Rice sbeii b mutant protein and application thereof in changing starch crystal structure and increasing resistant starch content

Abstract

The application belongs to the field of rice genetic breeding, and discloses a rice SBEIIb mutant protein and application thereof in changing starch crystal structure and increasing resistant starch content. The mutant protein simultaneously contains double-amino-acid substitution (M610I / D611N) of substitution of M at the 610th position to I and substitution of D at the 611th position to N. The mutant protein can change rice starch from A-type to C B -type, significantly increase amylose content from 13.8% of the wild type to 20.3%, and significantly increase starch gelatinization temperature. Meanwhile, the mutant protein (M610I / D611N) can increase the resistant starch content in rice by about 5 times; compared with the ae mutant with SBEIIb deletion, the grain width, grain thickness and grain weight are significantly increased, and the chalky kernel rate, chalky area and chalkiness are significantly reduced. The SBEIIb-M610I / D611N in the application has important application value in cultivating functional rice varieties rich in resistant starch.

Description

Technical Field

[0001] This invention relates to a rice SBEIIb mutant protein and its application in altering starch crystal structure and increasing resistant starch content, belonging to the field of rice genetics and breeding. Background Technology

[0002] Rice starch is composed of both amylose and amylopectin, accounting for over 80% of the dry weight of rice. Starch branching enzyme IIb (SBEIIb) is specifically and highly expressed in rice endosperm and is a key enzyme catalyzing the synthesis of short branched side chains in amylopectin; its function cannot be replaced by other isoenzymes. The side chain structure of amylopectin and the starch crystal type have a significant impact on the content of resistant starch. Alterations in SBEIIb function can significantly affect the distribution of amylopectin side chains, thereby altering the starch crystal structure and increasing the content of resistant starch (RS). Resistant starch is not digested and absorbed by the small intestine but can be fermented and utilized by intestinal flora in the colon, possessing important health benefits such as lowering the postprandial glycemic index, improving intestinal flora, and preventing colon cancer. Currently reported a large number of SBEIIb protein-deficient ae mutants can significantly increase RS content, but their endosperm exhibits a completely floury phenotype, and the grain weight is severely reduced. Meanwhile, materials with single amino acid substitutions currently being explored have good rice quality, but their crystal structure changes are not significant, and the increase in resistant starch content is not substantial. Therefore, the discovery and creation of dual / multi-amino acid replacement materials with altered crystal structure, significantly increased resistant starch content, and minimal decrease in grain weight are of great significance for rice breeding. Summary of the Invention

[0003] To address the aforementioned technical problems, this invention provides a rice SBEIIb mutant protein and its application in altering starch crystal structure and increasing resistant starch content. The rice SBEIIb mutant protein can convert rice starch from A-type to C-type. B- The study significantly increased the amylose content from 13.8% in the wild type to 20.3%, significantly increased the starch gelatinization temperature, and increased the resistant starch content of rice by about 5 times.

[0004] The technical solution provided by this invention is as follows:

[0005] This invention provides a mutant SBEIIb protein from rice, the amino acid sequence of which is shown in SEQ ID NO.4. Compared with the wild-type SBEIIb protein, the mutant protein has methionine (M) at position 610 replaced by isoleucine (I) and aspartic acid (D) at position 611 replaced by asparagine (N); the amino acid sequence of the wild-type SBEIIb protein is shown in SEQ ID NO.2.

[0006] The present invention also provides a mutant gene encoding the rice SBEIIb mutant protein.

[0007] The nucleotide sequence of the gene is shown in SEQ ID NO.3. Compared with the wild-type SBEIIb gene, the mutant gene has G replaced with A at position 139 of exon 16 and G replaced with A at position 140; the nucleotide sequence of the wild-type SBEIIb gene is shown in SEQ ID NO.1.

[0008] The present invention also provides an expression cassette or recombinant vector containing the mutant gene.

[0009] The present invention also provides the application of the rice SBEIIb mutant protein, mutant gene or expression cassette or recombinant vector in rice quality improvement breeding.

[0010] Furthermore, this includes breeding mutant rice varieties.

[0011] Furthermore, this includes breeding homozygous mutant rice.

[0012] Furthermore, the rice quality improvement includes increasing the amylose content of the rice.

[0013] Furthermore, the rice quality improvement breeding includes one or both of the following: altering the starch crystal structure of rice and increasing the resistant starch content of rice.

[0014] The rice quality improvement includes improving the thermodynamic properties of rice starch.

[0015] Furthermore, the alteration of the rice starch crystal structure includes converting rice starch from the A-type to the C-type. B - and reduces the relative crystallinity of starch.

[0016] Furthermore, the improved thermodynamic properties of rice starch include increasing the gelatinization temperature, gelatinization enthalpy, and gelatinization temperature range of rice.

[0017] This invention also provides a method for identifying homozygous mutant rice, comprising the following steps:

[0018] (1) Extract genomic DNA from the rice to be tested, and perform PCR amplification and identification of the Cas9 gene, gRNA element and HPT marker gene respectively to obtain single plants without Cas9, gRNA and HPT;

[0019] (2) The above-mentioned single strains that do not contain Cas9, gRNA and HPT were subjected to PCR amplification and sequencing identification of the target sites again.

[0020] The nucleotide sequences of the primers used to identify the Cas9 gene are shown in SEQ ID NO.11 and SEQ ID NO.12; the nucleotide sequences of the primers used to identify the gRNA element are shown in SEQ ID NO.13 and SEQ ID NO.14; and the nucleotide sequences of the primers used to identify the HPT marker gene are shown in SEQ ID NO.9 and SEQ ID NO.10.

[0021] Beneficial effects

[0022] This invention is the first to utilize a collaborative editing strategy of CBE editing window covering adjacent double Cs to achieve double amino acid substitution in a single genetic transformation, providing a new technical paradigm for the targeted modification of key enzymes in starch metabolism and having significant methodological promotion value.

[0023] This invention constructs an evoFERNY-CBE cytosine base editing vector targeting a specific sequence in exon 16 of the OsSBEIIb gene. Using rice Zhonghua 11 as the transformation material, transgenic plants were obtained through Agrobacterium-mediated rice genetic transformation. After mutation identification and progeny screening, a homozygous mutant without the exogenous gene was obtained in the T1 generation. In this mutant, the GG bases at positions 139 and 140 of exon 16 of the OsSBEIIb gene were replaced by AA, resulting in a double amino acid substitution (M610I / D611N) where methionine (M) at position 610 was replaced by isoleucine (I) and aspartic acid (D) at position 611 was replaced by asparagine (N). This M610I / D611N mutant protein significantly alters the crystal structure of rice starch (changing from A-type to C-type). B The M610I / D611N mutant significantly increased amylose content from 13.8% in the wild type to 20.3%, while also increasing the resistant starch content in cooked rice by approximately five times (from 0.74% to 3.72%) and significantly raising the starch gelatinization temperature. Furthermore, the grain width, thickness, and weight of the M610I / D611N rice were significantly higher than those of the SBEIIb protein-deficient ae mutant, while the chalky grain rate, chalky area, and chalkiness were significantly lower. This mutant has significant application value in breeding functional rice varieties rich in resistant starch. After progeny screening, homozygous mutants without exogenous elements such as Cas9, gRNA, and HPT were obtained, meeting breeding safety and compliance requirements and can be directly used for variety improvement. Attached Figure Description

[0024] Figure 1 This is a schematic diagram of the SBEIIb gene editing target site and the cytosine base editing vector structure. Figure 1 In the middle, A represents the target site sequence for editing the SBEIIb gene; Figure 1 B in the diagram represents the carrier structure of evoFERNY-CBE; Figure 1 The peak diagram in C represents the target site sequencing data of the T0 transgenic plant.

[0025] Figure 2 Screening and identification of T1 generation homozygous mutants without exogenous genes. Figure 2 Image A shows a gel electrophoresis result from the initial screening of HPT marker genes. Figure 2 B represents further detection of Cas9, gRNA elements, and Actin internal control in HPT-negative single strains; Figure 2 C represents the sequencing peaks of the target site in the homozygous mutant without exogenous genes (M610I / D611N).

[0026] Figure 3 The appearance quality of rice from wild-type (WT), M610I / D611N mutant and ae mutant of ZH11 was evaluated. Figure 3 In Figure A, the reflected and transmitted light phenotypes of polished rice are shown, with a scale bar of 5 mm. Figure 3 B represents the grain length, grain width, grain thickness, and 100-grain weight of polished rice, respectively. Figure 3 In the figure, C represents the chalky grain rate, chalky area, and chalkiness of polished rice.

[0027] Figure 4 The apparent amylose content (AAC), actual amylose content (TAC), and the difference between them (AAC – TAC) of rice starch are given.

[0028] Figure 5 X-ray diffraction pattern of rice starch (the number in parentheses indicates the degree of starch crystallinity).

[0029] Figure 6 This refers to the resistant starch content of cooked rice. Detailed Implementation

[0030] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and experimental data.

[0031] This invention uses the japonica rice variety Zhonghua 11 (ZH11) as the transformation recipient material to create a double-amino acid substitution mutant, M610I / D611N, in the SBEIIb protein, where methionine (M) at position 610 isoleucine (I) and aspartic acid (D) at position 611 is asparagine (N). ZH11, referred to as the wild type (WT) in this invention, is characterized by large panicles, strong tillering ability, lodging resistance, and strong disease resistance, resulting in excellent rice quality and making it a commonly used representative high-quality rice material in scientific research. As a control, this invention also uses a complete deletion mutant of the SBEIIb protein derived from ZH11 (ae mutant). This ae mutant was created using CRISPR / Cas9 gene editing technology, inserting an A base at position 77 of the second exon of the SBEIIb gene, causing a frameshift and premature termination of translation, without containing the foreign gene and without any off-target effects. The rice ae mutant is a highly resistant starch mutant reported in domestic and international literature, but its rice quality is severely degraded. To evaluate the effect of the M610I / D611N mutant created in this invention on rice quality improvement, this invention uses the wild-type (WT) of Zhonghua 11 and its derived ae mutants as control materials. The wild-type (WT) of Zhonghua 11 and its derived ae mutants and M610I / D611N mutant involved in this invention are preserved in our laboratory.

[0032] Example 1

[0033] SBEIIb gene editing target design

[0034] Based on the SBEIIb gene sequence of japonica rice (22 exons, 21 introns) published in the NCBI database, the editing target was located in exon 16. The core basis for target selection is that the active editing window of CBE is usually between positions 4 and 8, and the coding bases of M610 and D611 must be included in the window simultaneously. After sequence alignment, the editing target sequence TTGCATTCTGGTTGATGGACAAG (SEQ ID NO.17) was screened, and its complementary strand sequence is CTTGTCCATCAACCAGAATGCAA (SEQ ID NO.18), where the C at positions 6 and 7 are both within the effective editing window. Figure 1 A).

[0035] Example 2

[0036] Construction of CBE single-base editing vector

[0037] This embodiment uses the evoFERNY-CBE system ( Figure 1(B) Its cytosine deaminase uses the evolved evoFERNY, which offers higher editing precision compared to the classic rAPOBEC1, making it suitable for precise co-editing of adjacent sites. The following sgRNA oligonucleotides were synthesized targeting the designed sequence:

[0038] sgRNA-SBEIIb-F: 5'-TGTGTGTTGCATTCTGGTTGATGGAC-3' (SEQ ID NO. 5);

[0039] sgRNA-SBEIIb-R: 5'-AAACGTCCATCAACCAGAATGCAACA-3' (SEQ ID NO. 6);

[0040] The synthesized primers were dissolved in double-distilled water to a final concentration of 10 μM. The mixture was then incubated with 8 μL ddH₂O + 1 μL sgRNA-F + 1 μL sgRNA-R and annealed on a PCR instrument (95℃ for 5 min, then cooled to 25℃ at -0.1℃ / s) to obtain a double-stranded DNA fragment with sticky ends. The evoFERNY-CBE vector was digested with BsaI, and the linear fragment was recovered and ligated into the annealed product. This ligation was then performed on *E. coli* DH5α, and sequencing verification confirmed the correct CBE-SBEIIb-sgRNA vector.

[0041] Example 3

[0042] Agrobacterium-mediated genetic transformation of rice and identification of T0 plant mutations

[0043] 1. Obtaining T0 transformed plants using Agrobacterium-mediated rice genetic transformation.

[0044] The constructed editing vector was transformed into Agrobacterium tumefaciens EHA105. The genetic transformation of rice was completed through eight stages: callus induction, subculture, Agrobacterium infection, recovery, first screening, second screening, differentiation and regeneration, and rooting and seedling growth. The culture media used during the transformation process are shown in Table 1. Detailed transformation procedures are as follows.

[0045]

[0046] (1) Callus induction: ZH11 mature brown rice was sterilized with 75% ethanol (1 min) and 3% NaClO (30 min), washed with sterile water, and then placed in callus induction medium and cultured in a light incubator (16 h / 8 h, 28℃) for about 28 days.

[0047] (2) Subculture: Select small, pale yellow callus granules and transfer them to subculture medium. Culture them under the same conditions for 5-7 days.

[0048] (3) Agrobacterium infection: Amplify positive colonies to OD600 = 0.6~0.8, soak the callus in the infection solution for 30 min (dark culture at 22℃), pour off the bacterial solution and transfer the callus to co-culture medium, and culture at 22℃ in the dark for 2~3 days.

[0049] (4) Recovery: Wash the callus thoroughly with sterile water, add 40 mL of sterile water and 90 μL of 250 mg / mL carboxybenzyl, shake for 30 min, dry and transfer to recovery medium (16 h / 8 h, 28℃) for 3-4 days.

[0050] (5) Screening: Screening was performed sequentially on first-screening (13-15 d) and second-screening (13-15 d) media containing Hygromycin B.

[0051] (6) Differentiation and rooting: Take small yellow callus and transfer it to the differentiation medium to regenerate seedlings. Select long-rooted green seedlings and transfer them to the rooting medium to strengthen the seedlings.

[0052] 2. Identification of T0 plant mutations

[0053] Genomic DNA was extracted from leaves of T0 transgenic seedlings and positive detection was performed using HPT primers. The amplification primers were:

[0054] HPT-F: 5'-CGAGAGCCTGACCTATTGCAT-3' (SEQ ID NO. 9);

[0055] HPT-R: 5'-CTGTCCCATACAAGCCAACCAC-3' (SEQ ID NO.10)

[0056] Positive single plants were subsequently amplified using primers designed at both ends of the editing target site, and sequencing was performed to determine the mutation type. The amplification primers were:

[0057] SBEIIb-PCR-F: 5'-AGCCTGTCGCCTGTATGGT-3' (SEQ ID NO. 7);

[0058] SBEIIb-PCR-R: 5'-AATGAATGCATTGAGTATATTTGAGT-3' (SEQ ID NO. 8)

[0059] The amplified fragment was 993 bp. The PCR amplification system (50 μL) consisted of: 1 μL template DNA, 2 μL each of upstream and downstream primers, 25 μL 2×Taq Master Mix, and 20 μL ddH2O. The amplification program was: 95℃, 5 min; 95℃, 15 s; 55℃, 15 s; 72℃, 1 min (33 cycles total); 72℃, 7 min; and 16℃ isothermal. After identification by 1% agarose gel electrophoresis, the amplified products were sequenced by Nanjing Qingke Biotechnology Co., Ltd. The sequencing results of the transgenic plants were compared with those of wild-type ZH11 to analyze the mutation type. Target site mutations obtained in positive T0 plants were as follows: Figure 1 As shown in C, the GG mutations at positions 139 and 140 of exon 16 are heterozygous mutations of AA, corresponding to the amino acid substitution mutations M610M-I / D611D-N.

[0060] Example 4

[0061] Screening and identification of T1 generation homozygous mutants without exogenous genes

[0062] The offspring T1 plants of the heterozygous mutant single plants identified in Example 3 were screened for exogenous gene-free single plants. Figure 2 First, HPT marker genes were initially screened using HPT-F / HPT-R to select negative single plants. Figure 2 A); then Cas9 and gRNA elements were detected using Cas9-F / Cas9-R and gRNA-F / gRNA-R, and the internal control was amplified using Actin-F / Actin-R. Finally, single strains that were negative for HPT, Cas9, and gRNA were screened out. Figure 2 B), the identification primers are:

[0063] Cas9-F: 5'-CACCATCTACCACCTGAGAA-3' (SEQ ID NO. 11);

[0064] Cas9-R: 5'-CGAAGTTGCTCTTGAAGTTG-3' (SEQ ID NO. 12);

[0065] gRNA-F: 5'-ATTCTCTTCGCTGTGATGGGCT-3' (SEQ ID NO. 13);

[0066] gRNA-R: 5'-CTGCACTTCAAACAAGTGTGACAAA-3' (SEQ ID NO. 14);

[0067] Actin-F: 5'-CCAAGGCCAATCGTGAGAAGA-3' (SEQ ID NO. 15);

[0068] Actin-R: 5'-AATCAGTGAGATCACGCCCAG-3' (SEQ ID NO. 16).

[0069] The above-mentioned single plants without exogenous genes were sequenced again for the target sites. Figure 2 C), to obtain the homozygous mutant type. T2 seeds of the M610I / D611N homozygous mutant were used for subsequent propagation and phenotypic identification.

[0070] The mutation of GG to AA at positions 139 and 140 of exon 16 of the OsSBEIIb gene, and the resulting mutation of replacing M and D at positions 610 and 611 of the rice SBEIIb protein with I and N, respectively, are reported for the first time in this invention.

[0071] Example 5

[0072] Analysis of the appearance quality, starch composition and characteristics of mutant rice

[0073] In this embodiment, the wild type (WT) of Zhonghua 11 and its derived M610I / D611N and ae mutants were used as experimental materials, with WT and ae serving as control materials, and the traits were compared and analyzed.

[0074] 1. Appearance quality of rice

[0075] like Figure 3 As shown in Figure A, the polished rice was observed under reflected and transmitted light, respectively. WT grains were plump and translucent, while M610I / D611N showed a distinctly powdery appearance, but was still superior to the ae mutant. Further, 100 whole polished rice grains were randomly selected for grain length, width, thickness, and 100-grain weight measurements, repeated 10 times. First, the 100-grain weight was measured using an analytical balance. Then, the grain length and width were measured using a rice appearance quality analyzer (SC-E) from Hangzhou Wanshen Company. Next, the grain thickness was measured using a digital micrometer thickness gauge (32CHQF1030) from Deqing Shengtongxin Electronics Technology Co., Ltd. The results showed that although the grain width, thickness, and weight of M610I / D611N were reduced, they were still significantly higher than those of the ae mutant (…). Figure 3 B). Finally, the chalkiness traits of rice were analyzed using the Hangzhou Wanshen Rice Appearance Quality Analyzer (SC-E). The results showed that although the chalky grain rate, chalky area, and chalkiness of M610I / D611N were significantly increased, they were all significantly lower than those of the ae mutant ( Figure 3 C).

[0076] 2. Starch component analysis

[0077] The amylose content was first determined using the starch-iodine colorimetric method. Since the long branched side chains in amylopectin can also bind to iodine, the amylose content measured using the iodine colorimetric method is called the apparent amylose content (AAC). The apparent amylose content of the M610I / D611N mutant significantly increased from 17.1% to 33.0%, but was lower than that of the ae mutant (37.4%). Figure 4 ).

[0078] To eliminate the influence of amylopectin chain length distribution on the determination of amylose content, this invention further employs the concanavalin A (ConA) precipitation method to determine the amylose content. ConA can selectively bind and precipitate amylopectin; therefore, the ratio of amylose to total starch measured by this method is unaffected by amylopectin chain length distribution or starch purity, and is often referred to as the true amylose content (TAC). The ConA method results showed that the true amylose content of the M610I / D611N mutant increased from 13.8% in the wild type to 20.3%, but was lower than that of the ae mutant (23.0%). Figure 4 The difference between apparent amylose content and true amylose content (AAC - TAC) reflects the change in the proportion of long side chains in amylopectin; a larger difference indicates a higher proportion of long side chains. In the M610I / D611N mutant, this difference increased from 3.3% in the wild type to 12.7%, but was lower than that in the _ae_ mutant (14.3%). Figure 4 This indicates that the M610I / D611N mutant has a significantly increased proportion of long branched starch side chains, but its mutational effect is weaker than that of the ae mutant.

[0079] 3. Crystal structure of starch

[0080] The crystal structure of starch was analyzed using a Bruker D8 X-ray powder diffractometer. The X-ray diffraction patterns showed that WT exhibited strong diffraction peaks at 2θ 15º and 23º, and connected double peaks at 17º and 18º, indicating type A starch. M610I / D611N showed a distinct type B crystal diffraction peak at 2θ 5.6º, a single peak at 17º, and shoulder peaks at 22º and 24º, indicating type C starch. B Type B starch; type A starch has a diffraction peak at 5.6º, a single peak at 17º, and double peaks at 22º and 24º, which is typical of type B starch. Figure 5 The relative crystallinity of starch in M610I / D611N decreased from 28.7% in WT to 22.3%, while the relative crystallinity of ae starch was 21.6%, indicating that the amylopectin structure altered the starch crystal structure.

[0081] 4. Thermodynamic properties of starch

[0082] The thermodynamic properties of starch were analyzed using a Netzsch 200-F3 differential scanning calorimeter. The results showed that the gelatinization temperature, gelatinization enthalpy, and gelatinization temperature range of M610I / D611N were significantly higher than those of WT, but not significantly different from those of ae (Table 2), which is consistent with the changes in its crystal structure.

[0083]

[0084] Note: Data in the table are mean ± standard deviation. Data with different letters in the same column indicate significant differences (p < 0.05). To: gelatinization onset temperature; Tp: gelatinization peak temperature; Tc: gelatinization termination temperature; ΔT: gelatinization temperature range (Tc-To); ΔH: gelatinization enthalpy.

[0085] 5. Resistant starch content of rice

[0086] This study used the resistant starch assay kit (K-RSTAR) from Megazyme, Ireland, to determine the resistant starch content of fresh rice. Figure 6 The resistant starch content of WT was 0.74%, while that of M610I / D611N was 3.72%, approximately five times higher than that of WT. The resistant starch content of ae was 7.71%, which is basically consistent with the literature reports.

[0087] Based on the above results, the starch composition, crystal structure, and gelatinization characteristics of M610I / D611N showed significant changes, with a 5-fold increase in resistant starch content in cooked rice. Furthermore, its impact on rice appearance quality was less than that of the SBEIIb protein-completely deleted mutant ae. Therefore, the homozygous SBEIIb-M610I / D611N gene allelic mutant without exogenous genes provided by this invention is a valuable germplasm resource, offering an effective example for rapidly creating new functional rice lines with high resistant starch using a base editing window collaborative editing strategy.

[0088] SEQ ID No.1

[0089] WT's SBEIIb gene sequence:

[0090]

[0091] SEQ ID No.2

[0092] SBEIIb mutant amino acid sequence of WT:

[0093] MAAPASAVPGSAAGLRAGAVRFPVPAGARSWRAAAELPTSRSLLSGRRFPGAVRVGGSGGRVAVRAAGASGEVMIPEGESDGMPVSAGSDDLQLPALDDELSTEVGAEVEIESSGASDVEGVKRVVEELAAEQKPRVVPPTGDGQKIFQMDSMLNGYKYHLEYRYSLYRRLRSDIDQYEGGLETFSRGYEKFGFNHSAEGVTYREWAPGAHSAALVGDFNNWNPNADRMSKNEFGVWEIFLPNNADGSSPIPHGSRVKVRMETPSGIKDSIPAWIKYSVQAAGEIPYNGIYYDPPEEEKYIFKHPQPKRPKSLRIYETHVGMSSTEPKINTYANFRDEVLPRIKKLGYNAVQIMAIQEHAYYGSFGYHVTNFFAPSSRFGTPEDLKSLIDKAHELGLVVLMDVVHSHASNNTLDGLNGFDGTDTHYFHSGSRGHHWMWDSRLFNYGNWEVLRFLLSNARWWLEEYKFDGFRFDGVTSMMYTHHGLQVAFTGNYSEYFGFATDADAVVYLMLVNDLIHGLYPEAITIGEDVSGMPTFALPVQDGGVGFDYRLHMAVPDKWIELLKQSDESWKMGDIVHTLTNRRWSEKCVTYAESHDQALVGDKTIAFWLMDKDMYDFMALDRPATPSIDRGIALHKMIRLITMGLGGEGYLNFMGNEFGHPEWIDFPRAPQVLPNGKFIPGNNNSYDKCRRRFDLGDADYLRYRGMLEFDRAMQSLEEKYGFMTSDHQYISRKHEEDKMIIFEKGDLVFVFNFHWSNSYFDYRVGCLKPGKYKVVLDSDAGLFGGFGRIHHTAEHFTADCSHDNRPYSFSVYSPSRTCVVYAPAE*;

[0094] SEQ ID No.3

[0095] SBEIIb gene sequence of the M610I / D611N mutant:

[0096]

[0097] SEQ ID No.4

[0098] SBEIIb mutant amino acid sequence of M610I / D611N:

[0099] MAAPASAVPGSAAGLRAGAVRFPVPAGARSWRAAAELPTSRSLLSGRRFPGAVRVGGSGGRVAVRAAGASGEVMIPEGESDGMPVSAGSDDLQLPALDDELSTEVGAEVEIESSGASDVEGVKRVVEELAAEQKPRVVPPTGDGQKIFQMDSMLNGYKYHLEYRYSLYRRLRSDIDQYEGGLETFSRGYEKFGFNHSAEGVTYREWAPGAHSAALVGDFNNWNPNADRMSKNEFGVWEIFLPNNADGSSPIPHGSRVKVRMETPSGIKDSIPAWIKYSVQAAGEIPYNGIYYDPPEEEKYIFKHPQPKRPKSLRIYETHVGMSSTEPKINTYANFRDEVLPRIKKLGYNAVQIMAIQEHAYYGSFGYHVTNFFAPSSRFGTPEDLKSLIDKAHELGLVVLMDVVHSHASNNTLDGLNGFDGTDTHYFHSGSRGHHWMWDSRLFNYGNWEVLRFLLSNARWWLEEYKFDGFRFDGVTSMMYTHHGLQVAFTGNYSEYFGFATDADAVVYLMLVNDLIHGLYPEAITIGEDVSGMPTFALPVQDGGVGFDYRLHMAVPDKWIELLKQSDESWKMGDIVHTLTNRRWSEKCVTYAESHDQALVGDKTIAFWLINKDMYDFMALDRPATPSIDRGIALHKMIRLITMGLGGEGYLNFMGNEFGHPEWIDFPRAPQVLPNGKFIPGNNNSYDKCRRRFDLGDADYLRYRGMLEFDRAMQSLEEKYGFMTSDHQYISRKHEEDKMIIFEKGDLVFVFNFHWSNSYFDYRVGCLKPGKYKVVLDSDAGLFGGFGRIHHTAEHFTADCSHDNRPYSFSVYSPSRTCVVYAPAE*;

[0100] SEQ ID No.5:sgRNA-SBEIIb-F:tgtgtgttgcattctggttgatggac;

[0101] SEQ ID No.6:sgRNA-SBEIIb-R:aaacgtccatcaaccagaatgcaaca1

[0102] SEQ ID No.7:SBEIIb-PCR-F:agcctgtcgcctgtatggt;

[0103] SEQ ID No.8:SBEIIb-PCR-R:atgaatgcattgagtatatttgagt1

[0104] SEQ ID No.9:HPT-F:cgagagcctgacctattgcat;

[0105] SEQ ID NO.10:HPT-R:ctgctccatacaagccaaccac;

[0106] SEQ ID NO.11:Cas9-F:caccatctaccacctgagaa;

[0107] SEQ ID NO.12:Cas9-R:cgaagttgctcttgaagttg;

[0108] SEQ ID NO.13:gRNA-F:attctcttcgctgtgatgggct;

[0109] SEQ ID NO.14:gRNA-R:ctgcacttcaaacaagtgtgacaaa;

[0110] SEQ ID NO.15:Actin-F:caaggccaatcgtgagaaga.

[0111] SEQ ID NO.16:Actin-R:aatcagtgagatcacgcccag;

[0112] SEQ ID NO.17: specific sequence: TTGCATTCTGGTTGATGGACAAG.

[0113] SEQ ID NO.18: specific sequence: CTTGTCCATCAACCAGAATGCAA.

Claims

1. A rice SBEIIb mutant protein, characterized in that, Its amino acid sequence is shown in SEQ ID NO.4; compared with the wild-type SBEIIb protein SEQ ID NO.2, the mutant protein has M replaced with I at position 610 and D replaced with N at position 611; the amino acid sequence of the wild-type SBEIIb protein is shown in SEQ ID NO.

2.

2. A mutant gene encoding the rice SBEIIb mutant protein of claim 1.

3. The mutant gene according to claim 2, characterized in that, The nucleotide sequence of the mutant gene is shown in SEQ ID NO.3; compared with the wild-type SBEIIb gene, the mutant gene has G replaced with A at position 139 of exon 16 and G replaced with A at position 140; the nucleotide sequence of the wild-type SBEIIb gene is shown in SEQ ID NO.

1.

4. An expression cassette or recombinant vector, characterized in that, It contains the mutant gene as described in claim 2 or 3.

5. The application of the rice SBEIIb mutant protein of claim 1, the mutant gene of claim 2 or 3, or the expression cassette or recombinant vector of claim 4 in rice quality improvement breeding.

6. The application according to claim 5, characterized in that, The rice quality improvement includes increasing the amylose content of the rice.

7. The application according to claim 5, characterized in that, The rice quality improvement breeding includes one or both of the following: altering the starch crystal structure of rice or increasing the content of resistant starch in rice.

8. The application according to claim 7, characterized in that, The alteration of the rice starch crystal structure includes converting rice starch from A-type to C-type. B - and reduces the relative crystallinity of starch.

9. A method for identifying homozygous mutant rice, characterized in that, Includes the following steps: Genomic DNA was extracted from the rice plants to be tested, and PCR amplification was performed on the Cas9 gene, gRNA element, and HPT marker gene to identify them, and single plants without Cas9, gRNA, and HPT were obtained. The single strains that do not contain Cas9, gRNA, and HPT were subjected to PCR amplification and sequencing identification of the target sites again.

10. The method according to claim 9, characterized in that, The nucleotide sequences of the primers used to identify the Cas9 gene are shown in SEQ ID NO.11 and SEQ ID NO.12; the nucleotide sequences of the primers used to identify the gRNA element are shown in SEQ ID NO.13 and SEQ ID NO.14; and the nucleotide sequences of the primers used to identify the HPT marker gene are shown in SEQ ID NO.9 and SEQ ID NO.10.

Images