the URA3 gene and purify the digestion products.

[0078] (2) Transform Y1HGold yeast with 1 μL of the enzyme-digested plasmid according to the steps of Matchmaker Yeast Transformation System 2.

[0079] (3) Dilute each transformation system to 1 / 10, 1 / 100, and 1 / 1000, and spread each dilution evenly on SD / -Ura agar plates. After 3 days, pick 5 single clones and use Matchmaker Insert Check PCR Mix1 to detect positive clones by PCR. Use Y1HGold single clones as negative controls.

[0080] (4) Add 25 μL of PCR-grade H2O to the PCR tube.

[0081] (5) Gently touch a single yeast clone with a clean pipette tip to obtain yeast cells. Insert the pipette tip into PCR-grade H2O and stir.

[0082] (6) Add 25 μL of Matchmaker Insert Check PCR Mix to each tube, mix well, and centrifuge. Each PCR tube now contains the following reactants: 25 μL of Matchmaker Insert Check PCR Mix, 25 μL of H2O / yeast, for a total volume of 50 μL.

[0083] (7) Perform the PCR reaction according to the following procedure:

[0084] 95℃ 1min, 98℃ 10s, 55℃ 30s, 30cycles, 68℃ 2min

[0085] (8) Take 5 μL of PCR product and analyze it by 1% agarose gel electrophoresis.

[0086] (9) Select the PCR-positive bait clones and p53-AbAi control clones, respectively, and streak them on SD / -Ura plates. After incubation at 30℃ for 3 days, store the plates at 4℃. In the absence of traps, the bait sequence cloned into the pAbAi vector constitutes the newly constructed Y1HGold[Bait / AbAi] strain and [p53 / AbAi] control strain.

[0087] 3. Preparation of Y1HGold[pBait] competent cells and Prey conversion:

[0088] (1) Select a single colony of Y1HGold[pBait-AbAi] that has been successfully identified and streak it on an SD-Ura medium plate. Incubate at 30℃ for 3-5 days.

[0089] (2) When the diameter of a single yeast colony reaches 2-3 mm, pick a single colony and inoculate it into a 15 mL shake tube containing 3 mL of LYPDA liquid medium. Incubate overnight at 30°C and 200 rpm.

[0090] (3) Inoculate 3 mL of the small-shake bacterial culture (obtained from the previous small-shake step) into an Erlenmeyer flask containing 50 mL of liquid YPDA medium and continue culturing until the OD600 reaches 0.4-0.5. Centrifuge at 3000 rpm for 5 min and discard the supernatant. (For yeast culture stored at 4℃ for 1 week, inoculate 3 mL of the culture with 50 mL of YPDA medium and incubate overnight).

[0091] (4) Resuspend the precipitate in 10 mL of Y1 solution, centrifuge at 3000 rpm for 5 min, and discard the supernatant.

[0092] (5) Resuspend in 1 mL Y2 solution, aliquot 50 μL into 1.5 mL sterile centrifuge tubes, and use directly for transformation or cryopreservation. Note: Prepared competent cells need to be slowly frozen and then stored at -80°C for long-term storage. Place competent cells in a programmed cooling box, or wrap them in multiple layers of paper and place them in a foam box. First, place them at -80°C overnight, then remove the competent cells and place them at -80°C. They can be stored for one year. Thaw at room temperature before use for transformation.

[0093] (6) Place 50 μL of the above Y1HGold[pBait-AbAi] competent cells on ice, add 2 μg of pre-chilled target plasmid and 350 μL of Y3 solution, gently aspirate and mix, and incubate at 30°C for 60 min (invert once every 10 min to mix). For some strains, extending the incubation time can improve the transformation efficiency, but should not exceed 3 h. It is recommended to supplement the volume with ddH2O to bring the total volume of plasmid and Y3 solution to 0.36 mL.

[0094] (7) Centrifuge at 3000 rpm for 5 min and discard the supernatant.

[0095] (8) Resuspend the precipitate with 0.5 mL YPD Plus Liquid Medium, shake and incubate at 30 °C for 30-60 min, centrifuge at 12000 rpm for 15 s, and discard the supernatant.

[0096] (9) Add 50 μL ddH2O to resuspend the bacterial cells, spread on SD- / Leu plates, and incubate at 30℃ for 3-5 days.

[0097] 4. Mutual verification:

[0098] (1) After the above transformation is successful, pick a positive single colony for shaking, adjust the OD of the bacterial solution for dilution and spotting.

[0099] (2) Observe the growth of the colonies under 30℃ culture conditions and observe the experimental results.

[0100] like Figure 1 As shown, the regulatory activity of the OsWRKY36 transcription factor on the OsATL15 promoter was confirmed. Yeast colonies could grow on the resistant plate in the presence of OsWRKY36, demonstrating that the OsWRKY36 transcription factor can specifically bind to the W-box sequence of the OsATL15 Nipponbare promoter.

[0101] Example 2: Subcellular localization of OsWRKY36 protein

[0102] Total RNA was extracted from 15-day-old rice seedlings, and cDNA was obtained by reverse transcription. This cDNA was then used as a template for PCR amplification to amplify the full-length ORF of OsWRKY36 (with the stop codon removed). The primers used were:

[0103] F5: 5'-AACACGGGGGACGAGCTCGGTACCATGTATGCGTGCATGGAA-3'; R5: 5'-CTTGCTCACCATGTCGACTCTAGAGAAGGAGGTGAAGGCGCA-3'. The amplified target fragment was digested and recovered, and ligated with the empty vector 322-d1-eGFPn (Beijing Huayueyang) to fuse OsWRKY36 with GFP. After confirmation by sequencing, the fusion vector 322-d1-eGFPn-OsWRKY36 and the empty vector were transformed into rice protoplasts, respectively, and cultured at room temperature for 16 h. The subcellular localization of the fusion protein OsWRKY36-GFP and the protein GFP in rice protoplasts was observed under a laser confocal microscope.

[0104] The results are as follows Figure 2 As shown, this demonstrates that the OsWRKY36 protein is specifically located in the rice cell nucleus.

[0105] Example 3: Construction and identification of CRISPR knockout OsWRKY36 mutant plants

[0106] 1. Using the CRISPR / Cas9 system, target sequences were selected based on the exon sequences of OsWRKY36.

[0107] Using a simple and efficient CRISPR / Cas9 system, a specific target sequence was selected based on the OsWRKY36 exon sequence. The target sequence is: TTGCCGAGCCTGCAGCACAA. This target sequence specifically inactivates the OsWRKY36 protein.

[0108] 2. Construct pCRISPR / Cas9 recombinant vectors containing the above target sequence fragments.

[0109] (1) Design adapter primers with sticky ends based on the target sequence.

[0110] The designed target sequence was added with specific sticky end adapters (F: GGCA; R: AAAC) for the pCRISPR / Cas9 system, and the complete adapter primers were synthesized.

[0111] F3: 5'-GGCA-TTGCCGAGCCTGCAGCACAA-3';

[0112] R3: 5'-AAAC-TTGTGCTGCAGGCTCGGCAA-3'.

[0113] (2) Annealing the adapter primers with sticky ends to form double-stranded fragments with sticky ends.

[0114] Dilute the F3 and R3 primers to a concentration of 10 μM, take 10 μL of each and mix well. Perform an annealing reaction in a PCR instrument, reducing the temperature from 98℃ to 22℃, so that the F3 and R3 primers complement each other to form a double-stranded fragment with sticky ends.

[0115] (3) Enzymatic digestion of the original vector pOs-sgRNA containing sg-RNA (TAKARA Cat#632640)

[0116] The original pOs-sgRNA vector containing sgRNA was digested with the restriction endonuclease BsaⅠ to generate sticky ends that are complementary to the sticky ends of the target sequence. The digestion system of the original pOs-sgRNA vector with BsaⅠ was as follows: 2 μL of 10× buffer BsaⅠ, 1 μL of BsaⅠ enzyme, 4 μg of pOs-sgRNA vector, and ddH2O to a final volume of 20 μL. Digestion was carried out at 37℃ for 12 h. After verifying the band size by 1% agarose gel electrophoresis, the digested product was purified by column chromatography using a kit (OMEGA Cat#D2500-02) to obtain the digested pOs-sgRNA vector. The digested product was dissolved in sterile ddH2O, and the concentration was determined before use.

[0117] (4) The double-stranded fragment with sticky ends is ligated into the enzyme-digested pOs-sgRNA vector to form a recombinant vector containing the target sequence and sg-RNA.

[0118] The double-stranded fragment from step (2) and the digested pOs-sgRNA vector from step (3) were ligated using T4 ligase to form a complete recombinant vector containing the target sequence for OsWRKY36 protein and sg-RNA. The 15 μL ligation system consisted of: 1.5 μL of 10×T4 ligation buffer, 4 μL of the double-stranded fragment, 3 μL of the digested pOs-sgRNA vector, 1 μL of T4 DNA ligase, and ddH2O to a final volume of 15 μL. Ligation was performed at 16°C for 12 hours. The ligation product was transformed into E. coli DH5α, cultured overnight on kanamycin-resistant LB plates, and positive strains were selected for sequencing to obtain correctly sequenced recombinant vectors containing the target sequence and sg-RNA.

[0119] (5) Use LRmix to perform LR reaction recombination of the recombinant vector containing the target sequence and sg-RNA and the vector pH-Ubicas9-7 containing Cas9 to form a complete recombinant vector containing the target sequence sg-RNA+Cas9.

[0120] The recombinant vector obtained in step (4) and the Cas9-containing vector pH-Ubi-cas9-7 (provided by Wuhan Boyuan Company) were recombined using LR mix. The LR reaction system consisted of 25-50 ng of the recombinant vector containing the target sequence and sg-RNA, 75 ng of the pH-Ubi-cas9-7 vector, 1 μL of 5×LR Clonase™ buffer, TE Buffer (pH 8.0) to a final volume of 4.5 μL, and 0.5 μL of LRClonase™. The system was incubated at 25°C for 2 h. After the reaction, 2 μL of 2 μg / μL Proteinase K was added, and the mixture was treated at 37°C for 10 min. Then, 2 μL of the reaction product was transferred into E. coli DH5α and cultured overnight at 37°C on gentamicin-resistant LB plates. Positive strains were selected for sequencing to obtain a complete pCRISPR / Cas9 recombinant vector containing the OsWRKY36 protein target sequence-sg-RNA+Cas9 with correct sequencing.

[0121] 3. The obtained pCRISPR / Cas9 recombinant vector was introduced into rice callus tissue to obtain transgenic plants.

[0122] According to the method of OsWRKY36 rice transgenic vector transgenic vector in Example 2, the complete recombinant vector containing the OsWRKY36 protein target sequence -sg-RNA+Cas9 obtained in step (5) was introduced into rice callus to prepare transgenic rice. Transgenic plants with complete inactivation of OsWRKY36 protein can be obtained in T0 generation plants.

[0123] 4. Screening for transgenic positive plants among transgenic plants

[0124] DNA was extracted from the transplanted transgenic plants (T0 generation) and the target sequence sites were detected. A total of 15 positive plants were detected.

[0125] 5. Obtaining mutant plants from transgenic positive plants

[0126] (1) Identification of mutation sites

[0127] DNA was extracted from the transplanted positive plants. Specific primers F4 and R4 were designed to amplify the DNA fragment containing the target site within 500 bp. The 360 ​​bp PCR product obtained was purified and sent to the company for sequencing. The sequencing results were compared with the wild-type plant sequence to screen out mutant plants.

[0128] F4:5'-TTAGTTGCTGCATGTATGCGTG-3';

[0129] R4:5'-CACCTGCCCATCAGTCAATCTG-3'.

[0130] Analysis results of some mutant plants are as follows: Figure 3 As shown, the mutant plants were propagated, and seeds were collected from individual plants in the T1 generation transgenic segregating population that did not contain transgenic elements such as hygromycin and Cas9. These plants were then used to obtain loss-of-function mutants without transgenic components, which were named Crispr-1, Crispr-2, and Crispr-3, respectively.

[0131] Example 4: Construction and identification of plants overexpressing OsWRKY36

[0132] 1. Construction of the recombinant expression vector pCAMBIA1300-35S-OsWRKY36

[0133] RNA was extracted from wild-type Nipponbare seedlings and reverse transcribed to obtain cDNA as a template (extraction and reverse transcription methods were the same as in Example 1). PCR amplification was performed using primer 1 (5'-ACCCGGGGATCCTCTAGAGTCGAATGTATGCGTGCATGGAAGG-3') and primer 2 (ATGATACGAACGAAAGCTCTGCATCAGAAGGAGGTGAAGGCGCA) (Takara cat#R045). The reaction conditions were: 1 cycle: 98℃, 3 min; 32 cycles: 98℃, 30 s, 58℃, 30 s, 72℃, 1 min; 1 cycle: 72℃, 5 min; 16℃, yielding the OsWRKY36 gene with a 23-base homologous recombination arm.

[0134] The PCR products were recovered from the gel and homologously recombinated with the pCAMBIA1300-35S vector backbone (provided by Wuhan Boyuan Company) digested with Sal I and Pst I using an in-fusion kit (Takara cat#639648) to obtain the recombinant plasmid. The recombinant plasmid was sequenced and named pCAMBIA1300-35S-OsWRKY36, which is the recombinant expression vector.

[0135] 2. Preparation of transgenic rice overexpressing OsWRKY36

[0136] (1) The recombinant expression vector pCAMBIA1300-35S-OsWRKY36 was electroporated into Agrobacterium EHA105 (Olivia et al., 2019) to obtain the recombinant strain AGL1 / pCAMBIA1300-35S-OsWRKY36 (the plasmid was extracted from the positive clone and sequenced for verification).

[0137] (2) The recombinant strain AGL1 / pCAMBIA1300-35S-OsWRKY36 was transformed into callus tissue of Zhonghua 11 rice using Agrobacterium-mediated transformation, as detailed below:

[0138] Pick a single colony of AGL1 / pCAMBIA1300-35S-OsWRKY36 and inoculate it into 10 mL of Agrobacterium tumefaciens medium (containing 50 mg / L kanamycin and 50 mg / L rifampin). Incubate at 28°C and 180 rpm for 2-3 days. Take 4 mL of the bacterial suspension, centrifuge at 4000 rpm for 3 min, discard the supernatant, add a small amount of AAM medium to resuspend the cells, and then add 20 mL of AAM medium (containing 0.1 mM acetylsyleugenol As). Incubate at 28°C and 150 rpm in the dark for 1-2 h until OD600 = 0.4. Select healthy, granular callus tissue from Nipponbare (also known as wild-type rice) and immerse it in Agrobacterium culture medium. Shake at 28℃ and 150-200 rpm for 20 minutes. Decant the callus tissue, blot off excess bacterial solution with sterile filter paper, and spread it evenly on a sterile Petri dish containing multiple layers of filter paper. Dry the callus tissue on a laminar flow hood (ensuring it is dispersed and does not clump). Then transfer the callus tissue to a co-culture medium and incubate in the dark for 2-3 days. Transfer the callus tissue to NB basal medium containing 100 mg / L hygromycin and 400 mg / L cephalosporin for screening for 3-4 weeks (first screening). Transfer the surviving callus tissue to a second screening medium (NB basal medium containing 100 mg / L hygromycin and 200 mg / L cephalosporin) for screening for 3 weeks. The resistant callus was transferred to a differentiation medium (containing 100 mg / L hygromycin) for differentiation. After the regenerated plants rooted on a seedling strengthening medium containing 100 mg / L hygromycin (about 3-4 weeks), they were transferred to a greenhouse to obtain T0 generation OsWRKY36 rice.

[0139] The culture media used in the above transformation are as follows:

[0140] Co-culture medium: callus induction and subculture medium + As (0.1 mM / L) + glucose (10 g / L), pH 5.2.

[0141] Agrobacterium infection of rice callus AAM medium: AA macro-elements + AA micro-elements + AA amino acids + MS vitamins + hydrolyzed casein (500 mg / L) + sucrose (68.5 g / L) + glucose (36 g / L) + As (0.1 mM), pH 5.2.

[0142] NB basic culture medium: N6 macroelements + B5 microelements + B5 organic components + iron salts + hydrolyzed casein (300mg / L) + proline (500mg / L) + sucrose (30g / L) + agar (8g / L), pH 5.8.

[0143] Callus induction and subculture medium: NB basal medium + 2,4-D (2 mg / L).

[0144] Differentiation medium: NB basal medium + 6-BA (3 mg / L) + NAA (1 mg / L).

[0145] Seedling growth medium: 1 / 2 MS inorganic salts + NAA (0.5 mg / L) + MET (0.25 mg / L).

[0146] Agrobacterium tumefaciens medium (YEP): 10 g / L tryptone + 10 g / L yeast extract + 5 g / L sodium chloride + 15 g / L agar.

[0147] 3. Molecular identification of OsWRKY36 transgenic rice

[0148] (1) Preliminary PCR identification

[0149] Genomic DNA (OMEGA cat#D2485-02) was extracted from T0 generation OsWRKY36 rice and identified by PCR using primers F2 and R2 (primer sequences below). The reaction conditions were: 1 cycle: 98℃, 3 min; 32 cycles: 98℃, 30 s, 60℃, 30 s, 72℃, 30 s; 1 cycle: 72℃, 5 min; 16℃. PCR-positive (340 bp) T0 generation OsWRKY36 rice plants #1, #2, and #3 were selected.

[0150] F2: 5'-ATGTATGCGTGCATGGAAGGGAGCCA-3';

[0151] R2: 5'-GAAGGAGGTGAAGGCGCAGCTGGCG-3'.

[0152] 2) Transcription level analysis

[0153] Total RNA was extracted from PCR-positive T0 generation OsWRKY36 transgenic rice lines #1, #2, and #3, and reverse transcribed. The resulting cDNA was used as a template for real-time quantitative PCR using the following primers to detect the transcriptional expression level of the OsWRKY36 gene in each material. The experiment was repeated three times, and the results were averaged. Wild-type rice was used as a control.

[0154] Real-time quantitative PCR was performed using a Bio-Rad CFX96. The PCR reaction system (20 μL) was prepared according to the product instructions for SYBR Green Real-Time PCR Master Mix reagent (Takara), specifically: 10 μL SYBR Green Real-Time PCR Master Mix, 2 μL upstream and downstream primer mixture (both primer concentration 10 μM), 7 μL RNase-free water, and 1 μL cDNA template. The specific reaction program was as follows: enzyme activation at 95℃ for 30 s, 1 cycle; denaturation at 95℃ for 5 s, extension at 60℃ for 30 s, for a total of 40 cycles.

[0155] The primer sequences for detecting the OsWRKY36 gene are as follows:

[0156] OsWRKY36 upstream primer F: 5'-GAAGATGAAGGTGAGGAGGAAG-3';

[0157] OsWRKY36 downstream primer R: 5'-CCTCGTAGGTGGTGATCAC-3'.

[0158] Using ACT1 (LOC4333919) as an internal reference gene, the primer sequences for amplifying the internal reference ACT1 are as follows:

[0159] ACT1 upstream primer: 5'-CTTCATAGGAATGGAAGCTGCGGGTA-3';

[0160] ACT1 downstream primer: 5'-CGACCACCTTGATCTTCATGCTGCTA-3'.

[0161] Data processing employed the Comparative Ct method, where Ct is the number of cycles required for the fluorescence signal in the PCR tube to reach a set threshold, ΔCt = Ct(OsWRKY36) - Ct(ACT1), with a 2... －△△Ct The value measures the gene transcription level, and the expression of the OsWRKY36 gene in each material is analyzed and compared.

[0162] The results of real-time quantitative fluorescence PCR detection of OsWRKY36 gene expression levels in various experimental materials are as follows: Figure 4As shown, the expression levels of the OsWRKY36 gene are all relative values. It can be seen that, compared to the untransgenic wild-type japonica rice Nipponbare (WT), the expression level of the OsWRKY36 gene in the PCR-positive T0 generation OsWRKY36 transgenic rice lines #1, #2, and #3 is significantly increased at the transcriptional level. The PCR-positive T0 generation OsWRKY36 transgenic rice lines #1, #2, and #3 are named OX-1, OX-2, and OX-3.

[0163] Example 5: Effects of OsWRKY36 on pesticide absorption and translocation

[0164] The following pesticides were selected for the experiment: neonicotinoid insecticide thiamethoxam, diamide insecticide chlorantraniliprole, organophosphate insecticide acephate, nereistoxin insecticide cartap, carbamate insecticides carbofuran and methomyl, sulfonylurea herbicide bensulfuron-methyl, and thiazide fungicide tricyclazole.

[0165] 1. Effects of OsWRKY36 mutant plants on pesticide absorption and translocation

[0166] The pesticide content in the roots, stems and leaves of the Crispr-1, Crispr-2 and Crispr-3 mutant rice lines obtained in Example 3 and the wild-type rice Nipponbare was detected.

[0167] Thiamethoxam technical grade was dissolved in DMSO to prepare a 40 mM stock solution, which was stored at 4℃ for later use. Rice seedlings grown in a rice culture chamber for 14 days were selected, and the roots were carefully rinsed to remove the nutrient solution. Ten seedlings were grouped together. The roots of the rice seedlings were then pre-cultured in 0.5 mM calcium chloride buffer solution for 2 hours. The stock solution was diluted to 100 μM with 0.5 mM calcium chloride buffer solution, and the pH was adjusted to 5.8. The solution was then added to 50 mL centrifuge tubes (40 mL per tube), and the rice seedlings were transferred into these tubes and fixed with a centrifuge cup, ensuring the rice stems were in contact with the liquid surface. The tubes were then placed in an artificial climate incubator for 24 hours. After 24 hours, the rice seedlings were removed, and the roots were washed four times with 0.5 mM (pH 5.8) calcium chloride buffer solution to ensure complete removal of any adhering drug from the root surface. The surface moisture was wiped dry with filter paper, and then the rice was divided into three parts: root, stem, and leaf, by cutting off 1 cm below and 1 cm above the root-stem junction with a blade. After weighing and recording the samples, they were ground in a mortar with liquid nitrogen, extracted with 10 mL of chromatographic grade acetonitrile, sonicated for 30 min, centrifuged at 14000 g for 10 min, and 1 mL of the supernatant was collected and filtered through a 0.22 μM microporous membrane to remove impurities. The samples were then placed in liquid chromatography bottles and stored at -80℃ for later analysis. Each treatment was repeated in triplicate. Rice seedlings were treated with the same amounts of thiamethoxam, chlorantraniliprole, acephate, cartap, carbofuran, methomyl, bensulfuron-methyl, and tricyclazole, with each treatment repeated in triplicate.

[0168] like Figures 5-12 As shown, the contents of thiamethoxam (THX), chlorantraniliprole, acephate, cartap, carbofuran, methomyl, bensulfuron-methyl, and tricyclazole in the aboveground and underground (root) parts of Crispr-1, Crispr-2, and Crispr-3 mutant rice lines were all higher than those in the wild type.

[0169] 2. Effects of OsWRKY36 overexpression on pesticide absorption and translocation

[0170] The pesticide content in the roots, stems, and leaves of rice lines overexpressing OX-1, OX-2, and OX-3 obtained in Example 4 and wild-type rice Nipponbare was detected. The treatment method was the same as above.

[0171] like Figures 13-20 As shown, the contents of thiamethoxam (THX), chlorantraniliprole, acephate, cartap, carbofuran, methomyl, bensulfuron-methyl, and tricyclazole in the underground (root) and aboveground parts of OX-1, OX-2, and OX-3 rice lines were all lower than those in the wild type.

[0172] Therefore, OsWRKY36 can regulate the absorption and utilization of pesticides in rice, genetically improve the pesticide transport properties of rice varieties, and breed rice varieties with high pesticide utilization efficiency.

[0173] Example 6: Effects of OsWRKY36 on rice plant height

[0174] The OsWRKY36 rice Crispr-1, Crispr-2, and Crispr-3 mutants obtained in Examples 3 and 4, as well as OX-1, OX-2, and OX-3 overexpressing plants, were planted with wild-type rice Nipponbare in a rice culture incubator, and the phenotypes were observed after two weeks.

[0175] Observe the phenotype of the material after two weeks. Figure 21 and 22 As shown, the plant height and root length of rice were measured. Compared with the CRISpr-1, CRISpr-2 and CRISpr-3 mutants, there was no significant difference in root length (underground part) and plant height (above ground part) of wild-type Nipponbare rice. Compared with the overexpression of OX-1, OX-2 and OX-3, the plant height (above ground part) of the overexpressing rice was shorter than that of the wild type, but there was no significant difference in root length (underground part).

[0176] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of rice WRKY transcription factor OsWRKY36 in regulating pesticide absorption and transport in plants, characterized by, The amino acid sequence of the rice WRKY transcription factor OsWRKY36 is shown in SEQ ID No.

1.

2. The application of the rice OsWRKY36 gene, or an expression cassette, recombinant vector, or recombinant strain containing the rice OsWRKY36 gene, in regulating the absorption and transport of pesticides by plants, characterized in that... The amino acid sequence of the protein encoded by the rice OsWRKY36 gene is shown in SEQ ID No.

1.

3. The application of reagents for knocking out or inhibiting the expression of the rice OsWRKY36 gene in the cultivation of transgenic plants that efficiently utilize pesticides, characterized in that... The amino acid sequence of the protein encoded by the rice OsWRKY36 gene is shown in SEQ ID No.

1.

4. Application of molecular marker detection primers for the rice OsWRKY36 gene in identifying plants that efficiently utilize pesticides, characterized in that... The expression level of OsWRKY36 was identified using molecular marker detection primers to determine the sensitivity of plants to pesticide treatment; the amino acid sequence of the protein encoded by the rice OsWRKY36 gene is shown in SEQ ID No.

1.

5. The application according to any one of claims 2 to 4, characterized in that, The nucleotide sequence of the rice OsWRKY36 gene is any one of the following A) to C): A. A nucleotide sequence as shown in SEQ ID No. 2; B. Under strict conditions, it hybridizes with the nucleotides specified in A and encodes a nucleotide sequence of the amino acid shown in SEQ ID No. 1; C. Has at least 70% homology with the nucleotide sequence defined by A, and encodes a nucleotide sequence consisting of the amino acids shown in SEQ ID No.

1.

6. The application of rice WRKY transcription factor OsWRKY36 as a pesticide absorption enhancer in regulating plant height, characterized by: The amino acid sequence of the rice WRKY transcription factor OsWRKY36 is shown in SEQ ID No.

1.

7. The application according to any one of claims 1 to 4 or 6, characterized in that, The pesticide in question is a systemic pesticide.

8. The application according to claim 7, characterized in that, The systemic pesticide is one or more of the following: neonicotinoid insecticides, diamide insecticides, organophosphate insecticides, nereistoxin insecticides, carbamate insecticides, sulfonylurea herbicides, or thiazole fungicides.

9. The application according to claim 8, characterized in that, The neonicotinoid insecticide is thiamethoxam, the diamide insecticide is chlorantraniliprole, the organophosphate insecticide is acephate, the nereistoxin insecticide is cartap, the carbamate insecticide is carbofuran or methomyl, the sulfonylurea herbicide is bensulfuron-methyl, and the thiazole fungicide is tricyclazole.

10. The application according to any one of claims 1 to 4 or 6, characterized in that, The plant in question is rice.

Images