A chicken infectious bronchitis virus nanoparticle and a preparation method and application thereof
By using the SpyTag/SpyCatcher covalent linkage system to self-assemble SRBD antigen with ferritin nanoparticles, the problems of insufficient protection and weak immunogenicity of existing IBV vaccines are solved, and a highly efficient and stable chicken infectious bronchitis virus nanoparticle vaccine with rapid update capability is achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANXI AGRI UNIV
- Filing Date
- 2026-04-13
- Publication Date
- 2026-06-09
AI Technical Summary
Existing IBV vaccines are insufficient to provide adequate protection against constantly mutating strains, and live attenuated vaccines pose safety risks, while inactivated vaccines have weak immunogenicity and are difficult to induce effective mucosal immune responses.
Using the SpyTag/SpyCatcher covalent linkage system, the S1 protein receptor-binding domain (SRBD) of chicken infectious bronchitis virus was self-assembled with ferritin to form nanoparticles. The SRBD antigen was directionally displayed on the surface of the ferritin nanoparticles, thus forming chicken infectious bronchitis virus nanoparticles.
The invention achieves structurally stable nanoparticles, improves antigen presentation efficiency and immunogenicity, has rapid iteration capability, and is suitable for preventing infectious bronchitis virus infection in chickens.
Smart Images

Figure CN122168547A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of poultry vaccine technology, and in particular to a chicken infectious bronchitis virus nanoparticle, its preparation method, and its application. Background Technology
[0002] Infectious bronchitis (IB) is a highly contagious disease caused by the infectious bronchitis virus (IBV). It primarily affects the respiratory, urinary, reproductive, and digestive systems of chickens, leading to decreased growth performance in broilers and reduced egg production in laying hens, causing significant economic losses to the poultry industry.
[0003] IBV is an RNA virus with a high mutation rate and recombination capacity, easily generating multiple serotypes and genotypes. Due to limited cross-protection between different serotypes, existing vaccines often fail to provide adequate protection against constantly emerging variant strains. Currently, IBV prevention and control mainly relies on live attenuated vaccines and inactivated vaccines. However, live attenuated vaccines carry the risk of virulence reversion and recombination, while inactivated vaccines have weaker immunogenicity and are less likely to induce effective mucosal immune responses.
[0004] In recent years, vaccine delivery systems based on protein nanoparticles have attracted increasing attention. Ferritin, a protein carrier capable of self-assembling into nanoparticle structures, can be used to display antigens on its surface, thereby improving antigen presentation efficiency and enhancing immune responses. The SpyTag / SpyCatcher system is a protein linkage system capable of forming stable covalent bonds under mild conditions, which can be used to achieve targeted binding between antigens and carriers. However, currently, there is a lack of technology for displaying key antigens of chicken infectious bronchitis virus (IBV) on the surface of ferritin nanoparticles using the SpyTag / SpyCatcher system. Therefore, developing a nanovaccine capable of efficiently displaying key IBV antigens and possessing good immunogenicity is of great significance. Summary of the Invention
[0005] The purpose of this invention is to provide chicken infectious bronchitis virus (RIBV) nanoparticles, their preparation method, and applications, thereby addressing the problems existing in the prior art. This invention utilizes a SpyTag / SpyCatcher covalent linkage system to self-assemble BIBV nanoparticles, with the SRBD antigen directionally displayed on the surface of the ferritin nanoparticles. The nanovaccine prepared from these nanoparticles exhibits high safety, allows for rapid antigen module replacement, and is suitable for preventing BIBV infection. The technical solution of this invention possesses advantages such as structural stability, strong immunogenicity, and rapid iteration, providing a novel vaccine solution for poultry disease control.
[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a chicken infectious bronchitis virus nanoparticle, which is formed by the self-assembly of SRBD-SpyTag fusion protein and Ferritin-SpyCatcher fusion protein through a SpyTag / SpyCatcher covalent linkage system. The SRBD-SpyTag fusion protein is formed by fusing a SpyTag sequence to the N-terminus or C-terminus of the S1 protein receptor-binding domain of chicken infectious bronchitis virus. The Ferritin-SpyCatcher fusion protein is formed by fusing the SpyCatcher sequence to the N-terminus or C-terminus of the Helicobacter pylori Ferritin protein.
[0007] Furthermore, the gene sequence encoding the SRBD-SpyTag fusion protein is shown in SEQ ID NO.6.
[0008] Furthermore, the gene sequence encoding the Ferritin-SpyCatcher fusion protein is shown in SEQ ID NO.7.
[0009] The present invention also provides a method for preparing the above-mentioned chicken infectious bronchitis virus nanoparticles, comprising the following steps: (1) The recombinant plasmid containing the encoding gene sequence of the SRBD-SpyTag fusion protein was induced to express in the host bacteria, and after purification and refolding, the SRBD-SpyTag fusion protein was obtained; (2) The recombinant plasmid containing the coding gene sequence of the Ferritin-SpyCatcher fusion protein was induced to be expressed in the host bacteria and purified to obtain the Ferritin-SpyCatcher fusion protein. (3) The SRBD-SpyTag fusion protein and the Ferritin-SpyCatcher fusion protein were mixed at a molar ratio of 1:1 and covalently linked to obtain the chicken infectious bronchitis virus nanoparticles.
[0010] Optionally, in step (1), the purification method is denaturing Ni-NTA affinity chromatography purification; The refolding method involves sequentially performing gradient dialysis refolding with urea solutions of concentrations of 4 mol / L, 2 mol / L, 1 mol / L, 0.5 mol / L, and 0 mol / L.
[0011] Optionally, in step (2), the purification method is non-denaturing Ni-NTA affinity chromatography purification.
[0012] Optionally, in step (3), the temperature of the covalent bonding reaction is 4°C and the time is 24-48h.
[0013] The present invention also provides the application of the above-mentioned chicken infectious bronchitis virus nanoparticles in the preparation of chicken infectious bronchitis virus nanovaccines.
[0014] The present invention also provides a chicken infectious bronchitis virus nanovaccine, wherein the chicken infectious bronchitis virus nanovaccine contains the above-mentioned chicken infectious bronchitis virus nanoparticles.
[0015] Furthermore, the chicken infectious bronchitis virus nanovaccine also contains an immune adjuvant.
[0016] The present invention discloses the following technical effects: This invention involves fusing the receptor-binding domain (SRBD) of the IBV S1 protein with a SpyTag sequence to form an SRBD-SpyTag fusion protein, and fusing Helicobacter pylori ferritin with SpyCatcher to form a Ferritin-SpyCatcher fusion protein. These two components are then self-assembled in vitro using a SpyTag / SpyCatcher covalent linkage system to form nanoparticles, with the SRBD antigen directionally displayed on the surface of the ferritin nanoparticles. The resulting nanoparticles have a regular structure, uniform particle size, and high antigen surface display density, mimicking the natural structure of the virus and enhancing immunogenicity. The nanovaccine prepared from these nanoparticles exhibits high safety, allows for rapid antigen module replacement, and is suitable for preventing infectious bronchitis virus (IBV) infection in chickens. The technical solution of this invention offers advantages such as structural stability, strong immunogenicity, and rapid iteration, providing a novel vaccine solution for poultry disease control.
[0017] Compared with the prior art, the present invention also has the following significant advantages: (1) The stable connection between antigen and carrier is achieved by using the SpyTag / SpyCatcher covalent linkage system, which can improve the structural stability of nanoparticles; (2) The use of ferritin nanoplatform to display multiple copies of SRBD antigen can significantly enhance antigen presentation efficiency and improve immunogenicity; (3) The modular assembly strategy can quickly replace the antigen module according to the popular strain, which has good potential for rapid vaccine updates. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 Figure 1 shows the results of SRBD gene amplification and recombinant expression plasmid construction and identification. (A) is the SRBD gene amplification product; (B) is the SRBD-SpyTag fusion gene product; (C) is the PCR identification result of the recombinant plasmid pET32a-SRBD bacterial culture. Figure 2 Figure 1 shows the purification and refolding identification results of the SRBD-SpyTag fusion protein and the Ferritin-SpyCatcher fusion protein. In Figure 2, (A) shows the identification results of the purified SRBD-SpyTag fusion protein, where M is the protein standard (kDa) and 1 is the protein sample; (B) shows the identification results of the purified Ferritin-SpyCatcher fusion protein, where M is the protein standard (kDa) and 1 is the protein sample; (C) shows the SDS-PAGE results of the SRBD-SpyTag fusion protein before and after refolding, where M is the protein standard, 1 is the protein sample before refolding, 2 is the 4 M urea refolded sample, 3 is the 2 M urea refolded sample, 4 is the 1 M urea refolded sample, and 5 is the 0 M urea refolded sample; (D) shows the Western blot identification results of the SRBD-SpyTag fusion protein before and after refolding, where M is the protein standard (kDa), 1 is the protein sample before refolding, 2 is the 4 M urea refolded sample, 3 is the 2 M urea refolded sample, and 4 is the 0 M urea refolded sample. M is a urea refolded sample, 4 is a 1 M urea refolded sample, and 5 is a 0 M urea refolded sample. Figure 3 The figure shows the identification results of nanoparticles formed by the in vitro self-assembly of SRBD-SpyTag fusion protein and Ferritin-SpyCatcher fusion protein; where M is the protein standard (kDa), 1 is the Ferritin-SpyCatcher fusion protein, 2 is the SRBD-SpyTag fusion protein, and 3 is the assembly product. Figure 4 The images show the transmission electron microscopy observation results of SRBD-Ferritin nanoparticles; where (A) is an empty Ferritin nanoparticle; and (B) is an SRBD-Ferritin nanoparticle. Figure 5 The image shows the results of detecting IBV-specific antibodies (A) and neutralizing antibodies (B) in chicken serum after immunization with SRBD-Ferritin nanoparticles. Detailed Implementation
[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.
[0026] Example 1 1. Experimental materials Escherichia coli DH5α competent cells and BL21(DE3) competent cells were preserved in our laboratory.
[0027] 2. Design of SRBD-SpyTag fusion gene and construction of recombinant plasmid Based on the S gene sequence of chicken infectious bronchitis virus (GenBank: FJ888351.1) registered in GenBank, the hydrophobicity, signal peptide, transmembrane region, and major antigenic sites of the S1 protein were analyzed using bioinformatics software. The signal peptide and transmembrane region were truncated, and the region corresponding to the major antigen-binding site was selected for truncated expression, named SRBD. To achieve subsequent targeted coupling with the nanocarrier, GS-linker and SpyTag sequences were introduced to the 5' end of the SRBD sequence to construct the SRBD-SpyTag fusion gene fragment. Based on the sequence information of the expression vector pET32a, specific primers containing the vector homologous arm were designed, with BamHI as the upstream restriction enzyme site and XhoI as the downstream restriction enzyme site.
[0028] The specific construction process is as follows: Based on the target region corresponding to the S1 gene sequence of chicken infectious bronchitis virus (GenBank: FJ888351.1), SRBD-specific primers were designed. The SRBD sequence was amplified using primers SRBD-F and SRBD-R. Then, using primers tag-linker-RBD-F1, TY-tag-linker-F2, and TY32A-RBD-tag-R, the GS-linker, SpyTag sequence, and restriction enzyme site were sequentially introduced to the 5' end of the SRBD fragment to obtain the SRBD-SpyTag fusion gene fragment. After double digestion with BamHI / XhoI, it was cloned into the pET32a expression vector to construct the recombinant plasmid pET32a-SRBD. The constructed recombinant plasmid was transformed into E. coli DH5α competent cells, and positive colonies were selected for colony PCR and sequencing verification to confirm the successful construction of the recombinant plasmid.
[0029] The primer sequences are as follows: SRBD-F: TTGTATGACAGTAGTTCTTACGTTTA, SEQ ID NO.1; SRBD-R: CTGCTTAACTAAACTACTATTAATAAAAGG, SEQ ID NO.2; tag-linker-RBD-F1: CGTATAAACGCTATAAAGGTGGCGGTGGCAGCGGTGGCGGTGGCAGCGGTGGCGGTGGCAGCTTGTATGACAGTAGTT, SEQ ID NO.3; TY-tag-linker-F2: GGCTGATATCGGATCCCGCGGCGTGCCGCATATTGTGATGGTGGATGCGTATAAACGCTATAAA, SEQ ID NO.4; TY32A-RBD-tag-R: GGTGGTGGTGctcgagCTGCTTAACTAAACTACTATTAATAAAAGGATAAAAGCCATCT, SEQ ID NO.5 (where the BamHI and XhoI restriction sites are marked in bold and lowercase, respectively).
[0030] SRBD-SpyTag fusion gene fragment: , SEQ ID NO.6.
[0031] The obtained recombinant plasmid was transformed into *E. coli* DH5α competent cells, and the successful construction of the recombinant plasmid was verified by bacterial PCR and sequencing. The identification results are shown below. Figure 1 . Figure 1 A showed that the amplified SRBD gene band was consistent with the expected size; Figure 1B shows clear amplification bands of the SRBD fusion fragment containing the SpyTag sequence; Figure 1 The C-value showed that the PCR identification results of the recombinant plasmid pET32a-SRBD bacterial culture were consistent with the theoretical size, indicating that the recombinant expression plasmid was successfully constructed.
[0032] 3. Design of Ferritin-SpyCatcher fusion gene and construction of recombinant plasmid Helicobacter pylori selected from the NCBI nucleic acid database Helicobacter pylori The Ferritin gene (GenBank: NP_207580.1) sequence was analyzed using bioinformatics software to determine its amino acid sequence and antigenic site characteristics. A GS-linker, SpyCatcher, and 6×His tag sequence were added to the 3' end of the Ferritin gene, and codon optimization was performed to form the Ferritin-SpyCatcher fusion gene fragment. This fusion gene was synthesized by our company (Jilin Kumei Biotechnology Co., Ltd.) and directly cloned into the pET28a expression vector to obtain the recombinant plasmid pET28a-Ferritin-SpyCatcher, which can be used for subsequent protein expression and in vitro assembly with the SRBD-SpyTag protein.
[0033] Ferritin-SpyCatcher fusion gene fragment: ATGGGTAGCAGCGACAGCGCGACCCACATCAAATTCAGCAAGCGTGACGAGGATGGTAAAGAACTGGCGGGCGCGACCATGGAGCTGCGTGATAGCAGCGGCAAGACCATCAGCACCTGGATTAGCGACGGCCAGGTGAAAGATTTCTACCTGTATCCGGGCAAGTACACCTTTGTTGAAACCGCGGCGCCGGATGGTTATGAAGTGGCGACCGCGATCACCTTCACCGTTAACGAACAGGGTCAAGTGACCGTTAACGGTAAAGCGACCAAGGGCGATGCGCACATTGGTGGCGGTGGCAGCGGTGGCGGTGGCAGCGGTGGCGGTGGCAGCGACATTATCAAGCTGCTGAACGAGCAAGTGAACAAAGAAATGCAGTCCTCCAACCTGTACATGAGCATGAGCAGCTGGTGTTACACCCACAGCCTTGATGGCGCCGGACTGTTCCTGTTTGATCACGCCGCCGAGGAATACGAGCACGCCAAGAAGCTGATCATCTTCCTGAACGAGAACAATGTGCCCGTGCAGCTGACCAGCATTAGCGCCCCAGAGCACAAGTTCGAGGGCCTGACACAGATCTTTCAGAAGGCCTACGAACACGAGCAGCACATCTCCGAGAGCATCAACAACATCGTGGACCACGCCATTAAGAGCAAGGATCACGCCACCTTCAATTTTCTGCAGTGGTACGTGGCCGAACAGCACGAGGAAGAAGTGCTGTTCAAGGACATCCTGGACAAGATTGAGCTGATCGGCAACGAGAACCACGGCCTGTATCTGGCCGACCAGTACGTGAAGGGAATCGCCAAGAGCCGGGTGGCGGTGGCAGCGGTGGCGGTGGCAGCGGTGGCGGTGGCAGCCACCACCACCACCACCACTAA, SEQ ID NO.7。
[0034] 4. Expression, purification and refolding of SRBD-SpyTag fusion protein and Ferritin-SpyCatcher fusion protein The correctly identified recombinant expression plasmids pET32a-SRBD and pET28a-Ferritin were transformed into *E. coli* BL21(DE3) competent cells. Single positive colonies were picked and inoculated into LB broth containing the corresponding antibiotics, and cultured at 37°C with shaking until the bacterial culture reached OD500. 600 Once the concentration reaches 0.6-0.8, IPTG is added to induce expression. After induction, the bacterial cells are collected, lysed by sonication, and the supernatant and precipitate are collected separately for analysis after centrifugation.
[0035] The results showed that the Ferritin-SpyCatcher fusion protein was mainly present in the lysate supernatant in a soluble form, while the SRBD-SpyTag fusion protein was mainly present in the precipitate as inclusion bodies. The two fusion proteins were then purified by Ni-NTA affinity chromatography. The Ferritin-SpyCatcher fusion protein was purified under standard non-denaturing conditions (PBS buffer, pH 7.4, containing 20 mM imidazole). For the SRBD-SpyTag fusion protein, inclusion bodies were first dissolved (purified) in denaturing buffer containing urea (20 mM Tris-HC + 300 mM NaC + 8 M urea, pH 8.0). The purified SRBD-SpyTag denatured protein was placed in a dialysis bag (molecular weight cutoff 10 kDa) and subjected to gradient dialysis (renaturation) in phosphate buffer (PBS, pH 7.4) containing 4 mol / L, 2 mol / L, 1 mol / L, 0.5 mol / L, and 0 mol / L urea, with each gradient maintained for 12 h. Finally, the protein was dialyzed three times in pure PBS buffer to completely remove urea and restore the protein to its native conformation. The protein concentration after renaturation was determined by the BCA method to be no less than 0.8 mg / mL.
[0036] The purified SRBD-SpyTag fusion protein and Ferritin-SpyCatcher fusion protein were analyzed. Figure 2 Figure A shows the Western blot identification results of the SRBD-SpyTag fusion protein, where M is the protein standard (kDa) and 1 is the purified pET32a-SRBD protein band; Figure 2 Figure B shows the Western blot identification results of the Ferritin-SpyCatcher fusion protein, where M is the protein standard (kDa) and I is the purified pET28a-Ferritin-SpyCatcher protein band. Both figures show that the target protein can be specifically recognized by the corresponding antibody and a clear band appears at the expected molecular weight position, indicating that the protein purification was successful.
[0037] The SRBD-SpyTag fusion protein, after dialysis refolding, was analyzed. Results are shown below. Figure 2 Results from tests C and D showed that the refracted SRBD-SpyTag fusion protein bands were clear and without obvious aggregation tails, indicating that the protein maintained its molecular integrity and reactivity after refracting, providing qualified antigen material for subsequent in vitro assembly.
[0038] 5. In vitro assembly and identification of SRBD-Ferritin nanoparticles The refolded SRBD-SpyTag fusion protein was mixed with the purified Ferritin-SpyCatcher fusion protein at a molar ratio of 1:1 and incubated overnight at 4°C (or 24-48 h, ensuring sufficient reaction), allowing the two to undergo a spontaneous covalent linkage reaction through the SpyTag / SpyCatcher system to obtain SRBD-Ferritin nanoparticles. Samples were then taken for Western blot analysis after assembly.
[0039] See results Figure 3 After the reaction was completed, a distinct new band appeared, and its migration position matched the theoretical molecular weight of the covalently coupled SRBD-SpyTag and Ferritin-SpyCatcher fusion proteins. This specific band could be recognized by the corresponding antibody, indicating that the two fusion proteins had successfully formed a stable link through the SpyTag / SpyCatcher system, confirming that the SRBD antigen had been successfully coupled to the ferritin nanoparticle carrier.
[0040] 6. Morphological observation of SRBD-Ferritin nanoparticles The obtained SRBD-Ferritin nanoparticles were diluted to an appropriate concentration, dropped onto a copper grid, and allowed to adsorb statically. After negative staining with phosphotungstic acid and natural drying, they were observed using a transmission electron microscope. Meanwhile, unconjugated, empty Ferritin nanoparticles were used as a control.
[0041] The results of transmission electron microscopy are shown in Figure 4 . Figure 4 A shows that the unloaded Ferritin nanoparticles are regularly spherical and have a relatively uniform size. Figure 4 B shows that the SRBD-Ferritin nanoparticles conjugated with SRBD antigen still maintain a relatively intact spherical structure, but their particle size is larger than that of the unloaded particles, and more obvious protrusion-like structures can be observed on the particle surface. These results indicate that the SRBD antigen has been successfully displayed on the surface of ferritin nanoparticles, forming nanoparticle structures with virus-like appearance characteristics.
[0042] 7. Immunogenicity evaluation of SRBD-Ferritin nanoparticles After adjusting the obtained SRBD-Ferritin nanoparticles to a suitable concentration, they were emulsified with Freund's incomplete adjuvant at a 1:1 volume ratio to prepare an SRBD-Ferritin nanoparticle immunomodulator. After adjusting the refolded SRBD-SpyTag fusion protein to a suitable concentration, it was emulsified with Freund's incomplete adjuvant at a 1:1 volume ratio to prepare an SRBD monomeric protein immunomodulator. Separately, after adjusting the purified Ferritin-SpyCatcher fusion protein to a suitable concentration, it was emulsified with Freund's incomplete adjuvant at a 1:1 volume ratio to prepare a Ferritin control formulation.
[0043] Forty one-day-old SPF chickens were randomly divided into four groups of ten each. Group 1 was immunized with SRBD-Ferritin nanoparticle immunization agent, with each chicken receiving 20 μg of nanoparticle protein via intramuscular injection. Group 2 was immunized with SRBD monomeric protein immunization agent, with the dosage calculated as an equimolar amount of SRBD antigen in Group 1. Group 3 was immunized with Ferritin control preparation. Group 4 was immunized with an equal volume of PBS as a blank control. Blood samples were collected at 0, 7, 14, 21, 28, and 35 days post-immunization, and serum was separated for later use.
[0044] The serum IBV-specific antibody levels in each group were detected by indirect ELISA. The results are shown in the figure. Figure 5 In group A, the SRBD-Ferritin group showed a specific antibody response as early as 7 days post-immunization, with antibody levels rapidly increasing at 14 days and peaking between 21 and 28 days. Overall antibody levels were significantly higher than those in the SRBD monomer group, the Ferritin control group, and the PBS group. Virus neutralization assay results are shown below. Figure 5 The neutralizing antibody titer in the SRBD-Ferritin group at 28 days was significantly higher than that in the SRBD monomer group, Ferritin group, and PBS group.
[0045] The above results indicate that the SRBD-Ferritin nanoparticles prepared in this invention can effectively induce the body to produce a specific humoral immune response against IBV and a high level of neutralizing antibodies, demonstrating good immunogenicity and potential for vaccine application.
[0046] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A type of chicken infectious bronchitis virus nanoparticle, characterized in that, The chicken infectious bronchitis virus nanoparticles are formed by the self-assembly of SRBD-SpyTag fusion protein and Ferritin-SpyCatcher fusion protein through a SpyTag / SpyCatcher covalent linkage system. The SRBD-SpyTag fusion protein is formed by fusing a SpyTag sequence to the N-terminus or C-terminus of the S1 protein receptor-binding domain of chicken infectious bronchitis virus. The Ferritin-SpyCatcher fusion protein is formed by fusing the SpyCatcher sequence to the N-terminus or C-terminus of the Helicobacter pylori Ferritin protein.
2. The chicken infectious bronchitis virus nanoparticles according to claim 1, characterized in that, The gene sequence encoding the SRBD-SpyTag fusion protein is shown in SEQ ID NO.
6.
3. The chicken infectious bronchitis virus nanoparticles according to claim 1, characterized in that, The gene sequence encoding the Ferritin-SpyCatcher fusion protein is shown in SEQ ID NO.
7.
4. The method for preparing chicken infectious bronchitis virus nanoparticles according to any one of claims 1-3, characterized in that, Includes the following steps: (1) The recombinant plasmid containing the encoding gene sequence of the SRBD-SpyTag fusion protein was induced to express in the host bacteria, and after purification and refolding, the SRBD-SpyTag fusion protein was obtained; (2) The recombinant plasmid containing the coding gene sequence of the Ferritin-SpyCatcher fusion protein was induced to be expressed in the host bacteria and purified to obtain the Ferritin-SpyCatcher fusion protein. (3) The SRBD-SpyTag fusion protein and the Ferritin-SpyCatcher fusion protein were mixed at a molar ratio of 1:1 and covalently linked to obtain the chicken infectious bronchitis virus nanoparticles.
5. The preparation method according to claim 4, characterized in that, In step (1), the purification method is denaturing Ni-NTA affinity chromatography purification; The refolding method involves gradient dialysis refolding using urea solutions of concentrations of 4 mol / L, 2 mol / L, 1 mol / L, 0.5 mol / L, and 0 mol / L.
6. The preparation method according to claim 4, characterized in that, In step (2), the purification method is non-denaturing Ni-NTA affinity chromatography purification.
7. The preparation method according to claim 4, characterized in that, In step (3), the covalent bonding reaction is carried out at a temperature of 4°C for 24-48 hours.
8. The use of the chicken infectious bronchitis virus nanoparticles according to any one of claims 1-3 in the preparation of chicken infectious bronchitis virus nanovaccines.
9. A chicken infectious bronchitis virus nanovaccine, characterized in that, The infectious bronchitis virus nanovaccine for chickens contains the infectious bronchitis virus nanoparticles as described in any one of claims 1-3.
10. The chicken infectious bronchitis virus nanovaccine according to claim 9, characterized in that, The chicken infectious bronchitis virus nanovaccine also contains an immune adjuvant.