Mutant microorganisms into which a magnesium transporter protein is introduced for production of succinic acid and methods for producing succinic acid using the same

By introducing magnesium transporter genes and optimizing the composition of neutralizing agents, a highly efficient mutant microorganism was constructed, which solved the problem of low magnesium ion utilization efficiency and improved succinic acid production.

CN122161938APending Publication Date: 2026-06-05KOREA ADVANCED INST OF SCI & TECH

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
KOREA ADVANCED INST OF SCI & TECH
Filing Date
2024-07-19
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

In existing technologies, the magnesium ion utilization efficiency of succinic acid producing strains is low, resulting in low succinic acid yield. Furthermore, the feedback inhibition of enzymes by magnesium ions and the influence of osmotic pressure have not been effectively mitigated.

Method used

Magnesium ion uptake capacity was enhanced by introducing genes encoding magnesium transport proteins, such as CorA, MgtA, and MgtB; the composition of neutralizing agents was optimized to improve magnesium ion utilization; and mutant microorganisms were constructed to enhance succinic acid production capacity.

Benefits of technology

It improved the productivity of succinic acid and the magnesium ion utilization efficiency of the strain, reduced enzyme feedback inhibition and osmotic pressure effects, and promoted the efficient production of succinic acid.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122161938A_ABST
    Figure CN122161938A_ABST
Patent Text Reader

Abstract

The present invention relates to a mutant microorganism into which a magnesium transporter protein is introduced for production of succinic acid, and a method for producing succinic acid using the same; and more particularly, to a mutant microorganism into which a gene encoding a magnesium transporter protein is introduced for production of succinic acid, and a method for producing succinic acid using the same, in which the utilization of magnesium ions is improved by using an optimized neutralizing agent.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to mutant microorganisms that introduce magnesium transporter proteins for the production of succinic acid and methods for producing succinic acid using the mutant microorganisms; more specifically, it relates to mutant microorganisms that introduce genes encoding magnesium transporter proteins for the production of succinic acid to improve the utilization of magnesium ions using optimized neutralizing agents, and methods for producing succinic acid using the mutant microorganisms. Background Technology

[0002] In recent years, growing environmental concerns have spurred efforts to find alternatives to producing useful compounds from traditional fossil fuels. Consequently, research into the production of bio-based succinic acid from renewable biomass is underway worldwide. Succinic acid, a C4 dicarboxylic acid, serves as a precursor to industrially valuable compounds such as 1,4-butanediol, γ-butyrolactone, diethyl succinate, N-methyl-2-pyrrolidone, and tetrahydrofuran, and can also be used as a monomer for various polymers. With the increasing importance of succinic acid, various microorganisms are being utilized. (including Actinobacillus succinate) succinogenes), succinic acid-producing anaerobic spirillum (Anaerobiospirillum succiniciproducens), Escherichia coli Escherichia coli, Mannheimia succiniciproducens, and Saccharomyces cerevisiae (Saccharomyces cerevisiae), Yarrowia lipolytica ( Yarrowia lipolytica Extensive research has been conducted on bio-based production methods, including [list of methods].

[0003] Succinic acid-producing strains were modified by altering their metabolic flux, with the strategy being to enhance the flux to succinic acid by boosting carbon metabolism and eliminating or reducing byproduct production. Specifically, succinic acid production was increased by introducing or enhancing genes involved in succinic acid metabolic flux, or by deleting or weakening genes that inhibit succinic acid metabolic flux. Fed-batch fermentation was performed using these modified succinic acid-producing strains, along with different neutralizing agents (NH4OH, Ca(OH)2, Mg(OH)2, and NaOH) to control the optimal pH of the culture medium. These neutralizing agents significantly affected cell metabolism and carbon source utilization. In particular, Mg(OH)₂ was selected as the preferred neutralizing agent for succinic acid production in previous studies for the following reasons: compared with other neutralizing agents such as Ca(OH)₂, KOH, and NaOH, Mg(OH)₂ has a higher carbon source utilization rate, and the low solubility of magnesium succinate reduces the osmotic pressure effects induced by succinate ions, and also reduces feedback inhibition on enzymes such as phosphoenolpyruvate carboxykinase (PCKA), thereby promoting succinic acid production. Additionally, Mg(OH)₂ can be used as a buffer to prevent microbial acidosis. Specifically, the magnesium ions in Mg(OH)₂ are known to play multiple roles in cellular systems. Magnesium ions are involved in almost all metabolic cycles, play an important role in structural integrity and genome stability, act as a cofactor for DNA repair proteins, and are also intracellular regulators of cell cycle and apoptosis. Furthermore, magnesium ions act as an essential cofactor for enzymes involved in succinic acid production, including NADPH oxidase and PCKA. Therefore, considering the importance of magnesium ion supply, studies have been conducted to enhance magnesium uptake by modifying the magnesium transport system in Escherichia coli, thereby increasing succinic acid production {Bioresource Technology 170 (2014) 125-131}.

[0004] Based on the above technical background, the inventors discovered that by introducing a variety of magnesium transport proteins to increase magnesium ion uptake, a high-performance succinic acid-producing strain can be developed, thus completing this invention. Summary of the Invention

[0005] Technical issues Therefore, the present invention is made in response to the above-mentioned problems, and one of the objects of the present invention is to provide a mutant microorganism with enhanced succinic acid production capacity.

[0006] Another object of the present invention is to provide a method for maximizing succinic acid production capacity using this mutant microorganism.

[0007] According to one aspect of the invention, the above and other objectives can be achieved by providing a mutant microorganism, wherein the mutant microorganism is a microorganism in which a gene encoding a magnesium transporter protein is introduced into a microorganism capable of producing succinic acid.

[0008] According to another aspect of the present invention, a method for producing succinic acid is provided, the method comprising: (a) Cultivating mutant microorganisms to produce succinic acid; and (b) Recycle the succinic acid produced. Attached Figure Description

[0009] Figure 1 The use of glucose as a single carbon source, and a mixture of (a) Ca(OH)₂, (b) KOH, (c) NaOH, (d) Mg(OH)₂, (e) NH₄OH, and (f) 1.57 M NH₄OH and 6.84 M Mg(OH)₂ as a neutralizing agent, is shown for the use of succinate-producing Mansorobacter (…). M. succiniciproducens Growth and metabolite production curves of PALK strain in fed-batch culture.

[0010] Figure 2 The growth and metabolite production curves of fed-batch culture of *Mannidaria succinate* PALK strain using glucose as the sole carbon source and the following as neutralizing agents are shown: (a) 6.15 M NH4OH and 1.79 M Mg(OH)2, (b) 4.1 M NH4OH and 3.56 M MgOH2, (c) 3.08 M NH4OH and 5.35 M MgOH2, (d) 1.45 M NH4OH and 7.15 M Mg(OH)2, (e) 1.57 M NH4OH and 6.84 M Mg(OH)2, and (f) 0.96 M NH4OH and 7.85 M Mg(OH)2.

[0011] Figure 3 Two-dimensional gel images showing the physiological changes of the PALK strain of *Mannidaria succinate* due to Mg(OH)2. Two-dimensional images of the whole-cell proteome during (a) the logarithmic growth phase and (b) the stationary phase using NH4OH as a neutralizing agent; and two-dimensional images of the whole-cell proteome during (c) the logarithmic growth phase and (d) the stationary phase using a mixture of NH4OH and Mg(OH)2 as a neutralizing agent.

[0012] Figure 4 The growth and metabolite production curves of (a) PALKcorAKO strain and (b) PALK (pMS3-corA) strain in fed-batch culture using glucose as a single carbon source are shown to verify the function of the magnesium transporter system in *Mannial succinate*. (c) is a schematic diagram of the introduction of magnesium transporters into *Mannial succinate*. (D) is a comparison of intracellular magnesium ion concentrations in strains with different magnesium transporter genes introduced.

[0013] Figure 5 The growth and metabolite production curves of *Mannial succinate-producing* strains (a) PALK (pMS3-mgtA), (b) PALK (pMS3-mgtB), (c) PALK (pMS3-mgtA-corA), (d) PALK (pMS3-corA-mgtB), and (e) PALK (pMS3-mgtA-mgtB) are shown in fed-batch culture using glucose as the sole carbon source. (f) is a graph comparing the succinic acid concentration and productivity of the constructed strains.

[0014] Figure 6 The growth and metabolite production curves of *Mannidaria succinate* PALK (pMS3-mgtB) strain in fed-batch culture using (a) a combination of glucose and glycerol as carbon sources and (b) high cell density inoculation are shown.

[0015] Figure 7 Growth and metabolite production curves for fed-batch cultures of *Mannidaria succinate* PALK (pMS3-mgtB) using glucose as a single carbon source and fermentation media containing the following: (a) 0 CDM, (b) 1 CDM, (c) 2 CDM, (d) 0 CDM and 20 g / L corn steep liquor, (e) 1 CDM and 20 g / L corn steep liquor, and (f) 2 CDM and 20 g / L corn steep liquor.

[0016] Figure 8 This is a graph showing the amino acid analysis results of corn syrup.

[0017] Figure 9 Growth and metabolite production curves of antibiotic-free fed-batch cultures of *Mannidaria succinate* PALKmgtB using glucose as the sole carbon source are shown.

[0018] Figure 10 This is a comparative graph showing the increase in growth and succinic acid production of succinic acid-producing Mansorobacter MBEL55E (pMS3-mgtB), LPK (pMS3-mgtB), LPK7 (pMS3-mgtB), and PALFK (pMS3-mgtB) strains after 16 hours of culture using glucose as a single carbon source. Detailed Implementation

[0019] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as understood by one of ordinary skill in the art. Generally, the nomenclature used herein is well-known and commonly used in the art.

[0020] As a result of efforts to find a method that significantly improves succinic acid production compared to conventional methods, the inventors determined the effect of magnesium ions on succinic acid yield. The inventors verified the effects of various neutralizing agents on succinic acid production in *Mannial succinate* and optimized the composition of the neutralizing agents. Furthermore, the inventors analyzed the physiological effects of magnesium ions and discovered a gene acting as a magnesium transporter.

[0021] Based on this, the present invention relates to mutant microorganisms, which are constructed by introducing a gene encoding a magnesium transporter into a microorganism capable of producing succinic acid.

[0022] In one embodiment, the gene encoding the magnesium transporter may include one or more genes selected from the group consisting of CorA, MgtA, and MgtB, but is not limited thereto.

[0023] Specifically, genes encoding magnesium transporters may include, but are not limited to, the following genes: (1) CorA, MgtA or MgtB gene; (2) CorA and MgtA genes; (3) CorA and MgtB genes; or (4) MgtA and MgtB genes.

[0024] In one implementation, the CorA gene may include the sequence of SEQ ID NO. 17.

[0025] [SEQ ID NO. 17] atgataaatgcatttgcacttgaaaatgcacgcttaacccgtcttgatgaggataatctcagtacgttaaataaagctatttggattgatttggtcgagcctaccagcgaagaacgtgagattttacaagacggcttagagcaaagtctggcttcatttcttgagttggaagacattgaggcgtccgcacgttttttcgaagatgaagacggtttgcatttgcactcgtttttttattgtgaagacgaagaagattatgcggatttagccagtgtcgcctttactattcgcgacggtcgtttatttaccctgcgtgatcgtgatttgcccgcgttccgtttgtatcgcatgcgttcccgttatcaacgtttggacgaatgtaacgcttatgaagtgctactggatttatttgaaacgaaaatcgagcagttagccgacgtgattgaaaccgtttattccgatttggaacgtttgagtcgcgtgattttagacggcaagcagggcgaggcttttgacgacgcgcttggtaccttaaccgagcaggaagatatgagctcgaaagtgcgtttatgtttgatggatactcaacgcgcgttgagtttcttagtgcgcaaaacccgcctgccggcgaatcagctggagcaggcccgtgaaattttgcgagatatcgaatctctgcaacctcataatgaatccttattccaaaaagtaaactttttgatgcaggcggccatgggttatatcaatattgagcagaacagagtgatgaaatttttctccgtagtatcggtgatgttcctgccggcaaccttagtggcttccacttacggtatgaactttgaatttatgccggaactgggctttaaatacggttatccgatggcaatcggcttaatgatcgctgcgggcgtaacgccatatatgtattttaaacgtaaaggctggttgtaa In another embodiment, the MgtA gene may comprise the sequence of SEQ ID NO: 18.

[0026] [SEQ ID NO: 18] In another embodiment, the MgtB gene may include the sequence of SEQ ID NO: 19.

[0027] [SEQ ID NO: 19] Mutant microorganisms may additionally possess the deletion of antibiotic resistance genes. Specifically, mutant microorganisms may have an additional deletion of the antibiotic resistance gene of SEQ ID NO: 40 or SEQ ID NO: 41. This allows them to be cultured in antibiotic-free media.

[0028] [SEQ ID NO: 40] ATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAG ATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTT TGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTT ATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAA [SEQ ID NO: 41] As used herein, the term "overexpression" refers to a level of expression of a corresponding gene in a cell that is higher than the normal expression level. Overexpression includes increasing expression by replacing the promoter of a gene present in the genome with a strong promoter, or by cloning the corresponding gene into an expression vector and transforming it into cells.

[0029] As used herein, the term "vector" refers to a DNA product containing a DNA sequence operatively ligated to a suitable regulatory sequence capable of expressing that DNA in a suitable host. Vectors can be plasmids, phage particles, or simple potential genomic inserts. When transformed into a suitable host, vectors can replicate or function independently of the host genome, or some may integrate with the genome. Plasmids are currently the most commonly used form of vector, and therefore the terms "plasmid" and "vector" are often used interchangeably. For the purposes of this invention, plasmids are preferred. Plasmid vectors suitable for these purposes include: (a) origins of replication for efficient replication such that each host cell contains a predetermined amount of the plasmid vector; (b) screening for antibiotic resistance genes or auxotrophic marker genes in host cells transformed with the plasmid vector; and (c) restriction enzyme cleavage sites for insertion of exogenous DNA fragments. Even in the absence of suitable restriction enzyme cleavage sites, vectors and exogenous DNA can be readily ligated using synthetic oligonucleotide aptamers or adapters according to conventional methods.

[0030] After ligation, the vector should be transformed into a suitable host cell. Microorganisms capable of producing succinic acid can be selected from the following group: *Manbella* spp. ( Mannheimia sp. Actinobacterium spp. Actinobacillus sp. ), Anaerobic Spirogyra ( Anaerobiospirillum sp. ), BASF spp. Basfia sp. ), Escherichia coli ( Escherichia coli ) and Corynebacterium sp. 。 In addition, the genus *Mannbacterium* includes the genus *BASF*, which has recently been confirmed to be essentially the same genus as *Mannbacterium*.

[0031] Preferably, the microorganism capable of producing succinic acid can be *Mannidaria succinate* PALK (KCTC10973BP).

[0032] In some cases, BASF mutant strains encoding magnesium transporter genes can be included in BASF strains that are very similar to Mansorobacter succinate-producing bacteria.

[0033] When a nucleic acid sequence is aligned with another nucleic acid sequence based on a functional relationship, the nucleic acid sequence is "operably linked" to it. This can be one or more genes and one or more control sequences linked in such a way that the gene can be expressed when a suitable molecule (e.g., a transcription activator protein) is linked to one or more control sequences. For example, the DNA of the current sequence or secretion leader sequence is operably linked to the DNA of the polypeptide when it is expressed as a precursor protein involved in polypeptide secretion; the promoter or enhancer is operably linked to the coding sequence when it affects the transcription of the sequence; or the ribosome binding site is operably linked to the coding sequence when it affects the transcription of the sequence; or the ribosome binding site is operably linked to the coding sequence when it is localized to facilitate translation. Generally, the term "operably linked" means that the linked DNA sequence is in contact with it, and the secretion leader sequence is in contact with it and is present in the reading frame. However, the enhancer does not need to be in contact with it. The ligation of these sequences is achieved by joining (ligation) at a convenient restriction enzyme cleavage site. When such a site is not available, synthetic oligonucleotide adaptors or linkers according to conventional methods are used.

[0034] As used herein, the term "expression vector" generally refers to a recombinant vector into which a foreign DNA fragment has been inserted, and typically means a double-stranded DNA fragment. Here, "foreign DNA" means foreign DNA that is not naturally present in the host cell. Once the expression vector is present in the host cell, it can replicate independently of the host chromosomal DNA and can produce several copies of the vector and its inserted (foreign) DNA.

[0035] As is well known in the art, in order to increase the expression level of a transfected gene in recombinant cells, the gene should be operatively linked to a transcriptional or translational expression control sequence that functions in a selected expression host. Preferably, the expression control sequence and the corresponding gene are contained in a single expression vector containing bacterial selection markers and origins of replication. When the expression host is a eukaryotic cell, the expression vector should further include useful expression markers from the eukaryotic expression host.

[0036] On the other hand, the present invention relates to host cells transformed or transfected with the aforementioned expression vector. Recombinant vectors can be introduced into host cells by methods such as transformation or transfection. As used herein, the term "transformation" means introducing DNA into a host and making the DNA replicable using extrachromosomal factors or chromosomal integration. As used herein, the term "transfection" means that the expression vector is accommodated by the host cell, regardless of whether any coding sequence is actually expressed.

[0037] It should be understood that not all vectors and expression control sequences function identically when expressing the DNA sequences of the present invention. Similarly, not all hosts function identically within the same expression system. However, those skilled in the art will be able to make appropriate selections from a variety of vectors, expression control sequences, and hosts without departing from the scope of the present invention, without incurring excessive experimental burden. For example, the selection of a vector should take into account the host, as the vector should replicate within the host. The number of replications of the vector, the ability to control the number of replications, and the expression of other proteins encoded by the respective vector, such as antibiotic markers, should also be considered. Many factors should be considered when selecting an expression control sequence. For example, the relative strength, controllability, and compatibility with the DNA sequences of the present invention, particularly aspects related to possible secondary structures, should be considered. Factors such as the selected vector, the toxicity of the product encoded by the DNA sequences of the present invention, secretion characteristics, the ability to precisely fold proteins, culture and fermentation factors, and the ease of purifying the product encoded by the DNA sequences of the present invention from the host can be considered when selecting a single-cell host. Within these factors, those skilled in the art can select various vector / expression control sequence / host combinations capable of expressing the DNA sequences of the present invention in fermentation or large-scale animal cultures.

[0038] In another aspect, the present invention relates to a method for producing succinic acid, the method comprising: (a) culturing mutant microorganisms to produce succinic acid; and (b) recovering the produced succinic acid.

[0039] Culture can be carried out using glucose and / or glycerol as carbon sources.

[0040] Culture can be carried out under anaerobic conditions, but is not limited to them.

[0041] Culture can be carried out in a medium containing corn steep liquor. In some cases, the medium may include a chemically defined medium (CDM).

[0042] The culture can be carried out by adding a neutralizing agent selected from the group consisting of Ca(OH)₂, KOH, NaOH, Mg(OH)₂, NH₄OH, and mixtures of two or more thereof. The neutralizing agent can significantly affect cell metabolism and carbon source utilization, and can be selected from preferred neutralizing agents suitable for succinic acid production.

[0043] The neutralizing agent can be Ca(OH)2, KOH, NaOH, Mg(OH)2, NH4OH, or a mixture of NH4OH and Mg(OH)2.

[0044] Microorganisms capable of producing succinic acid can be selected from the following group: *Mannella*, *Actinomyces*, *Anaerobes*, *BASF*, *Escherichia coli*, and *Corynebacterium*. Furthermore, *Mannella* includes *BASF*, which has recently been identified as substantially identical to *Mannella*.

[0045] For example, microorganisms capable of producing succinic acid could be, for instance, succinic acid-producing Mansorobacter.

[0046] Microorganisms capable of producing succinic acid can be Mannheimia succiniciproducens MBEL55E (KCTC0769BP).

[0047] The inventors identified a highly efficient succinic acid-producing strain of *Mannial succinate* MBEL55E (KCTC0769BP) from Korean cattle and obtained its genome sequence and metabolic characteristics (Hong et al., *Nature Biotechnol.*, 22:1275, 2004). Furthermore, the inventors utilized the lactate dehydrogenase gene (… ldhA ) and pyruvate-formate lyase gene ( pfl The deletion of ) produced a mutant strain—Mannidaria succinate LPK (KCTC10558BP)—to inhibit the production of lactic acid and formic acid by Mannidaria succinate MBEL55E (a rumen bacterium).

[0048] Microorganisms capable of producing succinic acid can be LPK (KCTC10558BP), which is produced by extracting the lactate dehydrogenase encoding gene from succinic acid-producing Mansorobacter MBEL55E. ldhA ) and the gene encoding pyruvate-formate lyase ( pfl It was obtained due to the absence of )

[0049] Microorganisms capable of producing succinic acid can be mutant rumen bacteria—*Mannidella succinate* PALK (KCTC10973BP), which is produced by transmitting the lactate dehydrogenase encoding gene from *Mannidella succinate*. ldhA ), gene encoding phosphotransacetase ( pta ) and the gene encoding acetate kinase ( ackA The deletion of ) also caused the gene encoding pyruvate-formate lyase ( pfl It is obtained by maintaining its integrity.

[0050] The inventors identified a highly efficient succinic acid-producing strain of *Mannial succinate* MBEL55E (KCTC0769BP) from Korean cattle and reported its genome sequence and metabolic characteristics (Hong et al., *Nature Biotechnol.*, 22:1275, 2004). Furthermore, the inventors utilized the lactate dehydrogenase gene (… ldhA ) and pyruvate-formate lyase gene ( pfl The mutant strain *Mannobacter succinate* LPK (KCTC10558BP) was produced by deleting a gene containing a phosphotransacetase gene, thereby inhibiting the production of lactic acid and formic acid by *Mannobacter succinate* MBEL55E (a rumen bacterium). Furthermore, the inventors extracted the phosphotransacetase gene from the mutant strain *Mannobacter succinate* LPK. pta ) and acetate kinase gene ( ackA The mutant strain *Mannidaria succinate* LPK7 (KCTC10626BP) was produced by deleting acetic acid to inhibit the production of acetic acid. The strain was then cultured under anaerobic conditions to produce succinic acid (International Patent Publication No. WO 05 / 052135).

[0051] The lactate dehydrogenase gene was discovered from the genomic information of *Mannidaria bifidum* MBEL55E (a rumen bacterium). ldhA ) and pyruvate-formate lyase gene ( pfl Then, the gene was deleted from the genome of *Mannobacter* MBEL55E using a gene deletion vector to produce a mutant strain [*Mannobacter* genus (…)]. Mannheimia sp. [LPK, KCTC 10558BP] (Korean Patent No. 10-0556099).

[0052] Microorganisms capable of producing succinic acid can be *Mannidella succinate* LPK7 (KCTC10626BP), which is produced by extracting the phosphotransacetase gene from *Mannidella succinate* LPK (Korean Patent No. 10-0630819). pta ) and acetate kinase gene ( ackA Mutants obtained by deleting ()

[0053] Microorganisms capable of producing succinic acid can be *Mannidella succinate* PALK (KCTC10973BP), a mutant microorganism characterized by producing only high concentrations of succinic acid under anaerobic conditions, while producing almost no other organic acids. This mutant microorganism achieves this by modifying the lactate dehydrogenase encoding gene from *Mannidella succinate* (Korean Patent No. 10-0780324). ldhA ), gene encoding phosphotransacetase ( pta ) and the gene encoding acetate kinase ( ackAThe gene encoding pyruvate-formate lyase () is missing, without affecting the gene encoding pyruvate-formate lyase () pfl (Obtained due to missing)

[0054] Microorganisms capable of producing succinic acid can be *Mannidella succinate* PALFK (KCTC11694BP), a strain capable of metabolizing both sucrose and glycerol, and this is achieved by extracting the fructose phosphotransferase encoding gene from the genomic DNA of *Mannidella succinate* PALK (KCTC10973BP) (International Patent Publication No. WO 2012030130). fruA (Obtained due to missing)

[0055] In this invention, the fermentation process was optimized to produce an excess of succinic acid. Specifically, selecting the most suitable neutralizing agent to maintain the optimal pH (pH 6.5) for *Mannella succinate* is crucial for increasing succinic acid yield. Therefore, to find the most effective neutralizing agent for succinic acid production, five reagents were selected: NH4OH, KOH, Ca(OH)2, Mg(OH)2, and NaOH, and *Mannella succinate* PALK (KCTC10973BP) was chosen as the platform strain. The *Mannella succinate* PALK (KCTC10973BP) strain was obtained by deleting the lactate dehydrogenase, phosphate transacetase, and acetate kinase encoding genes from a wild-type *Mannella succinate* strain. This strain is a mutant microorganism that produces only high concentrations of succinic acid under anaerobic conditions, with almost no other organic acids. First, when using 8.4M Ca(OH)₂ as a neutralizing agent, the results of fed-batch fermentation showed that 16.79 g / L of succinic acid was produced, with a yield of 0.56 mol / mol glucose and a production rate of 0.67 g / L / h. Figure 1(Table 1). However, calcium precipitation occurred immediately upon the addition of Ca(OH)₂. This is because calcium ions rapidly convert to calcium carbonate along with carbonic acid, which is an insoluble white precipitate in the culture medium. This precipitation must be avoided because *Manniophages succinate* requires a continuous supply of carbonic acid (1 mol of carbonic acid is used to produce 1 mol of succinic acid). Therefore, considering the low succinic acid production rate and calcium carbonate precipitation, Ca(OH)₂ was determined not to be a suitable neutralizing agent. Strongly alkaline KOH and NaOH were then used as neutralizing agents. Feeded-batch fermentation using KOH as a neutralizing agent resulted in the production of 25.53 g / L succinic acid with a yield of 0.93 mol / mol glucose and a production rate of 0.88 g / L / h; while fed-batch fermentation using NaOH as a neutralizing agent resulted in the production of 33.16 g / L succinic acid with a yield of 1.02 mol / mol glucose and a production rate of 1.15 g / L / h. Figure 1 (Table 1). However, a disadvantage when using KOH or NaOH is that cell aggregation was observed in both cases. This is because the high concentrations of potassium and sodium ions in the fermentation medium may create a hypertonic environment, which could potentially disrupt bacterial morphology. Therefore, studies have found that slow cell growth and lower succinic acid yields were observed when using KOH or NaOH as neutralizing agents. Additionally, NH4OH is a moderately alkaline solution widely used industrially as a nitrogen source for microorganisms and for controlling pH during fermentation. Results of fed-batch fermentation using 28% w / w NH4OH as a neutralizing agent showed a production of 58.6 g / L succinic acid, with yields of 1.04 mol / mol glucose and 2.44 g / L / h (…). Figure 1 (Table 1).

[0056] To further increase succinic acid production, Mg(OH)₂ has been considered as a neutralizing agent for several reasons: First, it has been reported that using Mg(OH)₂ instead of KOH, Ca(OH)₂, and NaOH can improve carbon utilization. Furthermore, magnesium succinate has lower solubility compared to other succinates such as sodium and potassium succinate, which reduces the feedback inhibition of succinate anions when using Mg(OH)₂. Additionally, Mg(OH)₂ has been reported to provide a strong buffering capacity and is inherently insoluble under overfeed conditions. Therefore, an oversupply of Mg(OH)₂ will not lead to a rapid increase in pH, thus not severely impairing the fermentation process. In contrast, insoluble Mg(OH)₂ binds to nutrients and biosolids present in the fermenter, providing a gradual increase in pH and strong buffering capacity. Moreover, magnesium ions in Mg(OH)₂ are known to play multiple roles in cellular systems, including structural integrity, genome stability, DNA repair, intracellular regulation of cell cycle and apoptosis, and most importantly, succinic acid production. However, results from fed-batch fermentation using only Mg(OH)₂ as a neutralizing agent showed the formation of magnesium carbonate precipitation and the production of 33.72 g / L succinic acid, with a yield of 1.04 mol / mol glucose and a production rate of 1.37 g / L / h. Figure 1 Table 1). Therefore, mixtures of NH4OH and Mg(OH)2 at various concentrations (6.15 M NH4OH and 1.79 M Mg(OH)2, 4.1 M NH4OH and 3.56 M MgOH2, 3.08 M NH4OH and 5.35 M MgOH2, 1.45 M NH4OH and 7.15 M Mg(OH)2, 1.57 M NH4OH and 6.84 M Mg(OH)2, 0.96 M NH4OH and 7.85 M Mg(OH)2) were tested to determine the optimal amounts of each component. Figure 2 (Table 1). The study found that both cell growth and succinic acid production increased with increasing Mg(OH)₂ content in the mixture. This increase began to plateau when the Mg(OH)₂ concentration in the mixture exceeded 6.84 M, and succinic acid production slightly decreased. Furthermore, it was found that cell concentration (increased by 35%) and succinic acid production (increased by 27%) were significantly improved compared to fermentation using only NH₄OH. Therefore, the optimized mixture (1.57 M NH₄OH and 6.84 M Mg(OH)₂) was used as the best neutralizing agent for succinic acid-producing Mansonia in this invention.

[0057] To determine the mechanism by which Mg(OH)2 enhances cell growth and succinic acid production, the physiological changes of *Mannidella succinate* PALK (KCTC10973BP) strain were analyzed. During fed-batch fermentation of *Mannidella succinate* PALK (KCTC10973BP) strain, whole-cell proteomic samples were collected at both the logarithmic growth phase (10 hours after fermentation began) and the stationary phase (16 hours after fermentation began). Figure 3 Based on a proteomic reference map and more than 200 proteins identified and characterized in previous studies (Lee et al., Bioprocess Biosyst Eng 2010, 33:97-107), the intensity of protein spots on a two-dimensional gel was determined. Figure 3 Based on the comparison of spot intensity and area in the analysis, the fold difference between spots obtained during the logarithmic and stationary periods was calculated (Table 2).

[0058] As expected, enzymes involved in succinate production, such as PckA and FumC, showed increased activity in both the logarithmic and stationary phases compared to fed-batch fermentation using NH4OH alone. Furthermore, the corresponding enzymes (PckA, fructose kinase, enolase, glyceraldehyde-3-phosphate dehydrogenase, and 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase), TCA cycle enzymes (fumarate hydratase and malate dehydrogenase), sugar-binding proteins (phosphogannatase), and phosphotransferase systems (phosphocarrier protein HPr, sugar-specific IIA component) were all increased. In particular, the fold change in the logarithmic phase was significantly higher, indicating the importance of Mg(OH)2 for stabilizing cell growth. Moreover, due to the metabolically active nature during the logarithmic growth phase, a much higher cell density was observed when using a mixture of NH4OH and 6.84 M Mg(OH)2 as a neutralizing agent.

[0059] As can be seen from the above study, the use of Mg(OH)₂ as a neutralizing agent is beneficial to the production of succinic acid, and the intracellular magnesium ion concentration of the succinic acid-producing *Mannidella succinate* PALK (KCTC10973BP) strain was measured. Figure 4 (Tables 3 and 4). The intracellular magnesium ion concentration (3.452 mM) of the succinic acid-producing *Mannibacillus succinate* PALK (KCTC10973BP) strain was significantly higher than that of other strains, such as *Escherichia coli* or *Bacillus subtilis*. Bacillus subtilis (1-2 mM). Additionally, the genome sequence of *Mannophila succinate* was investigated to verify the magnesium transport system within *Mannophila succinate*. In previous studies (Hong... et al.In the study of *Mannidaria bifidum* (Nat. Biotechnol., 2004, 22:1275-1281), genomic analysis of the wild-type *Mannidaria bifidum* strain MBEL55E (KCTC0769BP) showed that this facultative anaerobic strain contains... corA The gene acts as a magnesium transporter, and mgtA or mgtB Genes (known and) corA (Similarly, it is an independent magnesium transporter, but it is not present in the genome.) Further research is needed. corA The importance of genes, we learned from the PALK strain genome corA The PALKcorAKO strain was established by deleting genes. These cells hardly grew in fed-batch fermentation. Figure 4 Therefore, corA The gene was overexpressed in the PALK strain to determine the effect of increased intracellular magnesium ion concentration on cell growth and succinic acid production. Results showed that the PALK (pMS3-corA) strain absorbed more magnesium ions, resulting in a higher intracellular magnesium ion concentration (5.814 mM) than the PALK strain (3.452 mM). Fed-batch fermentation results showed the production of 86.66 g / L succinic acid with a yield of 1.23 mol / mol glucose and a production rate of 3.30 g / L / h. Figure 4 (Table 5).

[0060] To enhance succinic acid production by introducing a magnesium transporter protein, we introduced a gene encoding a magnesium transporter protein from another microorganism into the succinic acid-producing *Mannidella succinate* strain PALK (KCTC10973BP). First, we introduced a gene from *Escherichia coli*... mgtA The gene functions as a magnesium transporter. The PALK (pMS3-mgtA) strain constructed from this gene absorbed a large amount of magnesium ions, and its intracellular magnesium ion concentration (6.240 mM) was higher than that of the PALK strain (3.452 mM), but similar to that of the PALK (pMS3-corA) strain (5.814 mM). Figure 4 (Tables 3 and 4). Fed-batch fermentation of the PALK (pMS3-mgtA) strain produced 82.33 g / L succinic acid with a yield of 1.19 mol / mol glucose and a production rate of 3.13 g / L / h. Figure 5 Table 5). Then, Salmonella enterica ( Salmonella enterica (as a magnesium transporter) mgtBThe gene was also introduced into the PALK strain. The resulting PALK (pMS3-mgtB) strain absorbed a large amount of magnesium ions and exhibited the highest intracellular magnesium ion concentration (8.474 mM) among succinic acid-producing Mansorobacter strains. Figure 4 (Tables 3 and 4). Furthermore, the fed-batch fermentation results showed that the PALK (pMS3-mgtB) strain produced 94.25 g / L of succinic acid, with a yield of 1.26 mol / mol glucose and a production rate of 3.46 g / L / h. Figure 5 (Table 5). Furthermore, to determine the synergistic effect of simultaneous overexpression of multiple magnesium transporters, three strains were constructed, each overexpressing two different magnesium transporters. The constructed PALK (pMS3-mgtA-corA), PALK (pMS3-corA-mgtB), and PALK (pMS3-mgtA-mgtB) strains, after fed-batch fermentation, produced 83.13, 94.12, and 76.69 g / L of succinic acid, respectively, with yields of 1.26, 1.26, and 1.19 mol / mol glucose, and production rates of 3.29, 3.45, and 3.03 g / L / h, respectively. Figure 5 (Table 5). The results showed that succinic acid production was not significantly increased in succinic acid-producing Mansorobacter strains overexpressing different magnesium transporters.

[0061] Overall, studies on the introduction of heterologous magnesium transporters showed that the succinic acid titer, yield, and productivity of the PALK (pMS3-mgtB) strain were significantly higher than those of other strains. Therefore, the PALK (pMS3-mgtB) strain was used to optimize culture conditions. To further improve the succinic acid yield of the constructed PALK (pMS3-mgtB) strain, fed-batch fermentation was performed in a defined medium using a combination of glucose and glycerol as carbon sources. It is known that the use of glycerol may be beneficial for succinic acid production because glycerol provides twice the reducing equivalent (in moles) of glucose (Ahn). et al . , Nat. Commun., 2020, 11:1970). When the PALK(pMS3-mgtB) strain was fed-batch fermented in a defined culture medium using a combination of glucose and glycerol as carbon sources, 110.92 g / L of succinic acid was produced, with a yield of 1.42 mol / mol glucose (for ease of yield comparison, when glucose and glycerol are used as a combined carbon source, the carbon number of both carbon sources is included in the calculation and expressed based on glucose, always in "mol / mol glucose"), and a productivity of 4.07 g / L / h ( Figure 6(Table 5). These results show a significant increase compared to previous fed-batch fermentation results using only glucose as the carbon source. Additionally, one characteristic of *Mannial succinate* fermentation is the low cell density during fed-batch fermentation. In the PALK (pMS3-corA), PALK (pMS3-mgtA), PALK (pMS3-mgtB), PALK (pMS3-mgtA-corA), PALK (pMS3-corA-mgtB), and PALK (pMS3-mgtA-mgtB) strains constructed in this study, the maximum cell densities during glucose-based fermentation were 3.52, 4.19, 3.45, 3.08, 3.01, and 3.58 gDCW / L, respectively. On the other hand, these strains exhibited cell productivity of 0.94, 0.75, 1.00, 1.07, 1.15, and 0.85 g / gDCWh, respectively. Because these constructed strains have very high unit cell productivity, their overall productivity remains very high even though their cell density is much lower than other succinic acid producing strains. Since cells can act as cell factories, productivity can be further increased by increasing cell density. Therefore, the constructed PALK (pMS3-mgtB) strain was inoculated at a high concentration to improve succinic acid production under anaerobic conditions. A high initial cell concentration of 9.25 g DCW / L was inoculated in a defined culture medium, and fed-batch fermentation was performed using a combination of glucose and glycerol as carbon sources. The results showed that 153.23 g / L of succinic acid was produced, with a yield of 1.25 mol / mol glucose and a productivity of 11.7 g / L / h.

[0062] Furthermore, to reduce production costs, the fermentation culture conditions for the constructed strain were optimized. To further reduce production costs, we adapted previous research (Song... et al. In a conventional fermentation medium containing seven amino acids and six vitamins, developed in Appl. Microb. Biotechnol., 2008, 79:263-272, these supplements were removed. To verify the effect of the supplements on the cell growth and succinic acid production of *Mannidella succinate*, we cultured the PALK (pMS3-mgtB) strain in a defined medium without amino acids or vitamins. The results showed that the PALK (pMS3-mgtB) strain could not grow cells or produce succinic acid without the supplements. Figure 7Therefore, instead of providing purified amino acids and vitamins, we explored other inexpensive supplements. Among various supplements, corn syrup (CSL) was selected as an alternative. CSL, a byproduct of the corn wet milling industry, contains a high amount of amino acids, peptides, and B vitamins, making it an excellent nitrogen source for most microorganisms. We analyzed the amino acid composition of CSL before supplying it to the fermentation medium. The results showed that CSL contains the essential amino acids (…). Figure 8 Furthermore, based on previous research (Yu) et al. (Biochem. Eng.J., 2008, 39:496-502), we found that CSL contains all the essential vitamins. Fed-batch fermentation results of the PALK (pMS3-mgtB) strain showed that CSL can produce 41 g / L of succinic acid, with a yield of 1.25 mol / mol glucose and a production rate of 1.61 g / L / h (…). Figure 7 Table 6). Furthermore, it was found that cell growth fully recovered, similar to fed-batch fermentation supplying seven amino acids and six vitamins. Figure 7 Table 6). Furthermore, to verify whether the supply of CSL was sufficient to replace amino acids and vitamins, we further supplied cysteine ​​and nicotinic acid (representative amino acids and vitamins found in defined media) to the fermentation medium. The results of fed-batch fermentation using media supplemented with CSL, cysteine, and nicotinic acid showed no significant increase in cell growth or succinic acid production, indicating that CSL can replace expensive amino acids and vitamins (…). Figure 7 (Table 6). Therefore, CSL fully restored cell growth, but the final concentration of succinic acid produced was only 43.5% of that produced by the medium supplemented with purified amino acids and vitamins.

[0063] Furthermore, the stability of metabolically engineered strains is crucial for industrial applications. Strain stability is particularly important when using plasmid-based expression systems. Therefore, developing antibiotic-free strains for succinic acid production is essential (Choi). et al. (Metab. Eng., 2018, 47:463-474). To address the issue of plasmid instability, a marker-free gene deletion strategy was used to... mgtB The gene was inserted into the chromosome of *Mannial succinate*, and the dependence of plasmid stability on antibiotics was eliminated by the deletion of antibiotic marker genes (Kim). et al., FEMS Microbiol. Lett., 2008, 278; 78-85). The results showed that the final PALKmgtB strain produced 94.23 g / L of succinic acid in fed-batch fermentation without antibiotics, with a yield of 1.26 mol / mol glucose and a production rate of 3.45 g / L / h (…). Figure 9 Therefore, the succinic acid production parameters of the antibiotic-free PALK mgtB strain were similar to those of the plasmid-based strain PALK (pMS3-mgtB) (Table 5), indicating its potential for industrial-scale succinic acid production. Furthermore, magnesium transporter protein... mgtB Genes were introduced into Mansorobacter succinate-producing bacteria. MBEL55E (KCTC0769BP), LPK (KCTC10558BP), LPK7 (KCTC10626BP) and PALFK (KCTC11694BP) These are all microorganisms capable of producing succinic acid. The results of in vitro culture of the developed strains MBEL55E (pMS3-mgtB), LPK (pMS3-mgtB), LPK7 (pMS3-mgtB), and PALFK (pMS3-mgtB) showed that after 16 hours, they produced 6.00, 7.32, 6.64, and 6.70 g / L of succinic acid, respectively. Figure 10 ).

[0064] The present invention will be described in more detail below through the following embodiments. However, it will be apparent to those skilled in the art that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention.

[0065] Specifically, in the following examples, only *Mannidaria* species used for the production of succinic acid are used. Mannheimia Microorganisms are used as host cells to replace or overexpress the genes according to the present invention. However, those skilled in the art will understand that mutant microorganisms with succinic acid production capabilities similar to those of the present invention can be obtained using other types of succinic acid producing microorganisms.

[0066] [Example 1] Construction of CorA, MgtA and MgtB overexpression vectors (pMS3-corA, pMS3-mgtA, pMS3-mgtB, pMS3-corA-mgtB, pMS3-mgtA-mgtB, pMS3-mgtA-corA), and construction of PALK (pMS3-corA), PALK (pMS3-mgtA), PALK (pMS3-mgtB), PALK (pMS3-corA-mgtB), PALK (pMS3-mgtA-mgtB), PALK (pMS3-mgtA-corA), MBEL55E (pMS3-mgtB), LPK (pMS3-mgtB), LPK7 (pMS3-mgtB), and PALFK (pMS3-mgtB) strains.

[0067] To overexpress genes encoding magnesium transporters in various microorganisms, respective overexpression vectors were constructed. Genomic DNA from *Mannial succinate*, *Escherichia coli*, and *Salmonella enterica* was used as templates, and PCR was performed using primers SEQ ID NO: 1 and 2, 3 and 4, and 5 and 6, respectively. The obtained PCR products were then processed using… EcoRI and KpnI The restriction enzyme cleaved the cells and cloned them into pMS3. EcoRI and In the KpnI site (Jang et al., Appl. Environ. Microb. 73) (17): 5411-5420., 2007) To complete the overexpression of the vectors pMS3-corA and pMS3-mgtA. mgtB Genetic KpnI and PstI Restriction enzyme digestion and cloning into pMS3 KpnI and PstI The site was used to complete the overexpression of the pMS3-mgtB vector. To simultaneously overexpress two magnesium transporters, corresponding overexpression vectors were constructed. Using the pMS3-mgtB vector as a template, PCR was performed using primers of SEQ ID NO: 7 and 8. The obtained PCR products were then processed using... Hind III restriction enzyme digestion and cloning into pMS3-corA and pMS3-mgtA Hind Site III was used to complete the overexpression of the vectors pMS3-corA-mgtB and pMS3-mgtA-mgtB. Additionally, using pMS3-corA as a template, PCR was performed using primers from SEQ ID NO: 9 and 10. The obtained PCR products were then processed using... Hind Restriction enzyme III digestion and cloning into pMS3-mgtA Hind III site was used to construct the overexpression vector pMS3-mgtA-corA.

[0068] SEQ ID NO: 1: 5'-TACAACTCTACTGGGGAGGATGATAAATGCATTTGCAC SEQ ID NO: 2: 5′-TCTAGAGGATCCCCGGGTACTTACAACCAGCCTTTACG SEQ ID NO: 3: 5'-ACTTTTATCAACTCTACTGGGGAGGATGTTAAAGAAATTTTAC SEQ ID NO: 4: 5′-TCTAGAGGATCCCCGGGTACTTATTGCCAGCCGTAACGAC SEQ ID NO: 5: 5′-GAGGAATTCGAGCTCGGTACATGACTGACATGAACATTG SEQ ID NO: 6: 5′-GCCAAGCTTGCATGCCTGCATTAAAACCACTGGCCAAAG SEQ ID NO: 7: 5′-AGTCGACCTGCAGGCATGCACTATTCTGTTGGCTAATGC SEQ ID NO: 8: 5′-GTCGCCCGCCAAAAACAGCCATTAAAACCACTGGCCAAAG SEQ ID NO: 9: 5′-AGTCGACCTGCAGGCATGCACTATTCTGTTGGCTAATGC SEQ ID NO: 10: 5'-GTCGCCCGCCAAAACAGCCAAGCTTTTACAACCAGCCTTTACG The pMS3-corA, pMS3-mgtA, pMS3-mgtB, pMS3-corA-mgtB, pMS3-mgtA-mgtB, and pMS3-mgtA-corA strains generated as described above were introduced into *Mannidaria difficile* PALK (KCTC10973BP) to finally complete the PALK (pMS3-corA), PALK (pMS3-mgtA), PALK (pMS3-mgtB), PALK (pMS3-corA-mgtB), PALK (pMS3-mgtA-mgtB), and PALK (pMS3-mgtA-corA) strains, respectively. In addition, by introducing pMS3-mgtB into *Mannophila succinate-producing* strains MBEL55E (KCTC0769BP), LPK (KCTC10558BP), LPK7 (KCTC10626BP), and PALFK (KCTC11694BP), MBEL55E (pMS3-mgtB), LPK (pMS3-mgtB), LPK7 (pMS3-mgtB), and PALFK (pMS3-mgtB) were finally constructed. To introduce the overexpression vectors described above, *Mannophila succinate-producing* strains PALK (KCTC10973BP), MBEL55E (KCTC0769BP), LPK (KCTC10558BP), LPK7 (KCTC10626BP), and PALFK (KCTC11694BP) were plated on BHI (brain and heart infusion) solid medium and incubated at 39°C for 36 hours. The colonies were then inoculated into 10 mL of BHI liquid medium and incubated for 12 hours. Then, 1 mL of the fully grown cell culture was inoculated into 100 mL of BHI liquid medium and incubated in a static incubator at 39°C. After approximately 4 to 5 hours, when cell growth reached OD... 600When the concentration of glycerol is 0.3 to 0.5, the bacterial culture is placed at 0 to 4°C for 20 minutes to inhibit further cell growth, and then centrifuged at 4°C and 4,500 rpm for 15 minutes to obtain cells. The cells are then resuspended in 200 mL of 10% glycerol solution at 4°C and centrifuged again under the same conditions as above. This resuspension and centrifugation is repeated three times, with the volume of 10% glycerol solution halved each time. The finally obtained cells are resuspended in an equal volume of 10% glycerol solution, aliquoted, and stored at -80°C. The cell concentrate suspension prepared in this example was mixed with four overexpression vectors and electroporated at 2.5 kV, 25 μF, and 200 Ω to transform *Mannidaeca succinate* PALK (KCTC10973BP), MBEL55E (KCTC0769BP), LPK (KCTC10558BP), LPK7 (KCTC10626BP), and PALFK (KCTC11694BP). The electroporated cells were added to BHI liquid medium and incubated at 39°C for 1 hour. The cultures were then plated on BHI solid medium containing 2.5 μg / mL ampicillin and incubated at 39°C for 48 hours or longer. The mutant strains formed in this medium were cultured in BHI liquid medium containing antibiotics, and the introduction of the overexpression vectors was verified by electrophoresis of the vectors obtained using vector mini-prep.

[0069] [Example 2] Construction of CorA deletion vector (pcorAKO) and PALKcorAKO strain To determine the effect of the corA gene, which encodes a magnesium transporter naturally present in succinic acid-producing Mansorobacter strains, on enhanced succinic acid production, the pcorAKO vector was constructed. This vector lacks the gene encoding the magnesium transporter naturally present in the genome of the succinic acid-producing Mansorobacter PALK (KCTC10973BP) strain. CorA The genes. To construct pcorAKO, using... XhoI and SacI The pSacHR06 gene containing the sacB gene was cleaved. Then, using the genome of *Mannidaria succinate* strain PALK (KCTC10973BP) as a template, and primers of SEQ ID NO: 11 and 12, 13 and 14 respectively, primers were used to cleave the gene containing the sacB gene. CorAPCR was performed on the front and back sequences of the coding gene. Using a vector containing the chloramphenicol resistance gene as a template and primers SEQ ID NO: 15 and 16, a lox66-cat-lox77 cassette was obtained by PCR. The resulting linear pSacHR06 and CorA coding gene sequences (1 kb each) and the lox66-cat-lox77 cassette were then assembled using the Gibson assembly method. et al. The pcorAKO strain was obtained by ligation with *Mannidaria heterophylla* PALK (KCTC10973BP) in Nat. Methods, 6(5):343, 2009. The pcorAKO strain was then introduced into *Mannidaria heterophylla* PALK (KCTC10973BP) to finally construct the PALKcorAKO strain.

[0070] SEQ ID NO. 11: 5'-TTCAACGGGAAACGTCTTGCATGGCTGCAGTTCTTCGG SEQ ID NO. 12: 5'-GTGTCACCTAATTTTGCTTTTTAAGCTAAAAGTGCG SEQ ID NO. 13: 5'-AAAGCAAAATAGGTGACACTATAGAACGC SEQ ID NO. 14: 5'-AGTATGACAACCGCATAGGCCACTAGTG SEQ ID NO. 15: 5'-GCCTATGCGGTTGTCATACTCCCTAGGTTC SEQ ID NO. 16: 5'-GCGGCCGCCACCGCGGTGGAGCTTTTTATCCACATGGCGACAG Similar to Example 1, *Mannidaria transglucosidase* PALK (KCTC10973BP) was plated on BHI solid medium and incubated at 39°C for 3 hours. The colonies were then inoculated into 10 mL of BHI liquid medium and incubated for 1 hour. Then, 1 mL of the fully grown cell culture was again inoculated into 100 mL of BHI liquid medium and incubated in a static incubator at 39°C. After 4 to 5 hours, when the cell growth reached OD... 600When the glycosidic acid content was approximately 0.3 to approximately 0.5, the bacterial culture was incubated at 0 to 4°C for 2 minutes to inhibit further cell growth, and then centrifuged at 4°C and 4,500 rpm for 15 minutes to obtain cells. The cells were then resuspended in 200 mL of 10% glycerol solution at 4°C and centrifuged again under the same conditions as above. This resuspension and centrifugation process was repeated three times, with the volume of 10% glycerol solution halved each time. The resulting cells were then resuspended in an equal volume of 10% glycerol solution, aliquoted, and stored at -80°C.

[0071] The cell concentrate suspension prepared in this example was mixed with four overexpression vectors and electroporated at 2.5 kV, 25 μF, and 200 Ω to transform *Mannidella succinate* PALK (KCTC10973BP), MBEL55E (KCTC0769BP), LPK (KCTC10558BP), LPK7 (KCTC10626BP), and PALFK (KCTC11694BP). The electroporated cells were added to BHI liquid medium and incubated at 39°C for 1 hour. The cultures were then plated on BHI solid medium containing 2.5 μg / mL ampicillin and incubated at 39°C for 48 hours or longer. To screen for colonies that underwent double crossover, the resulting colonies were plated on BHI agar containing chloramphenicol (6.8 μg / mL) and 100 g / L sucrose. After 24 hours of incubation, the resulting colonies were plated again on the same solid culture medium.

[0072] The mutant strains formed in the culture medium were cultured in BHI liquid medium containing antibiotics, and the genomic DNA of the cultured strains was analyzed. PCR was performed using the isolated mutant genomic DNA as a template, and the resulting PCR products were subjected to electrophoresis to determine whether any deletions were present in the genome. corA Gene.

[0073] [Example 3] Succinic acid was produced using succinic acid-producing Mansorobacter MBEL55E (pMS3-mgtB), LPK (pMS3-mgtB), LPK7 (pMS3-mgtB) and PALFK (pMS3-mgtB) strains.

[0074] The succinate-producing *Mannidella* strains MBEL55E (pMS3-mgtB), LPK (pMS3-mgtB), LPK7 (pMS3-mgtB), and PALFK (pMS3-mgtB) generated in Examples 1 and 2 were inoculated into 20 mL of MH5 medium (containing 2.5 g yeast extract, 2.5 g peptone, 1 g NaCl, 0.02 g CaCl2·2H2O, 0.2 g MgCl2·6H2O, and 8.709 g K2HPO4 per liter) and cultured anaerobically at 39°C for 12 hours with 10 g / L sterile glucose as the carbon source. Cell concentration and succinate production were measured. Cell concentration in the medium was measured using a spectrophotometer, and the cell concentration was calculated using a previously measured spectrophotometric absorbance and stem cell weight calibration curve. Samples were collected after 12 hours of incubation to measure succinate concentration. The collected samples were centrifuged at 13,000 rpm for 10 minutes. The supernatant was analyzed by liquid chromatography for various metabolites, succinic acid concentration, glucose and glycerol concentrations.

[0075] [Example 4] Production of succinic acid using *Mannidaria heterophylla* strains PALK (pMS3-corA), PALK (pMS3-mgtA), PALK (pMS3-mgtB), PALK (pMS3-corA-mgtB), PALK (pMS3-mgtA-mgtB), PALK (pMS3-mgtA-corA), and PALKcorAKO. The succinic acid-producing Mansorobacterium strains PALK (pMS3-corA), PALK (pMS3-mgtA), PALK (pMS3-mgtB), PALK (pMS3-mgtA-mgtB), PALK (pMS3-mgtA-corA), and PALKcorAKO produced in Examples 1 and 2 were inoculated into 20 mL of MH5 medium (containing 2.5 g yeast extract, 2.5 g peptone, 1 g NaCl, 0.02 g CaCl2·2H2O, 0.2 g MgCl2·6H2O, and 8.709 g K2HPO4 per liter) and cultured under anaerobic conditions at 39°C for 8 hours with sterile glucose or glycerol at a concentration of 10 g / L as the carbon source. They were then transferred to 270 mL of the same medium and cultured. Fermentation was carried out in a bioreactor (Bioflo 3000, New Brunswick Scientific Co., NJ, USA) containing 2.5 L of synthetic medium (each L containing: 1 g NaCl, 2 g (NH4)2HPO4, 0.02 g CaCl2·2H2O, 0.2 g MgCl2·6H2O, 8.709 g K2HPO4, 0.5 g cysteine, 0.5 g methionine, 0.5 g alanine, 0.5 g asparagine, 0.5 g aspartic acid, 0.5 g proline, 0.5 g serine, 0.005 g nicotinic acid, 0.005 g calcium pantothenate, 0.005 g pyridoxine hydrochloride, 0.005 g thiamine, 0.005 g ascorbic acid, and 0.005 g biotin) under the following conditions: initial glucose concentration of 18.2 g / L (100 g / L). The initial glycerol concentration was 4.6 g / L (50 mM) when using glycerol. Pure carbon dioxide was supplied at a rate of 0.2 vvm (CV / incubator working volume / min) at 39 °C and 200 rpm. During fermentation, the pH was adjusted to 6.5 using 1.57 M ammonia and 6.84 M magnesium hydroxide solution, and 25 μg / mL kanamycin and 25 μg / mL ampicillin were added as antibiotics. When the carbon source was completely consumed to produce a high concentration of succinic acid, a semi-continuous addition of 900 g / L glucose and glycerol solution was added as needed. Cell concentration in the culture medium was measured using a spectrophotometer, and the cell concentration was calculated using previously measured spectrophotometer absorbance and stem cell weight validation lines. Samples were collected periodically from the bioreactor during fermentation and centrifuged at 13,000 rpm for 10 min. The concentrations of various metabolites, succinic acid, glucose, and glycerol in the supernatant were analyzed by liquid chromatography.

[0076] The results show that, Figure 4and 5 As shown in Table 5, when glucose is used as the only carbon source, strain PALK (pMS3-corA) produces 86.66 g / L of succinic acid with a yield of 1.23 mol / mol glucose and a production rate of 3.30 g / L / h. Strain PALK (pMS3-mgtA) produces 82.33 g / L of succinic acid with a yield of 1.19 mol / mol glucose and a production rate of 3.13 g / L / h. Strain PALK (pMS3-mgtB) produces 94.25 g / L of succinic acid with a yield of 1.26 mol / mol glucose and a production rate of 3.46 g / L / h. Strain PALK (pMS3-mgtA-corA) produces 83.13 g / L of succinic acid with a yield of 1.26 mol / mol glucose and a production rate of 3.29 g / L / h. The PALK (pMS3-corA-mgtB) strain produced 94.12 g / L succinic acid with a yield of 1.26 mol / mol glucose and a production rate of 3.45 g / L / h. The PALK (pMS3-mgtA-mgtB) strain produced 76.69 g / L succinic acid with a yield of 1.19 mol / mol glucose and a production rate of 3.03 g / L / h. Finally, fed-batch fermentation of the PALKcorAKO strain produced 7.05 g / L succinic acid with a yield of 0.91 mol / mol glucose and a production rate of 0.27 g / L / h. These results indicate that the PALK (pMS3-mgtB) strain exhibited the best succinic acid production capacity, which is higher than that of the conventional succinic acid-producing *Mannidella* strain PALK (KCTC10973BP).

[0077] [Example 5] Improving succinic acid production rate using *Mannidaria heterophylla* strain PALK (pMS3-mgtB). In this embodiment, a method for improving succinic acid production using the succinic acid-producing Mansorobacter pALK (pMS3-mgtB) strain was determined.

[0078] From Figure 5 (b) It can be seen that the PALK (pMS3-mgtB) strain exhibited maximum productivity 11 to 13 hours after inoculation, at which time the cell concentration was also at its maximum. Therefore, the change in productivity when the cell concentration was further increased to a level higher than the current level to reach maximum productivity was first determined.

[0079] To determine the optimal cell concentration of PALK (pMS3-mgtB) strain when increased to OD under the same culture conditions as in Example 4. 600The change in succinic acid production at 20.5 g / L (9.25 g DCW / L) was investigated by inoculating and fermenting a microbial reactor containing 2.5 L of synthetic medium. Fermentation conditions at inoculation were: initial glucose concentration of 18.2 g / L (100 mM), and initial glycerol concentration of 4.6 g / L (50 mM) when glycerol was used; temperature of 39 °C, 200 rpm; and pure carbon dioxide supply rate of 0.2 vvm. The pH was adjusted to 6.5 during fermentation using 1.57 M ammonia and 6.84 M magnesium hydroxide solution. The antibiotics used were 25 μg / mL kanamycin and 6.8 μg / mL chloramphenicol. When the carbon source was completely consumed to produce high-concentration succinic acid, a semi-continuous addition of 900 g / L glucose and glycerol solution was necessary. PALK (pMS3-mgtB) fermentation was carried out for 11 hours. Culture was terminated when the cell concentration approached peak levels, and the culture medium was centrifuged at 6,000 rpm for 10 minutes at 4°C to obtain a cell pellet. The cell pellet was resuspended in 200 mL of the same synthetic medium to obtain a high concentration of inoculum. Inoculation and culture were performed under the same conditions as in Example 4, except that the initial glucose and glycerol concentrations were doubled. The results showed that, as Figure 6 As shown in Table 5, the succinic acid production rate was 11.79 g / L / h, with a maximum production rate of 40.32 g / L / h, which is more than twice the production rate under the original fermentation conditions. This indicates that the succinic acid-producing *Mannidella succinate* PALK (pMS3-mgtB) strain exhibits excellent succinic acid production rate and yield through a fermentation method utilizing high cell inoculum concentrations.

[0080] [Example 6] Construction of spectinomycin and kanamycin deletion vectors (pSpcKO, pKmKO) and mgtB gene insertion vector (pINmgtB), and construction of PALKmgtB strain. To provide stability and industrial application value for the strain, the pINmgtB vector was constructed by inserting the gene encoding MgtB into the genome of the succinate-producing *Mannidaria succinate* PALK (KCTC10973BP) strain. Additionally, the pKmKO and pSpcKO vectors were constructed to delete genes encoding antibiotic markers (kanamycin and spectinomycin) present in the genome of the PALK strain. Further work was done to construct a kanamycin resistance gene (which was previously used to...). ldhA Gene deletion to construct a PALK strain selection marker deletion pKmKO vector, containing the gene deletion marker (to construct a PALK strain selection marker deletion), will be used to construct a PALK strain selection marker deletion pKmKO vector. XhoI and SacI Cut sacBThe pSacHR06 plasmid of the gene, the front and back sequences of the kanamycin resistance gene (primers are SEQ ID NO: 17 and 18, 19 and 20), and lox66 - cat - lox77 The cassette (primers SEQ ID NO: 27 and 28) was ligated using the Gibson assembly method to obtain pKmKO. Additionally, in order to construct the spectinomycin resistance gene (which was previously used as a chromogenic chromogenic gene), pta-ackA Gene deletion to construct a PALK strain selection marker deletion pSpcKO vector, containing the gene deletion marker (to construct a PALK strain selection marker deletion), will be used to construct a PALK strain selection marker deletion pSpcKO vector. XhoI and SacI Cut sacB The pSacHR06 plasmid of the gene, the front and back sequences of the spectinomycin resistance gene (primers are SEQ ID Nos: 23 and 24, 25 and 26), and lox66 - cat - lox77 The cassettes (primers are SEQ ID No: 27 and 28) were linked using the Gibson assembly method to obtain pSpcKO. Additionally, to... mgtB Gene inserted into the genome of PALK strain encoding CorA The sequence at the front end of the gene will contain... sacB Linearization of the pSacHR06 plasmid, encoding CorA The front and back sequences of the gene (primers are SEQ ID No: 29 and 30, 31 and 32), derived from pMS3-mgtB. mgtB Genes, and lox66-cat-lox77 The cassette (primers SEQ ID No: 35 and 36) was ligated using the Gibson assembly method to obtain pINmgtB. The pSpcKO, pKmKO, and pINmgtB constructed as described above were then introduced into *Mannidaeca succinate-producing* PALK (KCTC10973BP) to finally construct the PALKmgtB strain.

[0081] SEQ ID NO: 20: 5'-ttcaacgggaaacgtcttgcTTCGGGCACGCAATACGTAATC SEQ ID NO: 21: 5'-gtgtcacctaTAACCCATATAAATCAGCATCCATG SEQ ID NO: 22: 5'-gcctatgcggATTTGATGCTCGATGAGTTTTTC SEQ ID NO: 23: 5’- gcggccgccaccgcggtggagctACTTAGCCGGCGTATAGTTAG SEQ ID NO: 24: 5’- tatatgggtaTAGGTGACACTATAGAACGC SEQ ID NO: 25: 5’- agcatcaaatCCGCATAGGCCACTAGTG SEQ ID NO: 26: 5’- ttcaacgggaaacgtcttgcTTCGGCACGCAATACGTAATC SEQ ID NO: 27: 5’- gtgtcacctaTTAATCAAATTGCTCATGATTTC SEQ ID NO: 28: 5’- gcctatgcggTCAATTAGGCTAATTTTATTGCAATAACAGGTGC SEQ ID NO: 29: 5’- gcggccgccaccgcggtggagctCCGTCTACTTCGCCGGCT SEQ ID NO: 30: 5’- aatttgattaaTAGGTGACACTATAGAACGC SEQ ID NO: 31: 5’- gcctaattgaCCGCATAGGCCACTAGTG SEQ ID NO: 32: 5’- ttcaacgggaaacgtcttgcTAATTGGGCTGATTTCGGG SEQ ID NO: 33: 5’- aacagaatagCTAAGGCGGCTTGCAAATG SEQ ID NO: 34: 5’- acgaacggtaAAGTATCAACTTACTTTATATGGTATC SEQ ID NO: 35: 5’- gcggccgccaccgcggtggagctGGAGAAAAATTTCATCACTC SEQ ID NO: 36: 5’- gccgccttagCTATTCTGTTGGCTAATGC SEQ ID NO: 37: 5’- gtgtcacctaTTAAAACCACTGGCCAAAG SEQ ID NO: 38: 5'-gtggttttaaTAGGTGACACTATAGAACG SEQ ID NO: 39: 5'-gttgatacttTACCGTTCGTATAATGTATG Similar to Example 1, *Mannidaria transglucosidase* PALK (KCTC10973BP) was plated on BHI solid medium and incubated at 39°C for 3 hours. The colonies were then inoculated into 10 mL of BHI liquid medium and incubated for 1 hour. Then, 1 mL of the fully grown cell culture was again inoculated into 100 mL of BHI liquid medium and incubated in a static incubator at 39°C. After 4 to 5 hours, when the cell growth reached OD... 600 When the glycosidic acid content was approximately 0.3 to approximately 0.5, the bacterial culture was incubated at 0 to 4°C for 2 minutes to inhibit further cell growth, and then centrifuged at 4°C and 4,500 rpm for 15 minutes to obtain cells. The cells were then resuspended in 200 mL of 10% glycerol solution at 4°C and centrifuged again under the same conditions as above. This resuspension and centrifugation process was repeated three times, with the volume of 10% glycerol solution halved each time. The resulting cells were then resuspended in an equal volume of 10% glycerol solution, aliquoted, and stored at -80°C.

[0082] The obtained concentrated cell suspension was mixed with the gene-deleted vector pcorAKO and then electrophoresed at 2.5 kV, 25 μF, and 200 Ω for transformation of *Mannidella succinate* PALK (KCTC10973BP) using the vector. Electroporated cells were placed in BHI liquid medium and incubated at 39°C for 1 hour. The cultures were then plated on BHI solid medium containing 6.8 μg / mL chloramphenicol and incubated at 39°C for over 48 hours. To screen for colonies exhibiting double crossover, the resulting colonies were plated on BHI solid medium containing chloramphenicol (6.8 μg / mL) and 100 g / L sucrose and incubated for 24 hours. The resulting colonies were then plated again on the same solid medium.

[0083] The mutant strains formed in the culture medium were cultured in BHI liquid medium containing antibiotics, and the genomic DNA of the cultured strains was analyzed. PCR was performed using the genomic DNA of the isolated mutant strains as templates, and the resulting PCR products were subjected to electrophoresis to determine the presence of the mgtB gene in the genome.

[0084] [Example 7] Production of succinic acid using *Mannidella succinate* strain PALKmgtB The succinic acid-producing Mansorobacter pALKmgtB strain prepared in Example 6 was inoculated into 20 mL of MH5 medium (containing 2.5 g yeast extract, 2.5 g peptone, 1 g NaCl, 0.02 g CaCl2·2H2O, 0.2 g MgCl2·6H2O and 8.709 g K2HPO4 per liter) and cultured under anaerobic conditions at 39°C for 8 hours with sterile glucose or glycerol at a concentration of 10 g / L as the carbon source. Then, it was transferred to 270 mL of the same medium and cultured. Fermentation was carried out in a bioreactor (Bioflo3000, New Brunswick Scientific Co., NJ, USA) containing 2.5 L of synthetic medium (each L containing: 1 g NaCl, 2 g (NH4)2HPO4, 0.02 g CaCl2·2H2O, 0.2 g MgCl2·6H2O, 8.709 g K2HPO4, 0.5 g cysteine, 0.5 g methionine, 0.5 g alanine, 0.5 g asparagine, 0.5 g aspartic acid, 0.5 g proline, 0.5 g serine, 0.005 g nicotinic acid, 0.005 g calcium pantothenate, 0.005 g pyridoxine hydrochloride, 0.005 g thiamine, 0.005 g ascorbic acid, and 0.005 g biotin) under the following conditions: initial glucose concentration of 18.2 g / L (100 g / L). The initial glycerol concentration was 4.6 g / L (50 mM) when using glycerol. Pure carbon dioxide was supplied at a rate of 0.2 vvm (CV / incubator working volume / min) at 39 °C and 200 rpm. The pH was adjusted to 6.5 during fermentation using 1.57 M ammonia and 6.84 M magnesium hydroxide solution. When the carbon source was completely consumed to produce a high concentration of succinic acid, a semi-continuous addition of 900 g / L glucose and glycerol solution was added as needed. Cell concentration in the culture medium was measured using a spectrophotometer, and the cell concentration was calculated using previously measured spectrophotometer absorbance and stem cell weight validation lines. Samples were collected periodically from the bioreactor during fermentation and centrifuged at 13,000 rpm for 10 min. The concentrations of various metabolites, succinic acid, glucose, and glycerol in the supernatant were analyzed by liquid chromatography.

[0085] The results show that, Figure 9As shown, when glucose was used as the only carbon source, strain PALKmgtB produced 94.23 g / L of succinic acid, with a yield of 1.26 mol / mol glucose and a production rate of 3.45 g / L / h. The results indicate that strain PALKmgtB exhibits similar succinic acid production capacity to strain PALK (pMS3-mgtB), and compared to the conventional succinic acid-producing *Mannidaria* strain PALK (KCTC10973BP), strain PALKmgtB shows enhanced succinic acid production capacity.

[0086] [Table 1] [Table 2] [Table 3] [Table 4] PALK 1 2 average value Standard deviation Before incubation (mg / L) 24.39 25.1 24.75 0.355 After incubation (mg / L) 23.24 24.07 23.66 0.415 <![CDATA[Consumed Mg 2+ (mg / L)]]> 1.15 1.03 1.09 0.06 <![CDATA[Mg 2+ (mmol / gDCW)]]> 0.0359 0.0321 0.034 0.0019 <![CDATA[Mg 2+ Concentration (mM / cell) 3.645 3.259 3.452 0.193 PALK (pMS3-corA) 1 2 average value Standard deviation Before incubation (mg / L) 24.75 22.26 23.51 1.245 After incubation (mg / L) 22.95 20.22 21.59 1.365 <![CDATA[Consumed Mg 2+ (mg / L)]]> 1.8 2.04 1.92 0.12 <![CDATA[Mg 2+ (mmol / gDCW)]]> 0.0537 0.0608 0.057 0.0036 <![CDATA[Mg 2+ Concentration (mM / cell) 5.453 6.174 5.814 0.361 PALK (pMS3-mgtA) 1 2 average value Standard deviation Before incubation (mg / L) 23.75 23.8 23.78 0.025 After incubation (mg / L) 21.63 21.83 21.73 0.1 <![CDATA[Mg consumed 2+ (mg / L)]]> 2.12 1.97 2.05 0.075 <![CDATA[Mg 2+ (mmol / gDCW)]]> 0.0637 0.0592 0.0615 0.0023 <![CDATA[Mg 2+ Concentration (mM / cell) 6.468 6.011 6.240 0.229 PALK (pMS3-mgtB) 1 2 average value Standard deviation Before incubation (mg / L) 26.4 25.87 26.14 0.265 After incubation (mg / L) 23.52 23.48 23.5 0.02 <![CDATA[Consumed Mg 2+ (mg / L)]]> 2.88 2.39 2.64 0.245 <![CDATA[Mg 2+ (mmol / gDCW)]]> 0.0912 0.0757 0.0835 0.0078 <![CDATA[Mg 2+ Concentration (mM / cell) 9.260 7.687 8.474 0.787 [Table 5] [Table 6] Industrial application The succinic acid-producing mutant microorganisms of the present invention express a gene encoding a magnesium transporter, significantly improving magnesium ion utilization. Therefore, when anaerobic microorganisms are cultured in a defined culture medium, high concentrations of succinic acid can be produced, achieving the highest succinic acid production rate reported to date. Furthermore, enhanced fermentation can lead to even higher production rates and concentrations of succinic acid.

[0087] Although preferred embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various modifications, additions, and substitutions are possible without departing from the scope and spirit of the invention as disclosed in the appended claims. Sequence List Free Text Please attach the electronic file.

Claims

1. A mutant microorganism, wherein the mutant microorganism is a microorganism with a gene encoding a magnesium transporter protein introduced into it, which has the ability to produce succinic acid.

2. The mutant microorganism according to claim 1, wherein, The gene encoding the magnesium transporter includes one or more genes selected from the group consisting of CorA, MgtA, and MgtB.

3. The mutant microorganism according to claim 1, wherein, The gene encoding the magnesium transporter protein includes the following genes: (1) CorA, MgtA or MgtB gene; (2) CorA and MgtA genes; (3) CorA and MgtB genes; or (4) MgtA and MgtB genes.

4. The mutant microorganism according to claim 2, wherein, The CorA gene includes the sequence of SEQ ID NO.

17.

5. The mutant microorganism according to claim 2, wherein, The MgtA gene includes the sequence of SEQ ID NO.

18.

6. The mutant microorganism according to claim 2, wherein, The MgtB gene includes the sequence of SEQ ID NO.

19.

7. The mutant microorganism according to claim 1, wherein, Additionally, the antibiotic resistance gene SEQ ID NO: 40 or SEQ ID NO: 41 is missing.

8. The mutant microorganism according to claim 1, wherein, The microorganisms capable of producing succinic acid are selected from the group consisting of: *Mannidaria* spp. Mannheimia sp. Actinobacterium spp. Actinobacillus sp. ), Anaerobic Spirogyra ( Anaerobiospirillum sp. ), BASF spp. Basfia sp. ), Escherichia coli ( Escherichia coli ) and Corynebacterium spp. Corynebacterium sp .).

9. The mutant microorganism according to claim 8, wherein, The microorganism capable of producing succinic acid is *Mannella vulgaris*. (Mannheimia succiniciproducens) .

10. The mutant microorganism according to claim 9, wherein, The microorganism capable of producing succinic acid is *Mannial succinate* PALK (KCTC10973BP), which is a mutant rumen bacterium obtained by: extracting the lactate dehydrogenase encoding gene from *Mannial succinate*. ldhA ), gene encoding phosphotransacetase ( pta ) and the gene encoding acetate kinase ( ackA The deletion of ) also caused the gene encoding pyruvate-formate lyase ( pfl Keep it intact.

11. The mutant microorganism according to claim 8, wherein, The microorganism capable of producing succinic acid is *Mannidella succinate* MBEL55E (KCTC0769BP).

12. The mutant microorganism according to claim 8, wherein, The microorganism capable of producing succinic acid is LPK (KCTC10558BP), which is produced by extracting the lactate dehydrogenase encoding gene from succinic acid-producing Mansorobacter MBEL55E. ldhA ) and the gene encoding pyruvate-formate lyase ( pfl It was obtained because of the missing information.

13. The mutant microorganism according to claim 8, wherein, The microorganism capable of producing succinic acid is *Mannidella succinate* LPK7 (KCTC10626BP), which produces succinic acid by transferring the phosphotransacetase gene from *Mannidella succinate* LPK7. pta ) and acetate kinase gene ( ackA It was obtained because of the missing information.

14. The mutant microorganism according to claim 8, wherein, The microorganism capable of producing succinic acid is *Mannidella succinate* PALFK (KCTC11694BP), which is produced by extracting the fructose phosphotransferase encoding gene from *Mannidella succinate* PALK (KCTC10973BP). fruA It was obtained because of the missing information.

15. A method for producing succinic acid, the method comprising: (a) Cultivating mutant microorganisms according to any one of claims 1 to 14 to produce succinic acid; as well as (b) Recycle the succinic acid produced.

16. The method according to claim 15, wherein, The culture was carried out in a culture medium containing corn slurry.

17. The method according to claim 15, wherein, The cultivation is carried out by adding a neutralizing agent selected from the group consisting of Ca(OH)2, KOH, NaOH, Mg(OH)2, NH4OH and two or more mixtures thereof.