A kit for detecting ctDNA and application

Abstract

The application provides a kit for detecting ctDNA and an application, and belongs to the technical field of kits for detecting ctDNA. The kit comprises the following components: a silver nanoparticle-fuel chain and a magnetic bead modified triple-stranded complex, wherein the silver nanoparticle-fuel chain is obtained by coupling a thiol-modified fuel chain and silver nanoparticles through a silver-sulfur bond; and the preparation method of the magnetic bead modified triple-stranded complex comprises the following steps: reacting single-stranded DNA TC-A, TC-B and TC-C through denaturation and annealing to obtain a triple-stranded complex, and then reacting the triple-stranded complex with streptavidin modified magnetic beads to obtain the magnetic bead modified triple-stranded complex. The kit has high stability, high sensitivity, high accuracy and strong specificity in detecting ctDNA, and can efficiently diagnose colorectal cancer. The kit can be used for rapidly detecting ctDNA, especially KRAS gene single base mutation type in the ctDNA, is convenient to carry, and can achieve the purpose of instant detection.

Description

Technical Field

[0001] This invention belongs to the technical field of reagent kits for detecting ctDNA, and particularly relates to a reagent kit for detecting ctDNA and its application. Background Technology

[0002] Circulating tumor DNA (ctDNA) is a promising target for liquid biopsies, obtainable non-invasively from a variety of bodily fluids. Compared to traditional colorectal cancer (CRC) biomarkers such as carcinoembryonic antigen (CEA) and carbohydrate antigen 199 (CA199), ctDNA has a shorter half-life, higher sensitivity and specificity, and can characterize tumor-specific genetic and epigenetic abnormalities, thus offering significant advantages as a dynamic biomarker of tumor burden. The potential clinical value of ctDNA in the diagnosis, characterization, and personalized management of solid tumors and hematologic malignancies has been revealed and expanded far beyond traditional biomarkers. For example, mutations in the V-Ki-ras2 Kirsten tumor virus oncogene homolog (KRAS) are among the most common drivers of tumor development across the human cancer spectrum. While direct inhibitors or modulators of KRAS (such as SOS1 and SHP2) have made progress, stratification based on KRAS mutation type is necessary before determining treatment strategies. Furthermore, mutations in the catalytic subunit α of phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA) may have a negative prognostic impact in late-stage tumors, predicting poorer cancer-specific and overall survival. Combination therapy with medications such as peramil has provided therapeutic benefits for CRC patients carrying PIK3CA mutations, enhancing the growth-inhibiting effect of PIK3CA-mutated cancer cells by inhibiting the mTOR pathway and promoting ferroptosis. Most importantly, real-time ctDNA testing provides valuable diagnostic and prognostic information and guides treatment decisions.

[0003] Currently, ctDNA testing primarily relies on sequencing technology, but its clinical application is limited due to insufficient infrastructure, high labor intensity, and cost. Previous research has developed a sequencing-free, multiplexed ctDNA detection platform with high sensitivity and specificity, identifying genetic variations through specific restriction endonucleases. However, enzyme inactivation or degradation during storage and transportation poses a clinical challenge, making it unsuitable for point-of-care testing in rural and remote areas. Furthermore, innovative methods have been proposed in recent years, such as catalytic hairpin assembly strategies in surface-enhanced Raman scattering (SERS) microfluidic chips and metal-graphene hybrid terahertz metasurfaces based on dual-signal amplification technology. These methods require large-scale instrumentation and specialized personnel. Therefore, point-of-care ctDNA testing provides precision medicine for cancer patients, delivering the test to their homes or bedsides, alleviating the need for health privacy protection, and avoiding the inconvenience of long waiting times. Thus, providing a kit for ctDNA detection is a pressing technical problem that needs to be solved. Summary of the Invention

[0004] Therefore, the purpose of this invention is to provide a kit for detecting ctDNA and its application.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a kit for detecting ctDNA, the kit comprising the following components: Silver nanoparticle-fuel chain and magnetic bead modified triple-chain complex; The preparation method of the silver nanoparticle-fuel chain includes the following steps: A thiol-modified fuel chain was coupled to silver nanoparticles via a silver-sulfur bond to obtain a silver nanoparticle-fuel chain; the nucleotide sequence of the fuel chain is shown in SEQ ID NO.1. The method for preparing the magnetic bead-modified triple-stranded complex includes the following steps: Single-stranded DNA TC-A, TC-B, and TC-C were denatured and annealed to obtain a triple-stranded complex; the nucleotide sequence of TC-A is shown in SEQ ID NO.2; the nucleotide sequence of TC-B is shown in SEQ ID NO.3; the nucleotide sequence of TC-C is shown in SEQ ID NO.4; the 5' end of the sequence shown in SEQ ID NO.4 is modified with biotin; The triple-streptavidin complex was reacted with streptavidin-modified magnetic beads to obtain a magnetic bead-modified triple-streptavidin complex.

[0006] Preferably, the kit comprises the following components: The silver nanoparticle-fuel chain, the magnetic bead-modified triple-chain complex, hydrogen peroxide, phenol red, urease, and urea.

[0007] Preferably, the kit consists of the following components at the following molar concentrations: 80-120 nM silver nanoparticle-fuel chain solution, 80-120 nM magnetic bead modified triple chain complex solution, 15-25 mM hydrogen peroxide solution, 80-120 μM phenol red solution at pH 5.5-6.0, 5-15 nM urease solution and 180-220 mM urea solution.

[0008] Preferably, the method for preparing the silver nanoparticle-fuel chain includes the following steps: The thiol-modified fuel chain was incubated with tris(2-carboxyethyl)phosphine hydrochloride, followed by an activation reaction to obtain the activated F probe; The activated F probe and SDS solution were mixed, and the resulting mixture was mixed with silver nanoparticle solution. Then sodium chloride solution was added, and the mixture was allowed to stand to obtain the reaction mixture. The reaction mixture was centrifuged, and the precipitate was collected to obtain the silver nanoparticle-fuel chain.

[0009] Preferably, the molar ratio of the thiol-modified fuel chain to tris(2-carboxyethyl)phosphine hydrochloride is 1:(1~3); the volume ratio of the thiol-modified fuel chain to tris(2-carboxyethyl)phosphine hydrochloride is (0.5~1.5):(0.5~1.5); the incubation method is incubation at 20~25℃ for 0.5~1.5h; the activation reaction method is reaction at 20~25℃ for 10~14h. The volume ratio of the activated F probe, SDS solution, silver nanoparticle solution, and sodium chloride solution is (0.18~0.22):(0.045~0.055):(9~11):(0.2~0.7); the mass-volume percentage of the SDS solution is 2%~6%; the concentration of the sodium chloride solution is 1~3M; and the standing is carried out at 20~25℃ for 6~10h.

[0010] Preferably, the reaction is carried out at 35-40°C for 25-35 min; the molar concentration of the triple-stranded complex is 10-20 μM; and the volume ratio of the triple-stranded complex to the streptavidin-modified magnetic beads is 0.05-0.15:1.

[0011] Preferably, the silver nanoparticle-fuel chain, the magnetic bead-modified triple-chain complex, hydrogen peroxide, phenol red, urease, and urea are each packaged separately.

[0012] This invention provides the application of the above-mentioned ctDNA detection kit in the preparation of ctDNA detection products.

[0013] This invention provides the application of the above-mentioned kit for detecting ctDNA in the preparation of products for detecting the KRAS gene in ctDNA.

[0014] Preferably, the KRAS gene is a KRAS mutant gene; the KRAS mutant gene is KRAS G12C; the nucleotide sequence of KRAS G12C is shown in SEQ ID NO.5.

[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a kit for detecting ctDNA and its application. The kit employs a signal amplification strategy, exhibiting high stability, high sensitivity, high accuracy, and strong specificity in ctDNA detection, achieving a sensitivity at the femtomolar level. Furthermore, this kit can efficiently diagnose colorectal cancer, with an AUC value of 0.9675 for ctDNA detection. This kit enables rapid detection of ctDNA, especially single-base mutations in the KRAS gene, and is easy to carry, achieving the purpose of immediate detection. Attached Figure Description

[0016] Figure 1 Characterization data for AgNPs-Fuel and MBs-TC are shown below: A is the TEM image of AgNPs; B is the infrared absorption spectrum of AgNPs and AgNPs-Fuel; C is the hydrated particle size of AgNPs and AgNPs-Fuel; D is the Zeta potential of Fuel, AgNPs, and AgNPs-Fuel; E is the Zeta potential of MBs and MBs-TC; and F is the hydrated particle size of MBs, MBs-TC, and MBs-AgNPs reporter molecules. Figure 2 This is a schematic diagram of multi-entropy driven catalytic single nucleotide resolution ctDNA detection (MED). Figure 3 The following are the results of the MED feasibility analysis: A is a schematic diagram of the entropy-driven reaction; B is the result of gel electrophoresis analysis; C is the result of MED reaction kinetics measurement at different times; D is the result of optimization of single-base mutation positions. Figure 4 For the sensitivity detection results of the kit of the present invention, A represents the colorimetric results of different concentrations of ctDNA; B represents the absorbance values ​​of different concentrations of ctDNA at 350nm~650nm; C represents the absorbance values ​​of different concentrations of ctDNA at 430nm; D represents the absorbance values ​​of different concentrations of ctDNA at 558nm; E represents the absorbance values ​​of different concentrations of ctDNA at A 430nm / A 558nm The results of linear correlation analysis; F represents the A of different concentrations of ctDNA. 558nm / A 430nm The results of the linear correlation analysis; Figure 5 For the specific detection results of the kit of the present invention, A is the colorimetric result of different addition ratios of ctDNA-KRAS G12C and wild-type KRAS; B is the absorbance value at 430nm for different addition ratios of ctDNA-KRAS G12C and wild-type KRAS. Figure 6 For the stability and accuracy test results of the kit of the present invention, A is the absorbance value at 430 nm over 12 weeks when AgNPs-Fuel and MBs-TC were prepared as the test sample with a ctDNA-KRAS G12C / wild-type KRAS addition ratio of 1%; B is the result of detecting the recovery rate of ctDNA-KRAS G12C spiked using the kit of the present invention. Figure 7The results of clinical sample validation of the kit of the present invention are as follows: A is the ROC curve of MED detection in the diagnosis of colorectal cancer using the kit of the present invention; B is the absorbance value of KRAS mutants in different samples at 430 nm detected using the kit of the present invention. Detailed Implementation

[0017] This invention provides a kit for detecting ctDNA, the kit comprising the following components: Silver nanoparticle-fuel chain and magnetic bead modified triple-chain complex; The preparation method of the silver nanoparticle-fuel chain includes the following steps: A thiol-modified fuel chain was coupled to silver nanoparticles via a silver-sulfur bond to obtain a silver nanoparticle-fuel chain; the nucleotide sequence of the fuel chain is shown in SEQ ID NO.1. The method for preparing the magnetic bead-modified triple-stranded complex includes the following steps: Single-stranded DNA TC-A, TC-B, and TC-C were denatured and annealed to obtain a triple-stranded complex; the nucleotide sequence of TC-A is shown in SEQ ID NO.2; the nucleotide sequence of TC-B is shown in SEQ ID NO.3; the nucleotide sequence of TC-C is shown in SEQ ID NO.4; the 5' end of the sequence shown in SEQ ID NO.4 is modified with biotin; The triple-streptavidin complex was reacted with streptavidin-modified magnetic beads to obtain a magnetic bead-modified triple-streptavidin complex.

[0018] In this invention, the triple-chain complex, also known as biotin-labeled TC, is connected to streptavidin-modified magnetic beads at the 5′ end through a biotin-streptavidin interaction; while the thiol-modified fuel chain at the 5′ end is bound to AgNPs through a silver-sulfur bond.

[0019] In this invention, a thiol-modified fuel chain refers to a nucleotide sequence as shown in SEQ ID NO.1, where the 5′ end is modified with a thiol group.

[0020] As a preferred embodiment, the method for preparing the silver nanoparticle-fuel chain includes the following steps: The thiol-modified fuel chain was incubated with tris(2-carboxyethyl)phosphine hydrochloride, followed by an activation reaction to obtain the activated F probe; The activated F probe and SDS solution were mixed, and the resulting mixture was mixed with silver nanoparticle solution. Then sodium chloride solution was added, and the mixture was allowed to stand to obtain the reaction mixture. The reaction mixture was centrifuged, and the precipitate was collected to obtain the silver nanoparticle-fuel chain.

[0021] In this invention, a mercapto-modified fuel chain is incubated with tris(2-carboxyethyl)phosphine hydrochloride, followed by an activation reaction to obtain an activated F probe. The molar ratio of the thiol-modified fuel chain to tris(2-carboxyethyl)phosphine hydrochloride is 1:(1~3), more preferably 1:(1.5~2.5), and even more preferably 1:2; the volume ratio of the thiol-modified fuel chain to tris(2-carboxyethyl)phosphine hydrochloride is (0.5~1.5):(0.5~1.5), more preferably (0.6~1.4):(0.6~1.4), and even more preferably 1:1; the incubation method is incubation at 35~40℃ for 0.5~2h, more preferably incubation at 36~38℃ for 1~1.5h, and even more preferably incubation at 37℃ for 1h; the activation reaction method is reaction at 20~25℃ for 10~14h, more preferably reaction at 20~25℃ for 11~13h, and even more preferably reaction at 20~25℃ for 12h.

[0022] In this invention, after obtaining the activated F probe, the activated F probe and SDS solution are mixed, and the resulting mixture is mixed with a silver nanoparticle solution. Then, a sodium chloride solution is added, and the mixture is allowed to stand to obtain the reacted mixture. The preferred volume ratio of the activated F probe, SDS solution, silver nanoparticle solution, and sodium chloride solution is (0.18~0.22):(0.045~0.055):(9~11):(0.2~0.7), more preferably (0.19~0.21):(0.047~0.053):(9.5~10.5):(0.25~0.65), and even more preferably 0.2:0.05:10:(0.25~0.65). This invention uses a salt aging method to prepare AgNPs-Fuel. In this invention, a sodium chloride solution is then added, and the mixture is allowed to stand to obtain the reacted mixture. In a preferred embodiment, the sodium chloride solution is added sequentially in four stages: after adding the first sodium chloride solution, the mixture is allowed to stand; then, the second sodium chloride solution is added, and the mixture is allowed to stand; then, the third sodium chloride solution is added, and the mixture is allowed to stand; finally, the fourth sodium chloride solution is added, and the mixture is allowed to stand, resulting in a mixed solution after the reaction. The volume ratio of the silver nanoparticle solution, the first sodium chloride solution, the second sodium chloride solution, the third sodium chloride solution, and the fourth sodium chloride solution is (9~11):(0.22~0.27):(0.25~0.30):(0.55~0.60):(0.60~0.70), more preferably 10:0.25:0.27:0.58:0.65. The SDS solution preferably has a mass-volume percentage of 2% to 6%, more preferably 3% to 5%, and even more preferably 4%, and the solvent of the SDS solution is water; the concentration of the sodium chloride solution is preferably 1 to 3 M, more preferably 1.5 to 2.5 M, and even more preferably 2 M, and the solvent of the sodium chloride is water; the standing is performed at 20 to 25°C for 6 to 10 hours, more preferably 7 to 9 hours, and even more preferably 8 hours.

[0023] In this invention, the reacted mixture is centrifuged, and the precipitate is collected to obtain silver nanoparticle-fuel chains. The centrifugation can be performed at 12000-14000 rpm for 15-25 min, such as 13000 rpm for 20 min. After adding 0.01% SDS solution, the centrifugation is repeated three times.

[0024] In this invention, single-stranded DNA TC-A, TC-B, and TC-C are denatured and annealed to obtain a triple-stranded complex. The preferred molar ratio of TC-A, TC-B, and TC-C is 1:1:1. The denaturation is preferably performed at 94°C to 96°C for 4 to 6 minutes, more preferably at 95°C for 5 minutes. The annealing is performed at a rate of 0.5 to 1.5°C / min to 3 to 5°C, more preferably at a rate of 1°C / min to 4°C.

[0025] In this invention, a triple-streptavidin complex is reacted with streptavidin-modified magnetic beads to obtain a magnetic bead-modified triple-streptavidin complex. The reaction is preferably carried out at 35-40°C for 25-35 min, more preferably at 36-39°C for 27-33 min, and even more preferably at 37°C for 30 min. The molar concentration of the triple-streptavidin complex is preferably 10-20 μM, more preferably 12-18 μM, and even more preferably 15 μM. The volume ratio of the triple-streptavidin complex to the streptavidin-modified magnetic beads is preferably 0.05-0.15:1, more preferably 0.07-0.12:1, and even more preferably 0.1:1. The triple-streptavidin complex is also referred to as biotin-labeled TC. The streptavidin-modified magnetic beads are washed streptavidin-modified magnetic beads. The washing method uses a coupling buffer, and the number of washes is 2-4 times, more preferably 3 times, with each wash volume preferably 2-4 mL, and even more preferably 3 mL. The coupling buffer is water with a final concentration of 20 mM Tris-HCl, a final concentration of 1 M sodium chloride solution, and a volume percentage of 0.02% Tween-20. The volume percentage refers to the percentage of the volume of Tween-20 to the volume of the coupling buffer.

[0026] In this invention, the kit comprises the following components: the silver nanoparticle-fuel chain, the magnetic bead-modified triple-chain complex, hydrogen peroxide, phenol red, urease, and urea. More preferably, the kit comprises the following components in molar concentrations: 80-120 nM silver nanoparticle-fuel chain solution, 80-120 nM magnetic bead-modified triple-chain complex solution, 15-25 mM hydrogen peroxide solution, 80-120 μM phenol red solution at pH 5.5-6.0, 5-15 nM urease solution, and 180-220 mM urea solution. In a preferred embodiment, the kit comprises the following components in molar concentrations: 90-110 nM silver nanoparticle-fuel chain solution, 90-110 nM magnetic bead-modified triple-chain complex solution, 17-23 mM hydrogen peroxide solution, 90-110 μM pH 5.5-6.0 phenol red solution, 7-13 nM urease solution, and 90-110 mM urea solution. More preferably, the kit comprises the following components in molar concentrations: 100 nM silver nanoparticle-fuel chain solution, 100 nM magnetic bead-modified triple-chain complex solution, 20 mM hydrogen peroxide solution, 10 μM pH 5.8 phenol red solution, 10 nM urease solution, and 100 mM urea solution. The volume ratio of the silver nanoparticle-fuel chain solution, magnetic bead-modified triple-chain complex solution, hydrogen peroxide solution, phenol red solution, urease solution, and urea solution is 10:10:20:80:20:50.

[0027] In this invention, the silver nanoparticle-fuel chain, the magnetic bead-modified triple-chain complex, hydrogen peroxide, phenol red, urease, and urea are each packaged independently.

[0028] This invention provides the application of the above-mentioned ctDNA detection kit in the preparation of ctDNA detection products.

[0029] This invention provides the application of the above-mentioned kit for detecting ctDNA in the preparation of products for detecting the KRAS gene in ctDNA.

[0030] In this invention, the KRAS gene is a KRAS mutant gene; the KRAS mutant gene is KRAS G12C; the nucleotide sequence of KRAS G12C is shown in SEQ ID NO.5. G12C in KRAS G12C refers to a mutation of glycine at position 12 of the KRAS genome into cysteine.

[0031] In this invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0032] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0033] In the following examples, 40 nm silver nanoparticles (AgNPs) were purchased from XF NANO, catalog number XFJ01; streptavidin-modified magnetic beads (1 μm) were purchased from XF NANO, catalog number 102128.

[0034] The room temperature refers to 20~25℃.

[0035] The 4% SDS solution is prepared by mixing 4g of sodium dodecyl sulfate with 100mL of purified water to obtain a 4% SDS solution by mass and volume.

[0036] The 0.01% SDS solution is prepared by mixing 0.01g of sodium dodecyl sulfate with 100mL of purified water to obtain a 0.01% SDS solution by mass and volume.

[0037] The coupling buffer is water with a final concentration of 20 mM Tris-HCl, a final concentration of 1 M sodium chloride solution, and a volume percentage of 0.02% Tween-20 added.

[0038] Statistical analyses were performed using GraphPad Prism 9.0 and SPSS 20.0 software packages. Data were standardized and expressed as mean ± standard deviation (SD). Independent samples t-tests were used for comparisons between two groups. For multiple group comparisons, one-way ANOVA was used, followed by post-hoc multiple comparisons using the least significant difference (LSD) method. A p-value less than 0.05 was considered statistically significant, and the diagnostic efficacy was assessed using the area under the ROC curve.

[0039] Example 1 1.1 A kit for detecting ctDNA, said kit comprising the following components in the following amounts: The following solutions were prepared: 10 μL of 100 nM silver nanoparticle-fuel chain solution, 10 μL of 100 nM magnetic bead-modified triple-chain complex solution, 20 μL of 20 mM hydrogen peroxide solution, 80 μL of 100 μM pH 5.8 phenol red solution, 20 μL of 10 nM urease solution, and 50 μL of 200 mM urea solution. Each of these solutions—the silver nanoparticle-fuel chain modified solution, the magnetic bead-modified triple-chain complex solution, the hydrogen peroxide solution, the pH 5.8 phenol red solution, the urease solution, and the urea solution—was packaged separately. Water was used as the solvent for all three solutions.

[0040] The preparation method of the silver nanoparticle-fuel chain (AgNPs-Fuel) involves coupling a thiol-modified F probe (also known as a fuel chain) with 40nm AgNPs via a salt aging method to form AgNPs-Fuel. The steps are as follows: (1) 5 mL of 10 mM thiol-modified F probe was incubated with 5 mL of 20 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP) at 37 °C for 1 hour, and then shaken and incubated overnight (12 h) at room temperature to obtain activated F probe; The F probe (5'-3') is CAAGTGGTGTTGGGCCTATCCTACCCTCATATA (SEQ ID NO.1); the thiol-modified F probe is SH-CAAGTGGTGTTGGGCCTATCCTACCCTCATATA.

[0041] (2) Add 200 μL of activated F probe and 50 μL of 4% SDS solution to 10 mL of 10 g / mL AgNPs solution, then add 250 μL of 2M sodium chloride solution and mix. Let stand at room temperature for 8 hours, then add 270 μL of 2M sodium chloride solution and mix. Let stand at room temperature for 8 hours, then add 580 μL of 2M sodium chloride solution and mix. Let stand at room temperature for 8 hours, and finally add 650 μL of 2M sodium chloride solution and mix. Let stand at room temperature for 8 hours to obtain the reaction mixture.

[0042] (3) Centrifuge the mixture after reaction at 13000 rpm for 20 min, remove supernatant 1 to obtain the first precipitate, add 0.01% SDS solution to the first precipitate, centrifuge at 13000 rpm for 20 min, remove supernatant 2 to obtain the second precipitate, add 0.01% SDS solution to the second precipitate, centrifuge at 13000 rpm for 20 min, remove supernatant 3, resuspend the obtained third precipitate in 10 mL of 0.01% SDS solution to obtain AgNPs-Fuel.

[0043] The preparation method of the magnetic bead-modified triple-stranded complex (MBs-TC) includes the following steps: (S1) Assemble three single-stranded DNAs, TC-A, TC-B, and TC-C, through denaturation and annealing: TC-A, TC-B and TC-C were mixed and denatured at 95°C for 5 min, and then annealed to 4°C at a rate of 1°C / min to obtain biotin-labeled TC; the molar ratio of the added TC-A, TC-B and TC-C was 1:1:1.

[0044] The nucleotide sequence of TC-A (5'-3') is CCTACCCTCATATA (SEQ ID NO.2); the nucleotide sequence of TC-B (5'-3') is CTTGTGGCGTAGGGCCTATTTTTTT (SEQ ID NO.3); and the nucleotide sequence of TC-C (5'-3') is Biotin-TATATGAGGGTAGGATAGGCCCTACGCCACAAGCTCCAACT (SEQ ID NO.4).

[0045] (S2) Wash 1 mL of streptavidin-modified MBs (SA-MBs) with 3 mL of coupling buffer each time, for a total of three washes. Remove the supernatant by magnetic separation to obtain washed SA-MBs. Then dissolve the washed SA-MBs in 3 mL of coupling buffer and mix with 100 μL of 15 μM biotin-labeled TC. Incubate at 37 °C for 30 min to obtain MBs-TC.

[0046] 1.2 Preparation and characterization of AgNPs, AgNPs-Fuel, and MBs-TC TEM images of AgNPs were recorded on a JEM-2100 (Tokyo, Japan), and the zeta potential of fuel chains (Fuel), AgNPs, AgNPs-Fuel, MBs, and MBs-TC were measured using a Zetasizer (Malvern, PA, USA). The size of hydrated particles of AgNPs, AgNPs-Fuel, MBs, MBs-TC, and the subsequently obtained MBs-AgNPs reporter molecules were measured using a Zetasizer (Malvern, PA, USA). XPS analysis of AgNPs was performed on a ThermoScientific K-Alpha, and Fourier transform infrared spectra of AgNPs and AgNPs-Fuel were recorded on a ThermoScientific Nicolet iS20 (MA, USA).

[0047] from Figure 1 As can be seen from A in the figure, the average size of the silver nanoparticles is approximately 40 nanometers. From... Figure 1 As can be seen from B in the figure, the absorption peaks of both AgNPs and AgNPs-Fuel are around 400 nm. After AgNPs are coupled with the fuel chain, the hydrated particle size of the silver nanoparticle-fuel chain changes from 73.00±4.29 nm to 137.83±17.61 nm (see Figure B). Figure 1 (C). The zeta potential of AgNPs is -28.05±1.17mV. Due to the abundance of negative charges in DNA, the zeta potential of AgNPs-Fuel shifts towards -33.12±1.5mV (see C). Figure 1 (D). Therefore, the above results confirm that the fuel chain is successfully linked to AgNPs via Ag-S bonds.

[0048] Next, biotin-modified TCs were linked to streptavidin-modified magnetic beads (MBs) via streptavidin-biotin interactions.

[0049] The zeta potential of MBs-TC increased from -10.43 ± 0.15 mV of MBs to -11.40 ± 0.75 mV. Figure 1 The hydrated particle size of MBs-TC increased from 0.91±0.08 μm to 1.01±0.16 μm (E in the text), while the hydrated particle size of MBs-TC increased from 0.91±0.08 μm to 1.01±0.16 μm (E in the text). Figure 1 (F in the text). Therefore, the above results demonstrate that biotin-modified TC and streptavidin-modified magnetic beads were successfully used to obtain MBs-TC through streptavidin-biotin interaction.

[0050] Furthermore, the hydrated size distribution of MBs-AgNPs reporter molecules carrying the ctDNA target was determined. In the presence of the target ctDNA, the average diameter increased to 1.35 ± 0.12 μm. Figure 1 The F in the figure indicates that MBs-AgNPs reporter genes were generated.

[0051] 1.3. Principle of Multi-Entropy Driven Catalytic Single Nucleotide Resolution (MED) ctDNA Detection Using the Above-described ctDNA Detection Kit The ctDNA is a V-Ki-ras2 Kirsten tumor virus oncogene homolog (KRAS).

[0052] Multi-path entropy-driven catalytic single nucleotide resolution ctDNA detection (MED) enables the visual detection of ctDNA from enzyme-free nucleic acid amplification, combining a highly programmable entropy-driven catalytic process with Ag... + In combination, the controlled urea inhibition reaction is driven by entropy-driven product release (see...) Figure 2 The strategy for detecting ctDNA includes two nucleic acid probes: a magnetic bead-modified triple-stranded complex (MBs-TC) for recognizing ctDNA, and an AgNPs-Fuel that generates a magnetic bead-silver nanoparticle reporter molecule (MBs-AgNPs) via entropy-driven generation. The triple-stranded complex and the fuel chain (Fuel) are designed based on the ctDNA nucleotide sequence (KRAS). Figure 2 and Figure 3As shown in Figure A, when exposed to the ctDNA target, MBs-TC captures ctDNA, sequentially yielding intermediates I-1, I-2, I-3, and waste 1. Furthermore, with the assistance of AgNPs-Fuel, intermediate I-3 ultimately dissociates into MBs-AgNPs reporter molecules for subsequent visible reactions. The released ctDNA is used to initiate the next cycle, while waste 2 is retained. After n cycles, the MBs-AgNPs reporter gene is produced exponentially, leading to amplification of the output signal. MBs-AgNPs reporter molecules are obtained through magnetic separation, and then H2O2 oxidizes the magnetically captured MBs-AgNPs reporter molecules, generating a large amount of free Ag. + When a sample contains ctDNA targets, Ag is released. + It inhibits urease activity, allowing urea to remain intact and maintain the acidity of the sample solution. Therefore, in the presence of the pH indicator phenol red, the solution appears yellow. In the absence of the ctDNA target in the sample, MBs-TC remain undisturbed and cannot produce MBs-AgNPs reporter molecules. Therefore, due to the increase in pH caused by urease hydrolysis, the solution changes from yellow to red, resulting in a color change in the pH indicator caused by the production of ammonium ions. The concentration of ammonium ions determines the solution pH, which can be visualized and observed visually or using an absorption spectrometer, including a smartphone, using a pH indicator. Based on this principle, only the target ctDNA can effectively activate enzyme-free nucleic acid amplification visualization detection, thus enabling the specific identification of mutations in ctDNA.

[0053] Example 2 Research on the detection of mutant ctDNA using the kit from Example 1 The mutant ctDNA in this embodiment is ctDNA-KRAS G12C.

[0054] The nucleotide sequence (5'-3') of the ctDNA-KRAS G12C is AGTTGGAGCTTGTGGCGTAGG (SEQ ID NO. 5); the nucleotide sequence (5'-3') of the wild-type KRAS (NC-KRAS) is AGTTGGAGCTGGTGGCGTAGG (SEQ ID NO. 6).

[0055] In the ctDNA-KRAS G12C, G12C is a mutation of glycine to cysteine ​​at position 12 of the KRAS genome, and the nucleotide sequence shown in SEQ ID NO.5 is a KRAS mutant gene fragment; the mutation site of the nucleotide sequence shown in SEQ ID NO.5 corresponding to ctDNA-KRAS G12C is G>T at position 11 of the sequence.

[0056] A chemically synthesized ctDNA-KRAS G12C sequence was used as a model target ctDNA to validate each reaction step constituting the MED (see [link to MED]). Figure 2 (A) The detection method is as follows: Lanes 1-4 are respectively the chemically synthesized TC-A (SEQ ID NO. 2), TC-B (SEQ ID NO. 2), the triple-stranded complex TC (composed of the sequences shown in SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4), and ctDNA-KRAS G12C (SEQ ID NO. 5). Lane 5 is reactant 1, obtained by reacting 10 μL of 100 nM TC with 10 μL of 100 nM model target ctDNA (ctDNA-KRAS G12C) at 37°C for 30 min. Lane 6 is reactant 2, obtained by reacting 10 μL of 100 nM TC, 10 μL of 100 nM model target ctDNA (ctDNA-KRAS G12C), and 10 μL of 100 nM ctDNA at 37°C for 30 min. Lane 7 shows reactant 3, obtained by reacting 10 μL of 100 nM TC with 10 μL of 100 nM wild-type KRAS (SEQ ID NO. 6) at 37 °C for 30 min; Lane 8 shows reactant 4, obtained by reacting 10 μL of 100 nM TC, 10 μL of 100 nM wild-type KRAS (SEQ ID NO. 6), and 10 μL of 100 nM Fuel at 37 °C for 30 min; Lane 9 shows chemically synthesized Fuel (with a 5' thiol-modified sequence as shown in SEQ ID NO. 1); Lane 10 shows a chemically synthesized DNA molecule (reporter molecule) composed of the sequence shown in SEQ ID NO. 4 and the 5' thiol-modified sequence shown in SEQ ID NO. 1; Lane 11 shows a chemically synthesized ctDNA-KRAS composed of TC-C as shown in SEQ ID NO. 4, TC-A as shown in SEQ ID NO. 2, and ctDNA-KRAS as shown in SEQ ID NO. 5. DNA molecules composed of G12C were analyzed by gel electrophoresis to detect the samples added to each lane.

[0057] Figure 3 The results from the study showed that in the presence of ctDNA-KRAS G12C (lane 5), TC was converted into intermediate I-3 and waste 1 (lane 6), and upon the addition of the fuel chain, it was decomposed into reporter molecules and ctDNA-KRAS G12C. In contrast, during the entropy-driven catalysis (EDC) initiated by wild-type KRAS, TC remained completely intact (lane 7), and even after the addition of the fuel chain, TC remained completely intact (lane 8).

[0058] The experiment was randomly divided into five groups: +G12C group, -G12C group, wild-type KRAS group, -Urease group without urease addition, and -H2O2 group without H2O2 addition. The treatment method for the +G12C group was as follows: (1) 10 μL of 10 nM chemically synthesized ctDNA-KRAS G12C was reacted with 10 μL of 100 nM MBs-TC and 10 μL of 100 nM AgNPs-Fuel in 20 μL of reaction buffer (10 mM Tris-HCl, 2 mM MgCl2, pH 8.0) at 37°C for 30 min. Magnetic separation was used to remove residual AgNPs-Fuel to obtain MBs-AgNPs reporter molecules; (2) The obtained MBs-AgNPs reporter molecules were dispersed in 20 μL of 20 mM H2O2 and reacted at 37°C for 5 min to oxidize AgNPs to Ag. + Add 20 μL of 10 nM urease solution and react at 37 °C for 5 min to obtain the reaction solution. Then, add 50 μL of 200 mM urea and 80 μL of 100 μM phenol red (pH 5.8) to the reaction solution and react at 37 °C for 5 min. Finally, record the absorption spectrum at 430 nm within 60 min after the start of the experiment. The difference between the treatment method of the -G12C group and the +G12C group is that the chemically synthesized ctDNA-KRAS G12C is not added in step (1) of the -G12C group, and the other steps are the same as those of the +G12C group. The difference between the treatment method of the +Wild type group and the +G12C group is that the synthesized ctDNA-KRAS G12C is replaced with the synthesized wild-type KRAS in step (1) of the +Wild type group, and the other steps are the same as those of the +G12C group. The difference between the treatment method of the -Urease group and the +G12C group is that the -Urease group does not add urease solution in step (2), while the other steps are the same as the +G12C group. The difference between the treatment method of the -H2O2 group and the +G12C group is that the -H2O2 group does not add H2O2 in step (2), while the other steps are the same as the +G12C group.

[0059] Figure 3 The results from the C-level analysis show that the target-initiated EDC process, Ag + The inhibitory effect on urease and urease hydrolysis was demonstrated by the peak color change and absorbance trend of phenol red at 430 nm in each reaction step. Compared with the -Urease group, a reaction time of approximately 45 min produced the most obvious yellow to red change caused by the EDC reaction induced by the absence of ctDNA-KRAS G12C. Therefore, the kit of this invention can be used for the rapid detection of ctDNA.

[0060] Subsequently, the sensitivity and specificity of MED detection of the target ctDNA-KRAS were evaluated using the kit from Example 1. (1) 10 μL of chemically synthesized ctDNA-KRAS G12C at different concentrations (0, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM and 100 nM) was reacted with 10 μL of 100 nM MBs-TC and 10 μL of 100 nM AgNPs-Fuel in 20 μL of reaction buffer (10 mM Tris-HCl, 2 mM MgCl2, pH 8.0) at 37 °C for 30 min. Magnetic separation was used to remove residual AgNPs-Fuel to obtain MBs-AgNPs reporter molecules; (2) The obtained MBs-AgNPs reporter molecules were dispersed in 20 μL of 20 mM H2O2 and reacted at 37 °C for 5 min to oxidize AgNPs to Ag. + Add 20 μL of 10 nM urease solution and react at 37 °C for 5 min to obtain the reaction solution. Then, add 50 μL of 200 mM urea and 80 μL of 100 μM phenol red (pH 5.8) to the reaction solution and react at 37 °C for 5 min. Finally, detect the absorption spectrum from 350 nm to 650 nm; and detect the absorption spectra at 430 nm and 558 nm after reactions with different concentrations of ctDNA-KRAS G12C. After the reactions with different concentrations of ctDNA-KRAS G12C, photographs were taken, and the A values ​​were measured. 430nm / A 558nm And A 558nm / A 430nm .

[0061] like Figure 4 As shown in Figure A, the target color gradually changes from red to yellow as the concentration of ctDNA-KRAS G12C increases. Correspondingly, as the concentration of ctDNA-KRAS G12C changes from 0 to 100 nM, the absorbance at 430 nm gradually increases, while the absorbance at 558 nm gradually decreases. Figure 4 (B) in the text is easy to detect with the naked eye.

[0062] The unique feature of the MED in this invention's kit is that it is not only easy to detect with the naked eye, but also enables linear analysis between absorbance and target concentration using a spectrophotometer. To capture a good linear relationship between absorbance (A) and target concentration (C), A... 430nm A 558nm A 430nm / A 558nm And A 558nm / A 430nmThe values ​​at the target concentration were analyzed ( Figure 4 (C~F in the middle).

[0063] Within the range of 100fM to 100nM, the regression equation is A. 430nm =0.05821LgC+0.03498, A 558nm =0.1407LgC+1.117, A 430nm / A 558nm =1.224LgC-3.557 and A 558nm / A 430nm =0.8947LgC+6.295, with coefficients of 0.9962, 0.9677, 0.8319, and 0.8288 respectively. Based on three times the blank standard deviation, the detection limit is calculated to be 7.27 fM. Considering A... 430nm The optimal linear correlation exists between A and concentration; therefore, A will be used subsequently. 430nm The output fluorescence signal is used for analysis.

[0064] To evaluate the specificity of the kit in Example 1 for detecting ctDNA using MED, ctDNA-KRAS G12C mutant and wild-type KRAS were mixed in different molar ratios of 0:100, 0.05:99.95, 0.1:99.9, 0.25:99.75, 0.5:99.5, 1:99, 10:90, and 100:0 to prepare different ctDNA (10 nM) samples, namely 0%, 0.05%, 0.1%, 0.25%, 0.5%, 1%, 10%, and 100%. The absorbance at 430 nm of the mixtures in different molar ratios was detected using the same method as the +G12C group. At the same time, the reaction of the ctDNA-KRAS G12C mutant and wild-type KRAS in different molar ratios was photographed after the reaction.

[0065] Figure 5 The results showed that, as expected, the color changed from red to yellow as the proportion of ctDNA-KRAS G12C mutant material increased. Figure 5 The A value in the text indicates that the actual minimum detectable ctDNA-KRAS G12C mutant / wild-type KRAS ratio reaches 1%. Figure 5 (B) means that even if there is only one target ctDNA in 100 DNAs, it can still be identified.

[0066] Next, in order to test the stability of MED in the test tube ( Figure 6In section A), parallel samples (containing 1% ctDNA-KRAS G12C, i.e., ctDNA-KRAS G12C: wild-type KRAS = 1:99) were tested at 0, 1, 2, 4, 8 and 12 weeks after the preparation of the silver nanoparticle-fuel chain solution and the magnetic bead-modified triple-stranded complex solution. The detection method is the same as that used for the +G12C group above.

[0067] Figure 6 The results of A in the study indicate that within 12 weeks of preparation, the reaction was completed and A was detected. 430nm The values ​​showed no significant difference, indicating the superiority of MED in long-term performance.

[0068] In addition, human serum was used as a simulated sample to quantify KRAS at three different concentrations using a spiked recovery method: ctDNA-KRAS G12C was added to human serum at final concentrations of 10, 100, and 1000 pM, respectively, and the concentration of ctDNA-KRAS G12C was detected using the same method as the +G12C group.

[0069] Figure 6 The results in section B showed that the recovery rate was in the range of 96.96% to 109.85%, and the RSD was from 8.40% to 12.56%, indicating the high confidence and accuracy of MED detection using the kit of the present invention.

[0070] Clinical sample measurement: From January 20, 2023 to December 20, 2023, 40 plasma samples were collected from 20 patients with histologically confirmed colorectal cancer (CA) at different clinical stages at Southwest Hospital of Army Medical University in Chongqing, China. The samples also included 10 patients with benign colorectal adenoma (AD) and 10 healthy controls (NC). All samples were collected after approval by the ethics committee. None of the patients had received any treatment prior to sampling.

[0071] Forty samples (20 cases of colorectal cancer, denoted as CA 1-20; 10 cases of benign colorectal adenomas, denoted as AD 1-10; and healthy controls, denoted as NC 1-10) were collected. Five mL of blood from each sample was centrifuged at 1600 × g for 10 min at 4°C. The supernatant was collected, and the ctDNA was concentrated and purified according to the instructions of the circulating nucleic acid kit. Finally, the extracted ctDNA was amplified by PCR and then sequenced. The ctDNA-KRAS G12C of each sample was detected using the kit described in Example 1, employing the +G12C group method.

[0072] Figure 7 The results of B indicate that A 430nm For KRAS mutants, the values ​​in CA patients were significantly higher than those in AD and NC patients.

[0073] To further evaluate the performance of the MED test in the diagnosis of colorectal cancer, receiver operating characteristic (ROC) curves were plotted to determine the area under the curve (AUC) value.

[0074] Figure 7 The results of the study showed that the AUC value of KRAS for the diagnosis of colorectal cancer was 0.9675, indicating that KRAS has a good effect on the diagnosis of colorectal cancer.

[0075] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A kit for detecting ctDNA, characterized in that, The kit contains the following components: Silver nanoparticle-fuel chain and magnetic bead modified triple-chain complex; The preparation method of the silver nanoparticle-fuel chain includes the following steps: A thiol-modified fuel chain was coupled to silver nanoparticles via a silver-sulfur bond to obtain a silver nanoparticle-fuel chain; the nucleotide sequence of the fuel chain is shown in SEQ ID NO.

1. The method for preparing the magnetic bead-modified triple-stranded complex includes the following steps: Single-stranded DNA TC-A, TC-B, and TC-C were denatured and annealed to obtain a triple-stranded complex; the nucleotide sequence of TC-A is shown in SEQ ID NO.2; the nucleotide sequence of TC-B is shown in SEQ ID NO.3; the nucleotide sequence of TC-C is shown in SEQ ID NO.4; the 5' end of the sequence shown in SEQ ID NO.4 is modified with biotin; The triple-streptavidin complex was reacted with streptavidin-modified magnetic beads to obtain a magnetic bead-modified triple-streptavidin complex.

2. The kit for detecting ctDNA according to claim 1, characterized in that, The kit consists of the following components: The silver nanoparticle-fuel chain, the magnetic bead-modified triple-chain complex, hydrogen peroxide, phenol red, urease, and urea.

3. The kit for detecting ctDNA according to claim 2, characterized in that, The kit consists of the following components at the following molar concentrations: 80-120 nM silver nanoparticle-fuel chain solution, 80-120 nM magnetic bead modified triple chain complex solution, 15-25 mM hydrogen peroxide solution, 80-120 μM phenol red solution at pH 5.5-6.0, 5-15 nM urease solution and 180-220 mM urea solution.

4. The kit for detecting ctDNA according to claim 1, characterized in that, The preparation method of the silver nanoparticle-fuel chain includes the following steps: The thiol-modified fuel chain was incubated with tris(2-carboxyethyl)phosphine hydrochloride, followed by an activation reaction to obtain the activated F probe; The activated F probe and SDS solution were mixed, and the resulting mixture was mixed with silver nanoparticle solution. Then sodium chloride solution was added, and the mixture was allowed to stand to obtain the reaction mixture. The reaction mixture was centrifuged, and the precipitate was collected to obtain the silver nanoparticle-fuel chain.

5. The kit for detecting ctDNA according to claim 4, characterized in that, The molar ratio of the thiol-modified fuel chain to tris(2-carboxyethyl)phosphine hydrochloride is 1:(1~3); the volume ratio of the thiol-modified fuel chain to tris(2-carboxyethyl)phosphine hydrochloride is (0.5~1.5):(0.5~1.5); the incubation method is incubation at 20~25℃ for 0.5~1.5h; the activation reaction method is reaction at 20~25℃ for 10~14h. The volume ratio of the activated F probe, SDS solution, silver nanoparticle solution, and sodium chloride solution is (0.18~0.22):(0.045~0.055):(9~11):(0.2~0.7); the mass-volume percentage of the SDS solution is 2%~6%; the concentration of the sodium chloride solution is 1~3M; and the standing is carried out at 20~25℃ for 6~10h.

6. The kit for detecting ctDNA according to claim 1, characterized in that, The reaction is carried out at 35-40℃ for 25-35 min; the molar concentration of the triple-stranded complex is 10-20 μM; and the volume ratio of the triple-stranded complex to the streptavidin-modified magnetic beads is 0.05-0.15:

1.

7. The kit for detecting ctDNA according to any one of claims 1 to 6, characterized in that, Silver nanoparticles-fuel chain, magnetic bead-modified triple-chain complex, hydrogen peroxide, phenol red, urease and urea are packaged separately.

8. The use of the kit for detecting ctDNA according to any one of claims 1 to 6 in the preparation of products for detecting ctDNA and / or diagnosing colorectal cancer.

9. The use of the kit for detecting ctDNA according to any one of claims 1 to 6 in the preparation of products for detecting the KRAS gene in ctDNA.

10. The application according to claim 9, characterized in that, The KRAS gene is a KRAS mutant gene; the KRAS mutant gene is KRAS G12C; the nucleotide sequence of KRAS G12C is shown in SEQ ID NO.5.

Images