Electrochemical biosensing system based on crisper-cas14a1 and era technology for detecting div1 and application thereof

Abstract

The application discloses an electrochemical biosensing system for detecting DIV1 based on CRISPR-Cas14a1 and ERA technology, which comprises a reaction detection unit and a signal conversion unit; the reaction detection unit comprises an ERA primer pair for targeting a DIV1 MCP gene, Cas14a1 protein and specific sgRNA; and the signal conversion unit comprises a gold nanoparticle modified working electrode and an electrochemical reporter probe fixed on the surface of the working electrode. During detection, after sample DNA is rapidly amplified through ERA, the DNA is recognized by a CRISPR-Cas14a1 complex and Cas14a1 is activated, the electrochemical reporter probe is cut, the electrochemical current signal is changed, and rapid, high-sensitivity and high-specificity detection of DIV1 is realized. The application organically combines nucleic acid isothermal amplification, a gene editing tool and electrochemical sensing, is convenient and fast, and is particularly suitable for instant detection requirements on the spot of aquaculture.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology detection technology and biosensing, specifically to an electrochemical biosensing system based on the combination of the CRISPR-Cas14a1 system and recombinase polymerase amplification (ERA) technology, and its application in the detection of Decapodiform Iridovirus 1 (DIV1). Background Technology

[0002] Decapod iridescent virus 1 (DIV1) is the only species in the genus *Virus* of the order *Decapod* in the family Iridoviridae. It is an enveloped icosahedral double-stranded DNA virus. This virus has an extremely wide host range, infecting many economically important crustaceans such as Litopenaeus vannamei and Penaeus monodon, causing high mortality rates and resulting in huge economic losses to the global crustacean aquaculture industry.

[0003] Currently, the main detection methods for DIV1 include PCR and ELISA. These methods generally suffer from problems such as long processing time, reliance on expensive thermal cycling equipment or professional operators, and limited sensitivity, making it difficult to meet the urgent need for rapid, point-of-care testing (POCT) in scenarios such as aquaculture sites and port quarantine.

[0004] Recombinase polymerase amplification (ERA) is a novel isothermal nucleic acid amplification technique that can achieve exponential enrichment of target nucleic acids within 20 minutes at a constant temperature (approximately 40°C). It requires no thermal cycling equipment, is simple to operate, and is ideal for field applications. The CRISPR-Cas14a1 system belongs to the VF type Cas protein and has the ability to specifically recognize double-stranded DNA. Upon activation, it can non-specifically cleave single-stranded DNA reporter molecules. Existing technologies have explored combining ERA with CRISPR systems for pathogen detection; however, signal readout largely depends on fluorescence detection, requiring expensive and not easily portable fluorescence detection equipment, limiting its widespread application in resource-constrained environments.

[0005] Electrochemical biosensors possess significant advantages such as fast response, low cost, and ease of miniaturization and portability, making them ideal platforms for on-site, real-time detection. However, no reports have yet documented a comprehensive, instrument-free detection system for DIV1 that deeply integrates efficient ERA amplification, highly specific CRISPR-Cas14a1 recognition, and sensitive electrochemical readout technology. Therefore, developing a biosensor system that integrates rapid ERA amplification, highly specific CRISPR recognition, and sensitive electrochemical readout is of significant technical and practical value for achieving rapid, accurate, and on-site detection of DIV1. Summary of the Invention

[0006] The present invention aims to overcome the shortcomings of the prior art and provide an integrated electrochemical biosensing system based on the CRISPR-Cas14a1 system and ERA technology to achieve rapid, ultrasensitive and highly specific detection of Decapoda Iridovirus 1 (DIV1), which is especially suitable for on-site detection needs in aquaculture and other fields.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows:

[0008] An electrochemical biosensing system for detecting DIV1 based on CRISPR-Cas14a1 and ERA technology, comprising:

[0009] (1) A reaction detection unit, including:

[0010] a. An ERA amplification system for the rapid enrichment of target DNA, wherein the ERA amplification system includes a specific primer pair targeting the DIV1 MCP gene;

[0011] b. CRISPR-Cas14a1 detection system, including Cas14a1 protein and specific sgRNA, is used to identify target amplification products and activate the cleavage activity of Cas14a1 protein;

[0012] (2) Signal conversion unit, including:

[0013] a. Working electrode with surface modified with gold nanoparticles;

[0014] b. An electrochemical reporter probe fixed to the surface of the working electrode;

[0015] The electrochemical reporter probe is a single-stranded DNA that can be non-specifically cleaved by the activated Cas14a1 protein. The 5' end of the single-stranded DNA is covalently linked to the surface of the gold nanoparticles through thiol modification, and the 3' end is labeled with an electroactive substance.

[0016] The electroactive substance is methylene blue (MB).

[0017] In this invention, the CRISPR-Cas14a1 detection system reacts on the surface of the working electrode, and the activated Cas14a1 protein generated by the reaction cleaves the reporter probe on the electrode, causing a change in the electrochemical signal, thereby realizing the detection of DIV1.

[0018] Furthermore, the CRISPR-Cas14a1 detection system is dropped onto the working electrode, and the electrochemical reporter probe immobilized on the surface of the working electrode can be cleaved by the activated Cas14a1 protein in the reaction system, causing the electroactive substances on the electrode surface to detach or the signal to change; the target is detected by detecting the change in the electrical signal of the working electrode.

[0019] In this invention, the specific primer pair is used to rapidly enrich target DNA; the Cas14a1 protein and sgRNA are used to specifically recognize ERA amplification products and activate cleavage activity.

[0020] Furthermore, the specific primer pair is any one of primer sets 1 to 8, wherein the sequences of primer set 1 are SEQ ID NO.1 and SEQ ID NO.2, the sequences of primer set 2 are SEQ ID NO.3 and SEQ ID NO.4, the sequences of primer set 3 are SEQ ID NO.5 and SEQ ID NO.6, the sequences of primer set 4 are SEQ ID NO.7 and SEQ ID NO.8, the sequences of primer set 5 are SEQ ID NO.9 and SEQ ID NO.10, the sequences of primer set 6 are SEQ ID NO.11 and SEQ ID NO.12, the sequences of primer set 7 are SEQ ID NO.13 and SEQ ID NO.14, and the sequences of primer set 8 are SEQ ID NO.15 and SEQ ID NO.16.

[0021] Preferably, the specific primer pair is primer set 3, and the sequence of primer set 3 is SEQ ID NO.5 and SEQ ID NO.6.

[0022] The sgRNA is any one of sgRNA1 to sgRNA6, and the sequences of sgRNA1 to sgRNA6 are SEQ ID NO.14 to SEQ ID NO.22, respectively. This sgRNA can specifically recognize the DIV1 major capsid protein (MCP) gene and contains an optimized backbone sequence to enhance its binding to the Cas14a1 protein and target recognition efficiency.

[0023] The sgRNA includes a Cas14a1 protein binding region, a stem-loop structure region, and a target recognition region; the target recognition region has a complementary sequence length of 20 bp to the DIV1 MCP gene, a GC content of 40%-60%, and no self-complementary secondary structure.

[0024] Preferably, the sgRNA is sgRNA1, sgRNA3, or sgRNA4, with sequences SEQ ID NO.17, SEQ ID NO.19, and SEQ ID NO.20, respectively.

[0025] More preferably, the sgRNA is sgRNA1, with the sequence SEQ ID NO.17.

[0026] The working electrode with gold nanoparticles on its surface is prepared by the following method: a bare gold electrode is activated in a 0.2-0.5 mM H2SO4 solution, and then immersed in a solution containing chloroauric acid (HAuCl4) to electrodeposit gold nanoparticles.

[0027] The electrochemical reporter probe is a single-stranded DNA with -SH modified at the 5' end and MB labeled at the 3' end; the sequence of the single-stranded DNA can be recognized and cleaved by CRISPR / Cas proteins, preferably T / A-rich single-stranded DNA with a length of 10-25 nt.

[0028] In a preferred embodiment, the sequence of the electrochemical reporter probe is as follows:

[0029] HS-SH C6-TTTTTTTTTTTTTTTTTTTT-MB.

[0030] The method for immobilizing the electrochemical reporter probe includes: self-assembling an electrochemical reporter probe with terminal thiol groups onto the surface of a working electrode modified with gold nanoparticles via Au-S bonds, and then sealing the electrode surface with mercaptohexanol.

[0031] Furthermore, the preferred method for immobilizing the electrochemical reporter probe is:

[0032] The electrochemical reporter probe was reduced with 10 mM TCEP-HCl in a metal bath at 37 °C for 30 min in the dark. Then, 20 μL of 2 μM electrochemical reporter probe was cast onto the surface of the working electrode modified with gold nanoparticles. The probe was fixed by Au-S bond by incubation at 37 °C for 1 h. After rinsing with 10 mM Tris buffer, the electrode was dried at room temperature. Then, 20 μL of 2 mM MCH was added to the working electrode area and incubated at 37 °C for 1 h to block unbound sites. After rinsing with water and drying at room temperature, the MB-DNA / MCH co-modified electrode was obtained.

[0033] The signal conversion unit of the present invention is preferably manufactured by the following method:

[0034] (1) Electrodeposition of gold nanoparticles on the surface of screen-printed electrode using cyclic voltammetry: 40 μL of a mixed solution containing 4 mM chloroauric acid and 0.5 M H2SO4 was added dropwise and covered the working electrode area of ​​SPE. The cathode was scanned 20 times at a scan rate of 50 mV / s in the potential range of −0.2 V to −1.2 V to reduce and deposit Au³⁺ to form a gold nanoparticle layer, thus obtaining a working electrode with gold nanoparticles modified on the surface.

[0035] (2) The electrochemical reporter probe was reduced with 10 mM TCEP-HCl in a metal bath at 37°C for 30 min in the dark. Then, 20 μL of 2 μM electrochemical reporter probe was cast onto the working electrode surface modified with gold nanoparticles in step (1). The electrode was incubated at 37°C for 1 h, rinsed with 10 mM Tris buffer, and dried at room temperature. Then, 20 μL of 2 mM MCH was added to the working electrode area and incubated at 37°C for 1 h. The electrode was rinsed with water and dried at room temperature to obtain the MB-DNA / MCH co-modified electrode, which is the signal conversion unit.

[0036] The present invention also provides a kit for detecting decapod iridovirus 1 (DIV1), the kit comprising the electrochemical biosensing system for detecting DIV1 based on CRISPR-Cas14a1 and ERA technology, ERA amplification reagent, CRISPR-Cas14a1 detection reagent, positive control and negative control.

[0037] The ERA amplification reagents include a solvent, an activator, and a basic amplification reagent, all of which were purchased from Suzhou Xianda Gene Technology Co., Ltd., catalog number KS101.

[0038] The CRISPR-Cas14a1 detection reagent includes a reaction buffer, prepared according to the literature "Efficient, specific and direct detection of double-stranded DNA targets using Cas12f1 nucleases and engineered guide RNAs, Biosensors and Bioelectronics 260 (2024) 116428". The 10× reaction buffer consists of: 50 mM Tris-HCl, 500 mM NaCl, 5 mM DTT, 50 mM MgCl2, pH 7.5.

[0039] The positive control is a plasmid containing the DIV1 MCP gene sequence; the DIV1 MCP gene sequence is shown in SEQ ID No. 23.

[0040] The negative control was nuclease-free water.

[0041] The kit may also include a nucleic acid extraction reagent for extracting nucleic acid from the sample to be tested as a template.

[0042] Alternatively, commercially available nucleic acid extraction kits can be used to extract nucleic acid from the sample to be tested.

[0043] The present invention also provides a method for detecting Decapodiform Iridovirus 1 (DIV1) using a kit for detecting DIV1, the method comprising the following steps:

[0044] (1) Extracting DNA from the sample to be tested;

[0045] (2) Using the extracted DNA as a template, perform ERA isothermal amplification;

[0046] (3) Mix the ERA isothermal amplification product with Cas14a1 protein, sgRNA, and 10× reaction buffer to prepare a CRISPR-Cas14a1 detection system. Add the system to the working electrode surface of the electrochemical biosensor system and incubate at 46℃ for 20-30 min to activate the cleavage activity of Cas14a1 protein.

[0047] (4) Clean and dry the working electrode, and use the square wave voltammetry to detect the change of current signal on the surface of the working electrode in Tris buffer. Perform qualitative and / or quantitative analysis of DIV1 based on the signal intensity.

[0048] In step (2), the DNA template is used to prepare the ERA amplification system and ERA isothermal amplification is performed.

[0049] Preferably, the total volume of the ERA amplification system is 50 μL, comprising: 48 μL of premix, 2 μL of activator, and basic amplification reagent mixed in the premix.

[0050] Furthermore, the 48 μL premix comprises: 20 μL of solvent, 2.5 μL of 10 μM upstream primer, 2.5 μL of 10 μM downstream primer, 2 μL of DNA template, and the remainder is nuclease-free water.

[0051] The conditions for ERA isothermal amplification are: constant temperature incubation at 40℃ for 20 min.

[0052] Furthermore, in step (3), the CRISPR-Cas14a1 detection system includes Cas14a1 protein, sgRNA, 10× reaction buffer, and ERA isothermal amplification product.

[0053] Preferably, the total volume of the CRISPR-Cas14a1 detection system is 20 μL, comprising: 1 μL of Cas14a1 protein at 1 mg / mL, 1 μL of sgRNA at 600 ng / μL, 2 μL of 10× reaction buffer, 1 μL of ERA amplification product, and the remainder being ddH2O.

[0054] In step (4), the working electrode is generally rinsed with ultrapure water and dried at room temperature.

[0055] In step (4), the Tris buffer is pH 8.0 and contains 100 mM NaCl and 10 mM Tris buffer.

[0056] Furthermore, in step (4), the qualitative analysis method is as follows: if the peak value of the square wave voltammetry (SWV) current of the electrochemical detection working electrode is significantly smaller than that before the reaction, it is determined to be positive; if the peak value of the SWV current of the working electrode does not change significantly, it is determined to be negative.

[0057] The quantitative analysis method is as follows: record the difference in SWV current response of the sample (ΔI = I0 − I), compare it with the standard curve, and perform quantitative analysis.

[0058] The standard curve is prepared using the following method:

[0059] The DIV1 DNA standard plasmid was serially diluted to obtain templates of different concentrations. Amplification and detection were performed in the same manner as steps (2), (3), and (4). The difference in SWV current response (ΔI) of the working electrode before and after the reaction was collected. A standard curve was plotted with the logarithm of the target DNA concentration as the abscissa and the corresponding difference in SWV current response (ΔI) as the ordinate.

[0060] The working electrode surface of the present invention is modified with gold nanoparticles (AuNPs) by electrochemical deposition to increase the specific surface area and enhance the probe immobilization amount and electron transfer capability.

[0061] The working principle of this sensing system is as follows: After rapid amplification of DIV1 DNA in the sample via ERA, the product is specifically recognized by the CRISPR-Cas14a1 complex, activating the cleavage activity of the Cas14a1 protein. The activated Cas14a1 protein can non-specifically cleave the electrochemical reporter probe immobilized on the electrode surface, causing the labeled electroactive substance (MB) to detach from the electrode surface, thereby resulting in a significant decrease in the electrochemical signal at the electrode interface (such as a decrease in the square wave voltammetric peak current). By detecting the change in this current signal, ultrasensitive and specific detection of DIV1 can be achieved.

[0062] The present invention also provides a method for preparing the above-mentioned integrated electrochemical biosensing system, particularly the optimization of electrode modification and probe immobilization processes.

[0063] The beneficial effects of this invention are as follows:

[0064] (1) Fast detection speed and simple operation: The entire detection process can be completed within 50 minutes (ERA amplification 20 min, CRISPR incubation 20~30 min, working electrode detection about 5 min), and the whole process is kept at a constant temperature. No complicated heating and cooling instruments are required, which is very suitable for rapid on-site screening.

[0065] (2) Wide range of applications: This biosensing system and method is not only suitable for precise analysis in the laboratory, but also for on-site real-time detection in shrimp farms, aquatic product trading markets, import and export ports, etc., and has important practical application value and promotion prospects.

[0066] (3) High integration and portability: For the first time, ERA amplification, CRISPR recognition and electrochemical detection are organically combined, overcoming the shortcomings of traditional methods such as multi-step transfer, reliance on complex instruments and inconvenience, and truly realizing the on-site detection mode of "sample in, result out".

[0067] (4) Fast and low cost: The entire detection process can be completed within 1 hour, and the electrochemical detection equipment is inexpensive and easy to miniaturize, which greatly reduces the detection cost and operation threshold.

[0068] (5) Laying a solid foundation for subsequent development: This invention not only provides a high-performance detection system, but its optimized electrode modification process, probe immobilization method and reaction system provide core technology and methodological support for the development of more advanced integrated, microfluidic electrochemical biosensors. Attached Figure Description

[0069] Figure 1 This is a schematic diagram illustrating the working principle of the sgRNA biosensor system for detecting DIV1 based on the CRISPR-Cas14a1 system provided by the present invention.

[0070] Figure 2 This is an SDS-PAGE gel electrophoresis image of the Cas14a1 protein.

[0071] Figure 3 Agarose gel electrophoresis images of the amplification products of 8 sets of ERA amplification primer pairs.

[0072] Figure 4 This is a gel electrophoresis verification image of the transcription products of 6 sgRNAs.

[0073] Figure 5 This is a comparison of the fluorescence signal kinetics curves of the six sgRNAs in the fluorescence detection system.

[0074] Figure 6 A bar chart showing the fluorescence signals of six sgRNAs at 30 min.

[0075] Figure 7 The images show the surface morphology and roughness analysis results of gold nanoparticles before and after electrode modification using atomic force microscopy (AFM). Image A shows the surface before modification, and image B shows the surface after modification.

[0076] Figure 8Figure A shows the characterization results of the SPE-AuNPs electrode. Figure B shows the energy dispersive X-ray spectra (EDS) of Au element distribution on the surface of the SPE-AuNPs electrode. Figure C shows the comparison of the Fourier transform infrared (FTIR) spectra before and after electrode surface modification. Figure D shows the high-resolution X-ray photoelectron spectroscopy (XPS) spectrum of the Au4f orbital. Figure 9 Figure A shows the electrochemical verification results of the electrode modification process. Figure B is a comparison of cyclic voltammetry (CV) curves and an electrochemical impedance spectroscopy (EIS) Nyquist plot.

[0077] Figure 10 This study analyzes the changes in electrochemical active area during the stepwise modification process of the electrode. Figures A and D show the cyclic voltammetry curves and their calibration curves for the bare SPE electrode; Figures B and E show the cyclic voltammetry curves and their calibration curves for the AuNPs-modified electrode; Figure C shows the original current response waveforms of the bare SPE electrode and the AuNPs-modified electrode at different scan rates (0.01–0.2 V / s); Figure F shows the linear fitting relationship between the peak current and the square root of the scan rate based on Figure C and the cyclic voltammetry curves at different scan rates (n=3).

[0078] Figure 11 Figure A shows the results of the optimized electrochemical reporter probe immobilization conditions. Figure A compares the square wave voltammetry (SWV) response current (ip) of electrodes modified with different sequence probes (Probe 1, 2, 3); Figure B shows the initial ip values ​​of the modified electrodes at different Probe 3 concentrations (1-8 μM); Figure C shows the effect of different probe immobilization times (0.5-5 h) on the ip values. Detailed Implementation

[0079] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be noted that the embodiments described below are intended to facilitate the understanding of the present invention and do not limit it in any way.

[0080] This invention provides a general and / or specific description of the materials and methods used in the experiments. While many of the materials and methods of operation used to achieve the objectives of this invention are well known in the art, they are still described in as much detail as possible herein.

[0081] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.

[0082] The experimental equipment involved in the following embodiments is shown in Table 1:

[0083] Table 1. Names and Manufacturers of Experimental Equipment

[0084] Material Name factory Basic Nucleic Acid Amplification Kit (ERA Method) KS101 Suzhou Xianda Gene Technology Co., Ltd. DEPC water Sangon Biotech (Shanghai) Co., Ltd. Nano-300 Micro Spectrophotometer Hangzhou Aosheng Instrument Co., Ltd. Q3 Real-time PCR Instrument Thermo Fisher Scientific T7 High Yield RNA Transcription Kit Nanjing Novozymes Biotechnology Co., Ltd.

[0085] The detection principle of the electrochemical biosensor system for detecting DIV1 based on CRISPR-Cas14a1sgRNA is as follows: Figure 1 As shown.

[0086] Example 1: Expression and purification of Cas14a1 protein

[0087] To achieve this invention, high-purity Cas14a1 protein needs to be prepared. The specific steps are as follows:

[0088] (1) Construction and induction of recombinant expression strains: The Cas14a1 encoding gene was cloned into the pET-21 (+) vector, and the pET-21(+)-Cas14a1 recombinant plasmid was constructed using a seamless cloning kit (Beijing TransGen Biotech Co., Ltd., catalog number CU101). The pET-21(+)-Cas14a1 recombinant plasmid was transformed into E. coli BL21(DE3) competent cells, and positive clones were screened on LB agar plates containing ampicillin. Single colonies were picked and inoculated into LB liquid medium containing the same antibiotic and cultured until the logarithmic growth phase (OD200). 600 (≈0.6), add 0.5 mM IPTG, and induce expression for 20 hours at 16℃ and 130 rpm.

[0089] (2) Cell disruption and crude extract acquisition: Cells were collected by centrifugation, washed with buffer, and resuspended in cell disruption buffer. Cells were disrupted by high-pressure homogenization or sonication. The supernatant was collected after centrifugation to obtain a crude extract containing Cas14a1 protein.

[0090] (3) Two-step chromatography to purify the protein: First, the crude extract was initially purified using Ni-NTA affinity chromatography. The supernatant was filtered through a 0.45 μm filter and loaded onto a pre-equilibrated Ni²⁺ column. Impurities were removed sequentially using washing buffers containing different concentrations of imidazole, followed by collection of the target protein using an elution buffer containing a high concentration of imidazole. Subsequently, cation exchange chromatography (e.g., HiTrap™ CM FF column) was used for further purification: the protein eluted by affinity chromatography was replaced with a low-salt buffer and loaded onto the column. Further impurities were removed by elution using a salt ion gradient, and the high-purity Cas14a1 protein fraction was collected. Protein purity was monitored by SDS-PAGE during the purification process (see results in [link to SDS-PAGE]). Figure 2 ).

[0091] (4) Protein concentration and storage: The purified protein solution was concentrated using an ultrafiltration centrifuge tube and then transferred to a storage buffer containing a protective agent (such as glycerol). After determining the protein concentration, the protein was aliquoted and stored at -80°C for later use.

[0092] Example 2: Preparation of DIV1 DNA Standard and sgRNA Template

[0093] 1.1 Construction of DIV1 DNA Standard Plasmid

[0094] Based on the conserved sequence of the DIV1 MCP gene (GenBank: KY681039.1), its full-length gene fragment (sequence shown in SEQ ID No. 23) was synthesized and cloned into the pUC-57 vector to construct the recombinant plasmid pUC-57-DIV1. After the recombinant plasmid was verified to be correct by sequencing, high-purity plasmid DNA was extracted and used as a DIV1 DNA standard (positive template), and serially diluted to establish a standard curve.

[0095] SEQ ID No. 23:

[0096]

[0097] 1.2 Preparation of sgRNA transcription template

[0098] According to the references, the Cas14a1-sgRNA template sequence was synthesized. Using this template, PCR amplification was performed using primers with the T7 promoter (Table 2) to prepare a DNA template for in vitro transcription of sgRNA.

[0099] Table 2 Primer sequences used for synthesizing DIV1 DNA standards and sgRNA transcription templates

[0100] SEQ ID name Sequence (5'→3') SEQ ID No. 24 DIV1-sgRNA-1F TAATACGACTCACTATAGGGACCGCTTCACTTAGAGTGAA SEQ ID No. 25 DIV1-sgRNA-1R AAAATAAAAGCTATTAAAGCGGCAAAGGGGTTGCATTCCTTTCTTTGTT SEQ ID No. 26 DIV1-sgRNA-2F TAATACGACTCACTATAGGGACCGCTTCACTTAGAGTGAA SEQ ID No. 27 DIV1-sgRNA-2R AAAATAAAAGTATCCGGTGAGTTCGGGAAGTTGCATTCCTTTCTTTGTT SEQ ID No. 28 DIV1-sgRNA-3F TAATACGACTCACTATAGGGACCGCTTCACTTAGAGTGAA SEQ ID No. 29 DIV1-sgRNA-3R AAAATAAAAAGGCACCGGCCATTCCCGAAGTTGCATTCCTTTCTTTGTT SEQ ID No. 30 DIV1-sgRNA-4F TAATACGACTCACTATAGGGACCGCTTCACTTAGAGTGAA SEQ ID No. 31 DIV1-sgRNA-4R AAAATAAAAGCTGCTATTAAAGCGGCAAAGTTGCATTCCTTTCTTTGTT SEQ ID No. 32 DIV1-sgRNA-5F TAATACGACTCACTATAGGGACCGCTTCACTTAGAGTGAA SEQ ID No. 33 DIV1-sgRNA-5R AAAATAAAAAGCAGCTTCGGAGCATTGAAGTTGCATTCCTTTCTTTGTT SEQ ID No. 34 DIV1-sgRNA-6F TAATACGACTCACTATAGGGACCGCTTCACTTAGAGTGAA SEQ ID No. 35 DIV1-sgRNA-6R AAAATAAAAGATCCTTCTGGGTCTGCCAAGTTGCATTCCTTTCTTTGTT

[0101] Prepare the PCR amplification system according to Table 3.

[0102] Table 3 PCR amplification system

[0103] Reagent Sample loading volume Fast PCR Master Mix (Takara) 10 μL F (10 μM) 2 μL R (10 μM) 2 μL Template (1 ng / μL) 1 μL ddH2O To a total volume of 20 μL

[0104] The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 5 min.

[0105] After gel purification, the amplified product was used to obtain the DNA transcription template for sgRNA.

[0106] Example 3: Screening and Validation of ERA Amplification Primer Sets

[0107] 2.1 Primer Design and Synthesis

[0108] Eight sets of ERA amplification primers were designed targeting the conserved region of the DIV1 MCP gene. The primer lengths ranged from 28 to 33 bp, and the GC content ranged from 40% to 60%. The primer sequences are shown in Table 4 as SEQ ID NO.1 to SEQ ID NO.16, representing the eight primer sets. The primers were synthesized and purified by General Biosystems (Anhui) Co., Ltd.

[0109] 2.2 Primer screening

[0110] Using 10 ng / μL of DIV1 DNA standard (prepared in Example 2) as a template, ERA amplification was performed using 8 sets of primer pairs (Table 4).

[0111] The ERA amplification reaction system (50 μL) is shown in Table 5.

[0112] Table 4. ERA amplification primer sequences

[0113] SEQ ID Name Sequence (5’→3’) SEQ ID No.1 DIV1-ERA-1F GGCCATTCCCGAACTCACCGGATACCAC SEQ ID No.2 DIV1-ERA-1R GGCTTCACCTTCACCCTTTGCCGCTTTA SEQ ID No.3 DIV1-ERA-2F CCATTCCCGAACTCACCGGATACCACAT SEQ ID No.4 DIV1-ERA-2R GGCTTCACCTTCACCCTTTGCCGCTTTA SEQ ID No.5 DIV1-ERA-3F CGATTACTTCTCACTGATCGAACCCTAC SEQ ID No.6 DIV1-ERA-3R GGCTTCACCTTCACCCTTTGCCGCTTTA SEQ ID No.7 DIV1-ERA-4F CGATTACTTCTCACTGATCGAACCCTAC SEQ ID No.8 DIV1-ERA-4R ACCAGTCTTGGCTTCACCTTCACCCTTT SEQ ID No.9 DIV1-ERA-5F GAACAATGTTGATCCTTCTGGGTCTGCC SEQ ID No.10 DIV1-ERA-5R ACCAGTCTTGGCTTCACCTTCACCCTTT SEQ ID No.11 DIV1-ERA-6F CCGAAGCCGAGCGAGCACGTATGGGATG SEQ ID No.12 DIV1-ERA-6R GATGTCGTAAGAGGGATTTGGGTTGAGG SEQ ID No.13 DIV1-ERA-7F CCGAAGCCGAGCGAGCACGTATGGGATG SEQ ID No.14 DIV1-ERA-7R CTGATGTCGTAAGAGGGATTTGGGTTGA SEQ ID No.15 DIV1-ERA-8F TATTCCCGTGATGACTGCCGATTACTTC SEQ ID No.16 DIV1-ERA-8R GGCTTCACCTTCACCCTTTGCCGCTTTA

[0114] Table 5 ERA amplification reaction system

[0115] Reagent components Volume / Concentration Solvent 20 μL Forward primer (10 μM) 2.5 μL Reverse primer (10 μM) 2.5 μL DNA template 2 μL Nuclease-free water Make up to 48 μL

[0116] For each sample, transfer 48 μL of the premix to each tube of basal amplification reagent. Vortex to mix until the amplification reagent is resuspended, and then briefly centrifuge.

[0117] For each sample, add 2 μL of activator to the reaction tube cap, carefully tighten the cap, and briefly centrifuge to allow the activator to enter the premixed solution. Briefly vortex to mix and then centrifuge rapidly again.

[0118] Reaction conditions: Incubate at 40℃ for 20 min.

[0119] Take 10 μL of the amplification product and perform 1.5% agarose gel electrophoresis (120 V, 30 min) for analysis.

[0120] The results are as follows Figure 3 As shown, primer pair DIV1-ERA-3 (corresponding to SEQ ID NO.5 and SEQ ID NO.6) has the highest amplification efficiency, with a single bright band and no non-specific products such as primer dimers. Therefore, it was selected as the optimal primer pair for ERA amplification.

[0121] Example 4: Preparation and Screening of sgRNA

[0122] 3.1 Design and in vitro transcription of sgRNA

[0123] Six candidate sgRNAs (SEQ ID NO.17-SEQ ID NO.22) were designed targeting the ERA amplification region of the DIV1 MCP gene. Using the DNA template of the sgRNA prepared in step 1.2 of Example 2, in vitro transcription was performed using the T7 High Yield RNA Transcription Kit. The transcription products were purified using an RNA purification kit to obtain six high-purity candidate sgRNAs (Table 6). Their integrity and size were verified by gel electrophoresis, and the results are shown below. Figure 4 .

[0124] Table 6 DIV1-sgRNA Sequence

[0125] SEQ ID Name Sequence (5’→3’) SEQ ID No.17 DIV1-sgRNA1 ACCGCUUCACUUAGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAGAAAGGAAUGCAACCCCUUUGCCGCUUUAAUAGCUUUUAUUUU SEQ ID No.18 DIV1-sgRNA2 ACCGCUUCACUUAGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAGAAAGGAAUGCAACUUCCCGAACUCACCGGAUACUUUUAUUUU SEQ ID No.19 DIV1-sgRNA3 ACCGCUUCACUUAGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAGAAAGGAAUGCAACUUCGGGAAUGGCCGGUGCCUUUUUAUUUU SEQ ID No.20 DIV1-sgRNA4 ACCGCUUCACUUAGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAGAAAGGAAUGCAACUUUGCCGCUUUAAUAGCAGCUUUUAUUUU SEQ ID No.21 DIV1-sgRNA5 ACCGCUUCACUUAGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAGAAAGGAAUGCAACUUCAAUGCUCCGAAGCUGCUUUUUAUUUU SEQ ID No.22 DIV1-sgRNA6 ACCGCUUCACUUAGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAGAAAGGAAUGCAACUUGGCAGACCCAGAAGGAUCUUUUAUUUU

[0126] 3.2 Screening of sgRNA

[0127] To screen for the sgRNA with the highest guiding activity, a CRISPR-Cas14a1 fluorescence detection system was constructed, and six candidate sgRNAs were added for testing.

[0128] The CRISPR-Cas14a1 fluorescence detection system (20 μL) is shown in Table 7.

[0129] Table 7 CRISPR-Cas14a1 fluorescence detection system

[0130] Component Volume (μL) 10× Reaction buffer 2 Cas14a1 protein (1 mg / mL) 1 FQ (8 µM) 1 sgRNA (600 ng / μL) 1 Template (original ERA concentration) 1 <![CDATA[ddH2O]]> 14

[0131] The formulation of 10× reaction buffer is: 50 mM Tris-HCl, 500 mM NaCl, 5 mM DTT, 50 mM MgCl₂ 2, pH 7.5.

[0132] The sequence of the Cas14a1-FQ fluorescent probe is 5'-FAM-TTTTTTTTTTTT-Bhq1-3'

[0133] Place the reaction system in a real-time PCR instrument (Q3) and set the reaction program to 46℃ for 30-40 min, collecting fluorescence once per minute.

[0134] Fluorescence signals were monitored in real time, and the fluorescence intensity value (ΔRn) was recorded after 30 min of reaction. The results are as follows: Figure 5 and Figure 6 As shown, sgRNA 1 (corresponding to SEQ ID NO.17) generated the highest fluorescence signal intensity and the fastest reaction kinetics, and was therefore identified as the optimal sgRNA.

[0135] Example 5: Construction and Characterization of Electrochemical Biosensing System

[0136] To achieve highly sensitive electrochemical detection of DIV1, this embodiment constructs a working electrode based on AuNPs modification, and comprehensively characterizes and optimizes its morphology, chemical composition, electrochemical performance, and probe immobilization conditions.

[0137] (1) Electrodeposition of gold nanoparticles on the surface of screen-printed electrode using cyclic voltammetry: 40 μL of a mixed solution containing 4 mM chloroauric acid and 0.5 M H2SO4 was drop-coated to cover the working electrode area of ​​SPE. The cathode was scanned 20 times at a scan rate of 50 mV / s in the potential range of −0.2 V to −1.2 V to reduce and deposit Au³⁺ to form a gold nanoparticle layer. The electrode was washed with water and dried before use.

[0138] 5.1 Morphology and structural characterization of AuNPs-modified electrodes

[0139] The electrode surfaces before and after AuNP modification were observed using atomic force microscopy (AFM). Figure 7 As shown, the electrode surface is relatively flat before modification. Figure 7A), with an average roughness (Rq) of (26.52 ± 1.03) nm; the modified surface exhibits a uniformly distributed rough nanostructure ( Figure 7 B), Rq significantly increased to (49.38 ± 4.25) nm, confirming the successful construction of gold nanoparticle (AuNFs) structure on the electrode surface, which helps to increase the specific surface area and provide more active sites for subsequent biomolecule immobilization.

[0140] To verify the chemical composition and distribution of AuNPs, further multispectral characterization was performed. Energy-dispersive X-ray spectroscopy (EDS) elemental surface scans were conducted. Figure 8 A) shows that Au elements are uniformly distributed on the electrode surface without obvious aggregation, indicating that the AuNPs modification is uniform. Fourier transform infrared (FTIR) spectroscopy comparison analysis ( Figure 8 B) indicates that after AuNP modification, the characteristic peaks in the 600–800 cm⁻¹ and 1000–1200 cm⁻¹ regions were significantly enhanced, possibly related to Au-molecule interactions; the double bond vibration peaks in the 1500–1700 cm⁻¹ region and the CH / OH stretching vibration peaks in the 2800–3200 cm⁻¹ region were also enhanced, reflecting the change in the chemical microenvironment of the electrode surface after the introduction of AuNPs. High-resolution X-ray photoelectron spectroscopy (XPS) analysis ( Figure 8 C) The chemical state of Au was further confirmed. Only the standard Au characteristic peaks at binding energies of approximately 84.0 eV (Au 4f7 / 2) and 87.7 eV (Au 4f5 / 2) appeared in the spectrum. No impurity signals were detected, confirming that the modified layer was pure gold.

[0141] 5.2 Electrochemical performance verification of the electrode modification process

[0142] The electrochemical probe (MB-DNA probe) was reduced with 10 mM TCEP-HCl in a metal bath at 37°C for 30 min in the dark to activate the thiol group. Then, 20 μL of 2 μM MB-DNA probe was cast onto the surface of a gold electrode and incubated at 37°C for 1 h to fix the probe through Au-S bonds. The electrode was then washed with 10 mM Tris buffer and dried at room temperature. Next, 20 μL of 2 mM MCH was added to the working electrode area and incubated at 37°C for 1 h to block unbound sites. The electrode was then washed with water and dried at room temperature to obtain the MB-DNA / MCH co-modified electrode.

[0143] The stepwise modification process of the electrode was monitored in real time using cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). Figure 9 CV curve () Figure 9 A) This shows that the bare screen-printed electrode (SPE) in [Fe(CN)6]³⁻ / 4⁻ The response in the probe solution was weak; after modification with AuNPs, the redox peak current increased significantly and the peak shape narrowed, indicating that AuNPs effectively promoted electron transfer; after immobilizing the methylene blue (MB) labeled DNA probe, the peak current further increased, confirming that the electroactive molecule MB was successfully introduced; finally, after blocking with mercaptohexanol (MCH), the peak current decreased significantly, attributed to the blocking effect of MCH on the electrode active site and the resulting charge repulsion effect. EIS results ( Figure 9 B) Consistent with this: the charge transfer resistance (Rct) of the bare SPE was 1185 Ω; after modifying with AuNPs, Rct dropped significantly to 194.8 Ω; subsequently, fixing MB and MCH gradually increased Rct to 1835 Ω and 4389 Ω, respectively. The CV and EIS results corroborate each other, systematically verifying the successful construction of the electrode from the bare substrate to the functionalized interface.

[0144] 5.3 Determination of Electrochemical Active Area

[0145] Based on CV data at different scan rates, the effective electrochemical active area of ​​the electrode was calculated according to the Randles–Ševčík formula. Figure 10 The results showed that the active area of ​​the bare electrode was 7.79 mm², which increased to 10.5 mm² after AuNP modification, representing an improvement of 34.79%. This significant increase further confirms that AuNP modification effectively expands the electrode reaction interface, laying a physical foundation for subsequent high-density probe immobilization and high-sensitivity detection.

[0146] 5.4 Optimization of Immobilization Conditions for Electrochemical Reporter Probes

[0147] To obtain optimal detection performance, the electrochemical reporter probe (single-stranded DNA, 5' end labeled with MB, 3' end modified with -SH), sequence HS-SH C6-TTTTTTTTTTTTTTTTTTTTTT-MB, concentration, and immobilization time were systematically optimized. Figure 11 The square wave voltammetry (SWV) response current of electrodes modified with different sequence probes (Probe 1, 2, 3) was compared. Figure 11 A) Determine that the Probe 3 signal is optimal.

[0148] Probe1 sequence: HS-SH C6-CTCAACTTATTATTACGAAC-MB;

[0149] Probe2 sequence: HS-SH C6-TTCCTTTTACCATTTTTTTAACTTATTTGGT-MB.

[0150] Probe3 sequence: HS-SH C6-TTTTTTTTTTTTTTTTTTTT-MB.

[0151] Further optimize the fixed concentration of Probe 3 ( Figure 11 B) and incubation time ( Figure 11 (C) When the concentration is 2 μM, the signal reaches a plateau while also considering economy; 1 h is the optimal fixed time.

[0152] The results showed that the electrode achieved the largest and most stable initial current response when the probe concentration was 2 μM and the immobilization time was 1 h. Therefore, Probe 3, a concentration of 2 μM, and an immobilization time of 1 h were selected as the standard probe immobilization conditions for the subsequent construction of the sensing system.

[0153] The working electrode was used to detect the ERA amplification products of primer pair DIV1-ERA-3 (corresponding to SEQ ID NO.5 and SEQ ID NO.6) in Example 2, and the steps are as follows:

[0154] Prepare a CRISPR-Cas14a1 detection system with a total volume of 20 μL, including: 1 μL of Cas14a1 protein at 1 mg / mL, 1 μL of sgRNA 1 at 600 ng / μL (corresponding to SEQ ID NO.17), 2 μL of 10× reaction buffer, 1 μL of ERA amplification product, and the remainder is ddH2O.

[0155] The CRISPR-Cas14a1 detection system was dropped onto the working electrode surface of the electrochemical biosensor system and incubated at 46°C for 20-30 min to activate the cleavage activity of the Cas14a1 protein.

[0156] (4) After rinsing the working electrode with ultrapure water and air-drying it at room temperature, the change in current signal on the surface of the working electrode was detected by square wave voltammetry in a buffer solution containing 100 mM NaCl and 10 mM Tris at pH 8.0. The DIV1 was then analyzed qualitatively and / or quantitatively based on the signal intensity.

[0157] If the peak value of the square wave voltammetry (SWV) current at the working electrode of the electrochemical detection is significantly smaller than that before the reaction, it is considered positive; if the peak value of the SWV current at the working electrode does not change significantly, it is considered negative.

[0158] The quantitative analysis method is as follows: record the difference in SWV current response of the sample (ΔI = I0 − I), compare it with the standard curve, and perform quantitative analysis.

[0159] The standard curve is prepared using the following method:

[0160] The DIV1 DNA standard plasmid was serially diluted to obtain templates of different concentrations. Amplification and detection were performed in the same manner as steps (2), (3), and (4). The difference in SWV current response (ΔI) of the working electrode before and after the reaction was collected. A standard curve was plotted with the logarithm of the target DNA concentration as the abscissa and the corresponding difference in SWV current response (ΔI) as the ordinate.

[0161] Conclusion: This embodiment successfully constructed an AuNPs-modified working electrode with high specific surface area and excellent conductivity, and its structural integrity and functional effectiveness were confirmed through multi-dimensional characterization. Furthermore, the optimal electrochemical reporter probe and its immobilization process were identified, providing a reliable and high-performance sensing interface for subsequent integration of the ERA-CRISPR reaction system and the realization of integrated electrochemical detection of DIV1.

Claims

1. An electrochemical biosensing system for detecting DIV1 based on CRISPR-Cas14a1 and ERA technology, characterized in that... include: (1) A reaction detection unit, including: a. An ERA amplification system for the rapid enrichment of target DNA, wherein the ERA amplification system includes a specific primer pair targeting the DIV1 MCP gene; b. CRISPR-Cas14a1 detection system, including Cas14a1 protein and specific sgRNA, is used to identify target amplification products and activate the cleavage activity of Cas14a1 protein; (2) Signal conversion unit, including: a. Working electrode with surface modified with gold nanoparticles; b. An electrochemical reporter probe fixed to the surface of the working electrode; The electrochemical reporter probe is a single-stranded DNA that can be non-specifically cleaved by the activated Cas14a1 protein. The 5' end of the single-stranded DNA is covalently linked to the surface of the gold nanoparticles through thiol modification, and the 3' end is labeled with an electroactive substance.

2. The electrochemical biosensing system as described in claim 1, characterized in that... The specific primer pair is any one of primer sets 1 to 8, wherein the sequences of primer set 1 are SEQ ID NO.1 and SEQ ID NO.2, the sequences of primer set 2 are SEQ ID NO.3 and SEQ ID NO.4, the sequences of primer set 3 are SEQ ID NO.5 and SEQ ID NO.6, the sequences of primer set 4 are SEQ ID NO.7 and SEQ ID NO.8, the sequences of primer set 5 are SEQ ID NO.9 and SEQ ID NO.10, the sequences of primer set 6 are SEQ ID NO.11 and SEQ ID NO.12, the sequences of primer set 7 are SEQ ID NO.13 and SEQ ID NO.14, and the sequences of primer set 8 are SEQ ID NO.15 and SEQ ID NO.

16.

3. The electrochemical biosensing system as described in claim 2, characterized in that... The specific primer pair is primer set 3, and the sequence of primer set 3 is SEQ ID NO.5 and SEQ ID NO.

6.

4. The electrochemical biosensing system as described in claim 1, characterized in that... The sgRNA is any one of sgRNA1 to sgRNA6, and the sequences of sgRNA1 to sgRNA6 are SEQ ID NO.17 to SEQ ID NO.22, respectively.

5. The electrochemical biosensing system as described in claim 4, characterized in that... The sgRNA is sgRNA1, and its sequence is SEQ ID NO.

17.

6. The electrochemical biosensing system as described in claim 1, characterized in that... The working electrode with gold nanoparticles on its surface is prepared by the following method: a bare gold electrode is activated in a 0.2-0.5 mM H2SO4 solution, and then immersed in a solution containing chloroauric acid to electrodeposit gold nanoparticles.

7. The electrochemical biosensing system as described in claim 1, characterized in that... The electrochemical reporter probe is a single-stranded DNA with -SH modified at the 5' end and MB labeled at the 3' end; the sequence of the single-stranded DNA can be recognized and cleaved by CRISPR / Cas proteins.

8. A kit for detecting Decapod Iridovirus 1, the kit comprising, as described in any one of claims 1 to 7, an electrochemical biosensing system for detecting DIV1 based on CRISPR-Cas14a1 and ERA technology, an ERA amplification reagent, a CRISPR-Cas14a1 detection reagent, a positive control, and a negative control.

9. A method for detecting decapod iridovirus 1 using the kit for detecting decapod iridovirus 1 as described in claim 8, characterized in that... The method includes the following steps: (1) Extracting DNA from the sample to be tested; (2) Using the extracted DNA as a template, perform ERA isothermal amplification; (3) Mix the ERA isothermal amplification product with Cas14a1 protein, sgRNA, and 10× reaction buffer to prepare a CRISPR-Cas14a1 detection system. Add the system to the working electrode surface of the electrochemical biosensor system and incubate at 46℃ for 20-30 min to activate the cleavage activity of Cas14a1 protein. (4) Clean and dry the working electrode. In Tris buffer, use square wave voltammetry to detect the change in current signal on the surface of the working electrode. Perform qualitative and / or quantitative analysis of DIV1 based on the signal intensity.

10. The method as described in claim 9, characterized in that... In step (2), an ERA amplification system is prepared using DNA template, and ERA isothermal amplification is performed. The total volume of the ERA amplification system is 50 μL, including: 48 μL premix, 2 μL activator, and basic amplification reagent mixed in the premix. The 48 μL premix consists of: 20 μL solvent, 2.5 μL 10 μM upstream primer, 2.5 μL 10 μM downstream primer, 2 μL DNA template, and the remainder is nuclease-free water. The conditions for ERA isothermal amplification are: constant temperature incubation at 40℃ for 20 min; In step (3), the CRISPR-Cas14a1 detection system includes Cas14a1 protein, sgRNA, 10× reaction buffer, and ERA isothermal amplification product.

Images