Pathogenic microorganism-specific primer combinations for assessing glacial environmental eco-risk

Abstract

This invention relates to a pathogen-specific primer set for assessing the ecological risks of glacial environments. The primer set includes primer Seq1 for *Bacillus anthracis* with a target gene of pagA, primer Seq4 for *Mycobacterium tuberculosis* with a target gene of IS6110, and primer Seq7 for *Xanthomonas oryzae*, a pathogen causing bacterial blight in rice, with a target gene of hrpB. This invention improves detection stability and applicability, enabling rapid joint detection of pathogens from different host sources in glacial environments. It also allows for the classification and assessment of ecological risks in glacial environments based on pathogen host type, seasonal variations, and differences in environmental media, providing technical support for biosafety monitoring and ecological risk early warning in glacial environments.

Description

Technical Field

[0001] This invention relates to the field of environmental microbial detection and ecological safety assessment technology, and in particular to pathogen-specific primer combinations for assessing the ecological risks of glacial environments. Background Technology

[0002] As a unique extreme ecosystem, the glacial environment has preserved a large number of microbial resources, including potential pathogens, under long-term low-temperature conditions. With global warming, the melting of glaciers has led to the release of a large number of microorganisms into the external environment. These microorganisms may enter different biological systems through water bodies, aerosols, and ecological migration, posing a risk of cross-species transmission.

[0003] Ecological risks stem not only from the presence of a single pathogen but also from its ability to spread between different hosts. For example, some pathogens can spread between animals and humans; some can spread through plant systems and impact agricultural ecology; and high-risk pathogens surviving in the environment can lead to sudden ecological risk events. Therefore, detecting only a single type of pathogen is insufficient for a comprehensive assessment of ecological risks in glacial environments.

[0004] Currently, there is a lack of molecular detection systems for ecological risks in glacial environments, a lack of key pathogen combinations that can indicate ecosystem risks, and an inability to rapidly determine different types of ecological risks. Therefore, it is necessary to develop a molecular detection method that can characterize the potential for cross-species transmission in glacial environments. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a pathogen-specific primer combination for assessing the ecological risks of glacial environments, which improves the stability and applicability of detection.

[0006] To address the aforementioned problems, the present invention provides a pathogen-specific primer combination for assessing the ecological risk of glacial environments, characterized in that: the specific primer combination comprises a primer Seq1 for *Bacillus anthracis* with a target gene of pagA, a primer Seq4 for *Mycobacterium tuberculosis* with a target gene of IS6110, and a primer Seq7 for *Xanthomonas oryzae*, a pathogenic species of rice with a target gene of hrpB; the *Bacillus anthracis* primer Seq1 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 1 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 2 in the sequence listing; the *Mycobacterium tuberculosis* primer Seq4 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 19 of SEQ ID NO. 7 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 2 in the sequence listing. The nucleotide sequence shown in positions 1 to 19 of NO.8 constitutes the downstream primer; the primer Seq7 for Xanthomonas oryzae, a pathogenic species of rice, consists of the upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO.13 in the sequence listing and the downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO.14 in the sequence listing.

[0007] The primer Seq1 for Bacillus anthracis is replaced by primer Seq2 or primer Seq3; primer Seq2 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO.3 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO.4 in the sequence listing; primer Seq3 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO.5 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO.6 in the sequence listing.

[0008] The Mycobacterium tuberculosis primer Seq4 is replaced by primer Seq5 or primer Seq6; primer Seq5 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 9 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 18 of SEQ ID NO. 10 in the sequence listing; primer Seq6 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 19 of SEQ ID NO. 11 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 18 of SEQ ID NO. 12 in the sequence listing.

[0009] The primer Seq7 for the pathogenic species Xanthomonas oryzae of rice bacterial blight is replaced by primer Seq8 or primer Seq9; primer Seq8 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 15 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 16 in the sequence listing; primer Seq9 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 17 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 18 in the sequence listing.

[0010] The application of the specific primer combination described above is characterized by: firstly, collecting glacial environmental samples; then extracting DNA from the glacial environmental samples and using the specific primer combination described above to perform PCR amplification of the DNA to detect the target pathogen; secondly, performing agarose gel electrophoresis on the amplification results to determine whether the target band appears; and finally, classifying and assessing the ecological risk of the glacial environment based on the detection of different pathogens.

[0011] The glacial environment sample refers to one of the following: ice body, ice dust, or meltwater.

[0012] The PCR amplification reaction system was as follows: 2×PCR Mix: 12.5 μL; upstream primer: 0.4 μM; downstream primer: 0.4 μM; template DNA: 1 μL; sterile water to a final volume of 25 μL; reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 30 s; 35 cycles; 72℃ final extension for 5 min.

[0013] The method for determining the ecological risk of glaciers is as follows: when Bacillus anthracis is detected, it is determined to be a high-risk animal pathogen, indicating a potential high-risk ecological risk; when Mycobacterium tuberculosis is detected, it is determined to be a human-related pathogen, indicating a public health risk; when Xanthomonas oryzae is detected, it is determined to be a plant pathogen, indicating an agricultural ecological risk; when multiple types of pathogens are detected simultaneously, it is determined to be a risk of cross-species transmission.

[0014] Compared with the prior art, the present invention has the following advantages: 1. This invention addresses ecological risks in glacial environments by constructing a detection system using representative pathogens from different host types. These include: Bacillus anthracis, representing animal-derived and high-risk pathogens; Mycobacterium tuberculosis, representing human obligate pathogens; and Xanthomonas oryzae, representing plant pathogens. These three types of pathogens represent animal-human, human-human, and plant systems, respectively, and together constitute a cross-host ecological risk indication system.

[0015] 2. This invention is not a simple combination of different pathogen detection methods, but rather an ecological risk indicator system based on pathogens from different host sources, in order to reveal potential cross-species transmission risks in glacial environments.

[0016] 3. This invention employs a multi-primer combination strategy to improve detection stability and applicability.

[0017] 4. The specific primer combination described in this invention is suitable for the detection of low-abundance pathogens in complex environmental samples. Attached Figure Description

[0018] The specific embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.

[0019] Figure 1 The results of multiplex PCR amplification of host-derived pathogens in environmental samples from glaciers in different seasons are shown in this embodiment of the invention.

[0020] Figure 2 The results of the detection of pathogens from different host sources in the glacial environment are shown in the embodiments of the present invention. Detailed Implementation

[0021] A pathogen-specific primer set for assessing ecological risks in glacial environments includes primer Seq1 for Bacillus anthracis (representing animal-derived and high-risk pathogens) with pagA as the target gene, primer Seq4 for Mycobacterium tuberculosis (representing human obligate pathogens) with IS6110 as the target gene, and primer Seq7 for Xanthomonas oryzae (representing plant pathogens) with hrpB as the target gene.

[0022] The primer Seq1 for Bacillus anthracis consists of an upstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 1 in the sequence listing and a downstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 2 in the sequence listing. That is: F: GGGGAAAGAACTTGGGCTGA R: GTAGATTGGAGCCGTCCCAG The Mycobacterium tuberculosis primer Seq4 consists of an upstream primer with the nucleotide sequence shown in positions 1 to 19 of SEQ ID NO. 7 in the sequence listing and a downstream primer with the nucleotide sequence shown in positions 1 to 19 of SEQ ID NO. 8 in the sequence listing. That is: F: GCTGTGGGTAGCAGACCTC R: CAGCCCAGGATTCTTGCGA The primer Seq7 for *Xanthomonas oryzae*, the pathogen causing bacterial blight in rice, consists of an upstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 13 in the sequence listing, and a downstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 14 in the sequence listing. That is: F: GAGAGCAGGTGCAAGGTCAA R: GGGAATGGAACGGCAGATCA In this configuration: Primer Seq1 for Bacillus anthracis is replaced by either primer Seq2 or primer Seq3; primer Seq2 consists of an upstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 3 in the sequence listing and a downstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 4 in the sequence listing; primer Seq3 consists of an upstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 5 in the sequence listing and a downstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 6 in the sequence listing. That is: Seq2: F: AAATGGAGCACGGCTTCTGA R: TCGGATAAGCTGCCACAAGG Seq3: F: GTGCATGCGTCGTTCTTTGA R: CCCAAGTTCTTTCCCCTGCT For Mycobacterium tuberculosis, primer Seq4 is replaced by primer Seq5 or primer Seq6; primer Seq5 consists of an upstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 9 in the sequence listing and a downstream primer with the nucleotide sequence shown in positions 1 to 18 of SEQ ID NO. 10 in the sequence listing; primer Seq6 consists of an upstream primer with the nucleotide sequence shown in positions 1 to 19 of SEQ ID NO. 11 in the sequence listing and a downstream primer with the nucleotide sequence shown in positions 1 to 18 of SEQ ID NO. 12 in the sequence listing. That is: Seq5: F: TGTGGGTAGCAGACCTCACC R: CGCCAGCCCAGGATTCTT Seq6: F: CTGTGGGTAGCAGACCTCA R: CCAGCCCAGGATTCTTGC For the pathogenic species *Xanthomonas oryzae*, the primer Seq7 can be replaced by either primer Seq8 or Seq9. Primer Seq8 consists of an upstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 15 in the sequence listing and a downstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 16 in the sequence listing. Primer Seq9 consists of an upstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 17 in the sequence listing and a downstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 18 in the sequence listing. That is: Seq8: F: CCTCGGATACCGTCCCTTCA R: CGACGACCGTATCCTGTTGA Seq9: F: CAGCATCACGATCTTGCGAC R: TTCCGATCTCCCCGTTGTTG The primer combinations described above can be used in singleton or multiplex PCR detection systems and are suitable for conventional PCR and quantitative real-time PCR detection methods.

[0023] The application of this specific primer combination is as follows: First, glacial environmental samples are collected; then, DNA is extracted from the glacial environmental samples, and the DNA is amplified by PCR using the specific primer combination to detect the target pathogen; second, the amplification results are detected by agarose gel electrophoresis to determine whether the target band appears; finally, classification and ecological risk assessment of the glacial environment are performed based on the detection of different pathogens.

[0024] Among them, glacial environmental samples refer to one of the following: ice body, ice dust, or meltwater.

[0025] The PCR amplification reaction system was as follows: 2×PCR Mix: 12.5 μL; upstream primer: 0.4 μM; downstream primer: 0.4 μM; template DNA: 1 μL; sterile water to a final volume of 25 μL; reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 30 s; 35 cycles; 72℃ final extension for 5 min.

[0026] The method for assessing ecological risks in glacier environments involves evaluating these risks based on the detection results of different types of pathogens. The detection of *Bacillus anthracis* indicates the presence of a high-risk zoonotic pathogen, suggesting a potential high-risk ecological environment. The detection of *Mycobacterium tuberculosis* indicates the presence of a human-related pathogen, suggesting a public health risk. The detection of *Xanthomonas oryzae* indicates the presence of a plant pathogen, suggesting an agricultural ecological risk. The simultaneous detection of multiple types of pathogens indicates a risk of cross-species transmission.

[0027] Example: Ecological risk assessment of environmental samples from the No. 1 glacier of Baishuihe River in Yulong Snow Mountain during different seasons. Ice, ice dust, and meltwater samples were collected from Glacier No. 1 of Baishuihe in Yulong Snow Mountain in April, August, and October 2024 for ecological risk assessment and analysis. Ice samples (500 mL) were collected using a sterile ice shovel; meltwater samples (500 mL) were collected using a sterile sampling bottle; and ice dust samples (2 g) were collected using a sterile stainless steel spoon. All samples were immediately placed in a 4℃ incubator after collection and transported to the laboratory within 24 hours, where they were subsequently stored at −20℃ for later use.

[0028] Ice and meltwater samples were filtered through a 0.22 μm filter membrane to enrich microorganisms before environmental DNA was extracted; 0.5 g of ice dust samples were weighed for direct total DNA extraction. DNA concentration and purity were determined using NanoDrop after extraction.

[0029] Using the specific primer combination described in this invention, multiplex PCR was performed to detect Bacillus anthracis, Mycobacterium tuberculosis, and Xanthomonas oryzae. The multiplex PCR reaction system consisted of 25 μL, including: 12.5 μL of 2×PCR Mix; 0.2 μM of each pathogen's upstream primer; 0.2 μM of each pathogen's downstream primer; 1 μL of template DNA; and sterile water to a final volume of 25 μL. The PCR amplification conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 30 s; a total of 35 cycles; and a final extension at 72℃ for 5 min. After optimization of annealing temperature, amplification efficiency, and primer compatibility, stable amplification could be achieved under uniform PCR conditions, with no significant non-specific amplification between different target bands. After amplification, the PCR products were detected by 1.5% agarose gel electrophoresis, and the target bands were observed using a gel imaging system.

[0030] The results are as follows Figure 1As shown, pathogens from different hosts exhibit significant differences in distribution across different seasons and environmental media within glaciers. Specifically, *Mycobacterium tuberculosis* amplification was detected in the April ice sample, suggesting a risk of human-associated pathogen introduction from spring snow and ice. *Xanthomonasoryzae* detection was significantly enhanced in the August cryoconite and Augustmeltwater samples, indicating that the ice dust and meltwater system may promote the accumulation and spread of plant pathogens. These results demonstrate that the distribution of pathogens from different hosts in glacial environments exhibits significant seasonal variations and environmental media differences.

[0031] Further quantitative real-time PCR (qPCR) was used to analyze the abundance changes of pathogens from different hosts in different seasons and environmental media. The qPCR reaction system was 25 μL, including: 12.5 μL of 2×SYBR Green qPCR Mix; 0.4 μM upstream primer; 0.4 μM downstream primer; 1 μL template DNA; and sterile water to a final volume of 25 μL. The qPCR amplification conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s; 58℃ annealing for 30 s; 72℃ extension for 20 s; for a total of 40 cycles. Fluorescence signals were collected after each cycle, and melting curve analysis was performed after amplification to verify the specificity of the amplified products.

[0032] qPCR results as follows Figure 2 As shown, pathogens from different hosts exhibit significant differences in abundance across different seasons and environmental media within glaciers. Specifically, *Mycobacterium tuberculosis* had a relatively high abundance in April ice; *Xanthomonas oryzae* had significantly increased abundance in August cryoconite and August meltwater; and *Bacillus santhracis* was detected at low abundance only in a few samples. These results indicate that the distribution of pathogens from different hosts in glacial environments exhibits significant seasonal variations and environmental media differences.

[0033] Based on the ecological risk level assessment system established according to this invention (Table 1), the pathogen composition characteristics in different seasons and different environmental media are considered: Mycobacterium tuberculosis was detected in April ice samples, indicating a certain risk of human-related pathogen input; the enhanced signal of Xanthomonas oryzae in August cryoconite and August meltwater suggests that the ice dust and meltwater system may promote the enrichment and spread of plant pathogens; low abundance of Bacillus anthracis was detected in some samples, indicating potential animal-derived ecological risks in the glacial environment.

[0034] Therefore, the ecological risk level of this area is determined to be "Level III ecological risk".

[0035] Table 1. Ecological Risk Level Determination System Established in This Invention In summary, the specific primer combination described in this invention can not only achieve rapid joint detection of pathogens from different host sources in glacial environments, but also classify and assess the ecological risks of glacial environments based on pathogen host types, seasonal changes, and differences in environmental media, providing technical support for biosafety monitoring and ecological risk early warning in glacial environments.

Claims

1. A pathogen-specific primer set for assessing ecological risks in glacial environments, characterized in that: This specific primer combination includes primer Seq1 for *Bacillus anthracis* with the target gene pagA, primer Seq4 for *Mycobacterium tuberculosis* with the target gene IS6110, and primer Seq7 for *Xanthomonas oryzae*, a pathogenic species of rice with the target gene hrpB. Primer Seq1 for *Bacillus anthracis* consists of an upstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 1 in the sequence listing and a downstream primer with the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 2 in the sequence listing. Primer Seq4 for *Mycobacterium tuberculosis* consists of an upstream primer with the nucleotide sequence shown in positions 1 to 19 of SEQ ID NO. 7 in the sequence listing and a downstream primer with the nucleotide sequence shown in positions 1 to 19 of SEQ ID NO. 8 in the sequence listing. The oryzae primer Seq7 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 13 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 14 in the sequence listing.

2. The pathogen-specific primer combination for assessing ecological risks in glacial environments as described in claim 1, characterized in that: The primer Seq1 for Bacillus anthracis is replaced by primer Seq2 or primer Seq3; primer Seq2 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO.3 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO.4 in the sequence listing; primer Seq3 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO.5 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO.6 in the sequence listing.

3. The pathogen-specific primer combination for assessing ecological risks in glacial environments as described in claim 1, characterized in that: The Mycobacterium tuberculosis primer Seq4 is replaced by primer Seq5 or primer Seq6; primer Seq5 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 9 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 18 of SEQ ID NO. 10 in the sequence listing; primer Seq6 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 19 of SEQ ID NO. 11 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 18 of SEQ ID NO. 12 in the sequence listing.

4. The pathogen-specific primer combination for assessing ecological risks in glacial environments as described in claim 1, characterized in that: The primer Seq7 for the pathogenic species Xanthomonas oryzae of rice bacterial blight is replaced by primer Seq8 or primer Seq9; primer Seq8 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 15 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 16 in the sequence listing; primer Seq9 consists of an upstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 17 in the sequence listing and a downstream primer having the nucleotide sequence shown in positions 1 to 20 of SEQ ID NO. 18 in the sequence listing.

5. The application of the specific primer combination as described in any one of claims 1 to 4, characterized in that: First, glacial environmental samples were collected; then, DNA was extracted from the glacial environmental samples, and the DNA was amplified by PCR using the specific primer combination described in any one of claims 1 to 4 to detect the target pathogen; second, the amplification results were detected by agarose gel electrophoresis to determine whether the target band appeared; finally, the pathogens were classified and the ecological risk of the glacial environment was determined based on the detection of different pathogens.

6. The application of the specific primer combination as described in claim 5, characterized in that: The glacial environment sample refers to one of the following: ice body, ice dust, or meltwater.

7. The application of the specific primer combination as described in claim 5, characterized in that: The PCR amplification reaction system was as follows: 2×PCR Mix: 12.5 μL; upstream primer: 0.4 μM; Downstream primer: 0.4 μM; Template DNA: 1 μL; Sterile water to 25 μL; Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 30 s; 35 cycles; 72℃ final extension for 5 min.

8. The application of the specific primer combination as described in claim 5, characterized in that: The method for determining the ecological risk of glaciers is as follows: when Bacillus anthracis is detected, it is determined to be a high-risk animal pathogen, indicating a potential high-risk ecological risk; when Mycobacterium tuberculosis is detected, it is determined to be a human-related pathogen, indicating a public health risk; when Xanthomonas oryzae is detected, it is determined to be a plant pathogen, indicating an agricultural ecological risk. When multiple types of pathogens are detected simultaneously, it is determined that there is a risk of cross-host transmission.

Images