Melon auxin receptor gene CmTIR1, encoded protein, recombinant expression vector, genetic transformant, method for regulating plant height and application in molecular breeding
By cloning the melon auxin receptor gene CmTIR1 and using CRISPR/Cas9 technology, the height of melon plants was regulated, solving the problems of long breeding cycles and low efficiency in traditional melon breeding, and achieving precise improvement of plant height and shortening of the breeding cycle.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-26
- Publication Date
- 2026-06-09
AI Technical Summary
Traditional melon hybridization breeding has a long cycle and low efficiency. The plant height trait is controlled by multiple genes and greatly affected by the environment, making selection difficult and precision breeding hard to achieve.
By cloning the melon auxin receptor gene CmTIR1, and using CRISPR/Cas9 gene editing technology to downregulate or overexpress CmTIR1, the height of melon plants can be regulated, and dwarf or taller phenotypes can be constructed.
It achieves precise and efficient improvement of melon plant height, shortens the breeding cycle, avoids the blindness and environmental interference of traditional breeding, and is applicable to the genetic improvement of different melon varieties.
Smart Images

Figure CN122168618A_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of plant genetic engineering technology, specifically relating to the melon auxin receptor gene CmTIR1 and its encoded protein, recombinant expression vector, genetic transformant, method for regulating plant height, and its application in molecular breeding. Background Technology
[0002] Muskmelon (Cucumis melo L.) is an important economic crop, prized for its delicious flavor and rich nutrition. In modern horticultural production, plant height is a key agronomic trait, directly affecting planting density, lodging resistance, and mechanized harvesting efficiency. Therefore, developing dwarf or semi-dwarf muskmelon varieties with moderate plant height and compact internodes is one of the key breeding goals for achieving high-yield, high-quality, and high-efficiency muskmelon production. Currently, genetic improvement of muskmelon plant height mainly relies on traditional hybridization breeding; however, this method is time-consuming, inefficient, and the plant height trait is greatly influenced by multiple genes and the environment, making selection difficult and unable to meet the needs of precision breeding.
[0003] In the field of plant biology, the TIR1 / AFB protein family in the auxin signaling pathway has been confirmed as a key factor in regulating plant height in crops such as Arabidopsis thaliana and rice. However, there are no reports on the specific biological functions of the CmTIR1 gene in melon and its potential application in plant architecture improvement. Summary of the Invention
[0004] The purpose of this application is to provide the melon auxin receptor gene CmTIR1 and its encoded protein, recombinant expression vector, genetic transformant, method for regulating plant height, and its application in molecular breeding. It elucidates the core role of the melon auxin receptor gene CmTIR1 in regulating melon plant height and internode elongation, and solves the problems of long cycle, low efficiency, and difficulty in selection due to the susceptibility of plant height traits to multiple genes and environmental interference in traditional melon hybridization breeding.
[0005] To achieve the above objectives, this application provides a melon auxin receptor gene CmTIR1, the nucleotide sequence of which is shown in SEQ ID No.1.
[0006] This application provides a melon auxin receptor protein encoded by the melon auxin receptor gene CmTIR1, the amino acid sequence of which is shown in SEQ ID No. 2.
[0007] This application provides a recombinant expression vector containing the melon auxin receptor gene CmTIR1; wherein, in the recombinant expression vector, the CmTIR1 gene is operatively linked to a promoter, the promoter being the CaMV 35S promoter.
[0008] This application provides a genetic transformant comprising the above-described recombinant expression vector.
[0009] This application provides a method for regulating the height of melon plants, comprising: downregulating or inhibiting the expression of the CmTIR1 gene or the activity of its encoded protein in melons to obtain melon plants with dwarf or semi-dwarf phenotypes; or, overexpressing the melon auxin receptor gene CmTIR1 in melons to obtain melon plants with increased height phenotypes.
[0010] Furthermore, the inhibition or downregulation process is achieved through gene editing technology, specifically CRISPR / Cas9.
[0011] Furthermore, the gRNA target sequence used in the CRISPR / Cas9 technology contains 5'-TGAGTCCTCAGACTGTAATC-3' or its complementary sequence.
[0012] Furthermore, a CmTIR1 mutant was obtained through the gene editing technology. The mutant is a loss-of-function mutant with a 49bp deletion at the target site, which causes premature termination of CmTIR1 protein translation.
[0013] Furthermore, the overexpression is achieved by introducing the recombinant expression vector into melon; wherein, the method of introduction is to introduce the recombinant expression vector into melon using Agrobacterium-mediated transformation.
[0014] This application provides an application of biological materials in the molecular breeding of melons, wherein the biological materials include the above-mentioned CmTIR1 gene, the above-mentioned CmTIR1 protein, the above-mentioned recombinant expression vector or the above-mentioned genetic transformant, and the application includes breeding melon varieties with specific plant heights, wherein the specific plant heights include dwarf phenotypes, semi-dwarf phenotypes or height-increasing phenotypes.
[0015] In summary, the application of the melon auxin receptor gene CmTIR1 and its encoded protein, along with various biological materials provided in this application, in the molecular breeding of melons has at least the following advantages: 1. The core function of the CmTIR1 gene in plant height regulation was clarified. This application reveals for the first time the crucial role of the CmTIR1 gene in the growth and development of melons. Experiments demonstrated that knocking out this gene using gene editing technology resulted in dwarfed plants with significantly reduced plant height and internode number; while overexpression of the gene resulted in plants with significantly increased plant height. This indicates that CmTIR1, as a positive regulatory factor, plays a decisive role in melon plant architecture development, filling a gap in this field.
[0016] 2. Precise and efficient regulation overcomes the blindness of traditional breeding. This application directly targets the upstream receptor of the auxin signaling pathway, with a clearly defined target. Compared with traditional hybridization breeding, the regulation of CmTIR1 using gene editing or overexpression technology has a direct, significant, and stable effect, avoiding the uncertainty and blind spots caused by multi-gene control and environmental factors in traditional breeding, and achieving precise and targeted improvement of melon plant height.
[0017] 3. Breeding cycle significantly shortened Using the genetic transformation or gene editing technology of this application, melon plants with the target plant height trait can be obtained in a single generation without going through a long and continuous multi-generation breeding process, which greatly improves breeding efficiency and shortens the time required for new variety breeding.
[0018] 4. It has broad application prospects and high applicability. The genetic resources and technical strategies provided in this application are universal and can be widely applied to the genetic improvement of different melon varieties (such as thick-skinned and thin-skinned melons). They provide valuable core germplasm resources and technical support for breeding new melon varieties with ideal plant types suitable for greenhouse cultivation, lodging resistance, suitable for dense planting, and adaptable to mechanized management. Attached Figure Description
[0019] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the description of the embodiments of this application will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 This is a diagram illustrating the identification process of the cmtir1 knockout mutant proposed in this application; where cr-cmtir1-L1 is a CmTIR1 gene knockout mutant.
[0021] Figure 2 This is a diagram showing the identification results of the CmTIR1 overexpression line proposed in this application; where p35S::CmTIR1 is the CmTIR1 overexpression line; A is the main element of the CmTIR1 overexpression vector; B is the PCR identification results of CmTIR1 transgenic plants, where + represents the positive control and the corresponding gene plasmid, and - represents the negative control WT; C shows the gene expression status in the CmTIR1 overexpression line.
[0022] Figure 3 This is a comparison of the phenotypes and root lengths of the cmtir1 mutant and WT seedlings proposed in this application. In this figure, A shows phenotypic photographs of the cmtir1 mutant and WT seedlings, with a scale bar of 5 cm; B shows the statistical results of the taproot lengths of the cmtir1 mutant and WT seedlings, n=5.
[0023] Figure 4 This is a figure showing the phenotypic and statistical comparison results of the cmtir1 mutant and WT adult plants proposed in this application; where A is a phenotypic photograph of the cmtir1 mutant and WT adult plants, with a scale bar of 10cm; B is the plant height statistics of the cmtir1 mutant and WT adult plants; C is the internode number statistics of the cmtir1 mutant and WT adult plants; and D is the internode length statistics of the cmtir1 mutant and WT adult plants.
[0024] Figure 5 These are the phenotypic and statistical results of plant height and internodes of the CmTIR1 overexpressing lines and WT plants proposed in this application; where A is a phenotypic photograph of the CmTIR1 overexpressing lines and WT plants, with a scale bar of 10cm; B is the statistical results of the height of the CmTIR1 overexpressing lines and WT plants; C is the statistical results of the number of internodes of the CmTIR1 overexpressing lines and WT plants; and D is the statistical results of the internode length of the CmTIR1 overexpressing lines and WT plants. Detailed Implementation
[0025] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.
[0026] In one aspect, this application provides a melon auxin receptor gene CmTIR1, the nucleotide sequence of which is shown in SEQ ID No. 1. This application provides the melon auxin receptor gene CmTIR1 and its encoded protein, and elucidates its core role in regulating melon plant height and internode elongation.
[0027] Secondly, this application provides a melon auxin receptor protein CmTIR1 encoded by the melon auxin receptor gene CmTIR1, the amino acid sequence of which is shown in SEQ ID No. 2. This application is the first to clone the auxin receptor gene CmTIR1 from melon, and its complete coding sequence (CDS) is shown in SEQ ID No. 1, with a full length of 1755 bp. This gene encodes a protein composed of 584 amino acids, namely the melon auxin receptor protein of the second aspect of this application, the amino acid sequence of which is shown in SEQ ID No. 2. Bioinformatics analysis shows that this protein contains a typical F-box domain and multiple leucine-rich repeat sequences (LRRs), belonging to the TIR1 / AFB protein family.
[0028] Among them, SEQ ID No. 1 is:
[0029] SEQ ID No.2 is: .
[0030] Thirdly, this application provides a recombinant expression vector containing the melon auxin receptor gene CmTIR1; wherein, in the recombinant expression vector, the CmTIR1 gene is operatively linked to a promoter, said promoter being a p35S (CaMV35S) promoter, such as... Figure 2 As shown in Figure A.
[0031] Fourthly, this application provides a genetic transformant comprising the above-mentioned recombinant expression vector.
[0032] Fifthly, this application provides a method for regulating the height of melon plants, comprising: (1) The expression of the melon auxin receptor gene CmTIR1 or the activity of its encoded protein were downregulated or inhibited by CRISPR / Cas9 gene editing technology to obtain melon plants with dwarf or semi-dwarf phenotypes. The gRNA target sequence used in the CRISPR / Cas9 technology contains 5'-TGAGTCCTCAGACTGTAATC-3' or its complementary sequence, and the CmTIR1 mutant obtained by this technology is a loss-of-function mutant with a 49bp deletion at the target site, which causes premature termination of CmTIR1 protein translation; the nucleotide sequence of the melon auxin receptor gene CmTIR1 is shown in SEQ ID No. 1.
[0033] (2) Alternatively, overexpress the melon auxin receptor gene CmTIR1 in melon to obtain melon plants with an increased height phenotype; wherein, overexpression is achieved by constructing a recombinant expression vector by operably linking the CmTIR1 gene with the CaMV 35S promoter, and then introducing the recombinant expression vector into melon using Agrobacterium-mediated transformation.
[0034] Based on the above methods, this application also provides a melon auxin receptor gene CmTIR1, the nucleotide sequence of which is shown in SEQ ID No. 1, for use in a method for regulating melon plant height. This application also provides a gene-encoded melon auxin receptor protein CmTIR1, the amino acid sequence of which is shown in SEQ ID No. 2. This application also provides a recombinant expression vector containing the melon auxin receptor gene CmTIR1, wherein the CmTIR1 gene is operatively linked to the CaMV 35S promoter, for use in a method for regulating melon plant height. This application also provides a genetic transformant containing the above-mentioned recombinant expression vector, for use in a method for regulating melon plant height.
[0035] In specific implementation methods, this application mainly controls the height of melon plants in two ways: One method involves overexpression. Specifically, a CmTIR1 gene overexpression vector driven by the 35S promoter was constructed and introduced into melon using Agrobacterium-mediated genetic transformation to obtain transgenic plants. Compared to the wild type, the overexpressing plants exhibited a significant increase in plant height and internode elongation. The molecular mechanism lies in the fact that CmTIR1 overexpression enhances the melon cells' ability to sense and transduce auxin. More CmTIR1 protein means more efficient mediation of the degradation of Aux / IAA repressor proteins, thereby continuously activating ARF transcription factors. These activated ARFs then upregulate the expression of a series of downstream target genes. Therefore, the shoot apical meristem cells of the overexpressing plants divide more actively, and the elongation ability of internode meristem cells and elongation zone cells is enhanced, ultimately leading to an increase in the number and length of internodes, resulting in a significant increase in plant height.
[0036] The second method involves gene knockout. Specifically, using CRISPR / Cas9 gene editing technology, gRNAs targeting the coding region of the CmTIR1 gene are designed to create functionally deficient mutants. Preferably, the CRISPR / Cas9 system is used, and the target sequence can be 5'-TGAGTCCTCAGACTGTAATC-3' (SEQ ID No. 15). By knocking out the CmTIR1 gene, the CmTIR1 protein loses its function, causing the SCF CmTIR1 complex to be unable to effectively sense auxin signals and mediate the degradation of Aux / IAA proteins. This leads to a large accumulation of Aux / IAA proteins in the cell, continuously inhibiting the function of the ARF transcription activator. As a result, the expression of downstream genes regulated by ARF that promote cell division and elongation is suppressed, cell cycle progression is slowed, and cell wall expansion is restricted. CmTIR1 mutant plants exhibit a typical dwarfing phenotype with significantly reduced plant height, fewer internodes, and a compact plant type.
[0037] Sixthly, this application provides an application of biological materials in the molecular breeding of melons, wherein the biological materials include the above-mentioned CmTIR1 gene, the above-mentioned CmTIR1 protein, the above-mentioned recombinant expression vector or the above-mentioned genetic transformant, and the application includes breeding melon varieties with specific plant heights, wherein the specific plant heights include dwarf phenotypes, semi-dwarf phenotypes or height-increasing phenotypes.
[0038] The technical solutions described above in this application will be explained in detail below with reference to specific embodiments.
[0039] The muskmelon plant height gene CmTIR1 in this application is MELO3C015898, its nucleotide sequence is shown in SEQ ID No.1, and its encoded protein amino acid sequence is shown in SEQ ID No.2. The muskmelon variety used in this application is Queen.
[0040] Example 1 This embodiment is used to construct a CmTIR1 knockout vector for gene editing. The CRISPR / Cas9 system is used to generate directional double-strand breaks in the melon genome, thereby knocking out the CmTIR1 gene and providing the material basis for obtaining mutant plants. The process includes: selecting a target site in the open reading frame coding region of the plant height gene CmTIR1, constructing a gRNA expression cassette, and then ligating the target gRNA expression cassette into the knockout vector to obtain the CmTIR1 knockout vector. The sequence of the target gRNA is shown in SEQ ID No. 15: TGAGTCCTCAGACTGTAATC (SEQ ID No. 15), and its complementary sequence is shown in SEQ ID No. 16: GATTACAGATCTGAGGACTCA (SEQ ID No. 16).
[0041] Specifically: (1) Screening target sites Log in to the website bioinfogp.cnb.csic.es / tools / breakingcas / ?gset=melon, enter the CDS sequence of the CmTIR1 gene, and use online tools to select highly specific and high-scoring target sites in the exons (especially the N-terminus) of the CmTIR1 gene, and design complementary primer pairs for synthesizing sgRNA (the synthesized sgRNA single-stranded primers are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively).
[0042] include: gRNA 1-F: ATTGTGAGTCCTCAGACTGTAATC (SEQ ID No. 3); gRNA 1-R: AAACGATTACAGTCTGAGGACTCA (SEQ ID No. 4).
[0043] (2) Mix equal amounts of primer gRNA 1-F and primer gRNA 1-R, denature at 95℃ for 5 min, and then anneal at room temperature for 20 min to form double-stranded gRNA.
[0044] (3) The “tandem” vector was linearized by digesting it with BbsI at 37℃ for 3 hours and then purified and recovered. It was then ligated with the double-stranded gRNA formed after annealing to obtain the intermediate vector containing the gRNA expression cassette “tandem-sgRNA”.
[0045] The enzyme digestion system consisted of 1 μg tandem (plasmid), 5 μL 10xNEB Buffer, and 1 μL BbsI enzyme, which were then diluted to a final volume of 50 μL with sterile water. Here, 10xNEB Buffer refers to a 10-fold concentration of NEB buffer, and BbsI enzyme is a restriction endonuclease; further details will not be provided hereafter.
[0046] The ligation system consisted of: 5 μL of double-stranded gRNA, 25 ng of tandem vector digested with BbsI, 1 μL of 10x ligase buffer, and 1 μL of T4 ligase, then diluted to 10 μL with sterile water. 10x ligase buffer refers to a 10-fold concentration of ligase buffer, and T4 ligase refers to T4 DNA ligase.
[0047] (4) After the intermediate vector was successfully sequenced, the tandem-sgRNA intermediate vector and the final vector pB7-CAS9-TPC (preserved in the laboratory) were digested with SpeI (restriction endonuclease) and KpnI (restriction endonuclease), respectively. The fragment containing gRNA was ligated into the Cas9 expression vector to obtain the complete CmTIR1 gene knockout plant expression vector (pB7-CAS9-TPC-gRNA).
[0048] The digestion solution for the final vector consisted of: 1.5 μL SpeI, 1.5 μL KpnI, 5 μL 10x rcut buffer, and 1 μg plasmid, then diluted to 50 μL with sterile water. After digestion, the DNA was purified and recovered using the Novizan DNA Purification Kit (DC301-01) for subsequent reactions.
[0049] The digestion system for the intermediate vector consisted of: 1.5 μL SpeI, 1.5 μL KpnI, 5 μL 10x rcut buffer (a 10-fold concentration of rapid digestion buffer), and 1 μg plasmid. Sterile water was then added to a final volume of 50 μL, and the digestion was carried out at 37°C for 3 hours. After digestion, electrophoresis was performed on a 1% agarose gel. Once DNA bands appeared, smaller bands were recovered (i.e., smaller DNA fragments were excised from the gel to obtain DNA fragments containing sgRNA sequences) for subsequent reactions. The digested fragments were then ligated into the cleaved CAS9 vector.
[0050] The ligation system consisted of 1 μL of T4 ligase, 1 μL of 10x buffer, 0.5 μL of the enzyme-digested and recovered CAS9 vector, and 0.5 μL of the enzyme-digested and recovered intermediate vector, which was then added to a final volume of 10 μL with sterile water.
[0051] (5) Colony PCR identification The PCR system consisted of: 6 μL of 2x PCR mix, 0.5 μL each of primer gRNA1-F and primer CR (as shown in SEQ ID No. 5), 2 μL of aqueous bacterial solution containing the target plasmid, and sterile water to a final volume of 12 μL. The PCR program was as follows: 95℃ pre-denaturation for 1 min 30 s; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for 32 cycles of amplification; and 72℃ extension for 5 min.
[0052] Colonies that were correctly identified by PCR were shaken and plasmids were extracted using the Novizan plasmid mini-extraction kit (DC201-01). The extracted plasmids were then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing using CR primers (primer sequences shown in SEQ ID No. 5). The correctly sequenced plasmids were transformed into Agrobacterium AGL1 (Weidi Biotechnology) and preserved (after positive colony PCR identification, the strain was preserved in 25% glycerol). This yielded an engineered Agrobacterium AGL1 strain containing the CmTIR1 knockout vector of gRNA1.
[0053] CR: GGAACTACTCACACATTATTCTGGA (SEQ ID No. 5).
[0054] Example 2 This embodiment is used to construct a CmTIR1 overexpression vector (i.e., a plant expression vector that can overexpress the CmTIR1 gene), and drive gene expression through the strong promoter p35S (CaMV 35S) to verify the effect of gene overexpression on melon plant height.
[0055] Specifically, the following steps are included: (1) Using melon leaf cDNA as a template, the full-length CDS sequence of the CmTIR1 gene was amplified using the high-fidelity enzyme Pfu.
[0056] The amplification system consisted of 12.5 μL of 2xPfu PCR Mix (Tiangen), 1 μL of PCY-BamHI-CmTIR1-F (primer sequence as shown in SEQ ID No. 6), 1 μL of PCY-SalI-CmTIR1-R (primer sequence as shown in SEQ ID No. 7), and 1 μL of cDNA, which was then brought to a final volume of 25 μL with sterile water.
[0057] The amplification conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 15 s, 72℃ extension for 2 min, 35 cycles of amplification; 72℃ extension for 10 min.
[0058] PCY-BamHI-CmTIR1-F: GGTACCCGGGGATCCATGCTGAGAATGGCGAGTAC (SEQ ID No. 6); PCY-SalI-CmTIR1-R: GTGGTGGTGGTCGACAGTAAGCTTTAGAGGAGCATCTC (SEQ ID No. 7).
[0059] (2) The amplified product was purified and recovered using the Novizan DNA Purification Kit (DC301-01). Simultaneously, the pCY vector was digested and purified using BamHI and SalI enzymes to obtain the purified target gene fragment and the linearized pCY vector. The target gene fragment was then constructed into the linearized pCY vector via homologous recombination. After the reaction, the vector was transformed into DH5α competent cells (Weidi Biotechnology), and identified by colony PCR.
[0060] The enzyme digestion system consisted of: 1.5 μL BamHI, 1.5 μL SalI, 5 μL 10x rcut buffer, and 1 μg pCY plasmid, which was then diluted to 50 μL with sterile water and digested at 37°C for 3 hours.
[0061] The homologous recombination reaction system consisted of: 1 μL of pCY vector recovered by BamHI and SalI enzyme digestion, 1 μL of amplification product, 2 μL of 5xCEII buffer, 1 μL of Exnase II, and then added to 10 μL with sterile water. The reaction was carried out at 37°C for 1 hour.
[0062] The PCR identification system consisted of: 6 μL of 2x PCR mix, 0.5 μL of primer PCY-BamHI-CmTIR1-F, 0.5 μL each of primer PCY-SalI-CmTIR1-R, and 2 μL of aqueous bacterial suspension containing the target plasmid, with sterile water added to a final volume of 12 μL. The PCR conditions were: 95℃ pre-denaturation for 1 min 30 s; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for 32 cycles of amplification; and 72℃ extension for 5 min. Colonies that tested positive by PCR were then inoculated with the remaining bacterial suspension into liquid LB medium containing kanamycin and cultured overnight. Plasmids were extracted using the Novizan plasmid mini-extraction kit (DC201-01).
[0063] (3) The plasmid was sequenced using CX-R primers (primer sequence as shown in SEQ ID No. 8). After the sequencing was correct, the plasmid was transformed into Agrobacterium GV3101 (Weidi Biotechnology), and the Agrobacterium GV3101 engineered bacteria containing the overexpression vector was identified by colony PCR.
[0064] The colony PCR identification system consisted of: 6 μL of 2x PCR mix, 0.5 μL of primer PCY-BamHI-CmTIR1-F, 0.5 μL of primer PCY-SalI-CmTIR1-R, and 2 μL of bacterial suspension, then diluted to 12 μL with sterile water. The PCR conditions were: 95℃ pre-denaturation for 1 min 30 s, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 32 cycles of amplification, and a final extension at 72℃ for 5 min. After positive colony PCR identification, the bacterial strain was preserved in 25% glycerol.
[0065] CX-R: CAGGATTCAATCTTAAGAAACT (SEQ ID No. 8).
[0066] Example 3 This embodiment is used to illustrate in detail the process of Agrobacterium-mediated genetic transformation of melon, that is, the vectors constructed in Examples 1 and 2 are introduced into the melon genome, and transgenic melon plants are obtained through tissue culture and screening.
[0067] Specifically, the following steps are included: (1) Disinfect the melon seeds with 75% alcohol for 30 seconds, then sterilize them with 5% sodium hypochlorite for 10 minutes, rinse them 5 times with sterile water, and leave them in the dark at room temperature overnight. After peeling off the inner seed coat, place them on MS medium and incubate them in the dark at 28°C for one day. The MS medium formula is as follows: 4.4g of M519 (MS medium powder), 30g of sucrose, 8g of agar, and H2O to a final volume of 1L, pH=5.8, and autoclave at 121°C for 20 minutes.
[0068] Simultaneously, the shaken Agrobacterium was added to the infection solution and shaken overnight for activation. The infection solution was formulated as follows: M519 2.2g, Sucrose 30g, H2O to a final volume of 1L, pH=5.8, autoclaved at 121℃ for 20min, cooled, and then 500μL of 400mM Acetosyringone (AS) was added.
[0069] (2) Remove the last 1 / 3 of the seed and about 5 mm of the radicle end, and cut the remaining part in the middle again (i.e., leave 4 usable parts for each seed). Place the cut seeds in the invasion dye solution, vacuum process them 10 times with a syringe, place the seeds on filter paper to dry, and place them in the co-culture medium. Culture them in a 26℃ incubator under light for 3 days to obtain genetically transformed explants. The formula of the co-culture medium includes: MS (M519) 4.4 g, CuSO4·5H2O (1 mg / mL) 1 mL, MES (2-(N-morpholino)ethanesulfonic acid) 0.6 g, Sucrose 30 g, Agar 8 g, H2O to a final volume of 1 L, pH=5.8, autoclave at 121℃ for 20 min, cool and then add 6-BA (1 mg / mL) 500 μL, IAA (2 mg / mL) 50 μL and Acetosyringone (400 mM) 500 μL.
[0070] (3) The explants were transferred from the co-culture medium to the selection medium to inhibit the growth of Agrobacterium and screen transgenic cells to obtain resistant callus and shoot clusters. The selection medium consisted of: MS (M519) 4.4g, CuSO4·5H2O (1mg / mL) 1mL, MES 0.6g, Sucrose 30g, Agar 8g, H2O to 1L, pH=5.8, autoclaved at 121℃ for 20min, cooled and then 6-BA (1mg / mL) 500μL, IAA (2mg / mL) 50μL, Cefotaxime (250mg / mL, cefotaxime) 1mL, Timentin (150mg / mL, timenine) 1mL, PPT (8mg / mL, herbicide) 500μL. PPT was only added in the method of knocking out the vector.
[0071] (4) Three weeks later, the explants produced clustered shoots and were transferred to a new selection medium. Subculture was performed every three weeks thereafter. When the stems were about 1 cm long, they were cut and placed in a rooting medium bottle to induce rooting, so as to obtain complete transgenic melon seedlings. When the seedlings grew, DNA could be extracted from the leaves for identification. The formula of the rooting medium was as follows: MS (M519) 4.4 g, Sucrose 30 g, Agar 3.6 g, H2O to a final volume of 1 L, pH=5.8, autoclaved at 121℃ for 20 min, cooled, and then 1 mL of Timentin (150 mg / mL) was added.
[0072] Example 4 This embodiment is used to verify CmTIR1 knockout mutants and overexpressing plants, to detect whether the gene has been knocked out or overexpressed, and to screen out positive plants for subsequent phenotypic analysis.
[0073] (1) Identification of CmTIR1 knockout mutants Primers F0 and R0 were designed near the target sites of the CmTIR1 gene in melon plants. DNA was extracted from young leaves of transgenic plants, and PCR amplification and sequencing were performed using the primers before and after the target site to obtain the PCR amplified fragment (the sequences of the amplification primer pairs are shown in SEQ ID No. 9 and SEQ ID No. 10). The PCR amplification system was as follows: 6 μL of 2x PCR mix, 0.5 μL each of primer F0 and primer R0, 2 μL of bacterial culture, and sterile water to a final volume of 12 μL. The PCR amplification conditions were: 95℃ pre-denaturation for 1 min 30 s; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for 32 cycles; and 72℃ extension for 5 min.
[0074] The PCR products were sequenced and compared; the results are shown below. Figure 1 As shown, Figure 1 The diagram shows a gene pattern, indicating an sgRNA target located in the first exon. The short horizontal line represents the PAM site. The cr-cmtir1-L1 mutant has a 49bp deletion at the target site, causing premature protein termination.
[0075] Primer F0: 5'-CGAGTACGTTTCCAGAAGAT-3' (SEQ ID No. 9); Primer R0: 5'-GCCCATCAGTACTGAACCCT-3' (SEQ ID No. 10).
[0076] (2) Identification of CmTIR1 overexpressing plants The constructed recombinant expression vector (such as Figure 2 (A in the vector represents the main element of the overexpression vector) was transformed into Agrobacterium GV3101 engineered bacteria via chemical transformation. Independent transformed lines were obtained through Agrobacterium-mediated genetic transformation of melon. The CmTIR1 overexpression lines (i.e., the CmTIR1 overexpression lines) were further identified using PCR. Figure 2 p35S::CmTIR1 of B in Figure 2 L11, L18, L19, L20, L24, and L25 represent different overexpression plants obtained. Primers were the F-terminus of the vector pCY plus the R-terminus of the gene. To verify the expression of the CmTIR1 gene, these overexpression plants were further detected by qRT-PCR using q-CmTIR1-F, q-CmTIR1-R, and internal control primers (Actin4-F and Actin4-R). The results are as follows: Figure 2As shown in C, compared with wild-type (WT) plants, the expression levels of the target gene in overexpressing plants L11, L18 and L24 were significantly higher than those in the control, indicating that CmTIR1 was overexpressed in these transgenic materials.
[0077] q-CmTIR1-F: 5'-AAGCTTTGGGTGCTGGACTT-3' (SEQ ID No. 11); q-CmTIR1-R: 5'-ACACATTTGGTTCCTGCCCA-3' (SEQ ID No. 12); Actin4-F: 5'-TGGAAGCTGCAGGAATCCACGA-3' (SEQ ID No. 13); Actin4-R: 5'-TGCTGGGAGCAAGGGCTGTG-3' (SEQ ID No. 14).
[0078] Example 5 This embodiment was used to analyze the plant height phenotype of CmTIR1 knockout mutants and overexpressing plants. Through agronomic trait surveys, the specific effects of CmTIR1 gene functional alterations on melon growth and development were verified, thus demonstrating the role of the CmTIR1 gene in plant height regulation.
[0079] Includes the following steps: (1) Phenotypic analysis during the seedling stage After surface sterilization of melon seeds from WT (wild-type) and CmTIR1 knockout mutants, they were vertically cultured on 1 / 2 MS medium at 26°C for 14 days. The length of the taproot of the seedlings was then measured and recorded. Figure 3 As shown, compared to the wild type, the taproot length of CmTIR1 mutant seedlings was significantly reduced. This indicates that the loss of CmTIR1 function inhibited root elongation growth in the early stages of seedling development.
[0080] (2) Phenotypic analysis in adulthood Muskmelon seeds from WT (wild-type), CmTIR1 knockout mutant, and CmTIR1 overexpression lines were sown in 50-cell trays and transplanted to the Kashgar base of the Fruit and Vegetable Research Institute of the Xinjiang Academy of Agricultural Sciences when the plants had two leaves and one bud. The muskmelon plants were managed routinely. At approximately 45 days of growth, plant height, internode length, and number of internodes were measured and recorded. Data for mutant plants are as follows: Figure 4 As shown: The CmTIR1 mutant exhibits a typical dwarfing phenotype. Compared to the wild type, its plant height and number of internodes are significantly reduced, but the length of individual internodes does not change significantly. The plant type is compact, and the stems are significantly thicker. Data from overexpression plants are shown below. Figure 5As shown, compared to the wild type, CmTIR1 overexpressing plants exhibited significantly increased plant height, along with increased internode number and length. In conclusion, the CmTIR1 gene can positively regulate melon plant height; knockout results in dwarfism, while overexpression leads to increased height.
[0081] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on its differences from other embodiments. Similar or identical parts between embodiments can be referred to interchangeably. Although preferred embodiments of this application have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of this application.
[0082] Finally, it should be noted that in this application, relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or terminal device that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or terminal device. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or terminal device that includes said element.
[0083] This application uses specific examples to illustrate the principles and implementation methods of this application. The description of the above embodiments is only for the purpose of helping to understand the method and core ideas of this application. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this application. Therefore, the content of this specification should not be construed as a limitation of this application.
Claims
1. A melon auxin receptor gene CmTIR1, characterized in that, Its nucleotide sequence is shown in SEQ ID No.
1.
2. A melon auxin receptor protein encoded by the melon auxin receptor gene CmTIR1 according to claim 1, characterized in that, Its amino acid sequence is shown in SEQ ID No.
2.
3. A recombinant expression vector, characterized in that, The recombinant expression vector contains the melon auxin receptor gene CmTIR1 as described in claim 1; wherein, in the recombinant expression vector, the CmTIR1 gene is operatively linked to a promoter, the promoter being the CaMV 35S promoter.
4. A genetic transformant, characterized in that, It includes the recombinant expression vector as described in claim 3.
5. A method for regulating the height of melon plants, characterized in that, include: Downregulate or inhibit the expression of the CmTIR1 gene as described in claim 1 or the activity of its encoded protein in melons to obtain melon plants with dwarf or semi-dwarf phenotypes. Alternatively, the CmTIR1 gene as described in claim 1 may be overexpressed in melons to obtain melon plants with an enhanced phenotype.
6. The method according to claim 5, characterized in that, The inhibition or downregulation process is achieved through gene editing technology, specifically CRISPR / Cas9.
7. The method according to claim 6, characterized in that, The gRNA target sequence used in the CRISPR / Cas9 technology contains 5'-TGAGTCCTCAGACTGTAATC-3' or its complementary sequence.
8. The method according to claim 7, characterized in that, The gene editing technology was used to obtain a CmTIR1 mutant, which is a loss-of-function mutant with a 49bp deletion at the target site, resulting in premature termination of CmTIR1 protein translation.
9. The method according to claim 5, characterized in that, The overexpression is achieved by introducing the recombinant expression vector into melon; wherein the method of introduction is to introduce the recombinant expression vector into melon using Agrobacterium-mediated transformation.
10. The application of a biomaterial in molecular breeding of melons, characterized in that, The biological materials include the CmTIR1 gene, CmTIR1 protein, recombinant expression vector, or genetic transformant, and the application includes breeding melon varieties with specific plant heights, wherein the specific plant height includes dwarf phenotype, semi-dwarf phenotype, or tall phenotype.