Plant low temperature response gene csfbk and application thereof

By using CsFBK gene overexpression vectors and transgenic technology, the CsFBK gene negatively regulates plant cold resistance, solving the problem of insufficient early signal perception of low temperature stress in horticultural crops and achieving fundamental progress in the study of plant low temperature stress response.

CN122256375APending Publication Date: 2026-06-23GANNAN NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610529737.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-21
Publication Date
2026-06-23

Smart Images

  • Figure CN122256375A_ABST
    Figure CN122256375A_ABST
Patent Text Reader

Abstract

The application discloses a sweet orange low-temperature response gene in the technical field of plant genetic engineering CsFBK and application thereof, and aims to solve the problem that new genes of citrus low-temperature stress response need to be further mined in the prior art, and provide a basic problem for plant low-temperature stress response research work. The application comprises a plant low-temperature response gene CsFBK , a protein coded by the gene, an expression vector containing the plant low-temperature response gene CsFBK CsFBK CsFBK CsFBK CsFB or a fragment thereof, a transgenic cell line or a host bacterium, and a method for preparing a low-temperature sensitive plant material; and the low-temperature sensitive material provided by the application is suitable for scientific research work of plant low-temperature stress response regulation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to an F-box protein encoding gene CsFBK involved in the regulation of plant low-temperature response and its applications. Background Technology

[0002] In recent years, various abiotic stresses caused by extreme weather have constrained the high-quality development of agriculture in my country. Low-temperature stress is one of the most significant factors limiting plant growth, development, yield, and geographical distribution. Research on the mechanisms of plant low-temperature stress response is of great value for improving plant responses to low-temperature stress. Currently, research on the early signal perception and negative regulatory mechanisms of low-temperature stress in plants, especially horticultural crops, remains relatively weak. This is partly due to the lack of low-temperature-sensitive materials, which hinders research into the mechanisms of plant low-temperature stress response. Summary of the Invention

[0003] The purpose of this invention is to provide a plant low-temperature response gene CsFBK and its application, providing a foundation for research on plant low-temperature stress response.

[0004] To achieve the above objectives, the present invention is implemented using the following technical solution:

[0005] In a first aspect, the present invention provides a plant low-temperature response gene CsFBK, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] In a second aspect, a CsFBK protein is encoded by the plant low-temperature response gene CsFBK described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO.2.

[0007] Thirdly, an expression vector, transgenic cell line, or host bacterium containing the plant low-temperature response gene CsFBK or a fragment thereof as described in the first aspect.

[0008] Furthermore, the expression vector is a plant overexpression vector.

[0009] Fourthly, any one of the following applications of the plant low-temperature response gene CsFBK described in the first aspect, the CsFBK protein described in the second aspect, and the expression vector, transgenic cell line, or host bacterium described in the third aspect:

[0010] The application of the plant low-temperature response gene CsFBK described in the first aspect, the CsFBK protein described in the second aspect, and the expression vector, transgenic cell line, or host bacteria described in the third aspect in regulating plant cold resistance;

[0011] The application of the plant low-temperature response gene CsFBK described in the first aspect, the CsFBK protein described in the second aspect, and the expression vector, transgenic cell line, or host bacterium described in the third aspect in the preparation of products that reduce plant cold resistance;

[0012] The application of the plant low-temperature response gene CsFBK described in the first aspect, the CsFBK protein described in the second aspect, and the expression vector, transgenic cell line, or host bacteria described in the third aspect in plant breeding.

[0013] Furthermore, the application of regulating plant cold resistance is to enhance the plant's sensitivity to low temperatures.

[0014] Fifthly, a method for cultivating low-temperature sensitive plants, wherein the low-temperature sensitive plants are used as negative controls for screening cold-resistant genes, the method comprising increasing the content and / or activity of the protein described in the second aspect in the target plant to obtain plants with lower low-temperature sensitivity than the target plant.

[0015] Optionally, the content and / or activity of the protein in the second aspect of the target plant are achieved by increasing the expression level of the gene encoding the protein in the target plant.

[0016] Optionally, the increase in the expression level of the gene encoding the protein in the target plant is achieved by increasing the expression of the gene encoding the protein.

[0017] Sixthly, a method for constructing a low-temperature sensitive plant model, the model being used for in vitro screening of chemical substances or differentially abundant proteins that enhance plant cold resistance, the method comprising increasing the content and / or activity of the protein described in the second aspect in the target plant to obtain plants with lower low-temperature sensitivity than the target plant.

[0018] Seventhly, a method for verifying the negative regulation of plant cold resistance by the plant low-temperature response gene CsFBK as described in the first aspect, comprising:

[0019] The plant low-temperature response gene CsFBK described in the first aspect of the target plant was overexpressed to obtain transgenic plants, and the T1 generation seeds of the transgenic plants were harvested.

[0020] T1 generation seeds of transgenic plants were planted with wild-type plants under the same conditions. After multiple generations of culture, PCR positive identification was performed. The phenotypic differences between transgenic plants and wild-type plants at low temperatures were compared to determine the function of the gene CsFBK.

[0021] Eighthly, a product comprising the CsFBK protein described in the second aspect and / or the expression vector, transgenic cell line, or host bacterium described in the third aspect, of any one of the following:

[0022] Products that regulate plant cold resistance;

[0023] Products that reduce the cold resistance of plants;

[0024] Products that enhance the low-temperature sensitivity of plants.

[0025] Beneficial effects

[0026] This invention relates to a low-temperature-induced significant upregulation of the F-box protein gene CsFBK. Low-temperature-sensitive materials constructed based on the CsFBK gene can provide important germplasm resources for research on plant responses to low-temperature stress.

[0027] The CsFBK gene and its encoded protein are associated with plant low-temperature response and have important application value in the regulation of plant cold resistance. Compared with wild-type tomatoes, CsFBK overexpressing lines showed higher sensitivity to low-temperature stress, with obvious wilting of their leaves, indicating that the CsFBK gene (CsFBK protein) negatively regulates plant cold resistance. CsFBK transgenic plants can be used to conduct research on the molecular regulatory mechanism of plant low-temperature stress. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of this disclosure or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0029] Figure 1 This is a schematic diagram of CsFBK nucleotide sequence alignment according to some embodiments provided by the present invention;

[0030] Figure 2 These are schematic diagrams illustrating the CsFBK protein structure analysis of some embodiments provided by this invention;

[0031] Figure 3 These are schematic diagrams illustrating the CsFBK expression analysis results of some embodiments provided by the present invention, wherein... Figure 3 A represents tissue expression analysis. Figure 3 B represents the expression analysis under low temperature stress. Figure 3 C represents the expression analysis under drought stress. Figure 3 D represents the expression analysis under salt stress;

[0032] Figure 4 This is a schematic diagram of CsFBK subcellular localization results from some embodiments provided by the present invention;

[0033] Figure 5This is a schematic diagram illustrating the expression analysis results of CsFBK in the leaves of 35S:CsFBK transgenic plants according to some embodiments provided by the present invention. Figure 5 In the image, A represents the RT-PCR test result. Figure 5 B represents the analysis of relative expression levels detected by RT-qPCR;

[0034] Figure 6 These are phenotypic results of 35S:CsFBK transgenic tomatoes and wild-type tomatoes under low-temperature stress according to some embodiments of the present invention.

[0035] Figure 7 This is a differential abundance protein volcano diagram of leaves of 35S:CsFBK transgenic tomatoes and wild-type tomatoes under low temperature stress, provided by this invention.

[0036] Figure 8 This is a hierarchical clustering heatmap of differential abundance proteins in the leaves of 35S:CsFBK transgenic tomatoes and wild-type tomatoes under low temperature stress, provided by this invention.

[0037] Figure 9 This invention provides a differential abundance protein GO enrichment analysis of leaves of 35S:CsFBK transgenic tomatoes and wild-type tomatoes under low temperature stress.

[0038] Figure 10 This invention provides a differential abundance protein KEGG enrichment analysis of leaves of 35S:CsFBK transgenic tomatoes and wild-type tomatoes under low temperature stress. Detailed Implementation

[0039] The above content is further illustrated below with specific embodiments, but it should not be construed as limiting the scope of the invention to the following embodiments. All technologies implemented based on the above content of this invention fall within the scope of this invention.

[0040] It should be understood that all experimental procedures not detailed in the experiment are routine experimental procedures well known to those skilled in the art.

[0041] Before introducing specific embodiments, the following is a brief introduction to some of the biological materials, experimental reagents, experimental equipment, etc. involved in the following embodiments.

[0042] Table 1: Source of materials.

[0043] name Item number factory FastPure Universal Plant Total RNA Isolation Kit RC411-01 Nanjing Novizan Biotechnology Co., Ltd. HiScript III RT SuperMix for qPCP R323-01 Nanjing Novizan Biotechnology Co., Ltd. ChamQ Universal SYBR qPCR Master Mix Q711-02 Nanjing Novizan Biotechnology Co., Ltd. 2 × Phanta Flash Master Mix Dye Plus P520-01 Nanjing Novizan Biotechnology Co., Ltd. FastPure Gel DNA Extraction Mini Kit DC301-01 Nanjing Novizan Biotechnology Co., Ltd. vector pCE2 TA / Blunt-Zero C601-01 Nanjing Novizan Biotechnology Co., Ltd. ClonExpress II One Step Cloning Kit C112-01 Nanjing Novizan Biotechnology Co., Ltd. BamH Ⅰ C401-01 Nanjing Novizan Biotechnology Co., Ltd. pCAMBIA1305:GFP / Laboratory preservation Xba I C419-01 Nanjing Novizan Biotechnology Co., Ltd. Sma I C417-01 Nanjing Novizan Biotechnology Co., Ltd. pBI121 / Laboratory preservation

[0044] The sources of the materials in the following examples are shown in Table 1, the sequences are shown in Table 2, and the primer sequences are shown in Table 3.

[0045] Example 1

[0046] This embodiment provides a cloning and expression analysis of the cryosensitive regulatory gene CsFBK.

[0047] 1. Cloning of the cryosensitive regulatory gene CsFBK, with gene number Cs_ont_8g004760. This gene encodes one F-box domain and three KELCH repeat domains. The full-length genome sequence is shown in SEQ ID NO.1. This example briefly introduces the cloning of the cryosensitive regulatory gene CsFBK as follows:

[0048] (1) Preparation of cDNA as a cloning template

[0049] Total RNA was extracted from fresh navel orange leaves using the FastPure Universal Plant Total RNA Isolation Kit, and cDNA was synthesized using HiScript Ⅲ RT SuperMix for qPCR.

[0050] (2) Design primers and perform PCR amplification.

[0051] Primers for the cryosensitive regulatory gene CsFBK were designed based on the publicly available reference genome of sweet orange (Citrus sinensis v3.0) (http: / / citrus.hzau.edu.cn / index.php). The upstream primer P1 (SEQ ID NO. 3): 5'-ATGATAAAGAAAGCGCGTTTGGATG-3' and the downstream primer P2 (SEQ ID NO. 4): 5'-TCAACAACCCAAGACGGCAC-3'.

[0052] Using the cDNA synthesized in step (1) as a template, PCR amplification was performed using the primers described above. The reaction system consisted of 25 μL of 2 × Phanta Flash Master Mix Dye Plus, 500 ng of cDNA, 2 μL each of upstream primer P1 (SEQ ID NO. 3) and downstream primer P2 (SEQ ID NO. 4), and ddH2O to a final volume of 50 μL. The PCR amplification conditions were as follows: 98℃ pre-denaturation for 30 s; followed by 35 cycles of 98℃ denaturation for 20 s, 60℃ annealing for 20 s, and 72℃ extension for 20 s; a final extension at 72℃ for 1 min; and finally storage at 4℃.

[0053] The PCR amplification products were detected by 1.2% agarose gel electrophoresis and purified using the FastPure Gel DNA Extraction Mini Kit. The purified products were ligated into the pCE2 TA / Blunt-Zero vector and transformed into *E. coli* DH5α competent cells via heat shock. Positive cells were screened by PCR. The cells were then inoculated into LB broth (Luria-Bertani medium, i.e., lysate) containing kanamycin and cultured at 37°C and 200 rpm for 10 h. The plasmid was extracted and sequenced. Sequencing results showed that the amplified fragment was identical to the nucleotide sequence of SEQ ID NO.1 in the sequence listing, consisting of 1173 bases. This fragment was named CsFBK. The gene clone sequence of CsFBK was compared with the reference sequence as follows: Figure 1 As shown in the figure. Analysis of the gene CsFBK revealed that the amino acid sequence of the protein it encodes is shown in SEQ ID NO. 2, and it is named CsFBK protein.

[0054] In this invention, the CsFBK protein encoded by the CsFBK gene belongs to the F-box family. In the sequence of SEQ ID NO.2 in the sequence listing, amino acid residues 46-91 from the N-terminus form an F-box structure, and amino acid residues 176-318 form a KELCH domain. The structural analysis of this CsFBK protein is as follows: Figure 2 As shown.

[0055] 2. Expression analysis of the low-temperature-sensitive regulatory gene CsFBK.

[0056] Sweet orange stems, leaves, flowers, ripe peel, and pulp were collected, with three biological replicates. Total RNA was extracted from fresh navel orange leaves using the FastPure Universal Plant Total RNA Isolation Kit, and cDNA was synthesized using HiScript III RT SuperMix for qPCR (see instruction manual for details). One-year-old grafted sweet orange seedlings were placed in an artificial incubator for low-temperature treatment, with plants grown under normal conditions serving as controls. Leaves were collected on days 0, 3, and 6 of treatment, with three biological replicates at each time point. Total RNA was extracted from the leaves and reverse transcribed to synthesize cDNA, using the same method as above. One-year-old grafted sweet orange seedlings were subjected to drought treatment under normal conditions with watering stopped, with plants grown under normal watering serving as controls. Leaves were collected on days 0, 6, and 12 of treatment, with three biological replicates at each time point. Total RNA was extracted from the leaves and reverse transcribed to synthesize cDNA, using the same method as above. One-year-old grafted sweet orange seedlings were subjected to salt stress treatment by watering with 200 mM NaCl saline solution under normal conditions, with normally watered plants serving as a control. Leaves were collected on days 0, 6, and 12 of treatment, with three biological replicates at each time point. Total RNA was extracted from the leaves and reverse transcribed to synthesize cDNA, using the same method as above.

[0057] Primers were designed according to the requirements for real-time quantitative RT-qPCR primers. Primers for CsFBK detection were designed using the NCBI database. The upstream primer P3 (SEQ ID NO. 5): 5'-CCACCCTCGTTGCTTGTTTG-3'; the downstream primer P4 (SEQ ID NO. 6): 5'-TTCCCATCTGCCTGTTGTGG-3'. The sweet orange gene CsActin was used as an internal control, and SYBR Green was used as the fluorescent dye for RT-qPCR. By diluting the concentrations of the CsFBK and CsActin primer pairs and leaf cDNA, an appropriate annealing temperature was set. In this example, the annealing temperature was 60℃, achieving an amplification efficiency of 90-110% for both CsFBK and CsActin genes, with Ct values ​​between 15-30. RT-qPCR reactions were performed on a LightCycler® 480 II instrument using a three-step amplification method. The reaction system and procedure were based on the ChamQ Universal SYBR qPCR Master Mix instruction manual. RT-qPCR was used to detect CsFBK expression in sweet orange tissues and stress-induced expression. Biological and technical replicates were performed three times. The results of CsFBK expression analysis are as follows: Figure 3 As shown, Figure 3 A represents tissue expression analysis. Figure 3 B represents the expression analysis under low temperature stress. Figure 3 C represents the expression analysis under drought stress. Figure 3 The expression analysis under salt stress (D) showed that CsFBK was expressed in different tissues, indicating it is a constitutive gene with significant tissue specificity. CsFBK expression was relatively high in leaves and flowers, but lower in the peel and pulp at maturity. Induced expression analysis revealed that CsFBK was strongly induced under low temperature conditions, with its relative expression level approximately 14 times that of the control on day 6. Under drought and salt stress treatments, CsFBK expression also showed an upregulation trend, but the response was relatively delayed, with significant differences only appearing after 12 days of treatment.

[0058] The above experimental results indicate that CsFBK is constitutively expressed in citrus and can be induced by various abiotic stresses, especially in response to low temperature stress.

[0059] Example 2

[0060] This embodiment provides the construction of two plant expression vectors containing the CsFBK gene.

[0061] 1. Construction of a subcellular localization vector for the 35S promoter driver gene CsFBK

[0062] (1) Enzyme digestion vector

[0063] The subcellular localization vector used was pCAMBIA1305:GFP, and the restriction endonuclease used was BamHI. In this embodiment, BamHI was used to digest the subcellular localization vector pCAMBIA1305:GFP, linearizing the localization vector pCAMBIA1305:GFP, thereby obtaining a linearized cloning vector with specific sequences at both ends.

[0064] (2) Design primers and perform PCR amplification.

[0065] By introducing a homologous sequence to the vector insertion site at the 5' end of the primers, the amplified product of the CsFBK gene and the linearized cloning vector were made to have completely identical sequences capable of homologous recombination, with a homology length of 15 bp. The cloning primers for removing the CsFBK gene stop codon were: upstream primer P5 (SEQ ID NO. 7): 5'-CGAGGACCGGTCCCGGGGGATCCATGATAAAGAAAGCGCGTTTGGATG-3', and downstream primer P6 (SEQ ID NO. 8): 5'-CGCCCTTGCTCACCATGGATCCACAACCCAAGACGGCAC-3'. PCR amplification of the nucleotide sequence of SEQ ID NO. 1 obtained from the cloned sequence in Example 1 was performed using primers P5 (SEQ ID NO. 7) and P6 (SEQ ID NO. 8). After the reaction, the PCR amplification products were detected by 1% agarose gel electrophoresis, and the target band was recovered and purified using the FastPure Gel DNA Extraction Mini Kit according to the instructions.

[0066] (3) In vitro homologous recombination

[0067] The amplified and purified product and the enzyme-digested linear subcellular localization vector pCAMBIA1305:GFP were recombined using the ClonExpress II One Step Cloning Kit. The recombinant product was transformed into E. coli DH5α competent cells using the heat shock method. Positive clones were screened by PCR and sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The results showed that a DNA fragment of 1170 bp was obtained by PCR amplification, which was consistent with the expected result, indicating that a 35S-driven plant expression vector containing CsFBK with the correct insertion sequence and position was obtained, named 35S:CsFBK:GFP.

[0068] 2. Construction of a vector for overexpressing the 35S promoter-driven gene CsFBK

[0069] (1) Enzyme digestion vector

[0070] The overexpression vector used was pBI121, and the restriction endonucleases were Xba I and Sma I. In this example, the overexpression vector pBI121 was double-digested with Xba I and Sma I to linearize it, obtaining a linearized cloning vector with specific sequences at both ends.

[0071] (2) Design primers and perform PCR amplification.

[0072] By introducing a homologous sequence to the vector insertion site at the 5' end of the primers, the amplified product of the CsFBK gene and the linearized cloning vector were made to have completely identical sequences capable of homologous recombination, with a homologous sequence length of 15 bp. The gene cloning primers constructed from the overexpression vector were: upstream primer P7 (SEQ ID NO. 9): 5'-GGAGAGAACACGGGGACTCTAGAATGATAAAGAAAGCGC-3', and downstream primer P8 (SEQ ID NO. 10): 5'-AAGGGACTGACCACCCGGGTCA ACAACCCAAGACGGCAC-3'. PCR amplification of the nucleotide sequence of SEQ ID NO. 1 obtained from the cloned sequence in Example 1 was performed using primers P7 and P8. After the reaction, the PCR amplification product was detected by 1% agarose gel electrophoresis, and the target band was recovered and purified using the FastPure Gel DNA Extraction Mini Kit according to the instructions.

[0073] (3) In vitro homologous recombination

[0074] The amplified and purified product and the enzyme-digested overexpression vector pBI121 were recombined using the ClonExpress II One Step Cloning Kit. The recombinant product was then transformed into *E. coli* DH5α competent cells using the heat shock method. Positive clones were screened by PCR and sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The PCR amplification yielded a 1173 bp DNA fragment, consistent with the expected result, indicating that a 35S-driven plant overexpression vector containing CsFBK with the correct insertion sequence and position was obtained, named 35S:CsFBK.

[0075] Example 3: Subcellular localization of 35S:CsFBK:GFP

[0076] The plant expression vector 35S:CsFBK:GFP and the empty vector 35S:GFP constructed in Example 2 were transformed into Agrobacterium GV3101 chemocompetent cells using the heat shock method. The cells were then plated on LB agar plates containing kanamycin and rifampin and cultured at 28°C for 48 h. Single colonies of Agrobacterium were picked, and positive clones selected by PCR were inoculated into 20 ml of LB liquid medium containing kanamycin and rifampin and cultured at 28°C and 200 rpm for 12 h.

[0077] Centrifuge at 4000 rpm for 5 min to collect the bacterial suspension, discard the supernatant, resuspend in MES buffer, and wash 2-3 times. Adjust the Agrobacterium resuspension to a suitable OD600 using a UV spectrophotometer and incubate in the dark for 2 h. Select 4-5 week old Nicotiana benthamiana leaves and infect them from the underside of the leaves using a 1 mL needleless syringe. Infected tobacco leaves are incubated in the dark for 16 h, followed by normal incubation for 2-3 days. Take a 1 cm sample from the infected area. 2 Temporary sections of leaves without veins were prepared and observed under a TCS SP8 laser confocal microscope. GFP fluorescence signal was detected using a 488 nm excitation wavelength, and images were acquired. The subcellular localization of CsFBK is shown in the image below. Figure 4 As shown, the results indicate that the 35S:CsFBK:GFP subcellular localizes in the plant cell nucleus and cell membrane.

[0078] Example 4: Obtaining 35S:CsFBK overexpression transgenic tomato

[0079] The plant vector 35S:CsFBK constructed in Example 2 was transformed into Agrobacterium GV3101 chemocompetent cells using the heat shock method. The transformed cells were then plated on LB agar plates containing kanamycin and rifampin and cultured at 28°C for 48 h. Single colonies of Agrobacterium were picked, and positive clones selected by PCR were inoculated into 30 ml of LB liquid medium containing kanamycin and rifampin and cultured at 28°C and 200 rpm for 12 h.

[0080] Centrifuge at 3000 rpm for 5 min, discard the supernatant, and resuspend in an appropriate amount of suspension. Place the pre-cultured explants in the suspension and add an appropriate amount of Agrobacterium resuspension. Infect for about 5 min, discard the suspension, absorb excess bacterial solution with sterile filter paper, and then transfer to a culture medium. Co-culture in the dark for 2 days. Subsequently, transfer the explants to 2 Z medium (2 mg / L zeatin) containing antibiotics and culture under light for about 15 days to induce adventitious shoot differentiation. Then transfer to 0.2 Z medium (0.2 mg / L zeatin) and continue culture for about 15 days. Remove the leaves from the explants, retaining only the regenerated shoots, and transfer them to a new 0.2 Z medium for further culture to promote shoot growth. When the regenerated shoots grow to about 2-3 cm, cut them off from the base and transfer them to a rooting medium to induce rooting. After the root system has developed well, place the seedlings indoors for 5-7 days to harden off. Wash away the culture medium from the roots with clean water and then hydroponically culture for 1-2 days. Subsequently, under artificial climate conditions, transplant the seedlings into plastic cups containing mixed substrate and cover them with transparent plastic cups to maintain humidity. Once the tomato plants have developed new roots, transplant them along with the substrate into seedling pots for conventional cultivation and management.

[0081] When the plants developed six true leaves, DNA was extracted for PCR identification. The target gene was amplified using upstream primer P9 (SEQ ID NO. 11): 5'-GACGCACAATCCCACTATCC-3' and downstream primer P10 (SEQ ID NO. 12): 5'-GTTTTCGCGATCCAGACTGA-3', developed using the vector sequence. The amplified products were then recovered from the gel and sequenced. Positive plants with correct sequencing results were cultured in an artificial climate chamber to observe their phenotype. Once the plants matured, the T1 generation seeds were harvested.

[0082] Seeds of transgenic plants (overexpression, OE) were collected and planted under the same conditions as wild-type (WT) tomatoes: 25°C, 70% humidity, and 30,000 Lux light in an artificial climate chamber. The growth of the transgenic plants and the control group was observed. After multiple generations, positive PCR identification was performed. The specific procedure was as follows: T1 generation seeds were sown in nutrient soil, and DNA extraction and PCR identification were performed. Single-copy positive plants were selected and transplanted into nutrient soil, with a positive:non-positive plant ratio of 3:1. T2 generation seeds were harvested after the plants matured. T2 generation seeds were sown in nutrient soil, and when the plants grew to 6 true leaves, DNA was extracted from the leaves of the transgenic plants. The leaf DNA was then amplified by PCR. The PCR products were detected by electrophoresis on a 1.2% agarose gel at 120 V for 30 min. The target bands were photographed and analyzed using a gel imaging system. Homozygous T2 generation transgenic lines with consistent phenotype and genotype (i.e., no heterozygous genotype) were screened for subsequent experimental analysis.

[0083] RNA was extracted from leaves of homozygous T2 transgenic lines and wild-type tomato, and then reverse transcribed to synthesize cDNA sequences. The cDNA obtained by reverse transcription was diluted 20-fold and could be directly used for subsequent RT-PCR and RT-qPCR reactions. Using upstream primer P1 (SEQ ID NO. 3) and downstream primer P2 (SEQ ID NO. 4), with the tomato gene Actin as an internal control, the expression level of CsFBK was detected by RT-PCR and 1.2% agarose gel electrophoresis using diluted leaf cDNA template. Using upstream primer P3 and downstream primer P4, with the tomato gene Actin as an internal control, and SYBR Green as the fluorescent dye for RT-qPCR, the concentrations of the two pairs of primers for CsFBK and SlActin and the leaf cDNA template were diluted, and an appropriate annealing temperature was set (60℃ in this example) to achieve an amplification efficiency of 90-110% for the CsFBK and SlActin genes, with Ct values ​​between 15-30. RT-qPCR reactions were performed on a LightCycler® 480 II instrument using a three-step amplification method. The reaction system and procedure were based on the ChamQ Universal SYBR qPCR Master Mix instruction manual. Based on comparisons of RT-PCR and RT-qPCR results between transgenic and wild-type materials, three families with relatively high expression levels were screened: OE-2, OE-7, and OE-10. Their expression analysis results are as follows: Figure 5 As shown, Figure 5 In the image, A represents the RT-PCR test result. Figure 5 Figure B shows the relative expression level analysis using RT-qPCR. The results indicated that the expression level of the CsFBK gene in the T2 generation transgenic plants was significantly higher than that in the wild type. Transgenic and wild-type lines were treated at 4°C in a low-temperature incubator. The phenotypic results of 35S:CsFBK transgenic tomatoes and wild-type tomatoes under low-temperature stress are shown below. Figure 6 As shown in the figure, CsFBK overexpressing tomatoes (OE-2, OE-7, and OE-10) exhibited significant leaf wilting on day 4 of low-temperature stress treatment, while wild-type (WT) tomatoes showed less wilting. These results indicate that 35S:CsFBK transgenic plants are more sensitive to low-temperature stress, suggesting that this gene plays a negative regulatory role in the low-temperature response.

[0084] Example 5: Study on the low-temperature response mechanism of tomato leaves using 35S:CsFBK overexpression in tomato

[0085] Tomato leaves overexpressing 35S:CsFBK and wild-type tomatoes treated with low temperature for 48 h were collected, with three biological replicates for each treatment. Data-independent acquisition (DIA) quantitative proteomics analysis was performed by Nanjing Jisi Huiyuan Biotechnology Co., Ltd. Sample processing was as follows: Samples were thoroughly ground into powder using liquid nitrogen, and an appropriate amount was placed in a pre-chilled 1.5 mL enzyme-free centrifuge tube. Lysis buffer was added, and the mixture was lysed for 30 min. Protein concentration was determined using the BCA method. 500 μg of total protein was taken, and 5 mM DTT was added for reduction at 37 ℃ for 1 h. Subsequently, 10 mM iodoacetamide was added for alkylation at room temperature in the dark for 45 min. Protein samples were precipitated using the methanol / chloroform method, washed with methanol, and dissolved in 8 M urea solution. Stepwise enzymatic digestion was then performed: first, LysC was used for digestion at room temperature for 2 h, followed by trypsin digestion overnight. The enzyme-to-substrate ratio was 1:50. After enzymatic hydrolysis, formic acid was added to acidify the system to a final concentration of 1% (pH 2-3), and centrifugation at 1500 g for 15 min was performed to remove urea precipitate. The supernatant was desalted using a Sep-Pak C18 column and then freeze-dried under vacuum. The dried peptides were dissolved in 0.1% formic acid. 25 μg of the sample was taken and separated using an EASY-nLC 1200 nano-scale liquid chromatography system. The peptides were separated using a C18 analytical column (180 mm × 100 μm, 1.9 μm C18-AQ packing material) with an acetonitrile gradient of 5-28% (containing 0.1% formic acid) over 45 min at a flow rate of 250 nL / min. Subsequently, data acquisition was performed using an Orbitrap Fusion Lumos mass spectrometer in data-independent acquisition (DIA) mode, with 30 variable windows and a scan range of 350-1500 m / z. The resolutions for MS1 and MS2 were set to 6 × 10⁻⁶ m / s, respectively. 5 and 1.5×10 5 The automatic gain control is 3×10 6 and 5×10 5The maximum injection time for MS1 was 100 ms, and MS2 was in automatic mode with a normalized collision energy of 28%. Mass spectrometry data were analyzed using DIA-NN software (version 1.8.1). The false positive rate of precursor ions was controlled at 1%, and the mass precision for MS1 and MS2 was set to 5 ppm and 15 ppm, respectively. Isotope peak identification and cross-sample matching were enabled. Protein inference was performed at the gene level, using a robust LC strategy for quantification, with a dual-channel neural network classifier. The spectral library was constructed using an in-silico method, with the restriction enzyme digestion rule being Trypsin / P, allowing one missed cleavage site. The fixed modification was cysteine ​​carbamide methylation, with no variable modifications. The peptide length range was 7-30 aa, the precursor charge number was 1-4, and the m / z ranges for precursor and fragment ions were set to 300-1300 and 300-1800, respectively.

[0086] The proteomics data analysis methods are as follows: After screening for false positives, the data were normalized to improve the comparability between samples. Data containing protein IDs, sample information, and normalized quantitative values ​​were imported into SIMCA 18.0.1 software for multivariate statistical analysis. To reduce the influence of high-variance variables and technical interference, the data were logarithmically transformed and standardized. Further analysis of inter-group differences and screening for differentially abundant proteins (DAPs) was conducted using t-tests. Significantly upregulated and downregulated proteins were screened using a P < 0.05 threshold and a fold change (FC) ≥ 1.20 or ≤ 0.83. Considering the error caused by multiple hypothesis testing, the P-values ​​were corrected using the "fdrtool" package in R software. Volcano plots and hierarchical clustering heatmaps of DAPs were plotted using the "ggplot2" and "pheatmap" packages in R software. Enrichment analysis of DAPs was performed based on the GO and KEGG databases. SRplot online website visualizes GO enrichment results, and ChiPlot online website visualizes KEGG enrichment results. Figure 7 This is a differential abundance protein volcano diagram of leaves of 35S:CsFBK transgenic tomatoes and wild-type tomatoes under low temperature stress, provided by this invention. Figure 8 This invention presents a hierarchical clustering heatmap of differential abundance proteins in leaves of 35S:CsFBK transgenic tomatoes and wild-type tomatoes under low-temperature stress. The results show extremely high similarity among biological replicates within the same group of samples, while significant distinction exists between different groups, indicating that the differential protein screening results have good reliability and biological reproducibility.

[0087] Figure 9This invention provides a differential abundance protein (DAP) enrichment analysis of leaves of 35S:CsFBK transgenic tomatoes and wild-type tomatoes under low-temperature stress. The results showed that, in the biological process (BP) category, the 2260 DAPs were mainly enriched in processes related to organonitrogen compound metabolic processes, responses to chemical substances, cellular component organization or biogenesis, and protein metabolic processes, indicating that low-temperature stress significantly affects basal metabolic activities and protein synthesis and degradation in leaves. In the molecular function (MF) category, the DAPs were mainly concentrated in binding, organic cyclic compound binding, heterocyclic compound binding, and protein binding, suggesting that low-temperature stress may lead to significant changes in the interaction networks between proteins and between proteins and small molecules, thereby affecting biological processes. Figure 10 This invention provides a KEGG enrichment analysis of differentially abundant proteins (DAPs) in leaves of 35S:CsFBK transgenic tomatoes and wild-type tomatoes under low-temperature stress. The results showed that DAPs were mainly enriched in pathways such as ribosome, amino acid biosynthesis, carbon metabolism, spliceosome, and protein processing in the endoplasmic reticulum. These enriched pathways mainly involve key biological processes such as protein synthesis and processing, basal metabolism, and RNA processing, indicating that low-temperature stress has a significant impact on protein homeostasis, energy metabolism, RNA processing, and post-transcriptional regulation in leaf cells.

[0088] Table 2: Sequence List.

[0089]

[0090] Table 3: Primer sequence list.

[0091] Serial Number Primer name Primer sequence (5'-3') SEQ ID NO. 3 upstream primer P1 ATGATAAAGAAAGCGCGTTTGGATG SEQ ID NO. 4 Downstream primer P2 TCAACAACCCAAGACGGCAC SEQ ID NO. 5 upstream primer P3 CCACCCTCGTTGCTTGTTTG SEQ ID NO. 6 Downstream primer P4 TTCCCATCTGCCTGTTGTGG SEQ ID NO. 7 upstream primer P5 CGAGGACCGGTCCCGGGGGATCCATGATAAAGAAAGCGCGTTTGGATG SEQ ID NO. 8 Downstream primer P6 CGCCCTTGCTCACCATGGATCCACAACCCAAGACGGCAC SEQ ID NO. 9 upstream primer P7 GGAGAGAACACGGGGGACTCTAGAATGATAAAGAAAGCGC SEQ ID NO. 10 Downstream primer P8 AAGGGACTGACCACCCGGGTCAACAACCCAAGACGGCAC SEQ ID NO. 11 upstream primer P9 GACGCACAATCCCACTATCC SEQ ID NO. 12 Downstream primer P10 GTTTTCGCGATCCAGACTGA

[0092] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A plant low-temperature response gene CsFBK, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A CsFBK protein, characterized in that, It is encoded by the plant low-temperature response gene CsFBK as described in claim 1, and the amino acid sequence of the CsFBK protein is shown in SEQ ID NO.

2.

3. An expression vector, transgenic cell line, or host bacterium containing the plant low-temperature response gene CsFBK or a fragment thereof as described in claim 1.

4. The expression vector, transgenic cell line, or host bacterium according to claim 3, characterized in that, The expression vector is a plant overexpression vector.

5. Any one of the following applications of the plant low-temperature response gene CsFBK according to claim 1, the CsFBK protein according to claim 2, and the expression vector, transgenic cell line, or host bacterium according to claim 3: Application of the plant low-temperature response gene CsFBK as described in claim 1, the CsFBK protein as described in claim 2, and the expression vector, transgenic cell line, or host bacterium as described in claim 3 in regulating plant cold resistance; The application of the plant low-temperature response gene CsFBK as described in claim 1, the CsFBK protein as described in claim 2, and the expression vector, transgenic cell line, or host bacterium as described in claim 3 in the preparation of products that reduce plant cold resistance; The application of the plant low-temperature response gene CsFBK as described in claim 1, the CsFBK protein as described in claim 2, and the expression vector, transgenic cell line, or host bacterium as described in claim 3 in plant breeding.

6. The application according to claim 5, wherein the application in regulating plant cold resistance is to increase the plant's sensitivity to low temperature.

7. A method for cultivating low-temperature sensitive plants, characterized in that, The low-temperature sensitive plant is used as a negative control for screening cold-resistant genes. The method includes increasing the content and / or activity of the protein described in claim 2 in the target plant to obtain plants with lower low-temperature sensitivity than the target plant.

8. A method for constructing a low-temperature-sensitive plant model, characterized in that, The model is used for in vitro screening of chemical substances or differentially abundant proteins that enhance plant cold resistance. The method includes increasing the content and / or activity of the protein of claim 2 in the target plant to obtain plants with higher low-temperature sensitivity than the target plant.

9. A method for verifying that the plant low-temperature response gene CsFBK as described in claim 1 negatively regulates plant cold resistance, comprising: By overexpressing the plant low-temperature response gene CsFBK as described in claim 1 in the target plant, transgenic plants are obtained, and T1 generation seeds of the transgenic plants are harvested. T1 generation seeds of transgenic plants were planted with wild-type plants under the same conditions. After multiple generations of culture, PCR positive identification was performed. The phenotypic differences between transgenic plants and wild-type plants at low temperatures were compared to determine the function of the gene CsFBK.

10. A product comprising the CsFBK protein of claim 2 and / or the expression vector, transgenic cell line, or host bacterium of claim 3, comprising any one of the following: Products that regulate plant cold resistance; Products that reduce the cold resistance of plants; Products that enhance the low-temperature sensitivity of plants.