InDel marker fingerprint of wild dictyophora rubrovolvata strain, construction method and application

By constructing an InDel marker fingerprint of the *Dictyophora indicum* strain, the problem of identifying wild *Dictyophora indicum* strains was solved, achieving efficient and accurate strain identification and specific differentiation, and promoting the protection and industrial application of the 'GA1' strain.

CN122168788APending Publication Date: 2026-06-09SHANGHAI ACAD OF AGRI SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI ACAD OF AGRI SCI
Filing Date
2026-03-30
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing technologies are unable to efficiently and accurately identify wild *Dictyophora indicum* strains, especially the 'GA1' strain from Anshun, Guizhou, which affects its conservation and industrial development.

Method used

InDel-labeled fingerprints of wild *Dictyophora indicum* strains were constructed. Allelic fragments were amplified using 10 pairs of InDel-labeled primers and detected by agarose gel electrophoresis to form a specific fingerprint for rapid identification and specific differentiation of the strains.

Benefits of technology

This enables accurate identification of the 'GA1' strain, improves identification efficiency, reduces the risk of strain confusion, and supports the protection of germplasm resources and industrial development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168788A_ABST
    Figure CN122168788A_ABST
Patent Text Reader

Abstract

The application discloses a kind of InDel marker fingerprint of wild Phyllostachys annamica strain, belong to red-to bamboo cane strain detection technical field, solve the problem that existing technical means cannot accurately identify wild red-to bamboo cane strain, the construction of the InDel marker fingerprint of the wild red-to bamboo cane is by genome DNA extraction, construct amplification system and amplify genome DNA, and the electrophoresis detection of amplification product, to obtain the InDel marker fingerprint of red-to bamboo cane strain, this fingerprint is used as standard atlas, the electrophoresis band in atlas is marked as 1; Lower band is marked as-1; Two bands are marked as 2;The InDel marker fingerprint of the wild red-to bamboo cane strain obtained by the above numbering step is-1, 2, 2, 2, -1, 1, -1, 1, 2, 2, subsequent unknown red-to bamboo cane strain is compared by constructing fingerprint, and the obtained fingerprint is compared with standard atlas.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of detection technology for *Dictyophora indicum* strains, specifically relating to an InDel-labeled fingerprint spectrum, construction method, and application of a wild *Dictyophora indicum* strain. Background Technology

[0002] Red-topped bamboo fungus is a rare and precious large edible fungus in my country, possessing both nutritional and medicinal value, with broad application and economic prospects. Due to factors such as origin and growth environment, different strains of red-topped bamboo fungus exhibit significant genetic and agronomical differentiation, resulting in various varieties. These varieties differ in growth conditions, growth cycle, and mature size. The unique ecological conditions of Anshun, Guizhou, have nurtured superior wild red-topped bamboo fungus strains. A superior strain collected and screened from the wild in Anshun, Guizhou, possesses excellent commercial value and is suitable for local large-scale cultivation; it has been named strain 'GA1' and has extremely high development and utilization value.

[0003] Existing technologies cannot efficiently and accurately identify various wild *Dictyophora indicum* strains, nor can they accurately determine whether the current wild *Dictyophora indicum* is the desired 'GA1' strain. This hinders the large-scale local cultivation of the strain and affects the protection and industrial development of the existing 'GA1' strain.

[0004] Therefore, developing a method for constructing fingerprint profiles of specific wild *Dictyophora indicum* strains and applying it to the specific identification of *Dictyophora indicum* strains is of great practical significance and application value for protecting germplasm resources, standardizing the strain market, and promoting high-quality development of the industry. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the core objective of this invention is to provide an InDel-marked fingerprint spectrum of wild *Dictyophora indicum*, its construction method, and its application. This solves the problem of the inability to accurately and efficiently identify *Dictyophora indicum* strains in existing technologies, enabling rapid identification and specific differentiation of the strain, and providing technical support for its germplasm resource protection, introduction and cultivation, and industrial development.

[0006] An InDel-labeled fingerprint of a wild *Dictyophora indicum* strain was obtained by amplifying allelic fragments using 10 pairs of InDel-labeled primers. This fingerprint was generated by numbering the allelic fragments, and the specific numbering steps are as follows: In the electrophoretic bands of the pattern, the upper band is marked as 1; the lower band is marked as -1; and two bands are marked as 2. The InDel-labeled fingerprint spectrum of the wild *Dictyophora indicum* strain obtained through the above numbering steps is -1, 2, 2, 2, -1, 1, -1, 1, 2, 2.

[0007] As a preferred embodiment of the present invention, the lengths of the allelic fragments of the *Dictyophora indicum* strain are as follows: 128bp, 179bp and 229bp, 203bp and 242bp, 160bp and 197bp, 119bp, 210bp, 119bp, 259bp, 153bp and 210bp, 113bp and 145bp.

[0008] As a preferred embodiment of the present invention, the sequences of the 10 pairs of InDel-labeled primers are as follows: Lefp_id001: Forward primer: TAGATCGCCGCACTCATCAC Reverse primer: TCAGACAAGGAGGAATGAGACA Lefp_id002: Forward primer: CGTCAGCGATACGACCTCAA Reverse primer: GCATACGAGCGGCACAAAG Lefp_id003: Forward primer: GCGAAAGGAAACTGGCCAAC Reverse primer: CAAGGTGCTCCGGAGAACAA Lefp_id004: Forward primer: ATGCGTTAGGGGTCTGTGGA Reverse primer: GATTCGCGTCTTTGGCACTG Lefp_id005: Forward primer: ACACCCGACGAAAACGAGAA Reverse primer: TGACCAAGCACCATCTCACC Lefp_id006: Forward primer: GGGTGGGTAACTAAGCGTGT Reverse primer: ACCGGTCTACCTTCCTTTAGTG Lefp_id007: Forward primer: TCGTCTTACAGCGTGGGAAC Reverse primer: GGTGAAATCCCCAGCAGGT Lefp_id008: Forward primer: AGACCGATCCTCTTCGCTGA Reverse primer: TAAGGATGGCGTGCTTCTCC Lefp_id009: Forward primer: TTCCGCCATTCCTGATACGG Reverse primer: CGTGACCGCATCGTAAACTC Lefp_id0010: Forward primer: CACGGTTATCGCCTCCTGAT Reverse primer: AACTGCCACCCCCTTGTTAA.

[0009] A method for constructing an InDel-labeled fingerprint of a wild-type *Dictyophora indicum* strain includes the following steps: Step 1: Take the dried mycelium of the *Dictyophora indicum* strain and extract the genomic DNA of the strain; Step 2: Construct the amplification system and amplify the genomic DNA from Step 1; Step 3: The amplification products from Step 2 are subjected to agarose gel electrophoresis. A D500 bp DNA ladder is used as the electrophoresis control. After electrophoresis, a gel imaging device is used to take pictures to obtain the InDel-labeled fingerprint of the *Dictyophora indica* strain.

[0010] As a preferred embodiment of the present invention, the amplification system is as follows: 2×Es Premix Taq TM 10 μL, 2 μL of genomic DNA from step one, and 2 μL of any one pair of InDel-labeled primers from the 10 pairs of InDel-labeled primers, with 1 μL of each of the forward and reverse primers; the remainder is ddH2O.

[0011] As a preferred embodiment of the present invention, the sequences of the 10 pairs of InDel-labeled primers are as follows: Lefp_id001: Forward primer: TAGATCGCCGCACTCATCAC Reverse primer: TCAGACAAGGAGGAATGAGACA Lefp_id002: Forward primer: CGTCAGCGATACGACCTCAA Reverse primer: GCATACGAGCGGCACAAAG Lefp_id003: Forward primer: GCGAAAGGAAACTGGCCAAC Reverse primer: CAAGGTGCTCCGGAGAACAA Lefp_id004: Forward primer: ATGCGTTAGGGGTCTGTGGA Reverse primer: GATTCGCGTCTTTGGCACTG Lefp_id005: Forward primer: ACACCCGACGAAAACGAGAA Reverse primer: TGACCAAGCACCATCTCACC Lefp_id006: Forward primer: GGGTGGGTAACTAAGCGTGT Reverse primer: ACCGGTCTACCTTCCTTTAGTG Lefp_id007: Forward primer: TCGTCTTACAGCGTGGGAAC Reverse primer: GGTGAAATCCCCAGCAGGT Lefp_id008: Forward primer: AGACCGATCCTCTTCGCTGA Reverse primer: TAAGGATGGCGTGCTTCTCC Lefp_id009: Forward primer: TTCCGCCATTCCTGATACGG Reverse primer: CGTGACCGCATCGTAAACTC Lefp_id0010: Forward primer: CACGGTTATCGCCTCCTGAT Reverse primer: AACTGCCACCCCCTTGTTAA.

[0012] As a preferred embodiment of the present invention, the amplification conditions in step two are as follows: preheating at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55-58°C for 45 s, extension at 72°C for 30 s, for a total of 35 cycles; and epitaxy at 72°C for 7 min after the cycle is completed.

[0013] As a preferred technical solution of the present invention, in step three, after electrophoresis, the allelic fragment number and length amplified by each InDel-labeled primer are determined according to the position and number of electrophoretic bands, wherein the upper band is recorded as 1, the lower band as -1, and the two bands as 2.

[0014] Application of InDel-labeled fingerprinting of a wild *Dictyophora indicum* strain.

[0015] As a preferred embodiment of the present invention, the application of an InDel-labeled fingerprint of a wild *Dictyophora indicum* strain includes the following steps: Step 1: Take the dried mycelium of the unknown *Dictyophora indicum* strain and extract the genomic DNA of the strain; Step 2: Construct the amplification system and amplify the genomic DNA from Step 1; Step 3: The amplification products from Step 2 were subjected to agarose gel electrophoresis. A D500 bp DNA ladder was used as the electrophoresis control. After electrophoresis, the gel imaging device was used to take pictures to obtain the InDel-labeled fingerprint of the unknown *Dictyophora indica* strain. Step 4: Compare the obtained InDel-labeled fingerprint of the unknown *Dictyophora indicum* with the InDel-labeled fingerprint of the wild *Dictyophora indicum* strain as described in claim 1.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) High specificity: The InDel marker fingerprint spectrum provided by this invention is a unique molecular marker feature of the 'GA1' strain of Dictyophora indicum. It is specific among the 19 Dictyophora indicum strains from different sources collected, and can accurately distinguish the 'GA1' strain from other Dictyophora indicum strains, thus solving the problem of insufficient specificity of traditional identification methods.

[0017] (2) High efficiency in detection: In the construction method and identification application of the present invention, PCR amplification and electrophoresis detection are simple to operate and the steps are clear. The whole detection process is short. Compared with morphological identification, antagonistic reaction identification and other methods, it greatly improves the efficiency of strain identification and is suitable for large-scale sample detection.

[0018] (3) High accuracy and good reproducibility: Based on InDel molecular marker technology, this invention is not affected by external factors such as culture conditions and growth stage. The stability of PCR amplification and electrophoresis detection is strong. Consistent fingerprint patterns can be obtained in multiple repeated experiments. The identification results are accurate and reliable, which can effectively avoid the loss caused by strain confusion.

[0019] (4) High application value: This invention fills the gap in the specific molecular identification technology of wild red-topped bamboo fungus 'GA1' strain in Anshun, Guizhou. Its fingerprint spectrum, construction method and application can be widely used in the fields of germplasm resource protection, strain purity detection, introduction and cultivation, and variety rights protection of 'GA1' strain. It is of great significance for promoting the standardization and high-quality development of the red-topped bamboo fungus industry. Attached Figure Description

[0020] Figure 1The InDel-labeled fingerprint of the *Dictyophora indicum* strain 'GA1' is shown, where M is the D500 bp DNA ladder, and the numbers 1-10 represent the 10 pairs of InDel-labeled primers used.

[0021] Figure 2 The amplification patterns of primer Lefp_idOOl in 19 selected *Dictyophora indicum* materials are shown.

[0022] Figure 3 The image shows the amplification patterns of primer Lefp_id002 in 19 selected *Dictyophora indicum* materials.

[0023] Figure 4 The amplification patterns of primer Lefp_idOO3 in 19 selected *Dictyophora indicum* materials are shown.

[0024] Figure 5 The image shows the amplification patterns of primer Lefp_id004 in 19 selected *Dictyophora indicum* materials.

[0025] Figure 6 The amplification patterns of primer Lefp_idOO5 in 19 selected *Dictyophora indicum* materials are shown.

[0026] Figure 7 The image shows the amplification patterns of primer Lefp_id006 in 19 selected *Dictyophora indicum* materials.

[0027] Figure 8 The amplification patterns of primer Lefp_idOO7 in 19 selected *Dictyophora indicum* materials are shown.

[0028] Figure 9 The amplification patterns of primer Lefp_idOO8 in 19 selected *Dictyophora indicum* materials are shown.

[0029] Figure 10 The image shows the amplification patterns of primer Lefp_id009 in 19 selected *Dictyophora indicum* materials.

[0030] Figure 11 The amplification patterns of primer Lefp_idOO10 in 19 selected *Dictyophora indicum* materials are shown.

[0031] Figure 12 The image shows the InDel-labeled fingerprint of the *Dictyophora indicum* strain 1, where M is the D500 bp DNA ladder and the numbers 1-10 represent the 10 pairs of InDel-labeled primers used.

[0032] Figure 13The image shows the InDel-labeled fingerprint of *Dictyophora indicum* strain 2, where M is the D500 bp DNA ladder, and the numbers 1-10 represent the 10 pairs of InDel-labeled primers used. Detailed Implementation

[0033] The present invention will be further described in detail below with reference to specific embodiments, in order to make the technical solution of the present invention easier to understand and master, and not to limit the scope of protection of the present invention.

[0034] All reagents and instruments used in this embodiment are commercially available products. The marker was purchased from Sangon Biotech Co., Ltd.; Premix Taq... TM Materials and reagents were purchased from: Takara Bio Inc.; Genomic DNA extraction kit: purchased from: Nanjing Novizan Biotechnology Co., Ltd. All other materials and reagents were commercially available products. Instruments included a high-speed refrigerated centrifuge, PCR instrument, agarose gel electrophoresis apparatus, and gel imaging system, all of which were calibrated and used according to standard operating instructions.

[0035] The *Dictyophora indicum* strain used in this embodiment was harvested from Anshun, Guizhou. Research has shown that this strain has good marketability and is suitable for large-scale local cultivation, making it highly valuable for development and utilization. It was named strain 'GA1', and its source is detailed in Table 1 below.

[0036] The 'GA1' strain is deposited at the Guangdong Provincial Microbial Culture Collection Center, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC NO: 67428 and taxonomic name Dictyophora rubrovalvata. This strain was isolated from the wild environment in Anshun, Guizhou Province, and is the core strain for fingerprint pattern construction and identification applications in this invention.

[0037] In addition, this invention also collected 18 strains from different producing areas such as Guizhou, Zhejiang, and Yunnan as control strains, as detailed in Table 1: Table 1. Isolated and preserved strains of *Dictyophora indicum* .

[0038] In this invention, the following construction method was specifically adopted to obtain the InDel marker fingerprint of the *Dictyophora indica* strain 'GA1': Step 1: Genomic DNA extraction from wild *Dictyophora indicum* strain 'GA1' Genomic DNA was extracted from the tested *Dictyophora indica* strain 'GA1' using a kit. The specific steps are as follows: A1. Take 20mg of dried mycelium of *Dictyophora indicum* strain 'GA1' and grind it into powder using a fully automated rapid sample grinder. Immediately add 400μl of Buffer A1 and 4μl of RNase A to the ground sample powder.

[0039] A2. Place the above mixed sample in a 65℃ water bath for 10 minutes. During the water bath, invert the centrifuge tube 2-3 times to ensure the sample is thoroughly mixed.

[0040] A3. Add 130 μl of Buffer A2 to the mixture after water bath, mix thoroughly, and place on ice for 5 min. Then centrifuge at 14,000 rpm for 5-10 min, and carefully aspirate the supernatant into a new 1.5 ml centrifuge tube to avoid aspirating precipitate.

[0041] A4. Accurately calculate the volume of the supernatant, add 1.5 times the volume of the supernatant to it, and immediately mix it by pipetting to ensure that there is no local precipitation.

[0042] A5. Transfer the entire mixture obtained in the previous step to a FastPure gDNA Columns IV adsorption column. Place the adsorption column into a collection tube and centrifuge at 12,000 rpm for 30-60 seconds. After centrifugation, discard the filtrate in the collection tube.

[0043] A6. Add 600 μl of Buffer AW to the adsorption column, centrifuge at 12,000 rpm for 30 seconds, discard the filtrate; repeat this step once for a second rinse.

[0044] A7. Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 minutes to remove as much residual washing solution as possible from the adsorption column to avoid affecting the subsequent DNA elution efficiency.

[0045] A8. Remove the adsorption column and place it in a new 1.5ml centrifuge tube. Add 50-100μl of preheated Elution Buffer (65-70℃) to the center of the membrane in the adsorption column and let it stand at room temperature for 3-5 minutes to allow the DNA to be fully eluted.

[0046] A9. Centrifuge at 12,000 rpm for 1 min, collect the eluent in the centrifuge tube, which is the genomic DNA of the *Dictyophora indica* strain 'GA1', and store it in a -20°C freezer for later use.

[0047] Step 2: Construct the amplification system and amplify the genomic DNA from Step 1. The specific steps are as follows: (1) PCR amplification Ten pairs of InDel-labeled primers were used to amplify the extracted genomic DNA of the *Dictyophora indicum* strain 'GA1' by PCR. The specific ten pairs of InDel-labeled primers are shown in Table 2. Table 2 List of InDel-labeled primers .

[0048] In this embodiment, the PCR amplification process is as follows.

[0049] PCR amplification system (total volume 20 μL): 2×Es Premix Taq TM 10 μL, 1 μL of any one pair of forward primers from the 10 primer pairs, 1 μL of the corresponding reverse primer, 2 μL of the genomic DNA extracted in step one, and ddH2O to bring the total to 20 μL; gently invert the centrifuge tube to mix the system thoroughly, avoiding the generation of air bubbles and ensuring that all reagents are in uniform contact.

[0050] PCR amplification conditions: Place the above PCR reaction system into a PCR instrument and set the reaction program as follows: preheat at 95℃ for 5 min to fully denature the genomic DNA; then enter 35 cycles, each cycle including denaturation at 95℃ for 30 s, annealing at 57℃ for 45 s, and extension at 72℃ for 30 s; after the cycle, extend at 72℃ for 7 min; finally, incubate at 4℃ for subsequent electrophoresis detection.

[0051] Step 3: The amplification products from Step 2 are subjected to agarose gel electrophoresis. After electrophoresis, a gel imaging device is used to take pictures, thus obtaining the InDel-labeled fingerprint of the *Dictyophora indica* strain. The specific process is as follows: To prepare a 2.5% agarose gel: Weigh 2.5g of agarose, add it to 100mL of TAE buffer, heat to boiling until the agarose is completely dissolved, cool to 50-60℃, add an appropriate amount of nucleic acid dye, mix gently, pour into a gel casting plate, insert a comb, and let it stand to solidify for more than 30 minutes to obtain a uniform, bubble-free agarose gel.

[0052] Sample loading: Mix the PCR amplification product with the loading buffer at a volume ratio of 5:1 and add the mixture to the sample wells of the agarose gel. At the same time, add a DNA ladder with a molecular weight of D500 bp to the adjacent sample wells as a control for subsequent determination of the relative molecular weight of the amplification product.

[0053] Electrophoresis: Place the gel casting plate into the electrophoresis tank, add TAE buffer, and make sure the buffer covers the gel surface by 1-2 mm; set the electrophoresis parameters to 120V and 30min, turn on the electrophoresis apparatus, and separate the PCR amplification products in the gel according to fragment size.

[0054] After electrophoresis, the agarose gel was removed and placed in a gel imaging system. Imaging parameters were adjusted, and the gel was photographed to obtain the InDel-labeled fingerprint of the *Dictyophora indica* strain 'GA1'. Based on the gel imaging results and the fragment length standard of the DNA molecular weight D500 bp DNA ladder, the number and relative molecular weight of allelic fragments amplified by each pair of InDel-labeled primers were determined. Simultaneously, following the rule of labeling the upper band as 1, the lower band as -1, and both bands as 2, the bands amplified by each primer were assigned values, ultimately forming the unique InDel-labeled fingerprint of the *Dictyophora indica* strain 'GA1'. Figure 1 And as shown in Table 3: Table 3 Summary of allelic fragment information amplified by InDel primers .

[0055] The allelic fragment numbering combination of the *Dictyophora indicum* strain 'GA1' was determined to be: -1, 2, 2, 2, -1, 1, -1, 1, 2, 2; the corresponding allelic fragment lengths were 128bp, 179bp and 229bp, 203bp and 242bp, 160bp and 197bp, 119bp, 210bp, 119bp, 259bp, 153bp and 210bp, 113bp and 145bp, respectively, for subsequent strain-specific identification.

[0056] To further verify the accuracy of the above-described construction method of the present invention, the present invention also provides the following verification method.

[0057] Specificity verification and application of InDel-labeled fingerprint of wild red-topped bamboo fungus 'GA1' from Anshun, Guizhou Nineteen control strains of *Dictyophora indicum* from different origins were selected. Genomic DNA was extracted from each control strain according to the construction method described above, and PCR amplification and electrophoresis detection were performed. Using the same 10 pairs of InDel marker primers, InDel marker fingerprints of each control strain were constructed. The allelic fragment numbering combination and fragment length of each control strain were compared one by one with the fingerprint of *Dictyophora indicum* strain 'GA1' constructed in this invention.

[0058] The validation results showed that the InDel marker fingerprints of 19 control strains were as follows: Figures 2-11 As shown, the allelic fragment numbering combination and fragment length are significantly different from those of the *Dictyophora indicum* strain 'GA1'. No control strain can completely match the fingerprint spectrum of strain 'GA1'. Only *Dictyophora indicum* strain 'GA1' can present the specific fingerprint spectrum described in this invention, proving that the InDel-labeled fingerprint spectrum provided by this invention has extremely high specificity and can be used for the specific identification of strain 'GA1'.

[0059] The above construction method can be used to construct the InDel-labeled fingerprint spectrum of wild-type *Dictyophora indicum* strains. Furthermore, this invention provides applications of the above fingerprint spectrum, which are illustrated in the following embodiments.

[0060] Example 1 Two samples of the unknown *Dictyophora indicum* strain (sample 1 and sample 2) were taken. Genomic DNA was extracted from each sample according to the method described above, and PCR amplification and electrophoresis were performed. Using the 10 pairs of InDel-labeled primers of this invention, the InDel-labeled fingerprint patterns, allelic fragment numbering combinations, and fragment lengths of each unknown sample were obtained and compared with the fingerprint pattern of *Dictyophora indicum* strain 'GA1'. Figure 12 and Figure 13 The specific comparison results are as follows: Sample 1: The allelic fragment numbering combination is -1, 2, 2, 2, -1, 1, -1, 1, 2, 2; the corresponding allelic fragment lengths are 128bp, 179bp and 229bp, 203bp and 242bp, 160bp and 197bp, 119bp, 210bp, 119bp, 259bp, 153bp and 210bp, 113bp and 145bp, which are completely consistent with the fingerprint spectrum of strain 'GA1'. Therefore, sample 1 is identified as the 'GA1' strain of *Dictyophora indica*.

[0061] Sample 2: The allelic fragment numbering combination is 2, 2, 2, 2, 2, -1, 2, 2, 2, with fragment lengths of 128 and 181 bp, 179 bp and 229 bp, 203 bp and 242 bp, 160 bp and 197 bp, 119 bp and 152 bp, 173 bp and 210 bp, 119 bp, 231 bp and 259 bp, 153 bp and 210 bp, and 113 bp and 145 bp, respectively. The fragment lengths differ from those of strain 'GA1' in 4 places, and it is determined that sample 2 is not the 'GA1' strain of *Dictyophora indica*.

[0062] The above identification results show that the InDel-labeled fingerprint spectrum and application method provided by the present invention can quickly and accurately identify whether an unknown strain is the 'GA1' strain of *Dictyophora indica*. The operation is simple and reproducible, and it is suitable for strain identification in actual production and scientific research.

[0063] To further ensure the accuracy of the construction method of the present invention, this embodiment also provides repeatability verification of the above method, the specific process of which is as follows.

[0064] Dry mycelial samples of the 'GA1' strain of *Dictyophora indicum* were collected, and fingerprint patterns were constructed three times by three different researchers, resulting in a total of nine fingerprint patterns. The allelic fragment numbering combinations and fragment lengths of the nine fingerprint patterns were compared, and the results showed that all fingerprint patterns were completely identical with no differences. This demonstrates that the fingerprint pattern construction method of the present invention has good reproducibility and ensures the reliability of the identification results.

[0065] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.

Claims

1. An InDel-labeled fingerprint of a wild *Dictyophora indicum* strain, characterized in that, This is an allelic fragment amplified by 10 pairs of InDel-labeled primers. The map was obtained by numbering the allelic fragments, and the specific numbering steps are as follows: In the electrophoretic bands of the pattern, the upper band is marked as 1; the lower band is marked as -1; and two bands are marked as 2. The InDel-labeled fingerprint spectrum of the wild *Dictyophora indicum* strain obtained through the above numbering steps is -1, 2, 2, 2, -1, 1, -1, 1, 2, 2.

2. The InDel-labeled fingerprint of the wild *Dictyophora indicum* strain according to claim 1, characterized in that, include: The allelic fragment lengths of the *Dictyophora indicum* strain were: 128bp, 179bp and 229bp, 203bp and 242bp, 160bp and 197bp, 119bp, 210bp, 119bp, 259bp, 153bp and 210bp, and 113bp and 145bp.

3. The InDel-labeled fingerprint of the wild *Dictyophora indicum* strain according to claim 1, characterized in that, The sequences of the 10 pairs of InDel-labeled primers are as follows: Lefp_id001: Forward primer: TAGATCGCCGCACTCATCAC Reverse primer: TCAGACAAGGAGGAATGAGACA Lefp_id002: Forward primer: CGTCAGCGATACGACCTCAA Reverse primer: GCATACGAGCGGCACAAAG Lefp_id003: Forward primer: GCGAAAGGAAACTGGCCAAC Reverse primer: CAAGGTGCTCCGGAGAACAA Lefp_id004: Forward primer: ATGCGTTAGGGGTCTGTGGA Reverse primer: GATTCGCGTCTTTGGCACTG Lefp_id005: Forward primer: ACACCCGACGAAAACGAGAA Reverse primer: TGACCAAGCACCATCTCACC Lefp_id006: Forward primer: GGGTGGGTAACTAAGCGTGT Reverse primer: ACCGGTCTACCTTCCTTTAGTG Lefp_id007: Forward primer: TCGTCTTACAGCGTGGGAAC Reverse primer: GGTGAAATCCCCAGCAGGT Lefp_id008: Forward primer: AGACCGATCCTCTTCGCTGA Reverse primer: TAAGGATGGCGTGCTTCTCC Lefp_id009: Forward primer: TTCCGCCATTCCTGATACGG Reverse primer: CGTGACCGCATCGTAAACTC Lefp_id0010: Forward primer: CACGGTTATCGCCTCCTGAT Reverse primer: AACTGCCACCCCCTTGTTAA.

4. A method for constructing an InDel-labeled fingerprint of a wild *Dictyophora indicum* strain, characterized in that, Includes the following steps: Step 1: Take the dried mycelium of the *Dictyophora indicum* strain and extract the genomic DNA of the strain; Step 2: Construct the amplification system and amplify the genomic DNA from Step 1; Step 3: The amplification products from Step 2 are subjected to agarose gel electrophoresis. A D500 bp DNA ladder is used as the electrophoresis control. After electrophoresis, a gel imaging device is used to take pictures to obtain the InDel-labeled fingerprint of the *Dictyophora indica* strain.

5. The method for constructing the InDel-labeled fingerprint of the wild *Dictyophora indicum* strain according to claim 4, characterized in that, The amplification system is as follows: 2×Es Premix Taq TM 10 μL, 2 μL of genomic DNA from step one, and 2 μL of any one pair of InDel-labeled primers from the 10 pairs of InDel-labeled primers, with 1 μL of each of the forward and reverse primers; the remainder is ddH2O.

6. The method for constructing the InDel-labeled fingerprint of the wild *Dictyophora indicum* strain according to claim 5, characterized in that, The sequences of the 10 pairs of InDel-labeled primers are as follows: Lefp_id001: Forward primer: TAGATCGCCGCACTCATCAC Reverse primer: TCAGACAAGGAGGAATGAGACA Lefp_id002: Forward primer: CGTCAGCGATACGACCTCAA Reverse primer: GCATACGAGCGGCACAAAG Lefp_id003: Forward primer: GCGAAAGGAAACTGGCCAAC Reverse primer: CAAGGTGCTCCGGAGAACAA Lefp_id004: Forward primer: ATGCGTTAGGGGTCTGTGGA Reverse primer: GATTCGCGTCTTTGGCACTG Lefp_id005: Forward primer: ACACCCGACGAAAACGAGAA Reverse primer: TGACCAAGCACCATCTCACC Lefp_id006: Forward primer: GGGTGGGTAACTAAGCGTGT Reverse primer: ACCGGTCTACCTTCCTTTAGTG Lefp_id007: Forward primer: TCGTCTTACAGCGTGGGAAC Reverse primer: GGTGAAATCCCCAGCAGGT Lefp_id008: Forward primer: AGACCGATCCTCTTCGCTGA Reverse primer: TAAGGATGGCGTGCTTCTCC Lefp_id009: Forward primer: TTCCGCCATTCCTGATACGG Reverse primer: CGTGACCGCATCGTAAACTC Lefp_id0010: Forward primer: CACGGTTATCGCCTCCTGAT Reverse primer: AACTGCCACCCCCTTGTTAA.

7. The method for constructing the InDel-labeled fingerprint of the wild *Dictyophora indicum* strain according to claim 4, characterized in that, The amplification conditions in step two are as follows: preheating at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 55-58℃ for 45 s, extension at 72℃ for 30 s, for a total of 35 cycles; after the cycle, extension at 72℃ for 7 min.

8. The method for constructing the InDel-labeled fingerprint of the wild *Dictyophora indicum* strain according to claim 4, characterized in that, In step three, after electrophoresis, the allelic fragment number and length amplified by each InDel-labeled primer are determined based on the position and number of electrophoretic bands. The upper band is recorded as 1, the lower band as -1, and the two bands as 2.

9. The application of the InDel-labeled fingerprint spectrum of the wild *Dictyophora indicum* strain as described in claim 1.

10. The application of the InDel-labeled fingerprint spectrum of the wild *Dictyophora indicum* strain according to claim 9, characterized in that, Includes the following steps: Step 1: Take the dried mycelium of the unknown *Dictyophora indicum* strain and extract the genomic DNA of the strain; Step 2: Construct the amplification system and amplify the genomic DNA from Step 1; Step 3: The amplification products from Step 2 were subjected to agarose gel electrophoresis. A D500 bp DNA ladder was used as the electrophoresis control. After electrophoresis, the gel imaging device was used to take pictures to obtain the InDel-labeled fingerprint of the unknown *Dictyophora indica* strain. Step 4: Compare the obtained InDel-labeled fingerprint of the unknown *Dictyophora indicum* with the InDel-labeled fingerprint of the wild *Dictyophora indicum* strain as described in claim 1.