Treatment drug for spinal cord injury based on linc00311-mir-4318-mylk regulatory axis and application thereof

Abstract

The application belongs to the technical field of biological medicine, and discloses a spinal cord injury treatment drug based on a LINC00311 / miR-4318 / MYLK regulation axis and an application thereof, and aims to solve the technical problems of poor targeting and large side effects of the existing anti-inflammatory treatment of spinal cord injury. The effective component of the drug is an inhibitor of LINC00311, the inhibitor is selected from one or more of shRNA, siRNA, antisense oligonucleotide and CRISPRi system, can target the specific nucleotide sequence of LINC00311, and can be used in combination with miR-4318 mimic, and is administered by intrathecal injection, slow virus carrier delivery and the like. The in-vitro experiment proves that the inhibitor can significantly inhibit the release of TNF-alpha, IL-1beta, IL-6 and other pro-inflammatory factors by microglia cells; the in-vivo experiment shows that it can significantly improve the BBB motor function score of spinal cord injury rats, and reduce spinal cord tissue edema and necrosis. The application first discloses the mechanism of the LINC00311 / miR-4318 / MYLK ceRNA regulation axis in spinal cord injury, has the advantages of novel target, significant effect and high transformation potential, and provides a new scheme for the clinical treatment of spinal cord injury.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a spinal cord injury treatment drug based on the LINC00311miR-4318MYLK regulatory axis and its application. Background Technology

[0002] Spinal cord injury (SCI) is a severe central nervous system trauma, and its secondary inflammatory response is the core pathological link leading to the continuous deterioration of neurological function and hindering injury repair. Current research has confirmed that the pro-inflammatory factors such as TNF-α, IL-1β, and IL-6 released after excessive activation of microglia can trigger cascade inflammatory damage and disrupt the spinal cord nerve microenvironment.

[0003] Currently, the main anti-inflammatory treatment used in clinical practice is high-dose steroid pulse therapy. This method has problems such as large side effects and poor targeting, and it cannot accurately regulate the inflammatory pathway, nor can it achieve both neuroprotection and repair effects.

[0004] Long non-coding RNAs (lncRNAs) play a crucial role in regulating neuroinflammation. Studies have shown that multiple lncRNAs, such as NEAT1, GAS5, and XIST, are involved in microglial activation, but the mechanism of action of LINC00311 in neuropathic pain (SCI) remains unclear. Existing reports only mention that LINC00311 functions through the STAT3 pathway in neuropathic pain, without mentioning miR-4318 or MYLK, let alone proposing its potential as a therapeutic target. Therefore, current technologies lack intervention strategies targeting the LINC00311 / miR-4318 / MYLK axis, and cannot effectively inhibit microglial activation and the inflammatory cascade response after SCI. Summary of the Invention

[0005] The purpose of this invention is to provide a spinal cord injury treatment drug based on the LINC00311miR-4318MYLK regulatory axis and its application, so as to solve the problem that the existing technology lacks a precise intervention method based on LINC00311 regulation.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: A pharmaceutical composition for treating spinal cord injury includes an inhibitor of LINC00311 and miR-4318 mimic, said inhibitor being selected from one or more of shRNA, siRNA, antisense oligonucleotides, and the CRISPRi system, said pharmaceutical composition exerting its therapeutic effect by regulating the LINC00311 / miR-4318 / MYLK axis.

[0007] In a further embodiment, the nucleotide sequence of the inhibitor targeting LINC00311 is TCGCTGCGTCCTAACCAAAT and / or TTCGCCAACTACTCTGCCTG.

[0008] In a further embodiment, the dosage form of the pharmaceutical composition is an injection, sustained-release microspheres, or an implantable sustained-release pump formulation.

[0009] In a further embodiment, the drug composition is administered via intrathecal injection, lentiviral vector delivery, or nanoparticle encapsulation delivery.

[0010] A pharmaceutical composition for treating spinal cord injury, the pharmaceutical composition being used to prepare a medicine for treating spinal cord injury.

[0011] The present invention has the following beneficial effects: Significant therapeutic effects: In vitro experiments confirmed that silencing LINC00311 significantly reduced the levels of TNF-α, IL-1β, and IL-6 in LPS-stimulated microglia; in vivo experiments showed that the BBB score of SCI rats in the shRNA-LINC00311 treatment group increased from approximately 8 points to over 13 points, and spinal cord edema and necrosis were significantly reduced; this study is the first to reveal that LINC00311 promotes inflammation through a ceRNA regulatory mechanism by "sponge-adsorbing" miR-4318, thereby relieving its inhibition of MYLK. This regulatory axis has not been found in existing SCI treatment patents or literature. shRNA or miRmimic has a solid foundation of preclinical research, mature delivery technology, and is easy to industrialize. Attached Figure Description

[0012] Figure 1 The effect of silencing LINC00311 on the expression of LPS-induced inflammatory factors in microglia is shown in the figure.

[0013] Figure 2 Figure showing the effects of silencing LINC00311 on motor function and spinal cord tissue in SCI rats.

[0014] In the figure: G1 - control group; G2-LPS / ASCI treatment group; G3-LPS / ASCI+shRNA-NC group; G4-LPS / ASCI+shRNA-LINC00311 group. Detailed Implementation

[0015] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0016] Example 1: Preparation of shRNA targeting LINC00311 and in vitro cell experiments shRNA design and synthesis: shRNA-LINC00311 sequence was designed and synthesized targeting the nucleotide sequence TCGCTGCGTCCTAACCAAAT / TTCGCCAACTACTCTGCCTG, and negative control shRNA-NC sequence was synthesized simultaneously.

[0017] Primary microglia culture in rats: Spinal cord tissue from newborn SD rats was used to isolate microglia, which were then seeded into culture dishes and cultured in a 37°C, 5% CO2 incubator.

[0018] Lentiviral transfection: shRNA-LINC00311 and shRNA-NC were constructed into lentiviral vectors and infected with microglia in the logarithmic growth phase. The transfection efficiency was observed by fluorescence microscopy 48 h after transfection.

[0019] LPS-induced inflammation model construction: Successfully transfected cells were divided into 4 groups: control group (G1), LPS treatment group (G2), LPS+shRNA-NC group (G3), and LPS+shRNA-LINC00311 group (G4). Groups G2-G4 were stimulated with LPS (1 μg / mL) for 24 h to construct the inflammation model.

[0020] Indicator Testing RT-qPCR detection: RNA was extracted from cells in each group, and the expression level of LINC00311 was detected. The results showed that the expression of LINC00311 in group G4 was significantly lower than that in group G3.

[0021] Western Blot analysis: Cell proteins were extracted, and the protein expression level of Iba-1, a marker of microglial cell activation, was detected. The results showed that Iba-1 expression was significantly reduced in the G4 group.

[0022] ELISA assay: Cell supernatant was collected and the levels of TNF-α, IL-1β, and IL-6 were detected. The results showed that the levels of the three pro-inflammatory factors in the G4 group were significantly lower than those in the G3 group (****P<0.0001).

[0023] Example 2: In vivo animal experiments and efficacy verification SCI rat model construction: Adult SD rats were selected, and an acute spinal cord injury (ASCI) model was constructed using the weight drop method. The sham operation group (G1) exposed only the spinal cord without injury.

[0024] Grouping and Administration: Model rats were randomly divided into three groups: ASCI group (G2), ASCI+shRNA-NC group (G3), and ASCI+shRNA-LINC00311 group (G4). Three days post-surgery, groups G3 and G4 were administered lentivirally vector-encapsulated shRNA-NC and shRNA-LINC00311 via intrathecal injection at a dose of 1×10⁻⁶. 8 TU / animal, administered once a week for 4 consecutive weeks.

[0025] Indicator Testing BBB motor function score: The BBB score of rats was performed weekly after surgery. The results showed that the BBB score of rats in group G4 increased to more than 13 points 7 days after surgery, which was significantly higher than the score of about 8 points in group G3.

[0026] HE staining: Spinal cord tissue from rats was collected 4 weeks after surgery and stained with HE. The results showed that the degree of edema and necrosis of spinal cord tissue in group G4 was significantly less than that in group G3.

[0027] Inflammatory factor detection: Spinal cord tissue homogenate was extracted and the levels of TNF-α, IL-1β and IL-6 were detected by ELISA. The results showed that the level of inflammatory factors in the G4 group was significantly lower than that in the G3 group (***P<0.001).

[0028] Example 3: Combined Drug Use Experiment Microglia from Example 1 were selected and divided into two groups: shRNA-LINC00311 alone and shRNA-LINC00311 + miR-4318 mimic combined treatment group. MYLK expression levels were measured 24 hours after treatment. The results showed that the combined treatment group had a significantly better inhibitory effect on MYLK expression than the alone treatment group, confirming that combined medication can synergistically enhance the therapeutic effect.

[0029] Summary of Implementation Examples The in vitro cell experiments in Example 1 confirmed that the shRNA inhibitor targeting LINC00311 can effectively silence the expression of LINC00311 in microglia, significantly inhibit LPS-induced microglia activation, and greatly reduce the release levels of pro-inflammatory factors TNF-α, IL-1β, and IL-6, thus verifying the effectiveness of the LINC00311 inhibitor in blocking the initiation of the inflammatory response.

[0030] The in vivo animal experiments in Example 2 further demonstrated that the shRNA-LINC00311 drug delivered by intrathecal injection could exert an anti-inflammatory effect in rats with spinal cord injury, not only reducing the pathological damage to the spinal cord tissue, but also significantly improving the recovery of motor function in rats, thus clarifying the therapeutic value and feasibility of the drug in vivo.

[0031] The results of the combined drug experiment in Example 3 show that the combined use of the LINC00311 inhibitor and miR-4318 mimic can enhance the inhibitory effect on the downstream MYLK gene by synergistically regulating the LINC00311 / miR-4318 / MYLKceRNA axis, and has a better therapeutic effect than the single drug, providing experimental evidence for optimizing the dosing regimen in clinical practice.

[0032] In summary, the three embodiments, from the perspectives of in vitro mechanism verification, in vivo efficacy verification, and combination drug optimization, fully demonstrate the scientific nature, effectiveness, and innovation of the technical solution proposed in this invention. At the same time, they verify the core value of the LINC00311 / miR-4318 / MYLK regulatory axis as a therapeutic target for spinal cord injury, laying a solid experimental foundation for the subsequent clinical translation of this drug.

[0033] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A pharmaceutical composition for treating spinal cord injury, characterized in that, The drug composition includes an inhibitor of LINC00311 and miR-4318 mimic, wherein the inhibitor is selected from one or more of shRNA, siRNA, antisense oligonucleotides, and the CRISPRi system, and the drug composition exerts its therapeutic effect by regulating the LINC00311 / miR-4318 / MYLK axis.

2. The pharmaceutical composition according to claim 1, characterized in that, The nucleotide sequence of the inhibitor targeting LINC00311 is as follows: TCGCTGCGTCCTAACCAAAT and / or TTCGCCAACTACTCTGCCTG.

3. The pharmaceutical composition according to claim 1, characterized in that, The dosage form of the pharmaceutical composition is an injection, sustained-release microspheres, or an implantable sustained-release pump formulation.

4. The pharmaceutical composition according to claim 1, characterized in that, The drug composition can be administered via intrathecal injection, lentiviral vector delivery, or nanoparticle encapsulation delivery.

5. The use of a pharmaceutical composition for treating spinal cord injury in the preparation of a drug for treating spinal cord injury.

Images