Application of smERF114 transcription factor in improving plant resistance to bacterial wilt
By identifying and regulating the SmERF114 transcription factor in eggplant, we revealed its regulatory mechanism in the SA, Eth, and ABA signaling pathways, which solved the problem of unclear function of eggplant ERF transcription factors in bacterial wilt resistance and achieved the effect of improving plant disease resistance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SOUTH CHINA AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-03-20
- Publication Date
- 2026-06-23
Smart Images

Figure CN122256369A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and in particular relates to the application of the SmERF114 transcription factor in improving plant resistance to bacterial wilt. Background Technology
[0002] Bacterial wilt, caused by *Ralstonia solanacearum*, is a devastating soil-borne bacterial disease that poses a serious threat to global agricultural production. This pathogen has a wide host range, infecting more than 200 plant species, including tomatoes, potatoes, bananas, eggplants, and peppers. It is particularly rampant in hot and humid environments, often leading to large-scale yield reductions or even crop failure. *Ralstonia solanacearum* invades the plant through the roots, spreading and multiplying rapidly within the vascular system, blocking water transport, and ultimately causing the plant to exhibit typical wilting symptoms. Statistics show that the incidence of bacterial wilt in eggplant can reach 50%-80% in severely affected areas, causing huge economic losses to farmers. Therefore, developing resistant varieties is an effective means of combating bacterial wilt.
[0003] In the process of co-evolution between plants and pathogens, plants have developed a complex immune system to defend against pathogen invasion. Transcription factors, as key molecules regulating gene expression, play a central role in plant immune responses. Studies have found that SmWRKY30 may play a positive regulatory role in eggplant resistance to bacterial wilt, and its high expression is closely related to eggplant resistance to this disease. In potato, StNACb4 can respond to the induction of salicylic acid, abscisic acid, and methyl jasmonic acid, providing important new insights into the regulatory mechanism of potato resistance to bacterial wilt. Furthermore, previous studies have found that SmNAC can negatively regulate eggplant resistance to bacterial wilt through the SA signaling pathway. These studies not only identify several key transcription factors involved in eggplant resistance to bacterial wilt but also lay the foundation for elucidating eggplant disease resistance signaling pathways.
[0004] The AP2 / ERF transcription factor family (APETALA2 / ethylene-responsive factor) is one of the largest transcription factor families in plants, attracting significant attention due to its central role in plant responses to biotic and abiotic stresses. Studies have shown that ERF transcription factors not only participate in the regulation of plant growth and development but also play a crucial role in stress defense responses, serving as an important bridge connecting plant hormone signals and defense gene expression. Based on the number and sequence characteristics of AP2 / ERF domains, this family can be divided into four subfamilies: AP2, RAV, ERF, and DREB, with the ERF and DREB subfamilies being most closely related to plant stress responses. Ethylene-responsive factor proteins are unique transcription factors in plants, containing one or more highly conserved AP2 / ERF domains composed of 57-66 amino acid residues. Based on sequence similarity and the number of AP2 / ERF domains, the AP2 / ERF multigene family is further divided into the AP2, DREB / CBF, ERF, and RAV subfamilies. The ERF subfamily contains a conserved AP2 domain that recognizes promoter sequences containing GCC-box or DRE / CRT (dehydration response element / C-repeat) cis-acting elements to regulate target gene expression. Therefore, these family proteins are of significant importance in plant resistance to abiotic or biotic stresses.
[0005] ERF transcription factors, as key regulators of plant stress responses, participate in the regulation of responses to various biotic stresses (including pathogen infection) and abiotic stresses (such as temperature, salinity, and drought). In tomato, SlERF1a has been shown to regulate systemic resistance induced by Bacillus cereus AR156, and silencing this gene significantly increases the susceptibility of tomatoes to bacterial wilt. In pepper, ERF098 regulates the expression of multiple defense-related genes by forming homodimers, while the Ralstonia solanacearum effector protein RipAK enhances plant susceptibility by inhibiting ERF098 dimerization. In soybean roots, the GsERF7 gene can be phosphorylated by the GsSnRK1 protein at the S36 site, thereby enhancing the plant's resistance to salt stress. ERF transcription factors mainly participate in plant immune responses by regulating the expression of downstream defense-related genes. These genes include pathogenesis-related proteins (PR proteins), phytoalexin synthesis genes, and cell wall reinforcement-related genes. For example, StoERF109, discovered in wild eggplant (Solanum torvum), has been shown to positively regulate plant resistance to Verticillium dahliae by modulating the expression of defense genes such as StoABR1 and StoAOS. When StoERF109 function was weakened using gene silencing technology, the expression levels of key defense genes significantly decreased; conversely, transient overexpression of StoERF109 could activate defense genes such as StoNPR1 and StoEDS1 to form an effective defense system. Notably, studies in wild eggplant (Solanum torvum) have found that the ERF transcription factor StoERF109 directs disease resistance through the jasmonic acid / ethylene signaling pathway. Furthermore, in Chinese cabbage, the BrERF72 gene regulates leaf senescence by upregulating the expression of jasmonic acid biosynthesis genes BrLOX4, BrAOC3, and BrOPR3. This discovery provides a new perspective on understanding the working mechanism of eggplant ERF transcription factors, suggesting that ERFs may coordinate plant immune responses by integrating multiple hormone signaling pathways.
[0006] Despite significant progress in recent years in the study of eggplant ERF transcription factors, several limitations remain. The specific functions of most SmERFs are still unclear, and their precise role and regulatory mechanisms in the eggplant bacterial wilt resistance signaling network are poorly understood. Furthermore, existing research largely focuses on gene expression analysis and simple functional verification, with limited research on their downstream target genes and cross-talk with other signaling pathways. How ERF transcription factors integrate hormone signals such as ethylene, jasmonic acid, salicylic acid, and abscisic acid, and how they synergistically regulate defense responses with other transcription factor families such as WRKY and NAC, are all unresolved questions. Summary of the Invention
[0007] To address the shortcomings of existing technologies, this invention provides the application of the SmERF114 transcription factor in improving plant resistance to bacterial wilt. Through yeast one-hybrid and functional verification experiments, this invention systematically identifies key transcription factors involved in bacterial wilt resistance in eggplant and their functions, revealing the molecular immune mechanism of eggplant against Ralstonia solanacearum infection. It also provides important gene resources and theoretical basis for the genetic improvement of eggplant disease resistance, which is of great significance for ensuring safe eggplant production and promoting the healthy development of the vegetable industry.
[0008] To achieve the above objectives, the present invention provides the following technical solution:
[0009] The first aspect concerns the application of the eggplant SmERF114 gene in enhancing plant stress resistance, specifically in any of the following areas:
[0010] 1) Enhance plant resistance to Ralstonia solanacearum;
[0011] 2) Breeding and improving disease-resistant transgenic plants;
[0012] The nucleotide sequence of the eggplant stress resistance gene SmERF114 is shown in SEQ ID NO. 1; its amino acid sequence is shown in SEQ ID NO. 2.
[0013] Preferably, the plant is eggplant, tomato, or tobacco.
[0014] Furthermore, plant stress resistance was improved by upregulating the expression of the SmERF114 gene in plants.
[0015] Furthermore, the upregulation is achieved by overexpressing the SmERF114 gene in plants.
[0016] The second aspect concerns the application of an isolated nucleic acid molecule in the preparation of products for enhancing plant stress resistance, said isolated nucleic acid molecule being selected from the group consisting of:
[0017] a) Has a nucleotide sequence as shown in SEQ ID NO: 1;
[0018] b) A nucleotide sequence having at least 80%, 90%, 95% or 99% sequence identity with the nucleotide sequence described in a), and encoding a protein that enhances plant resistance to bacterial wilt stress;
[0019] The plant in question is an eggplant, tomato, or tobacco.
[0020] Thirdly, the use of an isolated protein in the preparation of a product for improving plant stress resistance, wherein the isolated protein is a protein encoded by a nucleic acid molecule as described in claim 3a) or b); and the plant is eggplant, tomato, or tobacco.
[0021] Fourthly, the present invention also provides a method for cultivating disease-resistant transgenic plant varieties, which involves transforming a vector, expression cassette, transgenic cell line or transgenic recombinant bacteria containing SmERF114 gene overexpression into plant cells, tissues or organs, and then cultivating the transformed plant cells, tissues or organs to obtain disease-resistant transgenic plants; the nucleotide sequence of the SmERF114 gene is shown in SEQ ID NO. 1, and the plant is eggplant, tomato or tobacco.
[0022] Compared with the prior art, the beneficial effects of the present invention are:
[0023] This invention identifies that SmERF114 can directly bind to the SmDDA1b promoter region. Furthermore, SmERF114 not only participates in eggplant resistance to bacterial wilt through the SA signaling pathway of the SmDDA1b pathway, but may also participate in eggplant resistance to bacterial wilt through the Eth and ABA signaling pathways. Gene silencing experiments with SmERF114 confirmed that SmERF114 positively regulates eggplant resistance to bacterial wilt. Transient overexpression of SmERF114 further indicates that SmERF114 is a positive regulator in the process of eggplant resistance to bacterial wilt. These findings suggest that this gene can be applied to improve plant resistance mechanisms to bacterial wilt, providing a scientific basis for its role in plant resistance to abiotic or biotic stresses. Attached Figure Description
[0024] Figure 1 Transcription factors SmAP2, SmERF114, SmMYB44, and SmNAC directly interact with the SmDDA1b promoter;
[0025] Figure 2 Alignment of SmERF114 coding region sequence (CDS) in high-resistance material “E31” and high-sensitivity material “E32”;
[0026] Figure 3 Sequence alignment of the SmERF114 promoter (first 2000 bp of ATG) in the highly reactive material “E31” and the highly sensitive material “E32”;
[0027] Figure 4 SmERF114 protein sequence alignment and homologous gene evolution analysis;
[0028] Figure 5 Subcellular localization of SmERF114;
[0029] Figure 6 SmERF114 tissue expression pattern and expression analysis of Ralstonia solanacearum inoculation treatment;
[0030] Figure 7Expression analysis of SmERF114 in hormone spraying treatments in different resistant materials;
[0031] Figure 8 VIGS and phenotypic analysis of SmERF114;
[0032] Figure 9 Expression patterns of related disease resistance genes after SmERF114 gene silencing;
[0033] Figure 10 Transient overexpression and phenotypic analysis of SmERF114;
[0034] Figure 11 Analysis of hormone pathway gene expression in plants with silenced SmERF114 gene;
[0035] Figure 12 Analysis of hormone pathway gene expression in SmERF114 overexpressing plants. Detailed Implementation
[0036] The technical solution of the present invention will be clearly and completely described below with reference to embodiments and comparative examples. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0038] 1. Materials and Methods
[0039] 1.1 Materials
[0040] Plant materials: Eggplant bacterial wilt-resistant inbred line “E31” and eggplant bacterial wilt-sensitive inbred line “E32” were grown in culture room 419 of the College of Horticulture, South China Agricultural University, under the following conditions: 26℃ / 14 h light, 22℃ / 10 h darkness. Nicotiana benthamiana was grown under the following conditions: 22℃ / 14 h light, 20℃ / 10 h darkness.
[0041] Strains used: Escherichia coli DH5α (Weidi Bio), Agrobacterium strain GV3101, and Ralstonia solanacearum strain GMI1000.
[0042] Plasmids: pGreenII-c18, pTRV1, pTRV2, 1380 overexpression vector.
[0043] 1.2 RNA extraction from plant tissues
[0044] The kit used for extracting total RNA from plants was the Promega RNA Extraction Kit from Shanghai. All centrifuge tubes and pipette tips used in the experiment were de-RNase-treated.
[0045] (1) After sampling, the sample was immediately placed in liquid nitrogen for preservation, and the plant tissue was ground with liquid nitrogen until the sample was powdered. The sample was placed in a 1.5 ml centrifuge tube, 500 μl of RNA lysis buffer and 500 μl of RNA dilution buffer were added, the mixture was thoroughly shaken and mixed, and the sample was allowed to stand at room temperature for 5 min. Then it was centrifuged at 12000 rpm for 5 min.
[0046] (2) Transfer 600 μL of supernatant to 300 μL of anhydrous ethanol, mix well, transfer directly to a centrifuge column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid.
[0047] (3) Add 600 μL of RNA washing buffer, centrifuge at 12000 rpm for 1 min, and discard the waste liquid;
[0048] (4) Add 50 μL of incubation solution (preparation method as shown in Table 1) and let stand for 15 min;
[0049] Table 1. DNAase I incubation solution
[0050] (5) Add 600 μL of RNA washing buffer, centrifuge at 12000 rpm for 1 min, and discard the waste liquid;
[0051] (6) Repeat step (5);
[0052] (7) Remove the centrifuge column and centrifuge at 12,000 rpm for 2 min;
[0053] (8) Place the centrifuge column into a new 1.5 ml centrifuge tube, add 50 μL of nuclease-free water to the center of the adsorption membrane of the centrifuge column, let it stand at room temperature for 2 min, and centrifuge at 12000 rpm for 1 min;
[0054] (9) Use an ultra-micro spectrophotometer to detect the concentration and quality of RNA, and use 2% agarose gel electrophoresis to detect RNA bands; if the gel image shows 18S and 28S without dragging, the quality is good. Store the RNA sample at -80℃.
[0055] 1.3 RNA reverse transcription
[0056] The reverse transcription experiment converts RNA into cDNA. All centrifuge tubes and pipette tips used in the experiment were free of RNase.
[0057] (1) First, calculate the amount of RNA added when the concentration is 800 ng, and the amount of nuclease-free water added is the amount of RNA added;
[0058] (2) Add 2 μL of gDNA enzyme to a PCR tube that has been de-RNase removed, add the corresponding amount of RNA and let it stand at room temperature for 5 min.
[0059] (3) Add the corresponding amount of nuclease-free water and RT-Mix, mix by pipetting and centrifugation at low speed;
[0060] (4) Reverse transcription was performed using PCR, and the amplification procedure is shown in Table 2;
[0061] Table 2 Reverse Transcription Procedure
[0062] (5) After reverse transcription is completed, add 60 μL of ddH2O, dilute to 200 ng / μL, and store at -20℃ for later use.
[0063] 1.4 Real-time quantitative PCR and data analysis
[0064] The reaction system is shown in Table 3 below.
[0065] Table 3 qRT-PCR reaction system
[0066] After the reaction system was prepared, the reaction solution was aliquoted into 384 / 96-well PCR plates on ice and placed in a Bio-Rad CFX384 / 96 Touch quantitative PCR instrument for amplification. The amplification program is shown in Table 4.
[0067] Table 4 qPCR reaction procedure
[0068] Using SmCyclophilin as an internal reference gene in eggplant, Formula 2 was used. -ΔΔCt The relative expression levels of genes were calculated. t-tests, one-way ANOVA, and Least significant difference (LSD) multiple comparison analyses were all performed using IBM SPSS Statistics 20 software.
[0069] 1.5 Cloning and purification of the target gene
[0070] (1) Primer design: Primers for upstream and downstream of the target gene were designed using Primer 5.0 software and Vazyme's CE Design software. The primer sequences are shown in Table 10.
[0071] (2) Cloning of the target gene: The reaction system was 25 μL of PCR mixture, prepared on ice, and the components of the system are shown in Table 5. The PCR amplification reaction was carried out in a Bio-Rad PCR instrument, and the reaction program was: 98℃-10 s; 55℃-15 s; 72℃-kb / 5s; 35 cycles; 12℃-∞.
[0072] Table 5. PCR reaction system configuration for the target gene
[0073] (3) Take 2 μL of PCR product, add 0.3 μL of 6×Loading Buffer, mix well, and then perform electrophoresis on a 1% agarose gel to observe the length of the amplified product.
[0074] 1.6 Purification and recovery of the target fragment:
[0075] (1) Purification and recovery of the target fragment were performed using a gel extraction kit. The target band was cut off on a gel cutter and placed in a sterile 2 mL centrifuge tube;
[0076] (2) Add 500 μL of sol-buffered buffered GL and incubate in a 65°C metal bath for 4-6 min, inverting the centrifuge tube during the incubation until the gel is completely dissolved.
[0077] (3) Add 250 μL of Buffer BL to the centrifuge column to purify the silica membrane of the centrifuge column;
[0078] (4) Transfer the dissolved gel solution to a centrifuge column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid;
[0079] (5) Add 700 μL of Buffer W2 (pre-added with anhydrous ethanol according to the kit instructions) to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid;
[0080] (6) Repeat step (5);
[0081] (7) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 min;
[0082] (8) Take out the adsorption column and place it in a new 1.5 mL collection tube. Open the cap and let it stand for 2 min. Add 35 μL of ddH2O preheated to 65℃ to the silica membrane of the adsorption column. Let it stand at room temperature for 2 min. Centrifuge at 12000 rpm for 2 min and collect the liquid.
[0083] (9) Discard the adsorption column, use an ultra-micro spectrophotometer to detect the concentration and mass of the target fragment, and use agarose gel electrophoresis to detect the accuracy of the target band. Then store it at -20℃.
[0084] 1.7 Construction of Recombinant Vectors
[0085] Enzyme digestion: (1) The enzyme digestion system is shown in Table 6;
[0086] Table 6 Enzyme digestion reaction system
[0087] (2) Place the prepared reaction system in a PCR instrument, select different digestion temperatures (generally 37℃) according to the characteristics of different restriction endonucleases, digest for 2 h, and use 1% agarose gel electrophoresis to detect the migration rate of plasmids and digested plasmids to determine whether the plasmids have been linearized.
[0088] (3) After successful plasmid linearization, the restriction endonuclease was inactivated at 65℃ for 15 min. The obtained linearized vector was stored at -20℃ for later use.
[0089] Recombination reaction: (1) The reaction system is shown in Table 7 below.
[0090] Table 7 Recombination Reaction System
[0091] Note: X and Y represent the amount of the target gene and the linearized fragment added, respectively, where X:Y = 1:3 to 1:9.
[0092] (2) Use a pipette to mix the recombinant reaction system, centrifuge at low speed, place it in a PCR instrument, and react at 37°C for 20 min. After the reaction is complete, place it on ice for later use.
[0093] 1.8 Transformation of Escherichia coli with recombinant vector and identification of positive monoclonal strains
[0094] (1) Take out competent Escherichia coli DH5α cells from -80℃, thaw them on ice, add ligation product at a ratio of ligation product: competent cells = 1:10, and let stand on ice for 30 min;
[0095] (2) 42℃ metal bath / water bath for 60 s, then immediately place on ice and let stand for 2 min;
[0096] (3) Add 750 μL of LB liquid medium without any antibiotics, and incubate at 37°C and 200 rpm for 1 h;
[0097] (4) Centrifuge at 4500 rpm for 5 min, pour out the supernatant in a clean bench, and mix the remaining 50 μL of liquid by suction and beating to resuspend the bacterial culture. Use a spreader to evenly spread the bacterial culture on the corresponding resistant LB solid medium and incubate at 37℃ upside down for 12-15 h.
[0098] Identification of positive clones:
[0099] (1) Pick a single colony growing on LB solid medium and transfer it to 700 μL of LB liquid medium containing the corresponding antibiotic, and incubate at 37℃ and 200 rpm for 12 h.
[0100] (2) Prepare the bacterial culture PCR mixture system. The composition is shown in Table 8.
[0101] Table 8. Bacterial PCR Reaction System
[0102] (3) The PCR amplification program was: 95℃, 3 min; (95℃, 30 s; 55℃, 30 s; 72℃, xs) × 34 cycles; 72℃, 5 min;
[0103] (4) Perform PCR and agarose gel electrophoresis. Colonies that detect the target band are positive clones. Use 10 mL of LB liquid medium containing the corresponding antibiotic for amplification.
[0104] 1.9 Recombinant plasmid extraction
[0105] Extraction of recombinant plasmids:
[0106] (1) Add 250 μL of Buffer BL to the adsorption column to activate the silica membrane, and centrifuge at 12000 rpm for 1 min;
[0107] (2) Take 2 mL of overnight cultured bacterial solution into a 2 mL centrifuge tube, centrifuge at 12000 rpm for 1 min, discard the supernatant, and collect the bacterial cells. Take another 2 mL of overnight cultured bacterial solution and add it into a 2 mL centrifuge tube containing bacterial cells, and repeat step (2) once.
[0108] (3) Add 250 μL Buffer PA and vortex the bacterial solution until the bacteria are completely resuspended in a sterile block at the bottom of the centrifuge tube;
[0109] (4) Add 250 μL of Buffer PB and mix by inverting the container 6-8 times;
[0110] (5) Add 350 μL Buffer PC, invert and mix 6-8 times, centrifuge at 12000 rpm for 10 min, and discard the waste liquid;
[0111] (6) Place the adsorption column back into the collection tube, add 500 μL of Buffer PWA, and centrifuge at 12000 rpm for 1 min;
[0112] (7) Place the adsorption column back into the collection tube, add 600 μL of Buffer PWB, and centrifuge at 12000 rpm for 1 min;
[0113] (8) Repeat step (7);
[0114] (9) Return the adsorption column to the collection tube and centrifuge at 12,000 rpm for 2 min;
[0115] (10) Put the adsorption column back into the new collection tube, open the cap, let stand for 2 min, add 35 μL of ddH2O, let stand at room temperature for 2 min, and centrifuge at 12000 rpm for 2 min.
[0116] (11) Use an ultra-micro spectrophotometer to detect the concentration and quality of the extracted plasmid. After the quality is qualified, store it at -20℃ for later use.
[0117] 1.10 Transformation of Agrobacterium with recombinant plasmids and identification of positive clones
[0118] Agrobacterium-mediated transformation:
[0119] (1) Remove the Agrobacterium competent cells at -80℃, hold them in your hand, and wait for them to melt into an ice-water mixture. Place them on ice to continue dissolving. Add 1-2 μL of recombinant plasmid to the competent cells and incubate on ice for 30 min.
[0120] (2) Freeze in liquid nitrogen for 5 min, heat shock at 37℃ for 90 s, ice bath for 2 min, add 700 μL of antibiotic-free YEP liquid medium, and activate at 28℃ and 200 rpm for 2 h in a shaker.
[0121] (3) Centrifuge at 5000 rpm for 5 min, pour out the supernatant in a clean bench, mix well and spread evenly on YEP solid medium containing the corresponding antibiotic, and incubate in an inverted incubator at 28℃ for 36 h.
[0122] Positive single colony identification:
[0123] (1) Pick a single colony growing on YEP solid medium and put it into 700 μL of YEP liquid medium containing the corresponding antibiotic, and incubate at 37℃ and 200 rpm for 12 h.
[0124] (2) Prepare the bacterial culture PCR mixture system, and refer to the table for the composition;
[0125] (3) The PCR amplification program was: 95℃, 3 min; (95℃, 30 s; 55℃, 30 s; 72℃, xs) × 34 cycles; 72℃, 5 min;
[0126] (4) Perform PCR and agarose gel electrophoresis. Colonies that detect the target band are positive clones. Use 10 mL of LB liquid medium containing the corresponding antibiotic for amplification.
[0127] 1.11 Specific expression analysis of the target gene in different tissues of the plant
[0128] RNA was extracted from the roots, lower stem, and upper stem (divided equally based on the distance from the root to the leaf, with the part closer to the root being the lower stem and the part closer to the leaf being the upper stem) and leaves of healthy, uniformly grown eggplant materials "E31" and "E32" at the four-leaf-one-heart stage. After reverse transcription, qRT-PCR was performed for detection. At least three biological replicates were required for each tissue part, and data processing used a 23... -△△ct Significant differences were determined using a T-test, and the primers are shown in Table 10.
[0129] 1.12 Isolation of Ralstonia solanacearum
[0130] (1) Collect diseased plants of Ralstonia solanacearum from the field, select the stem end of the plant near the root, rinse it with clean water and spray it with 75% ethanol before placing it in a clean bench.
[0131] (2) Use sterilized scissors to cut the diseased stem segments into pieces, and disinfect them with 75% ethanol for 90 seconds. Rinse with sterile water 3-5 times until the alcohol is completely rinsed off. Soak in 2% NaClO solution for 10-15 minutes. Rinse with sterile water 3-5 times, then blot dry on filter paper. Place in 10-15 mL of sterile water and shake thoroughly for 10 minutes.
[0132] (3) When the sterile water becomes turbid, use a streak pen to take a portion of the bacterial solution and streak it onto TTC solid medium (10 g / L peptone, 1 g / L casein, 5 g / L glucose, 17 g / L agar, sterilized at 121℃ for 20 min, pH adjusted to 7.0-7.2, cooled to 60℃ and then 0.005% TTC solution was added) and incubated in an inverted 30℃ incubator for 48 h.
[0133] (4) After 48 h, observe whether there are pink, highly mobile colonies with white edges on the TTC solid medium. If colonies in this state are present, pick the colonies for PCR detection of Ralstonia solanacearum specific genes. If the target band can be amplified, Ralstonia solanacearum is successfully isolated. The primers for Ralstonia solanacearum cloning are shown in Table 10.
[0134] 1.13 Statistics on Ralstonia solanacearum inoculation and disease incidence and disease index in eggplant
[0135] (1) Use a streak plaster to streak the isolated Ralstonia solanacearum solution onto TTC solid medium and incubate upside down at 30℃ for 2-3 days. Pick a single colony and incubate it in 10 mL of TTC liquid medium at 30℃ and 200 rpm until the OD value of the bacterial solution is 0.6-1.0;
[0136] (2) Use pure water to dilute the bacterial solution to an OD value of 0.4-0.6 for later use. Pull out healthy eggplant seedlings with uniform growth at the four-leaf and one-heart stage, and use scissors to cut the roots. The cut root length is about 1 / 3 of the total root length. Then plant them in pots. Pour 50 mL of the prepared Ralstonia solanacearum bacterial solution into the treated plants. Pour an equal volume of TTC liquid medium diluted to the same concentration into the control plants. Keep the plants moist. Place the treated plants in an environment with 28-30℃ / 14 h light conditions and 24-26℃ / 10 h darkness conditions for cultivation.
[0137] (3) After the plants develop the disease, the incidence rate and disease index are statistically analyzed:
[0138] Incidence rate = Number of diseased plants / Total number of plants;
[0139] Disease incidence index = ∑ (disease severity level × number of plants with disease at the corresponding level) / (highest disease severity level × total number of plants) × 100;
[0140] Disease severity grading: Grade 0: Healthy; Grade 1: 1-2 leaves wilted; Grade 2: 3 or more leaves wilted; Grade 3: All leaves wilted; Grade 4: Plant dead.
[0141] 1.14 Ralstonia solanacearum treatment and hormone sampling methods
[0142] (1) Ralstonia solanacearum inoculation: Healthy eggplant plants “E31” and “E32” that have grown to the four-leaf-one-heart stage were inoculated with Ralstonia solanacearum. Eggplant plants with the same growth were sampled at 1 day, 3 days, 4 days, 7 days and 10 days after treatment. At least three biological replicates were selected at each time point.
[0143] (2) Hormone treatment: Healthy eggplant plants "E31" and "E32" at the four-leaf-one-heart stage were selected as experimental materials and sprayed with salicylic acid (SA), methyl jasmonate (MeJA), ethephon, and abscisic acid (ABA) at concentrations of 0.072 mg / L, 1.0 mg / L, 0.5 g / L, and 52.8 mg / L, respectively, until the eggplant leaves were covered with water droplets. Eggplant plants with uniform growth were sampled at 1 h, 3 h, 6 h, and 12 h after treatment, with at least 3 biological replicates at each time point.
[0144] 1.15 Subcellular localization of the target gene
[0145] (1) The CDS sequence of the target gene with the stop codon removed was constructed into the pEAQ-EGFP vector using the above method (single enzyme digestion clone, the enzyme digestion site is Age I).
[0146] (2) Transform the recombinant plasmid into Agrobacterium GV3101 according to the above method;
[0147] (3) Pick positive monoclonal colonies and inoculate them into 400 μL of YEP liquid medium containing antibiotics (50 μg / mL Kan, 50 μg / mL Rif), place them in a shaker at 28℃ and 200 rpm for 10-12 h, and at the same time spread Agrobacterium containing nuclear localization signal (NLS) on YEP solid medium;
[0148] (4) At a ratio of 1:100, take 100 μL of the initial shaken bacterial culture into 10 mL of YEP liquid medium containing antibiotics (50 μg / mL Kan, 50 μg / mL Rif), and incubate in a shaker (28℃, 200 rpm) until the OD value is between 0.6 and 1.0.
[0149] (5) Centrifuge the bacterial culture at 5000 rpm for 5-10 min using a high-speed centrifuge, discard the waste liquid, collect the bacterial cells, resuspend Agrobacterium in the infection solution (10 mM MgCl2, 10 mM MES, 100 μM AS), adjust the OD value to around 0.6, and place it in a dark environment at 28℃ for 2 h to activate.
[0150] (6) Mix the activated Agrobacterium tumefaciens culture with the pEAQ-EGFP-target gene and the Agrobacterium tumefaciens culture with pEAQ-EGFP with the Agrobacterium tumefaciens culture with nuclear localization signal (NLS) at a volume ratio of 1:1.
[0151] (7) Using a 1 mL syringe with the needle removed, inject the mixed bacterial solution from the back of the tobacco leaf into the tobacco until the tobacco leaf is waterlogged. Each combination should be injected into at least 3 tobacco plants.
[0152] (8) Place the infected tobacco in a 24℃ culture room and culture in the dark for 48 h, then culture in the light for 24-48 h. Observe the fluorescence signal of the tobacco leaves using a fluorescence microscope.
[0153] 1.16 Virus-induced gene silencing (VIGS)
[0154] (1) Upload the full-length CDS sequence of the target gene to the Solanaceae database VIGS Tool to predict the optimal silencing fragment for the gene;
[0155] (2) Referring to the above vector construction methods, the optimal silencing fragment of the target gene was constructed into the pTRV2 vector, and the amplification primers are shown in Table 10;
[0156] (3) Transform the recombinant plasmid into Agrobacterium competent cells GV3101;
[0157] (4) The recombinant plasmids of pTRV1, pTRV2 and pTRV2-target genes were respectively spread on YEP solid medium containing the corresponding antibiotics for activation and incubated in an inverted incubator at 28℃ for 2-3 days;
[0158] (5) Pick a single clone from YEP solid medium into 400 μL of YEP liquid medium containing antibiotics (50 μg / mL Kan, 50 μg / mL Rif), and place it in a shaker at 28℃ and 200 rpm for 10-12 h.
[0159] (6) At a ratio of 1:100, take 100 μL of the initial shaken bacterial culture into 10 mL of YEP liquid medium containing antibiotics (50 μg / mL Kan, 50 μg / mL Rif), and incubate in a shaker (28℃, 200 rpm) until the OD value is between 0.6 and 1.0.
[0160] (7) Centrifuge the bacterial culture at 5000 rpm for 5-10 min using a high-speed centrifuge, discard the waste liquid, collect the bacterial cells, resuspend Agrobacterium in infection solution (10 mM MgCl2, 10 mM MES, 100 μM AS), adjust the OD value to around 0.6, and place it in a dark environment at 28℃ for 2 h to activate.
[0161] (8) Mix the Agrobacterium tumefaciens containing pTRV2 and pTRV2-target genes and the bacterial solution of pTRV1 in equal volumes at a ratio of 1:1. Use a 1 mL syringe with the needle removed to inject the mixed bacterial solution into the underside of the cotyledon stage eggplant leaves until the leaves are water-soaked. Incubate at 24℃ in the dark for 2 days.
[0162] (9) Eggplant plants that have been cultured in the dark for two days are placed under light for normal culture. After 15 days, fresh eggplant leaves are picked, RNA samples are extracted, and the expression level of the target gene is detected by qRT-PCR. Positive plants that have successfully silenced the target gene are selected and inoculated with Ralstonia solanacearum to detect the resistance of blank control and gene-silenced positive plants to Ralstonia solanacearum and to statistically analyze the disease index.
[0163] 1.17 Transient overexpression analysis of the target gene
[0164] (1) Based on the above vector construction experimental method, the full-length CDS sequence of the target gene SmERF114 was constructed on the pCAMBIA-1300 overexpression vector. The primer sequences used are shown in Table 10.
[0165] (2) The recombinant plasmid was transformed into Agrobacterium GV3101 according to experimental method 3.2.9;
[0166] (3) Agrobacterium tumefaciens of pCAMBIA-1300 empty vector and pCAMBIA-1300-SmERF114 were inoculated into YEP solid medium (50 μg / mL Kan, 50 μg / mL Rif) and activated by using a spreader. They were then incubated in the dark at 28℃ for 2-3 days.
[0167] (4) Pick a single clone from YEP solid medium into 400 μL of YEP liquid medium containing antibiotics (50 μg / mL Kan, 50 μg / mL Rif), and place it in a shaker at 28℃ and 200 rpm for 10-12 h.
[0168] (5) Take 100 μL of the initial shaken bacterial culture at a ratio of 1:100 and put it into 10 mL of YEP liquid medium containing antibiotics (50 μg / mL Kan, 50 μg / mL Rif), and incubate it in a shaker (28℃, 200 rpm) until the OD value is between 0.6 and 1.0.
[0169] (6) Centrifuge the bacterial culture at 5000 rpm for 5-10 min using a high-speed centrifuge, discard the waste liquid, collect the bacterial cells, resuspend Agrobacterium in the infection solution (10 mM MgCl2, 10 mM MES, 100 μM AS), adjust the OD value to about 0.6, and place it in a dark environment at 28℃ for 2 h to activate.
[0170] (7) Agrobacterium infection solutions containing pCAMBIA-1300 empty vector and pCAMBIA-1300-SmERF114 were injected into the underside of the four-leaf-one-heart stage eggplant leaves using a 1 mL syringe with the needle removed until the leaves were water-soaked. After incubation at 24℃ in the dark for 2 days, the leaves were then incubated under normal light (28℃, 16 h light, 8 h dark).
[0171] (8) After three days of normal culture, samples were taken after inoculation with Ralstonia solanacearum, RNA was extracted to detect the expression level of the target gene, and the incidence and disease index were statistically analyzed.
[0172] 1.18 Analysis of expression of signaling pathway genes and defense genes
[0173] The relative expression levels of SA synthesis gene SmICS1, SA pathway signaling gene SmEDS1, SA pathway defense gene SmPR-1, Eth pathway signaling gene SmEIL1, and abscisic acid synthesis pathway genes SmPSY and SmPDS in control plants and treatment plants were determined by qRT-PCR experiments. Primer sequences are shown in Table 10.
[0174] 2. Results and Analysis
[0175] 2.1 Screening of upstream regulatory factors of SmDDA1b
[0176] Bacterial wilt disease in eggplant caused by Ralstonia solanacearum is regulated by genes. Previous studies have found that SmDDA1b can positively regulate eggplant resistance to bacterial wilt by mediating the degradation of the negative regulator SmNAC through ubiquitination. To further elucidate other factors involved in this regulatory pathway, this invention uses a previously constructed Ralstonia solanacearum library to screen for factors that directly bind to the SmDDA1b promoter sequence.
[0177] Yeast one-hybrid library screening revealed candidate genes containing AP2 / ERF, MYB, and NAC transcription factors, which can directly bind to the SmDDA1b promoter region. Figure 1 B). The AP2 / ERF transcription factors include SmAP2 and SmERF114, while the MYB and NAC transcription factors include the previously studied SmMYB44 and SmNAC. Previous studies have shown that SmMYB44 enhances eggplant's resistance to bacterial wilt by activating spermine synthesis, while SmNAC acts as a negative regulator of eggplant's resistance to bacterial wilt through the SA synthesis pathway. Yeast one-hybrid experiments showed that SmERF114, SmAP2, SmMYB44, and SmNAC can directly bind to the SmDDA1b promoter (…). Figure 1 C).
[0178] In tobacco, transcriptional activation experiments showed that SmERF114, SmAP2, SmMYB44, and SmNAC all possess transcriptional activation activity. Figure 1 (D and E). Furthermore, dual-luciferase reporter gene assays showed that SmERF114, SmAP2, and SmMYB44 directly activate the SmDDA1b promoter and its expression, while SmNAC directly binds to the SmDDA1b promoter and inhibits its transcription, consistent with previous functional studies of SmMYB44 and SmNAC. Figure 1 G).
[0179] 2.2 Bioinformatics Analysis of SmERF114
[0180] To understand the differences of SmERF114 in highly resistant and highly susceptible Ralstonia solanacearum materials, the coding sequence (CDS) and promoter sequence (first 2000 bp of ATG) of SmERF114 were cloned in the highly resistant material "E31" and the highly susceptible material "E32". The results are shown in the figure. Figure 2 and 3 Sequence alignment results showed that the coding region sequences of SmERF114 were completely identical in the high-resistance material "E31" and the high-sensitivity material "E32," with no mutation sites observed. Only four SNP sites were present in the promoter sequence, and cis-acting element prediction analysis indicated that none of the four SNP sites were located at key cis-acting element sites.
[0181] To determine whether SmERF114 is conserved in Arabidopsis thaliana, rice, and representative Solanaceae crops, protein homology sequence alignment and phylogenetic analysis were performed. The results showed that the AP2 domain of SmERF114 is conserved in Arabidopsis thaliana, rice, tobacco, tomato, pepper, potato, and eggplant. Figure 4 A). To determine the evolution and phylogenetic relationships of SmERF114 in Arabidopsis thaliana, rice, and representative plants of the Solanaceae family, a phylogenetic analysis was conducted. The results showed that SmERF114 has the highest homology and the closest phylogenetic relationship with potato StERF114.
[0182] 2.3 Subcellular localization of SmERF114
[0183] To determine the spatial location of SmERF114 at the subcellular level in plants, subcellular localization detection was performed on SmERF114 in Nicotiana benthamiana, such as... Figure 5 As shown in the figure. The results indicate that SmERF114 exhibits green GFP fluorescence at the cell nucleus, suggesting that SmERF114 is localized in the cell nucleus.
[0184] 2.4 Tissue expression pattern of SmERF114 and expression analysis after inoculation with Ralstonia solanacearum
[0185] To understand the expression pattern of SmERF114 in eggplant plants highly resistant to Ralstonia solanacearum "E31" and highly susceptible to Ralstonia solanacearum "E32", expression analysis was performed on the roots, lower stems, upper stems, and leaves of eggplant plants at the four-leaf-one-bud stage. Figure 6 B. The results showed that there was no significant difference in the expression of SmERF114 between the high-resistance and high-susceptibility materials in the upper and lower parts of the stem. In the roots and leaves, the expression level in the high-resistance material "E31" was significantly higher than that in the high-susceptibility material "E32", with the highest expression in the roots and the second highest in the leaves.
[0186] To analyze the effect of Ralstonia solanacearum inoculation on the expression of SmERF114 in different tissues, the expression of SmERF114 in eggplant roots and leaves at different time points after inoculation was identified. The results showed that in the eggplant roots, the expression level of the highly resistant material "E31" showed a significant upward trend 2 days after inoculation with Ralstonia solanacearum, while the expression level of the highly susceptible material "E32" generally showed an upward trend after inoculation with Ralstonia solanacearum. Figure 6 C. In the blades, there was no significant difference in expression between highly sensitive and highly resistant materials, such as... Figure 6 D.
[0187] 2.5 Analysis of SmERF114 Expression Patterns Induced by Different Exogenous Hormones
[0188] To understand the response of different resistant SmERF114 plants to different plant hormones (SA, JA, Eth, and ABA), SmERF114 expression was analyzed in eggplant leaves at 0h, 1h, 3h, 6h, and 12h after spraying different exogenous hormones at the four-leaf stage of eggplant plants. The results showed that after SA spraying, the expression level of "E31" significantly increased at 2h, and the expression level of "E32" significantly increased at 12h. After JA spraying, there was no significant difference in SmERF114 expression levels between "E31" and "E32". After ABA treatment, the expression levels of SmERF114 in both "E31" and "E32" materials significantly increased at 2h, and then decreased. After Eth spraying, the expression levels of SmERF114 in both "E31" and "E32" materials also showed a trend of significantly increasing at 2h, followed by a decrease. Figure 7 As shown above, these results indicate that SmERF114 can respond to exogenous hormones SA, ABA, and Eth, and increase their expression levels.
[0189] 2.6 VIGS Function Identification of Eggplant Bacterial Wilt Resistance Gene SmERF114
[0190] To identify the function of SmERF114 in eggplant resistance to bacterial wilt, a VIGS gene silencing experiment was conducted on SmERF114 in the bacterial wilt-resistant material "E31". The results showed that the expression level of SmERF114 was significantly reduced in the VIGS-treated experimental group. Figure 8 A. Simultaneously, at the four-leaf-one-heart stage of the eggplant plants, root damage was treated and the plants were inoculated with Ralstonia solanacearum. Five days after inoculation, the experimental group plants exhibited obvious wilting, such as... Figure 8B. Statistical analysis of the incidence rates in the control and experimental groups showed that the incidence rate in the control group was 55.6%, while it was 100% in the experimental group. The morbidity index was 20.4 in the control group and 60.2 in the experimental group. Furthermore, the experimental group exhibited more severe atrophy compared to the control group, such as… Figure 8 CE and Table 1. The results above show that after silencing SmERF114, the incidence rate increased by 44%, the morbidity index increased by 39.8%, and more severe wilting was observed, indicating that SmERF114 can positively regulate the resistance of eggplant plants to Ralstonia solanacearum.
[0191] Table 9. Statistics of diseased plants after SmERF114 gene silencing.
[0192] Simultaneously, in the experimental group, after the expression level of SmERF114 decreased, the expression level of SmDDA1b, a positive regulator of bacterial wilt resistance in eggplant that directly interacts with SmERF114 downstream, also decreased significantly, while the expression level of SmNAC, a negative regulator of bacterial wilt that is ubiquitinated and degraded by SmDDA1b, increased significantly. The expression level of SmMYB62, a positive regulator of bacterial wilt resistance and an interacting protein of SmERF114 identified in previous studies, was also significantly downregulated. Figure 9 As shown above, these results further demonstrate that SmERF114 can positively regulate the resistance of eggplant plants to bacterial wilt through the SA pathway regulated by the SmDDA1b and SmNAC modules.
[0193] 2.7 Transient overexpression of SmERF114 enhances plant resistance to bacterial wilt.
[0194] To further identify the function of SmERF114 in eggplant resistance to bacterial wilt, overexpression treatment was performed on the leaves of the highly susceptible material "E32" eggplant at the four-leaf stage. Figure 10 The results showed that the expression level of SmERF114 was significantly increased in the overexpressing plants, and the overexpressing plants exhibited stronger resistance, less wilting, and better growth compared to the control group after inoculation with Ralstonia solanacearum. These results further indicate that SmERF114 is a positive regulator in the resistance of eggplant plants to bacterial wilt.
[0195] 2.8 Eggplant bacterial wilt resistance gene SmERF114 regulates hormone pathways (SA, Eth, and ABA).
[0196] To further investigate whether SmERF114 regulates eggplant resistance to bacterial wilt through a hormonal pathway, the expression of genes involved in the SA pathway (SmICS1, SmEDS1, SmPR-1), the ethylene pathway signaling gene SmEIL1, and the abscisic acid (SA) pathway synthesis genes SmPSY and SmPDS were analyzed in control plants and VIGS gene-silenced plants. The results showed that silencing SmERF114 decreased the expression of SmICS1, SmEDS1, SmEIL1, SmPSY, and SmPDS, while increasing the expression of SmPR-1. Figure 11 .
[0197] Conversely, in SmERF114 overexpressing plants, compared to control plants, the synthetic genes and signaling genes of the SA pathway (SmICS1, SmEDS1, SmPR-1), the ethylene pathway signaling gene (SmEIL1), and the synthetic genes of the abscisic acid signaling pathway (SmPSY, SmPDS) all showed the opposite trend to those in SmERF114 gene-silenced plants. Figure 12 The above results indicate that SmERF114 may participate in eggplant plant resistance to bacterial wilt not only through the SA signaling pathway of the SmDDA1b pathway, but also through the Eth and ABA signaling pathways.
[0198] Table 10 Primer name Primer sequence SmActin-F GTCGGAATGGGACAGAAGGATG SmActin-R GTGCCTCAGTCAGGAGAACAGGGT pTRV2-F TGAGGGAAAAGTAGAGAACG pTRV2-R CCTATGGTAAGACAATGAGT pTRV1-F GACAGTAACGTGCTGACCCA pTRV1-R TACCTCGTTCCCAAACAGCC pTRV2-SmERF114-F gtgagtaaggttaccgaattcCCAATAGTTCACACTTCTTCTATGGATC pTRV2-SmERF114-R cgtgagctcggtaccggatccAAAATTGGAATGGTACATAGAAGAAGC qPCR-SmERF114-F AACTAATCAACCACGAAGAA qPCR-SmERF114-R GAGTAAAGGGTATTTGTAGGAT 1380-F CCACGAGGAGCATCGTGGAA 1380-R AATGTTTGAACGATCGGGGAAATT 1380-SmERF114-F gagaacacgggggactctagaATGTTTGGAGGGAATATTAATAGAGAAG 1380-SmERF114-R gtggctagcgttaacactagtTTATCCAGATGAAGAGGAAGGATGA pGreenII-c18-SmERF114-F gataagcttgatatcgaattcATGTTTTGGAGGGAATATTAATAGAGAAG pGreenII-c18-SmERF114-R tttactcatactagtggatccTCCAGATGAAGAGGAAGGATGATC pGreenII-c18-F GGAGAGGACAGCCCAAGCTAC pGreenII-c18-R CATGGAACAGGTAGTTTTCCAGTAGT qPCR-SmICS1-F GCATGGGACAATGCTGCTGCCTCATGGA qPCR-SmICS1-R TCTGGTGCTACGAGCAAGTACCACCT qPCR-SmEDS1-F GTTTCGCAGACAAGTTGAGCC qPCR-SmEDS1-R CTCTGTGTGAACCGATAACGC qPCR-SmPR-1-F GTGGGTCGATGAGAAGCAAT qPCR-SmPR-1-R TACGCCACACCACCTGAGTA qPCR-SmEIL1-F TTGAACGACAGCCCTGAGTATG qPCR-SmEIL1-R AGGTGTCCAGTTCTTCTTTGTTCG qPCR-SmPSY-F GTGGGAAGATAGGCTAGAAA qPCR-SmPSY-R CGTACCAGCAACATAATAACA qPCR-SmPDS-F CCATGCCATGACCAGAAGAT qPCR-SmPDS-R TTGCTGTAGACAAACCACCC pGreenII-62sk-F ACGTTCCAACCACGTCTTCA pGreenII-62sk-R TTATCGGGAAACTACTCACA pGreenII-0800-F GTGCGGGCCTCTTCGCTATT pGreenII-0800-R CAGGAACCAGGGCGTATCTC qPCR-SmDDA1b-F CCTCCGAACAATGCCACA qPCR-SmDDA1b-R GAAATCCCCTTGCCGTCT qPCR-SmNAC-F TCGTGGTAACGCCAAGGTTG qPCR-SmNAC-R TTGGTCCATGCCGTTTGTAT AD-SmNAC-F gccatggaggccagtgaattcATGGGTGTTCAAGAAAAAGATCCT AD-SmNAC-R cagctcgagctcgatggatccCTACTGTCTGAACCCGAGATTTAACG AD-SmMYB44-F gccatggaggccagtgaattcATGGCGGCGATTGCACAG AD-SmMYB44-R cagctcgagctcgatggatccTCACTCAATCTTACTGATGCCAATACG AD-SmAP2-F gccatggaggccagtgaattcATGGCTTCCCCTACTGCTAAGA AD-SmAP2-R cagctcgagctcgatggatccCTAAGCTTTAATAAGAGATAAACCCACC AD-SmERF114-F gccatggaggccagtgaattcATGTTTGGAGGGAATATTAATAGAGAAG AD-SmERF114-R cagctcgagctcgatggatccTTATCCAGATGAAGAGGAAGGATGA AD-F ATGGCCATGGAGGCCAGTGAATTC AD-R TGCAGCTCGAGCTCGATGGATCCC pAbAi-proSmDDA1b-1-F aaatgatgaattgaaaagcttTTCTGTTTGGGAGGCTACTTTTAAC pAbAi-proSmDDA1b-1-R accgagctcgaattcaagcttGAAATAGTTAAGGTCTTTTGGACGAA pAbAi-proSmDDA1b-2-F aaatgatgaattgaaaagcttCTATTTCTTGGTACAGTAATATATTATCT pAbAi-proSmDDA1b-2-R accgagctcgaattcaagcttTTTGAAAAAAAATTGGACCATAAAA pAbAi-proSmDDA1b-3-F aaatgatgaattgaaaagcttTATCGCGCATAATAAAAACTTAAT pAbAi-proSmDDA1b-3-R accgagctcgaattcaagcttAATACTGTTTCGTGGGGGCG pAbAi-F TCTAAGTCTGTGCTCCTTCC pAbAi-R CTTGTTTCTAAATCGGCTAC 0800-proSmDDA1b-F ctatagggcgaattgggtaccTTCTGTTTGGGAGGCTACTTTTAAC 0800-proSmDDA1b-R tgtttttggcgtcttccatggAGTTGCCGCACAGCAAAATT pEAQ-pBD-SmNAC-F ttgactgtatcgccgaccggtATGGGTGTTCAAGAAAAAGATCCT pEAQ-pBD-SmNAC-R tgaaaccagagttaaaggcctCTACTGTCTGAACCCGAGATTTAACG pEAQ-pBD-SmMYB44-F ttgactgtatcgccgaccggtATGGCGGCGATTGCACAG pEAQ-pBD-SmMYB44-R tgaaaccagagttaaaggcctTCACTCAATCTTACTGATGCCAATACG pEAQ-pBD-SmAP2-F ttgactgtatcgccgaccggtATGGCTTCCCCTACTGCTAAGA pEAQ-pBD-SmAP2-R tgaaaccagagttaaaggcctCTAAGCTTTAATAAGAGATAAACCCACC pEAQ-pBD-SmERF114-F ttgactgtatcgccgaccggtATGTTTGGAGGGAATATTAATAGAGAAG pEAQ-pBD-SmERF114-R tgaaaccagagttaaaggcctTTATCCAGATGAAGAGGAAGGATGA pEAQ-pBD-F ATGCCGTCACAGATAGAT pEAQ-pBD-R ACCTGCTAACAGGAGCT 62sk-SmNAC-F cgctctagaactagtggatccATGGGTGTTCAAGAAAAAGATCCT 62sk-SmNAC-R gataagcttgatatcgaattcCTACTGTCTGAACCCGAGATTTAACG 62sk-SmMYB44-F cgctctagaactagtggatccATGGCGGCGATTGCACAG 62sk-SmMYB44-R gataagcttgatatcgaattcTCACTCAATCTTACTGATGCCAATACG 62sk-SmAP2-F cgctctagaactagtggatccATGGCTTCCCCTACTGCTAAGA 62sk-SmAP2-R gataagcttgatatcgaattcCTAAGCTTTAATAAGAGATAAACCCACC 62sk-SmERF114-F cgctctagaactagtggatccATGTTTGGAGGGAATATTAATAGAGAAG 62sk-SmERF114-R gataagcttgatatcgaattcTTATCCAGATGAAGAGGAAGGATGA R. solanacearum check-F GTCGCCGTCAACTCACTTTCC R. solanacearum check-R GTCGCCGTCAGCAATGCGGAATCG
[0199] Obviously, the above embodiments of the present invention are merely examples to clearly illustrate the technical solution of the present invention, and are not intended to limit the specific implementation of the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the claims of the present invention should be included within the protection scope of the claims of the present invention.
Claims
1. The application of the eggplant SmERF114 gene in improving plant stress resistance, characterized by, Applies to any of the following: 1) Enhance plant resistance to Ralstonia solanacearum; 2) Breeding and improving disease-resistant transgenic plants; The nucleotide sequence of the eggplant stress resistance gene SmERF114 is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The plant in question is an eggplant, tomato, or tobacco.
3. The application according to claim 1, characterized in that, Upregulating the expression of the SmERF114 gene in plants can improve plant stress resistance.
4. The application according to claim 3, characterized in that, The upregulation was achieved by overexpressing the SmERF114 gene in plants.
5. The application of an isolated nucleic acid molecule in the preparation of products for improving plant stress resistance, characterized in that, The isolated nucleic acid molecules were selected from the following group: a) Has a nucleotide sequence as shown in SEQ ID NO: 1; b) A nucleotide sequence having at least 80%, 90%, 95% or 99% sequence identity with the nucleotide sequence described in a), and encoding a protein that enhances plant resistance to bacterial wilt; The plant in question is an eggplant, tomato, or tobacco.
6. The application of an isolated protein in the preparation of products for improving plant stress resistance, characterized in that, The isolated protein is a protein encoded by the nucleic acid molecule described in claim 5a) or b); the plant is eggplant, tomato, or tobacco; and the stress resistance is resistance to Ralstonia solanacearum stress.
7. A method for cultivating disease-resistant transgenic plant varieties, characterized in that, By transforming plant cells, tissues, or organs with a vector, expression cassette, transgenic cell line, or transgenic recombinant bacteria containing the SmERF114 gene overexpression, and then culturing the transformed plant cells, tissues, or organs, disease-resistant transgenic plants are obtained; the nucleotide sequence of the SmERF114 gene is shown in SEQ ID NO. 1, and the plant is eggplant, tomato, or tobacco; the disease resistance refers to resistance to Ralstonia solanacearum stress.