Camellia oleifera abel Cjagl42 gene and application thereof in regulating plant flowering time

Abstract

Camellia japonica CjAGL42 gene and application of regulating flowering period of plants, the nucleotide sequence of the Camellia japonica CjAGL42 gene is shown as SEQ ID No. 1, the full-length gene of CjAGL42 of the MADS-box family is cloned from the EMS mutagenesis strain Cj-EMS-79 of Camellia japonica for the first time, and the function of promoting flower bud differentiation and early flowering is determined through heterologous transformation of tobacco, and the problem of low efficiency of flowering period regulation trait improvement in traditional breeding of theaceae ornamental plants is solved.

Description

Technical Field

[0001] This invention relates to the field of Camellia sinensis CjAGL42 gene research, and particularly to a Camellia sinensis CjAGL42 gene and its application in regulating the flowering period of plants. Background Technology

[0002] Camellia species are an important ornamental group in East Asia. Among them, Camellia japonica, with its unique flower shape, rich colors, and profound cultural connotations, has become a core resource for landscape art and the floriculture industry. More than 30,000 horticultural varieties of camellias have been cultivated globally, highlighting its growing importance among ornamental plants. In recent years, with breakthroughs in molecular breeding technology and in-depth analysis of the mechanisms regulating ornamental traits, the development of the horticultural value of both species has entered a new stage. Camellia japonica, due to its smaller flower size compared to Camellia yunnanensis, is often called "small camellia" in East China. This species is naturally distributed mainly in the southeastern coastal areas of my country, native to Zhejiang, Fujian, Hunan, and other provinces in East and Central China. Its notable flowering characteristic is that it begins to bloom in October of the current year, with the flowering period lasting until March or April of the following year. In terms of ornamental value, camellias, with their rich variations in flower shape (single to double petals), vibrant red flowers (with occasional white and pink varieties), leathery and glossy leaves, and highly adaptable small tree form, have become a distinctive native tree species with both ecological benefits and landscape value. Establishing specialized camellia gardens can systematically showcase their varietal diversity and provide an important platform for germplasm resource preservation and innovative research. East China camellias are mostly distributed in the humid mountains south of the Yangtze River in China, commonly found in evergreen broad-leaved forests at altitudes of 600–1900 meters. Their growth depends on a warm and humid climate and acidic soil (pH 5.5–6.5), and they can tolerate short periods of -8°C in winter (Wang Kuiling et al., 2006). East China camellias (C. japonica) have a very long history of cultivation in my country and are a collective term for plant germplasm resources, including species, varieties, and cultivars, primarily cultivated for ornamental purposes (Li Xinlei et al., 2019a). With its clusters of brightly colored flowers, it has high ornamental value; it is one of the ten famous flowers in my country and one of the world's precious flowers. Camellia varieties generally bloom in winter and spring, with a long flowering period. They have rich variations in flower color and shape, and the rich variations in flower color provide a good material basis for the breeding and improvement of camellia flower color (Li Xinlei et al., 2019b).

[0003] As important ornamental flowering plants, the flowering process of Camellia species is a crucial developmental stage. Over long-term evolution, a complex regulatory network has formed, involving the synergistic effects of genetic basis, endogenous hormones, and the external environment (Boss et al., 2004; Chen et al., 2020). Research on the flowering period of this genus is of great value in solving the problem of asynchronous flowering of parental lines in hybridization breeding and can provide theoretical support for cultivating new varieties with superior comprehensive traits. Of particular note is Camellia azalea, which breaks through the winter-spring flowering characteristic of most Camellia varieties, achieving its peak flowering period in summer and possessing the potential for year-round flowering, making it an ideal material for studying the regulation of flowering period in Camellia species. Molecular biological studies have shown that Wang Jiangying et al. (2021) successfully isolated and cloned the ACC-oxidase (ACO) gene from the flower bud tissue of Camellia azalea. Its tissue-specific expression characteristics suggest that this gene may be involved in the regulation of floral organ development and senescence. Transcriptome analysis revealed that low-temperature signals, metabolic pathways, and hormonal regulation jointly participate in the flower bud differentiation process during the development of Camellia rubra flower buds, with members of the MADS-box gene family exhibiting a dynamic expression pattern during the flower bud development stage (Fan et al., 2015). Furthermore, Camellia perpetua and Camellia flavida also exhibit summer flowering characteristics, especially Camellia perpetua, which can achieve year-round flower bud differentiation, forming a unique phenotype of multi-season flowering. La Yanfei et al. (2021) found through comparative studies that the flower bud differentiation processes of the three types of Camellia perpetua are homologous, but differ in the duration and sequence of differentiation, with Camellia perpetua exhibiting typical differentiation overlap. Li Xinlei et al. (2012), combining morphological and metabolomics analysis, systematically revealed the flower bud differentiation patterns of Camellia, opening a new path for artificially controlling flowering time and cultivating year-round flowering varieties. As a key trait determining ornamental and economic value, accurately analyzing the flowering mechanism of Camellia plants is an important foundation for achieving targeted regulation of flowering time. Current research largely focuses on phenotypic observation and traditional cultivation techniques, leaving significant gaps in understanding molecular regulatory mechanisms. Future research should integrate multi-omics technologies such as genomics, transcriptomics, and metabolomics to deeply analyze the functional networks and regulatory pathways of key flowering genes, thereby achieving precise regulation of flowering time. Summary of the Invention

[0004] To address the problems existing in the prior art, the present invention aims to provide a Camellia sinensis CjAGL42 gene and its application in regulating the flowering period of the plant.

[0005] To achieve the above objectives, the technical solution of the present invention is as follows: A CjAGL42 gene of Camellia sinensis from East China, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0006] Furthermore, its amino acid sequence is shown in SEQ ID No. 2.

[0007] Furthermore, recombinant vectors based on the aforementioned genes; Furthermore, the above-mentioned genes are used in regulating plant flowering time.

[0008] Furthermore, the above-mentioned genes are applied in the breeding of early-flowering tobacco varieties.

[0009] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention discloses the full-length cDNA sequence of the CjAGL42 gene, whose encoded protein contains typical MADS-box and K-domain domains, exhibiting specific differences from known homologous genes. Transcriptome analysis showed that CjAGL42 expression was significantly downregulated in the mutagenic line Cj-EMS-79, suggesting a direct correlation with flowering time variation. Overexpression vector construction: The CjAGL42 gene was inserted into a plant expression vector (such as pCAMBIA1301) to construct a recombinant vector. Tobacco was transformed using the Agrobacterium tumefaciens-mediated leaf disc method. Of the 13 overexpression lines obtained, over 90% initiated flower bud differentiation at 5-6 weeks of seedling age, while wild-type tobacco remained in the vegetative growth stage.

[0010] For breeding early-flowering Camellia varieties: Overexpression of the CjAGL42 gene shortens the breeding cycle; primers designed based on the gene sequence are used for rapid detection of flowering traits in Camellia species. Breaking away from the general understanding of the MADS-box family genes as having "generalized flowering regulation," this study is the first to clearly define the "specific early flowering function" of the CjAGL42 gene in Camellia spp. in East China, and its function has been verified through heterologous transformation experiments, rather than simply through gene sequence cloning. Its function has been verified through transgenic tobacco and can be directly applied to improve the flowering time of ornamental plants such as Camellia, meeting the needs of the horticultural industry. Attached Figure Description

[0011] Figure 1 Vector spectra of CjSOC1, CjAGL42 and CjSVP; Figure 2 Sterile seedlings obtained by EMS mutagenesis; Figure 3(a) Subculture propagation after 20 days; Figure 3(b) Subculture propagation after 90 days; Propagation culture of mutant Camellia chinensis seedlings from East China; Figure 4 The number of mutant Camellia seedlings induced in East China; Figure 5 Rooting status of Camellia seedlings in East China after EMS induction; Figure 6Field transplantation of camellia in East China; Figure 7 Statistical analysis of stem morphology of Camellia mutant plants in East China; Figure 8 Statistical analysis of leaf morphology of mutant Camellia strains in East China; Figure 9 Statistical analysis of root count in wild-type and mutant Camellia sinensis strains in East China; Figure 10 Comparison of roots between wild-type and mutant Camellia sinensis strains in East China; Figure 11 Enzyme activity determination of wild-type and mutant strains of Camellia sinensis in East China; Note: Figure A shows the determination of SOD, Figure B shows the determination of POD, and Figure C shows the determination of CAT. Figure 12 Genomic DNA electrophoresis detection of some materials; Figure 13 Screening of SCoT and CDDP primers (M. DNA standard molecular weight DL2000). Figure 14 SCoT 1 and SCoT 2 amplification results of SCoT in the East China Camellia mutant (M. DNA standard molecular weight DL2000); Figure 15 CDDP amplification results of CDDP 1, CDDP 13, and CDDP 27 for the East China Camellia mutant (M. DNA standard molecular weight DL2000). Figure 16 MA diagram of differentially expressed genes between wild-type and EMS-79 Camellia sinensis in East China; Figure 17 qRT-PCR was used to validate transcriptome data; Figure 18 Results of KEGG enrichment analysis of differentially expressed genes; Figure 19 Conserved domains of CjSOC1, CjAGL42 and CjSVP proteins from Camellia sinensis var. chinensis; Figure 20 The main pathways controlling flowering time in Arabidopsis thaliana (Robert et al., 2024). Figure 21 SSR detection and analysis; Note: A: SSR percentage statistics; B: SSR type distribution statistics; C: GO enrichment analysis of genes with SSR variant sites; D: KEGG enrichment analysis of genes with SSR variant sites. Figure 22 Electrophoresis diagram of target gene cloning and vector construction; Note: M stands for DL2000; A: Electrophoresis diagram of target gene clones, 1-2 are CjSOC1, 3-4 are CjAGL42, 5-6 are CjSVP; B: Electrophoresis diagram of CjSOC1 Escherichia coli bacterial culture detection; Figure 23 The process of genetic transformation in tobacco; Note: Figure A shows callus growth on transgenic tobacco leaves, Figure B shows adventitious buds growing on the callus, Figure C shows adventitious buds being cut off and transferred to a seedling culture medium, Figures D and F show complete plants of CjSOC1, CjAGL42 and CjSVP respectively, Figure G shows wild-type tobacco, and Figure H shows a flowering plant of CjAGL42. Figure 24 PCR test results of transgenic positive plants; Note: M is DL2000, 3-12 is T0 generation, WT is negative control (wild type), CK is blank control (water), and P is positive control (Agrobacterium tumefaciens suspension). Figure 25 Results of quantitative fluorescence detection of CjAGL42 gene-positive plants; Note: WT stands for wild type, EV stands for empty carrier; Figure 26 Phenotypic comparison between wild-type and transgenic CjAGL42 tobacco; Note: The AI ​​in the figure represents: wild type, empty vector, AGL42-9-1, AGL42-9-2, AGL42-10-2, AGL42-11-1, AGL42-11-3, AGL42-12-1, and AGL42-12-5. Detailed Implementation

[0012] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments: like Figure 1 As shown, experimental example: Experimental materials plant materials The Camellia chrysantha seeds used for EMS mutagenesis in this study consisted of 3000 seeds each from the original Camellia chrysantha species and the Camellia sasanqua cultivar "Little Rose," collected from the germplasm resource nursery of Southwest Forestry University in December 2022. A total of 254 plants (80 lines of the mutagenized Camellia chrysantha, 31 lines of Camellia sasanqua, and the wild type of Camellia chrysantha) were used as materials for molecular marker analysis. The Camellia chrysantha mutant Cj-EMS-79, screened by phenotypic observation and molecular marker technology, was used as material. Wild-type plants with consistent genetic background, growth conditions, and similar growth vigor as Cj-EMS-79 were selected as controls. Each sample was a single replicate, and each material was replicated four times. After sampling, the samples were stored at -80℃ for transcriptome sequencing. The tobacco variety used for genetic transformation was K326.

[0013] Vectors and strains The empty vector for gene overexpression in this study was pCAMBIA1300-35S-E9. The *Escherichia coli* strain used in this study was DH5α, and the *Agrobacterium tumefaciens* strain was EHA105.

[0014] Experimental reagents The experimental reagents used in this study were as follows: Ethyl methanesulfonate (EMS) was purchased from Hefei Bomei Biotechnology Co., Ltd.; CTAB (hexadecyltrimethylammonium bromide), mercaptoethanol, Tris (trichloroaminomethane), EDTA (ethylenediaminetetraacetic acid), isoamyl alcohol, and DL2000 Marker were all purchased from Beijing Dingguo Biotechnology Co., Ltd.; gene cloning reagents: 2×Hieff Canace® Gold PCR Master Mix high-fidelity enzyme premix (10149ES01, YEASEN), 2×EasyTaq® PCR SuperMix (AS111-11, TRAN); recombination ligation reagent: NovoRec® plus Onestep PCR Cloning Kit (NR005-01A, novoprotein); DNA Marker: DL5000 (3427A, TaKaRa); agarose: Agarose Regular (5260, TaKaRa); nucleic acid dye: Star Stain Red. Nucleic acid dye 10,000× (E109-01, GenStar); competent cells: DH5α (DL1001, Weidi Biotechnology); LB medium: tryptone (LP0042, OXOID), yeast extract (LP0021, OXOID), and NaCl (Shanghai Education); antibiotics: kanamycin (B25656, Shanghai Yuanye Biotechnology), rifampin (B25308, Shanghai Yuanye Biotechnology); gel extraction kit (DP209, Tiangen Biotechnology); plasmid mini-preparation kit (DP103, Tiangen Biotechnology); RNA extraction kit (DP441, Tiangen Biotechnology); cDNA synthesis kit (RR036A, TaKaRa); kanamycin sulfate, rifampin, hygromycin, cephalosporin, and ampicillin were all purchased from Beijing Coolplay Technology; 2* Rapid Taq Master Mix was purchased from Novizan Biotechnology; DL2000 DNA Maker was purchased from Beijing Qingke Biotechnology; 6-BA and NAA were purchased from Beijing Dingguo Changsheng Biotechnology.

[0015] Instruments used in the experiment The main instruments used in this study include: gene amplification instrument (Beijing Dongsheng Innovation Biotechnology, Beijing), ultra-clean workbench (Suzhou Purification Equipment Co., Ltd., Suzhou), constant temperature shaker (Shanghai Yiheng, Shanghai), Nanodrop2000 (Thermo Fisher Scientific, Shanghai), electronic analytical balance (METTLER TOLEDO, USA), ultra-low temperature freezer (Haier, Qingdao), pipette (DLAB, Beijing), Bio-Rad C1000 (Bio-Rad, USA), DYCP-32B agarose gel electrophoresis system (Beijing Liuyi, Beijing), and Alpha Imager HP gel imaging system (Protein Simple, USA).

[0016] Experimental methods EMS mutagenesis of Camellia sinensis in East China Explant pretreatment Mature and plump Camellia sinensis seeds from East China were harvested on sunny days. After harvesting, the seeds were treated at 4°C for 7 days to remove the outer seed coat, and then soaked in 40°C warm water for 24 hours to activate the hydrolytic enzymes in the seeds, accelerate the decomposition of stored substances, and provide energy and substrate for germination. Aseptic germination experiments could only be carried out after breaking seed dormancy.

[0017] Explant disinfection and induction After pre-soaking, the seeds were grouped and treated with 0.4%, 0.6%, and 0.8% EMS solutions, respectively, in the dark with shaking for 12 h. Termination and germination: The treated seeds were neutralized with 0.5% sodium thiosulfate, rinsed with running water for 2 h, and then disinfected with 2% sodium hypochlorite for 7–8 min on a clean bench. The material was then treated with 75% ethanol for 30 s, rinsed three times with sterile water, and all disinfection steps were repeated once more. The disinfected seeds were placed on filter paper to absorb excess moisture, and finally inoculated onto MS sugar-free medium for germination. 1000 seeds of each of the different concentrations of *Camellia sinensis* were inoculated, one seed per bottle of medium, and cultured under light in a culture room. After 60 days, the germination rate of *Camellia sinensis* seeds was calculated [Seed germination rate = (Number of germinated seeds / Number of inoculated seeds) × 100%].

[0018] Preparation of culture medium The basic culture medium used in this experiment was MS medium. MS stock solution needed to be prepared in advance. The MS stock solution contained 10 times the amount of macroelements, 100 times the amount of microelements, organic elements, and iron salts. The prepared MS stock solution needed to be stored at 4°C for later use. Based on experimental needs, using 1 L as the standard, the four stock solutions were measured and prepared in 100 mL, 10 mL, 10 mL, and 10 mL increments respectively to prepare MS medium. Sucrose was not required for the seed germination medium in this experiment; only 20 g of sucrose was needed for the rooting medium, and 30 g of sucrose was needed for the subculture medium. After the MS stock solution and sucrose were dissolved and brought to a fixed volume, plant hormones such as 6-BA, IAA, IBA, and NAA, or anti-browning agents such as PVP, required for each stage of plant growth and development, were added one by one. Finally, the pH was adjusted to the suitable acid-base environment for plant growth; generally, the pH of Camellia sinensis in East China is 5.6–5.8. Finally, 0.7% agar was added, and the mixture was autoclaved at 121°C for 20 min.

[0019] Table 1. Culture medium required for Camellia sinensis in East China Subsequent cultivation and transplanting After the mutagenized Camellia sinensis seeds germinated and grew into sterile seedlings, they were transferred to a subculture medium for subculture and proliferation. After stable growth, they were transferred to a rooting medium for further culture.

[0020] Select robust, well-developed rooted seedlings of Camellia chrysantha from East China for hardening-off transplanting. Before transplanting, the regenerated Camellia plants must first undergo hardening-off, requiring at least one week of natural light acclimatization to allow them to adapt to the outdoor temperature and humidity environment. Camellia chrysantha from East China has relatively high requirements for cultivation temperature and air humidity. Generally, in the early stages of transplanting, the cultivation temperature should be maintained at a constant indoor temperature of (25±2)°C, and the air humidity should be maintained at around 75% to 90%. After transplanting, the Camellia chrysantha from East China plants should be watered regularly. When the seedlings have grown new leaves and clearly differentiated new nodes, they should be transplanted into a greenhouse for cultivation. The survival rate should be counted after 30 days.

[0021] Mutant screening of Camellia sinensis in East China Phenotypic observation of mutants After the mutant M1 generation seedlings grew multiple cotyledons and roots, their phenotypic characteristics were observed and some indicators were measured.

[0022] Extraction of DNA from Camellia sinensis in East China Genome extraction of *Camellia sinensis* from East China was performed using the standard CTAB method with appropriate adjustments to obtain high-quality DNA. Main steps: (1) Take 1 g of vigorous Huadong Mountain tea leaves and grind them quickly into powder with liquid nitrogen, then put them into a 2 mL sterile centrifuge tube.

[0023] (2) Add 1 mL of extraction medium (Table 2), invert several times, centrifuge at 7000 rpm for 5 min, and remove the supernatant. Repeat step 2 twice with the precipitate.

[0024] (3) Add 1 mL of 3xCTAB (Table 2) and 20 μL of mercaptoethanol at 65℃ and mix well; keep warm at 65℃ for 1 h (mix several times in between), centrifuge at 7000 rpm for 10 min; take the supernatant into a sterile centrifuge tube.

[0025] (4) Add an equal volume of chloroform / isoamyl alcohol (24:1), gently shake in a spiral motion, centrifuge at 10,000 rpm for 10 min for about 15 min, and transfer the supernatant to a sterile centrifuge tube.

[0026] (5) Add 2 volumes of pre-cooled anhydrous ethanol, gently shake in a spiral motion, centrifuge at 8000 rpm for 5 min at 4°C, and discard the solution.

[0027] (6) Wash the precipitate twice with 75% ethanol for 15 min each time, and let it air dry naturally.

[0028] (7) Add 100 μL of sterile water to dissolve the DNA, and use 1.0% agarose gel electrophoresis and Nanodrop2000 to detect the DNA quality. Dilute with sterile water to 50-80 ng / μL and store at -20℃.

[0029] Table 2 Reagents used in the CTAB method 2.2.2.3 SCoT-PCR and CDDP-PCR reaction systems and procedures The SCoT reaction system of Camellia chrysantha was referenced (Qin Dongmei, 2021) and appropriately adjusted.

[0030] Table 3 SCoT reaction system (20 μL) Amplification program: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 50 s, annealing for 45 s (48℃, 54℃, 60℃), extension for 90 s, 38 cycles; 72℃ extension for 10 min; storage at 4℃.

[0031] The amplified products were separated by 2% agarose gel electrophoresis. After electrophoresis at 120 V for 60 min, they were placed on a gel imaging instrument for preliminary observation. Subsequently, polyacrylamide gel electrophoresis was used for clearer observation and photography. The same applies below.

[0032] Refer to the CDDP reaction system of camellia (Pan et al., 2023).

[0033] Table 4 CDDP reaction system (20 μL) Amplification program: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 50 s, annealing for 45 s (48℃, 54℃, 60℃), extension for 90 s, 38 cycles; 72℃ extension for 10 min; storage at 4℃.

[0034] Using WT as a template, 10 SCoT primers (Table 2-5) and 10 CDDP primers (Table 2-6) were screened using an optimized system. The SCoT primer sequences were referenced from Collard and Mackill (Collard and Mackill, 2009; Luo, 2012), and the CDDP primer sequences were referenced from Pan et al. (Pan et al., 2023). All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Primers with high polymorphism, stable reaction, and clear bands were selected for PCR amplification.

[0035] Table 5. Information on SCoT molecular marker primers Table 6. Information on CDDP molecular marker primers Transcriptome analysis of mutant Cj-EMS-79 cDNA library enrichment and transcriptome sequencing The entire Cj-EMS-79 M1 generation was sequenced. After extracting total RNA, the purity, concentration, and integrity of the RNA samples were assessed using the Nanodrop method. Once the requirements were met, a cDNA library was obtained through mRNA enrichment, cDNA first-strand synthesis, cDNA second-strand synthesis, cDNA purification, end repair, A-tailing, ligation of sequencing adapters, fragment size selection, and PCR enrichment for subsequent sequencing. High-throughput sequencing was performed using the Illunima HiSeq X-ten sequencing platform, with a read length of PE150.

[0036] 2.2.3.2 Screening and Functional Annotation of Differentially Expressed Genes The raw sequencing sequences were filtered to obtain Clean Data. Trinity and DEseq software were used to assemble and quantify the reads and perform differential expression analysis between sample groups. BLAST was used to align the genes with the GO and KEGG databases, perform gene functional annotation and enrichment analysis.

[0037] Data processing methods Statistical processing and graphing were performed using software such as Excel 2010 and R.

[0038] Cj-EMS-79 candidate gene cloning and expression vector construction RNA extraction and cDNA synthesis After rapidly grinding the sample in liquid nitrogen, pour the sample powder into a centrifuge tube containing 500 μL of lysis buffer SL, immediately vortex to mix, and centrifuge for 2 min. Collect the supernatant onto the filter column CS and centrifuge for 2 min. Collect the supernatant into a new RNase-Free centrifuge tube, slowly add 0.4 times the volume of the supernatant in anhydrous ethanol, mix well, and transfer to the adsorption column CR3. Centrifuge for 15 sec and discard the waste liquid. Add 350 μL of protein removal buffer RW1, centrifuge for 15 sec, and discard the waste liquid. Add 80 μL of DNase I working solution, incubate at room temperature for 15 min, add another 350 μL of protein removal buffer RW1, centrifuge for 15 sec, and discard the waste liquid. Add 500 μL of wash buffer RW to the adsorption column CR3, centrifuge for 15 sec, and discard the waste liquid. Repeat the previous step. Centrifuge for 2 min, place the adsorption column CR3 into a new RNase-Free centrifuge tube, add 50 μL of RNase-Free ddH2O dropwise to the center of the membrane, incubate at room temperature for 2 min, and centrifuge for 1 minute. The RNA solution was obtained after centrifugation at 12,000 rpm (~13,400 x g) throughout the process. Then, the components were added according to Table 6, cDNA synthesis was performed, the mixture was vortexed, and then briefly centrifuged.

[0039] Table 7 cDNA synthesis of CjSOC1, CjAGL42 and CjSVP Primer design Based on homologous recombination, primers are designed considering the insertion direction of the target fragment. Homologous sequences from both ends of the linearized vector are introduced into the 5' end of the forward and reverse amplification primers of the insert fragment, so that the 5' and 3' ends of the amplified insert fragment contain homologous sequences (15-20 bp, excluding restriction sites) that correspond to the ends of the linearized cloning vector.

[0040] Vector map and restriction enzyme sites The selected vector is pCAMBIA1300-35S-E9 ( Figure 1 The primers were digested with KpnI and PstI, and pCAMBIA1300-35S-E9 was used as the backbone. The upstream sequence added to the primers was: ACGGGGGACGAGCTCGGTACC; the downstream sequence added was: CTGCAGAGCTTTCGTTCGTAT.

[0041] Gene cloning system The primer sequences for each gene cloning are shown in Table 8. The gene cloning system was prepared by adding the components according to Table 9, vortexing, and briefly centrifuging. The PCR amplification program was as follows: 94℃ for 5 min; 94℃ for 30 sec; 58℃ for 30 sec; 72℃ for 1 min; 35 cycles; 72℃ for 10 min. After the PCR reaction was completed, electrophoresis was performed, and the gene fragments were recovered from the gel.

[0042] Table 8. Primer sequences for gene cloning Table 9. Gene cloning system of CjAGL42 Vector enzyme digestion system Add the components to the vector digestion system according to Table 10, vortex to mix, and centrifuge briefly; incubate at 37℃ for 15 min; incubate at 70℃ for 15 min; after the digestion system is completed, perform electrophoresis detection and recover large fragments from the gel.

[0043] Table 10 Vector Enzyme Digestion System Homologous recombination system Add the components to the homologous recombination system according to Table 11, shake to mix, and centrifuge briefly; incubate at 50℃ for 20 min; after homologous recombination is completed, add the reaction solution to 100 μL of competent cells, heat shock transformation, spread on solid LB plates containing kanamycin, and incubate at 37℃ for 12 h.

[0044] Table 11 Homologous Recombination System Activation of Escherichia coli The formulation of LB medium containing kanamycin (0.05 mg / mL) is shown in Table 12. Take 3 mL of LB liquid culture medium in a centrifuge tube; add 100 μL of Escherichia coli culture; incubate at 37℃, 200 r / min, and shake for 9–12 h; streak the cultured culture onto the surface of the corresponding solid medium; after the culture is absorbed by the medium, invert the plate and incubate at 37℃ for 12–24 h to allow colonies to appear; pick a single colony and place it in a PCR tube containing 20 μL of sterile water, then mix thoroughly by pipetting.

[0045] Table 12 LB medium formulation Escherichia coli PCR detection and plasmid extraction Add the components according to Table 13, vortex to mix, and centrifuge briefly; PCR amplification program: 94℃ 3 min; 94℃ 30 sec; 58℃ 30 sec; 72℃ 2 min; 30 cycles; 72℃ 10 min. After the PCR reaction is complete, perform electrophoresis and extract plasmids. Primer sequences are shown in Table 8.

[0046] Table 13 PCR detection of Escherichia coli bacterial culture Cj-EMS-79 candidate gene tobacco genetic transformation Activation of competent cells Take competent cells frozen at -80℃, thaw them in an ice bath, add 10 μL of the plasmid to be transformed, and gently vortex to mix. Perform the following treatments in sequence: ice bath for 15 min, liquid nitrogen quenching for 5 min, 37°C water bath for 5 min, ice bath for 5 min; add 900 μL of antibiotic-free LB medium, and incubate at 28℃ and 200 rpm for 2 h with shaking. Centrifuge at 6000 rpm for 1 min to collect the bacterial cells, retain 100 μL of supernatant to resuspend the bacterial cells, and spread them on LB plates containing specific antibiotics (50 μg / mL Kan: 28℃ inverted culture for 48 h; 50 μg / mL Kan + 20 μg / mL Rif: 60 h; 50 μg / mL Rif: 72-90 h); pick single colonies for PCR identification, and inoculate positive strains into 1 mL of LB liquid medium containing Kan / Rif, and incubate at 28℃ and 200 rpm for 3 days. Mix 500 μL of bacterial culture with an equal volume of 40% glycerol and store at -80°C for a long period of time.

[0047] Preparation of sterile vaccines Select plump, mature tobacco seeds, disinfect them with 1.5% sodium hypochlorite solution for 15 min, then with 75% alcohol for 45 sec, rinse four times with sterile water, and inoculate them onto sugar-free MS solid medium. After one week of dark incubation at 25℃, transfer them to light incubation. Once the sterile seedlings have developed 3-5 cotyledons, transfer them to MS solid medium containing 3% sucrose for later use.

[0048] Agrobacterium propagation, tobacco infection and co-culture Glyceryl bacteria were streaked on LB solid medium (containing 100 mg / L kanamycin + 50 mg / L rifampin) and incubated at 28°C for 2 days. Single colonies were picked and inoculated onto LB liquid medium (containing 100 mg / L kanamycin + 50 mg / L rifampin) to prepare an Agrobacterium MS resuspension with OD600=0.4. Leaves from 4-6 week old sterile tobacco seedlings were selected and cut into 2-3 cm leaf discs in a clean bench to serve as recipient materials for genetic transformation. The leaf discs were immersed in the Agrobacterium resuspension for 7-10 minutes, and after aspirating the bacterial suspension, they were spread evenly on the surface of the co-culture medium and incubated in the dark at 25°C for 48 hours. The required culture medium formulations are shown in Table 14.

[0049] Table 14 Culture medium composition and dosage Bud differentiation induction, rooting and screening of resistant plants After co-culturing, the leaves were transferred to a budding medium to induce bud formation. This stage was maintained at 25℃ and 16 hours of light for 2-3 weeks, with the medium changed every 2 weeks. Untransformed cells, lacking resistance genes, gradually browned and died, while transformed cells differentiated into green resistant callus tissue. When 1-2 cm adventitious buds sprouted from the callus surface, they were separated and transferred to a seedling strengthening medium for further culture to promote robust bud growth. After developing into resistant seedlings, they were transferred to a rooting medium to induce root development, and fully regenerated plants could be obtained in about 2 weeks.

[0050] PCR testing Genomic DNA extracted using the CTAB method was used as a template for PCR detection to identify positive seedlings. The PCR amplification system is shown in Table 15. The detection primers were hygromycin phosphotransferases, with the upstream sequence being: CGTCTGTCGAGAAGTTTCTG and the downstream sequence being: GCGATACTTCTTCGCCAGAT.

[0051] Table 15 PCR Amplification System qRT-PCR detection of target gene in transgenic tobacco plants Empty vector and transgenic tobacco leaves grown for approximately 8 weeks were used as experimental materials. Plant RNA was extracted after rapid grinding with liquid nitrogen, and cDNA was reverse transcribed. SYBR Green real-time quantitative PCR was performed based on cDNA from different tobacco leaves, using NtGAPDH as an internal reference gene. The upstream sequence was: TCACGGATTTGGTCGTATTG, and the downstream sequence was: GATGGTGATGGGTTTCCCGT. A 2... -ΔΔCt Calculate the relative expression level.

[0052] Results and Analysis EMS induction of aseptic seeds of Camellia sinensis in East China Seed germination results of mutagenesis in Camellia sinensis var. huadongensis This study combined tissue culture techniques with a mixed culture method involving the addition of mutagen to the culture medium to induce mutations in Camellia dongnanensis seeds. 1000 Camellia dongnanensis seeds treated with different concentrations of EMS (0.4%, 0.6%, and 0.8%) were inoculated into sugar-free MS medium. Aseptic germination experiments were conducted on the seeds, and the germination rate was recorded after 60 days of light cultivation. The results showed that the germination rate of Camellia dongnanensis seeds treated with 0.8% EMS was approximately 95%, reaching the half-lethal concentration, with a mutation rate of 1.33%, which was determined to be the optimal treatment concentration for Camellia dongnanensis seeds. Furthermore, the induced aseptic seedlings of Camellia dongnanensis showed good growth. Figure 2 ).

[0053] Results of mutagenesis of sterile seedlings Aseptic Camellia seedlings were subcultured using a subculture medium. After 90 days of subculture, observations showed that the nodes of the aseptic Camellia seedlings continuously increased and the internodes gradually elongated (Figure 3), with a proliferation rate reaching 88.33%. After multiple subcultures, the total number of candidate mutant Camellia lines in East China reached 800, providing sufficient material for subsequent experiments. Figure 4 ).

[0054] Adventitious root induction experiment of camellia seedlings in East China Adventitious roots were induced in camellia seedlings using a rooting medium. After 120 days of rooting induction on the medium, the seedlings showed good rooting, with a rooting rate of 46.67%. Figure 5 ).

[0055] Results of hardening off and transplanting A transplanting substrate of humus, perlite, and vermiculite in a 1:1:1 ratio was used for the field transplanting of regenerated Camellia chrysantha plants. The survival rate was 66.67% after 30 days. Due to the slow growth of the transplanted Camellia chrysantha plants, no new leaves were clearly differentiated, and phenotypic changes such as internode spacing and plant height remained largely consistent with those before transplanting. Figure 6 ).

[0056] Screening of EMS mutants of Camellia sinensis in East China Phenotypic observation of Camellia mutants in East China Some indicators of the East China Camellia mutant showed significant differences from those of the wild type East China Camellia.

[0057] Internode length is a core parameter in plant stem morphology, directly affecting plant height, branching pattern, and resource allocation strategy. Shorter internodes enhance lodging resistance by lowering the plant's center of gravity, while also reducing the length of xylem vessels to optimize water transport efficiency. Figure 7This data presents internode spacing, number of nodes, and plant height measurements from six different mutant strains of Camellia chrysantha from East China. The internode spacing of all six mutant strains was significantly reduced compared to the wild type, with an average internode spacing of 0.55 cm, 72.5% shorter than the average internode spacing of the wild type. These results indicate that the shortened internodes in the six mutant strains of Camellia chrysantha from East China reduce transpiration water consumption, which is beneficial for the plant's resistance to high-temperature stress and also helps to combat drought stress.

[0058] Leaf margin serrations are a morphological feature of leaf margin differentiation. High-density serrations enhance CO2 diffusion efficiency by increasing the density of stomatal distribution at the leaf margin. The serrated structure also improves the leaf's tear resistance through a stress dispersion mechanism. A comparative study of leaf morphology between the East China Camellia mutant and wild-type plants showed significant phenotypic differences in the morphological feature of leaf serration density, while no statistically significant changes were detected in leaf size parameters. Figure 8 Observational analysis revealed that the wild-type plants exhibited a typical sparse distribution pattern of leaf margin serrations, with an average of (8.2±0.6) serrations per unit leaf margin length and a mean serration spacing of (1.22±0.15) mm. In contrast, the corresponding parameters in the EMS-mutated mutants increased to (14.7±0.8) and (0.68±0.09) mm, respectively. One-way ANOVA confirmed that the difference in serration density was highly significant (P<0.001). Notably, leaf morphometric data showed no significant differences between groups in leaf length and maximum leaf width among the mutants. This specific phenotypic variation suggests that EMS mutagenesis may preferentially affect the genetic regulatory network related to leaf margin development in East China Mountain tea, particularly with a higher likelihood of base substitutions in genes involved in the activity of serration primordia meristems. The acquisition of such mutants provides an important material basis for elucidating the evolution of plant leaf morphological diversity and improving horticultural traits.

[0059] Since the main function of roots is to absorb water and inorganic salts, a strong root system osmotic regulation capacity can not only increase the water absorption capacity of the plant's roots, but also improve the survival ability and recovery resistance of the roots under stress. Figure 9 The data shows the root lengths of wild-type and mutant Camellia chinensis in East China before transplanting, revealing significant differences between individual mutant plants and the wild type. Figure 10 The text presents a comparison of root length between some mutant plants and their control plants. Among them, some East China Camellia mutants showed significantly increased root length, with the mutant plants of longest to shortest root length being Cj-EMS-77. Cj-EMS-69 Cj-EMS-24 Cj-EMS-20 Cj-EMS-41 Among the Cj-EMS-79 mutants, Cj-EMS-77 had the longest root, measuring 13.6 cm, which is 60% longer than the WT root. Some East China Camellia mutants showed an increase in the number of roots measured, with significant differences from the WT mutant. The root lengths were, in descending order, Cj-EMS-79. Cj-EMS-41 Cj-EMS-24 Cj-EMS-20 Among the Cj-EMS-77 mutants, Cj-EMS-79 had the most lateral roots, with 29, which is 93.3% more than the WT mutant. These results indicate that, in terms of root length, the mutant with the greatest increase is Cj-EMS-77, and in terms of the number of lateral roots, the mutant with the greatest increase is Cj-EMS-79.

[0060] Physiological parameters of wild-type and mutant strain Cj-EMS-79 of Camellia sinensis in East China The activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) in wild-type (WT) and mutant line EMS-79 of Camellia sinensis from East China were measured. Regarding SOD activity, the mean value of the wild-type was 111942.959 U / g, showing high enzyme activity with relatively small fluctuations. However, the SOD activity of the mutant Cj-EMS-79 was significantly reduced, with a mean value of 84301.441 U / g, a decrease of approximately 20%-40% compared to the wild-type, and the variation was greater, indicating that the mutation may have affected the stability of SOD. Figure 11 A). POD activity showed the opposite trend, with wild-type showing a lower value (3222 U / g), while EMS-79 showed a significantly increased POD activity to 9400 U / g, an increase of 2-4 times, suggesting that the mutation may have activated the peroxidase defense system. Figure 11 B). The most significant change was observed in CAT activity. The wild-type maintained a low level of only 185.1 U / g, while the mutant's CAT activity increased dramatically to 1749.9 U / g, an increase of nearly 10-fold, indicating that the EMS-79 mutation may respond to oxidative stress by enhancing hydrogen peroxide scavenging capacity. Figure 11 (C) In summary, this mutation leads to a reprogramming of the antioxidant enzyme system. The decreased SOD activity may result in the accumulation of superoxide anions, while the synergistic increase in POD and CAT activities may constitute a compensatory mechanism, jointly maintaining cellular redox homeostasis. This change in physiological characteristics provides important clues for elucidating the stress resistance mechanism of this mutant.

[0061] Analysis of the effect of modified CTAB method on DNA extraction from Camellia sinensis in East China In this study, DNA extracted using a modified CTAB method was a colorless flocculent precipitate. The extracted total DNA was detected by agarose gel electrophoresis and nucleic acid / protein analysis. Figure 12 As can be seen, the DNA bands are clear, with an average 260 / 280 ratio of 1.77. This indicates that the DNA extracted by this method has good purity, the experimental results are stable, and it can meet the requirements for amplification of both molecular markers.

[0062] SCoT and CDDP molecular marker analysis of Camellia sinensis from East China This study used a multi-index evaluation system to select three primers with excellent amplification efficiency from the SCoT and CDDP primer sets respectively. Figure 13 Then, the best primers with the most and clearest bands were selected, and the DNA from the Camellia sinensis samples from East China was amplified and analyzed using dual molecular marker technology (SCoT-PCR and CDDP-PCR). Electrophoresis patterns are shown below. Figure 14 , Figure 15 Analysis using SCoT and CDDP molecular markers revealed numerous specific bands, such as Cj-EMS-9, Cj-EMS-10, Cj-EMS-24, and Cj-EMS-79, in the amplification results of SCoT 1, SCoT 2, and CDDP 14 primers. These results demonstrate that EMS mutagenesis treatment has induced structural variations at the genome level in Camellia sinensis var. chinensis.

[0063] Transcriptome analysis of mutant Cj-EMS-79 cDNA library construction quality control tests and transcriptome sequencing results The quality and quantity of the starting template are key factors determining the success of library construction. RNA quality control results showed that, for a total of 8 samples (2 materials, 4 biological replicates), the average brightness ratio of 28S rRNA to 18S rRNA was 1.97, the RNA concentration ranged from 320.8 to 461.3 ng / μL, the average OD260 / OD280 ratio was 2.01, and the average OD260 / OD280 ratio was 1.69. The RNA concentration, quality, and integrity all met the requirements for library construction. Approximately 55.01 Gb of clean data was obtained from the 8 samples, with each sample achieving a clean data value exceeding 6.41 Gb, and the Q30 base percentage exceeding 96.3%.

[0064] Differential gene expression analysis Differential expression analysis of samples was performed using DEseq software, which is suitable for biological reproducibility. During the analysis, FDR ≤ 0.01 and FC = 8 were used as screening criteria to obtain the differentially expressed gene set between *Camellia sinensis* and EMS-79. A total of 9171 differentially expressed genes were screened, of which 3698 genes were upregulated and 5473 genes were downregulated. Figure 16 The expression levels of other genes showed no significant difference.

[0065] To verify the reliability of RNA-seq data, eight differentially expressed genes were selected for qRT-PCR detection. The results showed that the expression trends of each gene in qRT-PCR were consistent with the transcriptome results, indicating that the RNA-seq results were accurate and reliable. Figure 17 ).

[0066] KEGG enrichment analysis of differentially expressed genes KEGG enrichment results showed that among the top 20 significantly enriched pathways in the comparison between Camellia huadongensis and its mutant EMS-79, the ribosome metabolic pathway showed the most significant difference, involving extensive changes in the expression of genes related to ribosome protein synthesis and translation regulation. This suggests that the mutant may have undergone important changes in protein synthesis efficiency. Enrichment of starch and sugar metabolism pathways was observed in key processes such as glycolysis, gluconeogenesis, and starch degradation, indicating that the mutant's carbon source utilization and energy metabolism pathways may have undergone adaptive adjustments. Significant enrichment of plant hormone signaling pathways further revealed potential changes in growth regulation in the mutant, which may affect the plant's growth and development patterns or stress response capabilities. Furthermore, enrichment of the flavonoid biosynthesis pathway suggests significant differences in secondary metabolism in the mutant, which may be closely related to changes in flower color variation or antioxidant capacity. Figure 18 ).

[0067] These findings suggest that EMS mutagenesis may disrupt key metabolic networks and signal transduction systems in Camellia sinensis, leading to significant physiological and morphological variations in the mutant Cj-EMS-79. Further functional validation of key regulatory genes in these pathways will be conducted to elucidate the molecular mechanisms underlying the mutant phenotype and its potential ornamental or practical value.

[0068] qRT-PCR results of candidate genes Based on transcriptome KEGG enrichment analysis and FPKM value analysis measuring transcript expression levels, flowering-related genes CjSOC1, CjSVP, and CjAGL42 were selected from significantly enriched pathways, and their expression levels were analyzed using qRT-PCR. The results showed consistent results from both sequencing gene expression quantification and qRT-PCR analysis: gene expression levels were significantly higher in wild-type cells than in EMS-79, while expression levels of these three genes were extremely low in EMS-79.

[0069] MADS-Box gene family analysis The MADS-box gene family is a highly conserved transcription factor family in eukaryotes. Its name comes from the initials of four representative genes from yeast (MCM1), Arabidopsis thaliana (AGAMOUS), snapdragons (DEFICIENS), and humans (SRF). Members of this family regulate developmental processes through unique combinations of domains, playing a central role, particularly in plant floral organ formation, fruit development, and animal cell differentiation.

[0070] Based on phylogenetic and structural differences, the MADS-box gene family is divided into two main categories: Type I and Type II. Type I genes contain only the MADS domain and a short C-terminus, lacking the K domain. They are further divided into three subclasses: Mα, Mβ, and Mγ, and are mainly involved in reproductive processes such as ovule and seed development. Type II (also known as MIKC type) genes contain the complete MADS (M), intermediate region (I), K domain (K), and C-terminus (C). MIKCC type genes are the core regulators of plant floral organ development. Analysis of the conserved amino acid sequences of CjSOC1, CjAGL42, and CjSVP genes using SMART online software revealed that all three genes contain the conserved MADS domain, located at amino acids 1-60. Figure 19 The SOC1 gene has coiled regions at amino acids 75-112 and 1411-175, and a low-complexity region at amino acids 121-136; the CjAGL42 gene has a coiled region at amino acids 145-173, and a low-complexity region at amino acids 189-196; the CjSVP gene and the CjAGL42 genes screened in this study are all Type II, which have a positive effect on the regulation of floral organs.

[0071] MADS-Box gene family functional prediction Initial functional studies of the MADS-box gene family were based on the model plant Arabidopsis thaliana, which was studied from the formation of floral organs in Arabidopsis thaliana. Later, with the in-depth research on the genomes and large-scale transcriptomes of other plants, it was found that the MADS-box gene family not only affects flowering, but also plays an important role in the formation of floral organs, seed development and stress regulation (Table 16).

[0072] Table 16 Overview of MADS-box gene functions In Arabidopsis thaliana, the SOC1 and SVP genes significantly influence flowering time (Robert et al., 2024) and play key roles in the pathway. Figure 20 ).

[0073] SSR detection and analysis Analysis of 126,132 unigenes using the MISA software identified 30,128 SSR sites, with an SSR occurrence frequency (ratio of the number of SSRs found to the number of search sequences) of 23.89%. Among these, 19,345 unigenes contained more than one SSR site, and 4,855 unigenes contained compound SSRs. When SSR sites contain lower-level motifs (such as dinucleotide or trinucleotide repeats), these sites often exhibit higher polymorphism potential. Among the SSR types, single nucleotide repeats numbered 10,405, accounting for 34.54% of the total; dinucleotide repeats were the most numerous, with 14,011, accounting for 46.5%; trinucleotide repeats numbered 4,607 SSR sites, accounting for 15.29%; while tetranucleotide, pentanucleotide, and hexanucleotide repeats were less common, with 430, 251, and 424 SSR sites respectively, accounting for 1.43%, 0.83%, and 1.41% of the total. Figure 21 A).

[0074] The distribution of SSR motif repeat numbers in transcriptome sequences reveals that SSR site polymorphism is mainly caused by variations in motif repeat numbers. The repeat numbers in transcriptome SSRs are primarily concentrated between 6 and 15, accounting for 89.67% of the total. Specifically, SSR sites with repeat numbers of 1-5 account for 2964 (9.84%), SSR sites with repeat numbers of 6-10 account for 14956 (49.65%), and SSR sites with repeat numbers of 11-15 account for 9100 (30.21%). Repeat numbers exceeding 15 are considered higher repeat numbers, with 3105 SSR sites accounting for 10.31% of the total. Figure 21 B).

[0075] Significant functional enrichment analysis of unigenes containing differentially expressed SSRs in the GO database revealed 40,499 involved in three major functional processes: biological, molecular, and cellular. Among biological processes, 288 metabolic processes showed significant differences, including biological regulation, biological process control, and cellular process regulation. Among molecular functional processes, 86 metabolic processes showed significant differences, including DNA-binding transcription factor activity, transcription factor activity, and RNA polymerase II. Among cellular component processes, 67 metabolic processes showed significant differences, primarily in the nuclear pathway. Figure 21 C).

[0076] Significant functional enrichment analysis of SSR-differentially expressed unigenes in the KEGG database revealed that 3197 unigenes were enriched in 136 metabolic pathways, with five pathways—plant hormone signal transduction, circadian rhythm pathway, MAPK signaling pathway, thiamine metabolism pathway, and diterpenoid biosynthesis—being significantly enriched (P<0.05). Specifically, the plant hormone signal transduction pathway was enriched with 131 unigenes at SSR loci, including upregulated enzymes or transcription factors such as PP2C (serine / threonine protein phosphatase), BAK1 (plant receptor kinase), and TCH4 (xyglucan transglycosylase / hydrolase protein). The plant circadian rhythm pathway was enriched with 23 unigenes at SSR loci, such as gigantea, FT (protein flowering locus), CO (zinc finger protein constans), and LHY (MYB-related transcription factor LHY), all of which directly or indirectly regulate flowering time in plants. The MAPK signaling pathway was enriched with unigens at 69 SSR sites, with significant upregulation of MKK1 / 2, MAPKKK17 / 18, and ERF1. The thiamine metabolic pathway was enriched with unigens at 19 SSR sites, including upregulated expression of enzymes such as thiazole biosynthetic enzyme, nucleoside triphosphatase, and adenosine kinase 4. The diterpenoid biosynthetic pathway was enriched with unigens at 10 SSR sites, with upregulated expression of gibberellin 20 oxidase, gibberellin 2-β-dioxidase, and tartaric acid oxidase. Figure 21 D). The above results indicate that changes in the unigene at the SSR site may regulate the changes in mutant 79 plants.

[0077] Candidate gene cloning, expression vector construction, and genetic transformation of tobacco. Candidate gene sequence cloning and analysis Using the Cj-EMS-79 mutant of Camellia sinensis from East China as material, candidate genes related to flowering time regulation were screened based on its transcriptome data. The obtained gene fragments were used as probes for BLAST homology comparison with the NCBI database. The gene sequences with the highest homology were screened and identified by open reading frames (CDS). Based on the comparison, the target gene was finally named CjAGL42. Validation by primer design and sequence analysis confirmed that the lengths of the amplified gene fragments were consistent with the bioinformatics predictions. Figure 22 A).

[0078] Escherichia coli PCR detection After activation and amplification by *E. coli*, white patches were screened for PCR verification. The results showed that the amplification products of positive transformants of the target gene exhibited the correct characteristic bands. Figure 22B), successful confirmation of target fragment insertion. The fragment length perfectly matches the theoretical design value, indicating that the clone screening process is effective.

[0079] Tobacco genetic transformation like Figure 23 The process of tobacco genetic transformation is shown. Note: Figure A shows callus growth on transgenic tobacco leaves, Figure B shows adventitious buds growing on the callus, Figure C shows adventitious buds being cut off and transferred to a seedling culture medium, Figures D and F show complete plants of CjSOC1, CjAGL42 and CjSVP respectively, Figure G shows wild-type tobacco, and Figure H shows a flowering plant of CjAGL42.

[0080] Throughout the entire process of plant genetic transformation, the time and conditions of pre-culture and co-culture, bacterial concentration and infection time, and bud differentiation conditions all affect the transformation efficiency. In this study, tobacco K326 leaves were used as explants, and Agrobacterium GV3101 was selected as the mediator. The bacterial concentration was OD600=0.4, and the infection time was 7-10 min. The pre-culture medium and co-culture medium were MS solid medium. Callus tissue could grow from tobacco leaves within one to two weeks. Compared with the wild type, CjAGL42 plants underwent flower bud differentiation about 4-6 weeks earlier, and flower buds growing from axillary buds could directly differentiate and flower. Figure 23 H).

[0081] PCR-positive plants As can be seen from the electrophoresis image, some transgenic positive seedlings obtained bands of the same size as the target gene, and multiple positive plants were obtained for each gene. Figure 24 This provides preliminary evidence that the target gene has been introduced into the plant genome.

[0082] Quantitative fluorescence detection of Cj-EMS-79 candidate gene resistance lines qPCR was performed on transgenic lines with a large number of offspring. The method for extracting RNA from transgenic tobacco leaves is described in 5.1.3. The qPCR results showed that the relative expression levels of all three genes in the positive lines were significantly higher than those in the wild type and the empty vector. The positive lines for the AGL42 gene showed the highest relative expression level, and the expression levels of all five lines were significantly higher than those in the wild type and the empty vector. Figure 25 Among them, CjAGL42-11 showed the highest relative expression level of the CjAGL42 gene, approximately 2500 times that of the wild-type and empty vector. Relative quantitative fluorescence detection results of these CjAGL42 overexpression vector resistant lines showed that the overexpression vector stably integrated into the transgenic plants and efficiently drove the expression of the exogenous gene. These results provide a reliable genetic basis for further investigation into the biological function and regulatory network of the target gene in tobacco. Subsequent phenotypic analysis will reveal the mechanism by which its overexpression affects plant growth and development.

[0083] Hardening-off and phenotypic observation of transgenic tobacco lines Relative quantitative fluorescence expression analysis of transgenic tobacco overexpression lines revealed that the relative expression levels of CjSOC1, CjAGL42, and CjSVP genes in the resistant lines were significantly different from those in the wild type. Therefore, the CjSOC1, CjAGL42, and CjSVP genes have been successfully transferred into the plant, and transgenic tobacco materials have been successfully obtained.

[0084] The obtained transgenic tobacco materials and wild-type plants used as concurrent controls underwent hardening-off culture and were carefully managed. Phenotypic observation was conducted during the aseptic subculturing and hardening-off processes of the transgenic tobacco materials. After 8 weeks of culture, the CjSOC1 and CjSVP gene overexpression lines showed no significant phenotypic changes compared to the wild-type and empty vector lines, and no signs of reproductive growth were observed. However, among the CjAGL42 gene overexpression lines, CjAGL42-11, CjAGL42-9, CjAGL42-12, and CjAGL42-10 all showed significant phenotypic differences compared to the wild-type, exhibiting a significant early flowering phenotype. Compared to the wild-type plants, which maintained vegetative growth under tissue culture conditions (showing no signs of reproductive development after 8 weeks of culture), the transgenic lines formed visible flower primordia at the stem apical meristem after 4 weeks of culture. By the 5th week, 67% of the lines had completed flower bud differentiation and formed complete flower buds, and the flower buds at the axillary buds could directly flower. Figure 26 It is worth noting that this phenomenon of advanced reproductive growth has a gene dosage effect—the flower buds of high-expression lines appear an average of 3.2 days earlier than those of low-expression lines.

[0085] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions conceived without inventive effort should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.

Claims

1. A CjAGL42 gene of Camellia sinensis from East China, characterized in that, Its nucleotide sequence is shown in SEQ ID No.

1.

2. The gene according to claim 1, characterized in that, Its amino acid sequence is shown in SEQ ID No.

2.

3. A recombinant vector based on the gene described in claim 1.

4. The application of the gene described in claim 1 in regulating the flowering period of plants.

5. The application of the gene described in claim 1 in the breeding of early-flowering tobacco varieties.

Images