A molecular switch type nucleic acid framework fluorescent probe and its application in detection of depression marker ATP molecules
By designing molecular switch-type nucleic acid framework fluorescent probes and utilizing biomolecular switch reaction mechanisms, we have achieved high spatiotemporal resolution, high selectivity, and high sensitivity detection of ATP. This solves the problem of real-time and continuous monitoring of ATP that is difficult to achieve in existing technologies, reduces costs, and improves the specificity and sensitivity of the detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-26
- Publication Date
- 2026-06-23
AI Technical Summary
Existing technologies struggle to achieve real-time, continuous monitoring of ATP, especially for high-sensitivity and high-specificity detection in complex biological samples. Furthermore, traditional fluorescent probes are costly, time-consuming, and can negatively impact cell function.
A molecular switch-type nucleic acid framework fluorescent probe was designed, which uses a tetrahedral DNA single strand. Through a biomolecular switch reaction mechanism, it utilizes Nt.BbvCI endonuclease and T4 DNA ligase to achieve rapid response and signal recovery to ATP, enabling dynamic cyclic detection.
It achieves high spatiotemporal resolution, high selectivity, and high sensitivity in the detection of ATP, can stably exist in complex biological samples, reduces costs, and enables real-time dynamic detection.
Smart Images

Figure CN122255990A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biodetection technology, specifically relating to a molecular switch-type nucleic acid framework fluorescent probe and its application in the molecular detection of ATP, a biomarker for depression. Background Technology
[0002] Currently, the diagnosis of depression is mainly based on clinical interviews and patient clinical rating scales. However, this method is highly dependent on the doctor's professional level and the patient's cooperation, is time-consuming, and has a high rate of misdiagnosis and missed diagnosis. The limitations of existing diagnostic methods have prompted researchers to explore more efficient and accurate diagnostic methods. In comparison, detecting depression biomarkers is a simpler, faster, and more objective method for diagnosing depression, and it is of great significance in the early detection, prevention, treatment, and prognosis of depression. ATP (adenosine triphosphate), as a classic energy carrier and a core member of purinergic neurotransmitters, participates in synaptic transmission, regulation of neural plasticity, glial cell activation, and neuroinflammatory regulation in the central nervous system by activating P2X and P2Y purinergic receptors on the cell membrane. Abnormal regulation of its purinergic signaling pathway is one of the important molecular mechanisms in the occurrence and development of depression. However, ATP has characteristics such as spatiotemporal dynamic changes, transient release, diverse distribution and low abundance, and a wide variety of interfering ATP molecular derivatives, making real-time dynamic, high-sensitivity, and high-specificity detection in the complex liquid biopsy system still a huge challenge.
[0003] To achieve accurate ATP detection, methods including microdialysis and optical imaging have been developed. Microdialysis utilizes a microdialysis probe to exchange substances with cerebrospinal fluid; however, due to its high invasiveness and low temporal resolution, it is difficult to detect rapidly changing ATP levels in real time. Optical imaging methods have seen rapid development in ATP detection due to their high sensitivity and non-invasiveness. ATP concentrations in the physiological environment are low, requiring fluorescent probes with high affinity for ATP. However, these high-affinity fluorescent probes form thermodynamically stable complexes with ATP, which are difficult to dissociate. Therefore, ATP concentration changes can only be obtained at a single time point, making real-time, continuous monitoring of ATP difficult. Besides small-molecule fluorescent probes, a series of novel genetically encoded fluorescent probes have been developed, which significantly improve sensitivity, specificity, and spatiotemporal resolution. However, these fluorescent probes require transgenic or virus-mediated expression, which is costly, time-consuming, and can affect the function of endogenous cellular proteins. Summary of the Invention
[0004] Purpose of the invention: To address the problems existing in the prior art, this invention provides a molecular switch-type nucleic acid framework fluorescent probe, which can achieve high spatiotemporal resolution, high selectivity and high sensitivity detection of ATP, and can be effectively applied to liquid biopsy of ATP, a biomarker of depression.
[0005] The present invention also provides a method for preparing the molecular switch-type nucleic acid framework fluorescent probe and its application.
[0006] Technical Solution: To achieve the above objectives, the present invention provides a molecular switch-type nucleic acid framework fluorescent probe. The fluorescent probe has a tetrahedral structure, comprising three complementary DNA single strands and four DNA single strands forming the tetrahedral structure. The three complementary DNA single strands each include a Cy3 dye modified with a central backbone, a phosphate group modified at the 5' end, and a Cy5 dye modified at the 3' end, represented by F1-T, F1-TP, and F2-T, respectively. The four DNA single strands are represented by A13, B13, C13, and D13, respectively.
[0007] The F1-T sequence is: GAATCTGATAGAGGTAGAGTGAT-Cy3-CAGTCC;
[0008] The F1-TP sequence is: P-TCAGCTTCACCGTAAGTCTATTCGCAT;
[0009] The F2-T sequence is: TTACGTAGTTAGTATGCTTGCTGT ATGCGAATAGACTTACGGTGAAGCTGAGGACTGGTC-Cy5;
[0010] The sequence of A13 is: ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTATT;
[0011] The sequence of B13 is: GCAAGCATACTAACTACGTAAGTACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCT;
[0012] The sequence of C13 is: TCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACCTT;
[0013] The sequence of D13 is: CACTCTACCTCTATCAGATTCTTTCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCAT.
[0014] The lengths of the three complementary DNA single strands and the four DNA single strands forming the tetrahedral structure are 27nt, 29nt, 56nt, 41nt, 41nt, 64nt, and 64nt, respectively.
[0015] The method for preparing the molecular switch type DNA tetrahedral fluorescent probe of the present invention includes first dissolving the DNA single strand, mixing the seven single strands that form the tetrahedral nanostructure probe in an equimolar ratio in rCutsmart buffer, then placing the prepared sample in a PCR instrument at 95°C for 5 min, then rapidly cooling it to 4°C for 1 min, and stabilizing it at 4°C for 10 min to assemble the nucleic acid framework fluorescent probe.
[0016] The application of the molecular switch-type nucleic acid framework fluorescent probe described in this invention in the preparation of reagents for detecting ATP molecules.
[0017] The application of the molecular switch-type nucleic acid framework fluorescent probe in the preparation of reagents for detecting the neurotransmitter ATP molecules in vivo or in vitro.
[0018] The application of the molecular switch-type nucleic acid framework fluorescent probe described in this invention in the preparation of diagnostic reagents for early depression.
[0019] Among them, the molecular switch-type nucleic acid framework fluorescent probe is used in the preparation of early depression diagnostic reagents by detecting ATP molecules, a marker of depression, in plasma and urine.
[0020] This invention relates to a kit for detecting the neurotransmitter ATP molecules, the kit comprising the aforementioned molecular switch-type nucleic acid framework fluorescent probe.
[0021] The early depression diagnostic kit of the present invention includes the molecular switch-type nucleic acid framework fluorescent probe.
[0022] The present invention relates to the application of the molecular switch-type nucleic acid framework fluorescent probe in the detection of the neurotransmitter ATP molecules, and further to its application in reagents for detecting the depression biomarker ATP molecules.
[0023] Among them, the molecular switch-type nucleic acid framework fluorescent probe is used in the preparation of reagents for detecting ATP molecules, a biomarker of depression, in plasma and urine.
[0024] Furthermore, the application specifically includes: highly sensitive, highly specific, and dynamically circulating detection of ATP molecules, a biomarker for depression, from plasma samples drawn from different patient populations.
[0025] Furthermore, the kit includes Nt.BbvCI endonuclease and T4 DNA ligase.
[0026] The molecular switch-type fluorescent probe constructed in this invention is activated by ATP, rapidly responding to ATP to emit a fluorescent signal, and is deactivated by an endonuclease, automatically returning the probe to its initial state. Based on a biomolecular switch reaction mechanism, this fluorescent probe enables dynamic detection of ATP molecules and is suitable for rapid, highly sensitive, and selective quantitative analysis of the purine neurotransmitter ATP in complex biological samples such as plasma and urine, providing an effective means for early screening of neurological diseases.
[0027] In its initial state, the molecular switch-type nucleic acid framework fluorescent probe of this invention has a broken DNA double strand attached to a tetrahedral structure. At this time, the two fluorescent groups Cy3 and Cy5 are far apart and do not generate a fluorescence energy resonance transfer signal. When a blood sample drawn from the human body contains the analyte ATP, a marker of depression, the two broken DNA double strands are joined together by a ligase to form a complete double strand. At this time, the two fluorescent groups Cy3 and Cy5 move closer together and generate a fluorescence energy resonance transfer signal. At the same time, the endonuclease cuts the joined double-stranded DNA into two broken fragments, restoring the signal to the initial state. When a blood sample containing ATP is added again, a signal can be generated again, thereby realizing spatiotemporal dynamic and cyclically reversible detection of ATP.
[0028] This invention proposes a novel strategy for reversible recognition based on biological antagonistic responses. The generation reaction promotes the binding of the target and probe, generating a signal; the consumption reaction causes the probe and target to dissociate, restoring the signal. Compared to traditional probes that can only provide instantaneous measurements at a single time point, making dynamic and continuous detection difficult, this invention proposes a molecular switch-type nucleic acid framework probe capable of continuously monitoring the dynamic changes of ATP, a biomarker for depression. This probe can be used in complex liquid biopsy systems to achieve real-time, dynamic, highly sensitive, and highly specific detection of depression biomarkers.
[0029] Currently, in the development of precise ATP detection technologies, methods such as microdialysis and optical imaging have been developed. Microdialysis directly exchanges substances between the probe and cerebrospinal fluid, but it is highly invasive, requiring several minutes per sample, making it difficult to monitor rapidly changing ATP levels in the brain in real time. Optical imaging methods have seen rapid development in ATP detection due to their high sensitivity, high spatiotemporal resolution, and non-invasiveness. However, these high-affinity fluorescent probes form thermodynamically stable complexes with ATP, which are difficult to dissociate, thus hindering continuous ATP monitoring. Besides small-molecule fluorescent probes, a series of novel, highly sensitive, and selective genetically encoded fluorescent probes have been developed. However, these probes require transgenic or virus-mediated expression, which is costly, time-consuming, and damages endogenous cellular proteins. Therefore, this invention, based on a novel analytical method of biological competitive reaction, constructs a molecular switch-type nucleic acid framework fluorescent probe and achieves highly selective, highly sensitive, and real-time dynamic detection of ATP in samples from depression.
[0030] Beneficial effects: Compared with the prior art, the present invention has the following advantages:
[0031] 1. The molecular switch-type nucleic acid framework fluorescent probe provided by this invention has great programmability and can be modified with different types and numbers of fluorescent dye groups on different vertex extension chains; it is simple, fast and low cost to operate.
[0032] 2. The molecular switch-type nucleic acid framework fluorescent probe provided by this invention can remain stable in complex human blood samples for more than 48 hours, with almost no fluorescence leakage of the target, greatly increasing the fluorescence concentration and improving the signal-to-background ratio.
[0033] 3. The molecular switch-type nucleic acid framework fluorescent probe provided by this invention can realize reversible cyclic detection of biomarkers and achieve real-time dynamic detection of biomarker changes.
[0034] 4. The molecular switch-type nucleic acid framework fluorescent probe provided by this invention can achieve highly specific response to ATP, eliminate interference from other neurotransmitter molecules and ATP derivatives, and has high sensitivity and real-time dynamic detection. Attached Figure Description
[0035] Figure 1 This is a schematic diagram of the method for liquid biopsy of the depression biomarker ATP using a molecular switch-type nucleic acid framework fluorescent probe according to the present invention.
[0036] Figure 2 This is an agarose gel electrophoresis image of the synthesized molecular switch-type nucleic acid framework fluorescent probe of this invention.
[0037] Figure 3 This is an agarose gel electrophoresis image of the stability of the molecular switch-type nucleic acid framework fluorescent probe of this invention.
[0038] Figure 4 This invention provides an agarose gel electrophoresis image of a molecular switch-type nucleic acid framework fluorescent probe that detects the dynamic changes in the signal of ATP molecules over time and can spontaneously recover to its initial state.
[0039] Figure 5 The fluorescence dynamics of this invention.
[0040] Figure 6 To optimize the Nt.BbvCI endonuclease concentration in the detection system of this invention.
[0041] Figure 7 The concentration of T4 DNA ligase in the detection system of this invention was optimized.
[0042] Figure 8 This invention provides an ultrafast detection of ATP using a molecular switch-type probe.
[0043] Figure 9 This invention provides an ultrafast active reset of the molecular switch-type probe.
[0044] Figure 10 The probe of this invention is used to detect the fluorescence intensity of 0-50 uM ATP.
[0045] Figure 11 The probe of this invention is used to detect the fluorescence intensity of 0-3 uM ATP.
[0046] Figure 12 The probes of this invention detect different neurotransmitter molecules and other structurally similar nucleoside derivatives.
[0047] Figure 13 The probe of this invention enables the spatiotemporal dynamics and reversible circulation detection of ATP, a biomarker for depression in plasma samples. Detailed Implementation
[0048] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0049] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.
[0050] Among them, Nt.BbvCI endonuclease, manufacturer: NEB, catalog number: R0632L.
[0051] T4 DNA ligase, manufacturer: NEB, catalog number: M0202S.
[0052] ATP, Manufacturer: NEB, Part Number: P0756S.
[0053] Example 1
[0054] Design and fabrication of molecular switch-based fluorescent probes
[0055] 1. Design of molecular switch fluorescent probes
[0056] This invention discloses a molecular switch-type nucleic acid framework fluorescent probe. The fluorescent probe has a tetrahedral structure, comprising three complementary DNA single strands and four DNA single strands forming the tetrahedral structure. The three complementary DNA single strands include a Cy3 dye modified with the central backbone, a phosphate group modified at the 5' end, and a Cy5 dye modified at the 3' end, represented by F1-T, F1-TP, and F2-T, respectively.
[0057] The lengths of the three DNA single strands are 27nt, 29nt, and 56nt, respectively; the lengths of the four DNA single strands are 41nt, 41nt, 64nt, and 64nt, respectively.
[0058] 2. Preparation and characterization of molecular switch-type fluorescent probes
[0059] (1) Materials and preparation
[0060] The DNA oligo was synthesized by Sangon Biotech (Shanghai) Co., Ltd. and purified by HPLC. Its sequences are shown in SEQ ID NO. 1-7. The nucleotide sequences of the three complementary DNA single strands are shown in SEQ ID NO. 1-3, the F1-T sequence is shown in SEQ ID NO. 1, the F1-TP sequence is shown in SEQ ID NO. 2, and the F2-T sequence is shown in SEQ ID NO. 3. The sequences of the four DNA single strands forming the tetrahedral structure are shown in SEQ ID NO. 4-7, the A13 sequence is shown in SEQ ID NO. 4, the B13 sequence is shown in SEQ ID NO. 5, the C13 sequence is shown in SEQ ID NO. 6, and the D13 sequence is shown in SEQ ID NO. 7. See Table 1 for details.
[0061] Table 1. Three complementary DNA single strands and the tetrahedral structure of DNA. (Four DNA single strands)
[0062]
[0063] Probe preparation process: First, single-stranded DNA was dissolved, and seven single-stranded DNA molecules were mixed in an equimolar ratio in rCutsmart buffer to prepare a sample with a final concentration of 1 μM. The prepared sample was then placed in a PCR instrument and heated to 95°C for 5 min, followed by a rapid cooling to 4°C for 1 min, and stabilized at 4°C for 10 min to obtain a molecular switch-type nucleic acid framework fluorescent probe with a tetrahedral DNA nanostructure. The yield, size, and other characteristics of the obtained DNA tetrahedral structure probe were preliminarily characterized by agarose gel electrophoresis. Figure 2 Agarose gel electrophoresis results showed that the synthesis yield of the DNA tetrahedral probe was over 90%, and the probe was a regular tetrahedral structure with a side length of 13 bp. These results indicate that the molecular switch-type nucleic acid framework fluorescent probe was successfully synthesized.
[0064] Example 2
[0065] The 1 μM molecular switch-type nucleic acid framework fluorescent probe synthesized according to the steps in Example 1 was added to cell culture medium containing 10% bovine serum in a sequential manner from 0 to 48 h, and incubated at 37 degrees Celsius to preliminarily obtain the stability of the probe in complex sample environments. Figure 3 Agarose gel electrophoresis results showed that the molecular switch-type nucleic acid framework fluorescent probe could remain stable in complex samples containing bovine serum for more than 48 hours without being degraded by nucleases, and the target analyte showed almost no fluorescence leakage, which greatly increased the fluorescence concentration and improved the signal-to-background ratio.
[0066] Feasibility testing of molecular-switch fluorescent probes:
[0067] The molecular switch-type nucleic acid framework fluorescent probe synthesized in Example 1 was used to detect ATP, including the following steps:
[0068] S1. Synthesize a 1 μM probe according to the preparation method in Example 1: First, dissolve the single-stranded DNA, and mix the seven single strands forming the probe in an equimolar ratio in rCutsmart buffer to prepare a tetrahedral nanostructure probe with a final concentration of 1 μM. Then, place the prepared sample in a PCR instrument at 95°C for 5 min, followed by a rapid cooling to 4°C for 1 min, and stabilize at 4°C for 10 min to obtain a nucleic acid framework fluorescent probe.
[0069] S2. At 25℃, add 0.5 U / uL Nt.BbvCI restriction enzyme and 2.4 U / uL T4 DNA ligase to the probe reaction system prepared in S1 and mix well. Then add 8 uM ATP to the well-mixed system and react for different times (1 min, 10 min, 30 min, 1 h, 2 h, 4 h). Then heat at 90℃ for 10 minutes to inactivate the restriction enzyme and ligase and terminate the reaction.
[0070] S3, such as Figure 4 As shown, the agarose gel electrophoresis results indicate that band 1 (reference group 1) represents a broken DNA double-stranded fragment; band 2 (reference group 2) represents a joined DNA double-stranded fragment; band 3 (control group) represents a joined DNA double-stranded fragment that was completely cleaved in a system containing only endonucleases; bands 4-6 show that with increasing time, the concentration of broken DNA double-stranded fragments decreases (the bands become lighter compared to reference group 1), while the concentration of joined DNA double-stranded fragments increases (the bands become darker compared to the control group), reaching the strongest signal; bands 7-9 show that with increasing time, the bands of broken DNA double-stranded fragments become darker, while the bands of joined DNA double-stranded fragments become lighter, resulting in the weakest signal, and the probe gradually returns to its initial state. These results demonstrate that the molecularly switched nucleic acid framework fluorescent probe detects ATP molecules with a dynamic signal change over time and can spontaneously recover to its initial state, thus achieving cyclically reversible ATP detection.
[0071] S4. Measure fluorescence kinetics. Synthesize a 1 μM probe according to the preparation method in Example 1. Add 0.5 U / μL Nt.BbvCI restriction enzyme and 2.4 U / μL T4 DNA ligase to the experimental group system and mix thoroughly. Add an equal volume of rCutsmart buffer solution and 2.4 U / μL T4 DNA ligase to the control group system and mix thoroughly. After stabilizing at 25°C for 15 min, add 8 μM ATP to both the experimental and control groups simultaneously. Figure 5 As shown, the fluorescence kinetics results indicate that in the control group without endonuclease, the signal increase reached a constant state after the probe detected ATP; while in the experimental group with endonuclease, the signal increase reached its maximum value after the probe detected ATP and then automatically returned to the initial state. These results demonstrate that the experimental group using the molecular switch-type nucleic acid framework fluorescent probe can achieve continuous monitoring of the dynamic changes of the target molecule, while the control group without endonuclease can only provide instantaneous measurements at a single time point, making dynamic continuous detection difficult.
[0072] Example 3
[0073] Optimization of endonuclease concentration in molecular switch-type nucleic acid framework fluorescent probe system
[0074] Fluorescence kinetics were measured. A 1 μM probe was synthesized according to the preparation method in Example 1. 6 U / μL LT4 DNA ligase and different concentrations (0.35 U / μL, 0.5 U / μL, 1 U / μL, 1.25 U / μL, 1.5 U / μL) of restriction enzyme were added and mixed thoroughly. After stabilizing at 25°C for 15 min, 8 μM ATP was simultaneously added to each system. Figure 6The fluorescence kinetics results showed that, under constant ligase and ATP concentrations, as the endonuclease concentration increased, the probe responded to ATP more slowly, the fluorescence signal weakened, and the probe returned to its initial state in a shorter time. These results indicate that the endonuclease regulates the signal strength, probe response speed, and reset speed of the detection system.
[0075] Example 4
[0076] Optimization of ligase concentration in molecular switch-type nucleic acid framework fluorescent probe system
[0077] Fluorescence kinetics were measured. A 1 μM probe was synthesized according to the preparation method in Example 1. 0.2 U / μL Nt.BbvCI restriction enzyme and different concentrations (1.2 U / μL, 3 U / μL, 9 U / μL, 12 U / μL, 18 U / μL) of T4 DNA ligase were added and mixed thoroughly. After stabilizing at 25°C for 15 min, 8 μM ATP was simultaneously added to each system. Figure 7 The fluorescence kinetics results showed that, under constant endonuclease and ATP concentrations, the higher the ligase concentration, the faster the probe responded to ATP, the stronger the fluorescence signal (signal saturated after the ligase concentration reached 9 U / µL), and the longer it took for the probe to recover to its initial state. The results of Examples 3 and 4 above collectively demonstrate that the endonuclease and ligase jointly regulate the signal strength of the detection system, as well as the probe response and reset speed.
[0078] Example 5
[0079] Response time of molecular switch-type nucleic acid framework fluorescent dynamic probe
[0080] Fluorescence kinetics were measured. A 1 μM probe was synthesized according to the preparation method in Example 1. 6 U / μL of T4 DNA ligase was added to both the experimental and control groups, and the mixture was thoroughly mixed. After stabilizing at 25°C for 15 min, 50 μM ATP and an equal volume of rCutsmart buffer solution were added to both groups. Figure 8 Fluorescence kinetics results showed that, compared with the control group, the molecularly switched nucleic acid framework fluorescent probe responded rapidly to ATP within 21 seconds, resulting in an increased fluorescence signal. These results demonstrate that the molecularly switched nucleic acid framework fluorescent probe of this invention can rapidly respond to ATP, enabling ultrafast liquid biopsy.
[0081] Example 6
[0082] Molecular switch-type nucleic acid framework fluorescent dynamic probe reset time
[0083] Fluorescence kinetics were measured. A 1 μM molecular switch-type nucleic acid framework fluorescent probe was synthesized according to the preparation method in Example 1. After stabilization at 25 °C for 15 min, 0.2 U / μL of Nt.BbvCI endonuclease and an equal volume of rCutsmart buffer solution were added to both the experimental and control groups. Figure 9 Fluorescence kinetics results showed that, compared with the control group, the molecular switch-type nucleic acid framework fluorescent probe could rapidly reset within 15 seconds, with the fluorescence signal decreasing and returning to its initial state. Fluorescence kinetics results also showed that the molecular switch-type nucleic acid framework fluorescent probe of this invention can rapidly reset under the action of endonuclease after the ligation reaction, achieving reversible cyclic detection.
[0084] Example 7
[0085] Molecular switch-type nucleic acid framework fluorescent dynamic probe detection sensitivity
[0086] Fluorescence kinetics were measured. A 1 μM probe was synthesized according to the preparation method in Example 1. 0.2 U / μL of Nt.BbvCI restriction enzyme and 6 U / μL of T4 DNA ligase were added and mixed thoroughly. After stabilizing at 25°C for 15 min, different concentrations (0-50 μM) of ATP were simultaneously added to the system. Reaction kinetics were measured, and the maximum signal value for each sample was extracted. A detection standard curve was fitted to show the change in fluorescence signal with ATP concentration. Figure 10 The standard curve represents the fluorescence signal intensity of 0-50 μM ATP; such as Figure 11 The standard curve represents the fluorescence signal intensity of 0-3 μM ATP, with a detection limit of 50 nM. The detection standard curve demonstrates that the molecular switch-type nucleic acid framework fluorescent probe possesses excellent sensitivity.
[0087] Example 8
[0088] Molecular switch-type nucleic acid framework fluorescent dynamic probe detection specificity
[0089] Fluorescence kinetics were measured. A 1 μM probe was synthesized according to the preparation method in Example 1. 0.2 U / μL of Nt.BbvCI restriction enzyme and 6 U / μL of T4 DNA ligase were added and homogenized. After stabilizing at 25°C for 15 min, 5 μM ATP and equal concentrations of other neurotransmitter markers associated with depression, including dopamine, acetylcholine, norepinephrine, serotonin, and other nucleoside derivatives such as GTP, UTP, and CTP, were added to the system. Figure 12Fluorescence kinetics results showed that when ATP was added to the molecularly switched nucleic acid framework fluorescent dynamic probe system, the fluorescence signal increased and spontaneously recovered to its initial state, while the addition of other depression-related neurotransmitter markers and other nucleoside derivatives did not produce significant fluorescence signals. Fluorescence kinetics results indicate that the molecularly switched nucleic acid framework fluorescent probe of this invention has good specificity and can effectively distinguish ATP and other depression-related neurotransmitter markers and other nucleoside derivatives in mixed samples.
[0090] Example 9
[0091] Spatiotemporal dynamics and reversible circulation detection of ATP, a biomarker for depression, in human plasma samples.
[0092] Measuring fluorescence kinetics. For example... Figure 1 This study demonstrates the application of a molecularly switched nucleic acid framework fluorescent probe to the liquid biopsy biopsy marker ATP for depression. A 1 μM probe was synthesized according to the preparation method in Example 1. 0.2 U / μL of Nt.BbvCI restriction enzyme and 6 U / μL of T4 DNA ligase were added, and the mixture was thoroughly mixed. After stabilizing at 25°C for 15 min, 100 μL of plasma separated from blood collected from patients with depression was added. Figure 13 Fluorescence kinetics results showed that when a sample was added to the molecularly switched nucleic acid framework fluorescent dynamic probe system once, a fluorescence signal was generated, and then the fluorescence signal spontaneously returned to its initial state. After one detection was completed, when the sample to be tested was added again, a fluorescence signal was generated again, and the fluorescence signal spontaneously returned to its initial state. This cycle of adding samples to be tested achieved dynamic cyclic detection. The fluorescence kinetics results indicate that the molecularly switched nucleic acid framework fluorescent probe of the present invention can detect the ATP concentration in plasma samples and achieve cyclic detection of the test samples, indicating that the present invention has a good ability to detect the spatiotemporal dynamics and reversible cycling of ATP, a biomarker of depression in human plasma samples.
Claims
1. A molecular switch-type nucleic acid framework fluorescent probe, characterized in that, The fluorescent probe has a tetrahedral structure, comprising three complementary DNA single strands and four DNA single strands forming the tetrahedral structure; the three complementary DNA single strands each include a Cy3 dye modified with a central backbone, a phosphate group modified at the 5' end, and a Cy5 dye modified at the 3' end, represented by F1-T, F1-TP, and F2-T, respectively; the four DNA single strands are represented by A13, B13, C13, and D13, respectively. The F1-T sequence is: GAATCTGATAGAGGTAGAGTGAT-Cy3-CAGTCC; The F1-TP sequence is: P-TCAGCTTCACCGTAAGTCTATTCGCAT; The F2-T sequence is: TTACGTAGTTAGTATGCTTGCTGT ATGCGAATAGACTTACGGTGAAGCTGAGGACTGGTC-Cy5; The sequence of A13 is: ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTATT; The sequence of B13 is: GCAAGCATACTAACTACGTAAGTACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCT; The sequence of C13 is: TCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACCTT; The sequence of D13 is: CACTCTACCTCTATCAGATTCTTTCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCAT.
2. A method for preparing the molecular switch-type nucleic acid framework fluorescent probe according to claim 1, characterized in that, The process includes the following steps: first, dissolve the DNA single strands; then, mix the seven single strands that will form the probe in equal proportions in a buffer solution; and finally, assemble the prepared sample in a PCR instrument to obtain a molecular switch-type nucleic acid framework fluorescent probe.
3. The application of the molecular switch-type nucleic acid framework fluorescent probe of claim 1 in the preparation of reagents for detecting ATP molecules.
4. The application according to claim 3, characterized in that, Application of the molecular switch-type nucleic acid framework fluorescent probe in the preparation of reagents for detecting the neurotransmitter ATP molecules in vivo or in vitro.
5. The application of the molecular switch-type nucleic acid framework fluorescent probe according to claim 1 in the preparation of diagnostic reagents for early depression.
6. The application according to claim 5, characterized in that, The molecular switch-type nucleic acid framework fluorescent probe is used in the preparation of early depression diagnostic reagents by detecting ATP molecules, a marker of depression, in plasma and urine.
7. A reagent kit for detecting the neurotransmitter ATP molecules, characterized in that, The kit includes the molecular switch-type nucleic acid framework fluorescent probe as described in claim 1.
8. The reagent kit for detecting the neurotransmitter ATP molecules according to claim 7, characterized in that, The kit includes Nt.BbvCI endonuclease and T4 DNA ligase.
9. A diagnostic kit for early depression, characterized in that, The kit includes the molecular switch-type nucleic acid framework fluorescent probe as described in claim 1.
10. The early depression diagnostic kit according to claim 9, characterized in that, The kit includes Nt.BbvCI endonuclease and T4 DNA ligase.