An optimized method and kit for vaginal flora detection reaction reagents

Abstract

This application relates to the field of in vitro diagnostics and microbial detection technology, and in particular to a method and kit for optimizing reaction reagents for vaginal flora detection. The method includes serial dilution of 2×One-Step SYBR Green reagent and iScript reverse transcriptase in an RT-qPCR system, and supplementing the diluent with 0.2 mmol / L dNTPs and 1 mmol / L Mg. 2+ Achieving the reaction of 10 in an 8 μL reaction system 3 -10 8 Stable amplification of cellular equivalent RNA. This application reduces reagent usage to one-third of the original protocol while maintaining amplification efficiency, sensitivity, and reproducibility, significantly lowering detection costs and making it suitable for high-throughput screening and epidemiological studies.

Description

Technical Field

[0001] This invention belongs to the field of in vitro diagnostics and microbial detection technology, specifically a method and kit for optimizing reaction reagents for vaginal flora detection. Background Technology

[0002] Real-time quantitative PCR (qPCR) technology, as a mainstream method for detecting specific microbial nucleic acids, studying gene expression, and analyzing microbial community composition, has been widely applied in research on the female reproductive tract microecology, playing a crucial role, especially in the diagnosis of microbiota imbalance-related diseases such as bacterial vaginosis. This technology, through specific primers and probes, can perform highly sensitive and specific quantitative analysis of various key vaginal flora, such as *Lactobacillus curvularia*, *Lactobacillus indolentus*, *Gardnerella vaginalis*, and *Atopobacterium vaginalis*. However, current clinical and research practices largely rely on commercially available qPCR kits, which are costly and impose a significant economic burden on large-scale screening or epidemiological studies. Although some guidelines recommend using original reagents to ensure detection performance, there is a lack of effective solutions for systematically optimizing reagent systems to reduce dosage without sacrificing sensitivity and reproducibility.

[0003] Among existing patent technologies, CN116121411A (Biotech) discloses a real-time quantitative PCR primer, kit, and detection method for detecting various reproductive tract microbiota. This scheme, through extensive screening and optimization, obtains a set of primer and probe combinations with high specificity and sensitivity, and establishes a qPCR detection system that replaces 16S rRNA sequencing, with detection results showing good correlation with 16S sequencing. However, this patent focuses on the design and validation of primer and probe sequences, without addressing the optimization of concentration gradients or ratio adjustments of core components in the reaction system (such as DNA polymerase, dNTPs, and buffer systems), nor providing specific strategies for reducing the overall reagent consumption while ensuring amplification efficiency and Ct value stability. Therefore, there is room for improvement in controlling detection costs. Summary of the Invention

[0004] This invention provides a method and kit for optimizing reaction reagents for vaginal flora detection. It aims to significantly reduce the reagent volume and cost required for a single reaction while maintaining amplification efficiency, sensitivity and repeatability by systematically adjusting the concentration ratio of key components in the real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) system. This method is suitable for high-throughput screening and epidemiological research scenarios.

[0005] In a first aspect, the present invention provides a method for optimizing reaction reagents for vaginal flora detection, comprising the following steps: S1: Extract total RNA from a vaginal microbial sample, including but not limited to Lactobacillus crispatus, L. iners, Gardnerella vaginalis, Atopobium vaginae, L. jensenii, L. gasseri, Mobiluncus curtisii, Prevotella spp., Streptococcus spp., Escherichia coli, and Candida spp.; S2: The extracted RNA is serially diluted to obtain the equivalent of 10 3 Up to 10 8 A cell equivalent of template RNA solution; S3: Prepare the optimized RT-qPCR reaction system, adding 2×One-Step SYBR Green reagent as stock solution, 2-fold dilution, or 3-fold dilution; adding iScript reverse transcriptase as stock solution, 2-fold dilution, or 3-fold dilution; the diluent used for dilution contains 0.2 mmol / L dNTP mixture (containing dATP, dCTP, dGTP, and dTTP) and 1 mmol / L Mg... 2+ ; S4: Construct an RT-qPCR reaction system with a total volume of 8 μL per well in a 384-well plate. The amounts of each component added are as follows: 4 μL of 2×One-Step SYBR Green reagent, 0.1 μL of iScript reverse transcriptase, 0.25 μL of upstream primer (final concentration of 0.3125 μmol / L), 0.25 μL of downstream primer (final concentration of 0.3125 μmol / L), 2 μL of template RNA, and 1.4 μL of nuclease-free water (NFW). S5: Place the constructed reaction plate in a real-time quantitative PCR instrument and execute the following thermal cycling program: reverse transcription at 50 degrees Celsius for 30 minutes, initial denaturation at 95 degrees Celsius for 10 seconds, followed by 35 amplification cycles, each cycle including denaturation at 95 degrees Celsius for 20 seconds, annealing at 58 degrees Celsius for 30 seconds, extension at 72 degrees Celsius for 50 seconds, and finally perform melting curve analysis: 95 degrees Celsius for 15 seconds and 55 degrees Celsius for 15 seconds; S6: Evaluate the amplification performance of the reagent system at different dilution ratios based on the linear relationship between Ct value and standard curve, and determine the minimum effective reagent concentration that can be stably used for vaginal flora detection.

[0006] According to the present invention, the 2× reaction buffer and reverse transcriptase component in the commercially available iScript™ One-Step RT-PCR Kit With SYBR® Green reagent are serially diluted, and a specified concentration of dNTPs and Mg is added to the dilution buffer. 2+ It can compress the single-well reaction volume to 8 μL while maintaining the effect on 10 3 Up to 10 8 Stable amplification capability of cellular equivalent RNA template. This method overcomes the technical bias of requiring the use of stock reagents in conventional operations. By precisely controlling the stoichiometry of key components in the reaction system, the amount of reagent used can be reduced to one-third of the original protocol without causing a decrease in amplification efficiency or Ct value drift.

[0007] In some embodiments, the RNA extraction in step S10 employs a combination of glass bead mechanical disruption and hot phenol extraction, specifically including: [the process involves adding 1×10⁻⁶ molecules of water to a container containing...] 9 Add 450 μL of lysis buffer (composed of Buffer RLT, TE buffer, and 30 mM DTT) and 0.3 g of 0.1 mm diameter glass beads to a sample of bacterial cells, and process in a sample homogenizer at 5500 rpm for 30 seconds; then add 500 μL of acidic phenol, vortex for 10 seconds, and heat in a dry bath at 60°C for 10 minutes; then add 100 μL of a solution of chloroform and isoamyl alcohol at a volume ratio of 24:1, vortex for 10 seconds, and centrifuge at 12000 rpm for 5 minutes; take 400 μL of supernatant, mix with an equal volume of 99% ethanol, and load it onto a Zymo-Spin™ IICR column. After multiple washes and DNase I digestion, finally elute and purify RNA with 200 μL of nuclease-free water.

[0008] In some embodiments, the RNA gradient dilution in step S2 is performed using nuclease-free water at a rate of 10⁻⁶ ppm. -1 Up to 10 -6 Each of the tenfold dilutions corresponds to 10... 8 Up to 10 3 The amount of starting template equivalent to cells.

[0009] In some embodiments, the 2×One-Step SYBR Green reagent 2x dilution in step S3 is prepared by mixing the stock solution and the diluent, and the 3x dilution is prepared by mixing the stock solution and the diluent; the iScript reverse transcriptase dilution is prepared by mixing the stock solution and the diluent, and the 3x dilution is prepared by mixing the stock solution and the diluent; the diluent consists of a Tris-HCl buffer system, a 0.2 mmol / L dNTP mixture and a 1 mmol / L MgCl2, and the pH is adjusted to 8.3.

[0010] In some embodiments, the primers in step S4 are oligonucleotide sequences designed for the 16S rRNA gene or specific functional genes of the target bacterial species, such as s-Ecoli-F (sequence: GAGTAAAGTTAATACCTTTGCTCATTG) and s-Ecoli-R (sequence: GAGACTCAAGCTKRCCAGTATCAG) for Escherichia coli, with a final concentration controlled in the range of 0.25 to 0.5 μmol per liter.

[0011] In some embodiments, the annealing temperature of the thermal cycling procedure in step S5 can be adjusted in the range of 55 to 62 degrees Celsius according to the Tm value of different primers, the extension time can be set in the range of 30 to 60 seconds according to the length of the amplicon, and the number of cycles is 30 to 40.

[0012] In some implementations, the standard curve in step S60 is plotted with the logarithm of template RNA concentration on the x-axis and Ct value on the y-axis, requiring a linear correlation coefficient R. 2 A value not lower than 0.99 indicates an amplification efficiency between 90% and 110%; the slope, intercept, and R0 of the standard curve obtained by diluting the reagent 2-fold or 3-fold are also important indicators. 2 When the value is not statistically significantly different from the original reagent (p > 0.05), the dilution ratio is considered an acceptable operating condition.

[0013] In some embodiments, the method is applicable to multiplex RT-qPCR detection systems, i.e., specific primer pairs targeting two or more vaginal flora are added simultaneously to the same reaction well, with the final concentration of each primer controlled at 0.15 to 0.3 μmol / L, and the total primer concentration not exceeding 1.2 μmol / L, and the remaining reaction components are prepared in the aforementioned proportions.

[0014] Secondly, the present invention provides an optimized kit for vaginal flora detection, comprising the following components: (a) A diluted 2×One-Step SYBR Green reagent, which is prepared by mixing a commercially available 2×One-Step SYBR Green reagent stock solution with a diluent containing 0.2 mmol / L of dNTP mixture and 1 mmol / L of Mg. 2+ ; (b) A diluted iScript reverse transcriptase, which is prepared by mixing a commercially available iScript reverse transcriptase stock solution with a diluent containing 0.2 mmol / L of dNTP mixture and 1 mmol / L of Mg. 2+ ; (c) A specific primer pair for at least one vaginal flora, said flora being selected from Lactobacillus curvularis, Lactobacillus indolentus, Gardnerella vaginalis, Atobacillus vaginalis, Lactobacillus janniae, Lactobacillus gasseri, Moscurvy, Prevotella, Streptococcus, Escherichia coli or Candida. (d) Nuclease-free water; According to the present invention, the kit provides diluted core reaction components in premixed or dispensed form, avoiding operational errors caused by user-dilution, while clearly defining the dNTP and Mg content in the diluent. 2+ The kit ensures the necessary substrate and cofactor levels for reverse transcription and DNA polymerase activity are maintained even with low reagent usage. It is compatible with 384-well plate platforms, reducing the cost per assay to 30% to 50% of the original protocol without sacrificing the limit of detection or quantitative accuracy.

[0015] In some embodiments, the diluted 2×One-Step SYBR Green reagent in component (a) is provided as a lyophilized powder, to which a specified volume of reconstitution buffer is added before use. The reconstitution buffer contains 0.2 mmol / L dNTP mixture, 1 mmol / L MgCl2 and 5% trehalose as stabilizers.

[0016] In some embodiments, the dilute iScript reverse transcriptase stable solution in component (b) is provided.

[0017] In some embodiments, the primer pairs in component (c) are verified by BLAST alignment to ensure that there is no nonspecific amplification in the background of the human genome and common vaginal commensal bacteria, and the amplicon length is controlled between 80 and 150 base pairs.

[0018] In some embodiments, the kit further includes a positive control RNA composed of a target bacterial 16S rRNA fragment synthesized in vitro, with a concentration gradient covering 10-1... 3 Up to 10 7 Each microliter is copied for quality control in each batch of testing.

[0019] In some implementations, the kit is suitable for automated liquid handling workstations, with all components packaged in 96-well deep-well plates or 384-well reservoir plates, supporting direct transfer to PCR plates for reaction construction.

[0020] In some implementations, the kit includes a data analysis template with a built-in standard curve fitting algorithm and threshold setting rules, which automatically outputs the absolute copy number or relative abundance ratio of each bacterial community.

[0021] Thirdly, the present invention provides the application of the aforementioned methods or kits in the microecological diagnosis of bacterial vaginosis, dynamic monitoring of vaginal flora, or epidemiological surveys.

[0022] In some embodiments, the application includes extracting RNA from clinical vaginal swab samples and simultaneously detecting at least five key bacterial groups using an 8 μL reaction system, including Lactobacillus curvularia, Lactobacillus indolentus, Gardnerella vaginalis, Atobacillus vaginalis, and Prevotella spp., and calculating the Lactobacillus dominance index or pathogen load ratio based on the quantitative results of each bacterial group to assist in clinical interpretation.

[0023] In some implementations, the application can process 384 samples in a single run, with a total reagent consumption reduced by 60% compared to the conventional 20 μL system, and a reagent cost of less than RMB 1.5 per sample.

[0024] In summary, this invention precisely controls the dilution ratio of the core enzyme and buffer components in the RT-qPCR reaction system, and supplements it with limited concentrations of dNTPs and Mg. 2+ Furthermore, this study is the first to demonstrate that commercially available reagents can maintain reliable quantification of vaginal flora RNA templates even when diluted three times. This technical approach breaks with the conventional practice of "must use the original solution," providing a standardized and scalable low-cost detection pathway with significant industrial application value. Attached Figure Description

[0025] Figure 1 The image shows the results of RT-PCR reactions using the stock solution, 2-fold dilution, and 3-fold dilution of the RT-PCR reagent. Detailed Implementation

[0026] The various embodiments or implementation schemes in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments.

[0027] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "illustrative embodiment," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with an implementation or example is included in at least one implementation or example of this application. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same implementation or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more implementations or examples.

[0028] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of that feature. In the description of this application, "multiple" means at least two, such as two, three, etc., unless otherwise explicitly specified.

[0029] As described in the background section above, current vaginal flora detection primarily relies on real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) technology. Routine procedures typically use a 20-25 μL reaction volume and strictly adhere to the instructions for commercially available kits to ensure amplification efficiency and reproducibility. However, in high-throughput screening or large-scale epidemiological studies, this approach suffers from high reagent consumption, high cost per test, and accumulated liquid handling errors. Although some studies have attempted to reduce the reaction volume, they generally face technical obstacles such as decreased amplification efficiency, Ct value drift, and missed detections of low-concentration templates. The root cause lies in the lack of systematic regulation of the stoichiometry of key components in the diluted reaction system, especially dNTPs and Mg. 2+ The dynamic equilibrium of concentration was not effectively maintained.

[0030] Based on this, this application provides a method and kit for optimizing reaction reagents for vaginal flora detection. This involves precisely controlling the dilution ratio of 2×One-Step SYBR Green reaction reagent to iScript reverse transcriptase, and supplementing the diluent with a defined concentration of dNTP mixture and Mg. 2+ This allows the single-pore reaction volume to be compressed to 8 microliters, while maintaining the effect on 10 3 Up to 10 8 Stable amplification capability of cellular equivalent RNA template.

[0031] In a first aspect, this application provides a method for optimizing reaction reagents for vaginal flora detection, comprising the following steps: S10: Extract total RNA from vaginal microbial samples. The samples were clinically collected vaginal swabs, placed in Amies transport medium, and stored at 4°C for no more than 72 hours. Take 1×10⁻⁶ RNA. 9A sample equivalent to 1 bacterial cell volume was treated with 450 μL of lysis buffer, which consisted of 90% (v / v) Buffer RLT (Qiagen), 5% (v / v) TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), and 5% (v / v) 30 mM dithiothreitol (DTT). Then, 0.3 g of sterile glass beads (0.1 mm diameter) were added, and the sample was mechanically disrupted in a FastPrep-24 sample homogenizer at 5500 rpm for 30 seconds. Next, 500 μL of acidic phenol (pH 4.5) was added, vortexed for 10 seconds, and then heated in a 60°C dry bath for 10 minutes to promote protein denaturation and nucleic acid release. Finally, 100 μL of a 24:1 (v / v) mixture of chloroform and isoamyl alcohol was added, vortexed for 10 seconds, and then centrifuged at 12000 rpm for 5 minutes at 4°C. Take 400 μL of the supernatant, mix it with an equal volume of 99% ethanol, and load it onto a Zymo-Spin™ IICR column (ZymoResearch). Wash twice with 600 μL of RNA Wash Buffer I and 600 μL of RNA Wash Buffer II, while performing DNase I digestion on the column: add 80 μL of reaction solution containing 2 units of DNase I (composed of 10×DNase I buffer, RNase-free water, and DNase I enzyme), incubate at room temperature for 15 minutes, and then wash twice to remove residual DNA. Finally, elute with 200 μL of nuclease-free water (NFW) to obtain purified total RNA, and determine its concentration and purity (A260 / A280 ratio between 1.9 and 2.1).

[0032] S20: Perform serial dilutions of the extracted RNA. Dilute the original RNA solution with nuclease-free water for 10... -1 Up to 10 -6 Seven dilution gradients were obtained through successive tenfold dilutions. Each dilution gradient corresponded to an initial template amount of 10... 8 10 7 10 6 10 5 10 4 10 3 and 10 2 Cellular equivalents. Of which, 10 8 Cellular equivalents are defined as the amount of RNA in 1 μL of solution containing the equivalent of 1 × 10⁻⁶ cells / mL. 8 The 16S rRNA copy number of each target bacterial cell is calculated based on standard curve calibration.

[0033] S30: Prepare the optimized RT-qPCR reaction system. The 2×One-Step SYBR Green reagent (Bio-Rad, catalog number 1725130) is added in the form of stock solution, 2-fold dilution, or 3-fold dilution. The 2-fold dilution is prepared by mixing 1 volume of stock solution with 1 volume of dilution, and the 3-fold dilution is prepared by mixing 1 volume of stock solution with 2 volumes of dilution. iScript reverse transcriptase (same as kit components) is also added in the form of stock solution, 2-fold dilution, or 3-fold dilution, and the dilution method is the same as above. The dilution consists of 10 mmol / L Tris-HCl (pH 8.3), 0.2 mmol / L dNTP mixture (50 μmol / L each of dATP, dCTP, dGTP, and dTTP), and 1 mmol / L MgCl2. All components are dissolved in nuclease-free water, filtered through a 0.22 μm filter for sterilization, aliquoted, and stored at -20°C.

[0034] S40: Construct an RT-qPCR reaction system with a total volume of 8 μL per well in a 384-well white PCR plate (Thermo Fisher Scientific, AB-1456). The amounts of each component added are as follows: 4 μL of 2×One-Step SYBR Green reagent, 0.1 μL of iScript reverse transcriptase, 0.25 μL of upstream primer (final concentration 0.3125 μmol / L), 0.25 μL of downstream primer (final concentration 0.3125 μmol / L), 2 μL of template RNA, and 1.4 μL of nuclease-free water. Primer pairs were designed targeting the 16S rRNA gene of the target bacterial species. For example, the primers for *E. coli* were s-Ecoli-F (sequence: GAGTAAAGTTAATACCTTTGCTCATTG) and s-Ecoli-R (sequence: GAGACTCAAGCTKRCCAGTATCAG), with an amplicon length of 112 base pairs; the primers for *Gardnerella vaginalis* were s-Gard-F (sequence: ATGCAAGTCGAGCGGAGT) and s-Gard-R (sequence: TCCCACTTCTGTTACCCG), with an amplicon length of 98 base pairs. All primers were confirmed by BLAST alignment to have no nonspecific matches in the human genome or common vaginal commensal bacteria.

[0035] S50: After sealing the constructed reaction plate, place it in a CFX384 real-time quantitative PCR instrument (Bio-Rad) and execute the thermal cycling program: reverse transcription at 50 degrees Celsius for 30 minutes, initial denaturation at 95 degrees Celsius for 10 seconds, followed by 35 amplification cycles, each cycle including denaturation at 95 degrees Celsius for 20 seconds, annealing at 58 degrees Celsius for 30 seconds, and extension at 72 degrees Celsius for 50 seconds; finally, perform melting curve analysis: 95 degrees Celsius for 15 seconds, 55 degrees Celsius for 15 seconds, then increase the temperature to 95 degrees Celsius at a rate of 0.5 degrees Celsius every 5 seconds, and monitor the fluorescence signal in real time.

[0036] The amplification performance of the reagent system at different dilution ratios was evaluated based on the linear relationship between Ct values ​​and the standard curve. A standard curve was plotted with the logarithm of template RNA concentration on the x-axis and Ct values ​​on the y-axis, and the linear correlation coefficient R was calculated. 2 and amplification efficiency (Efficiency = [10^(-1 / slope) - 1] × 100%). The slope, intercept, and R0 of the standard curve obtained by diluting the reagent 2-fold or 3-fold are also considered. 2 When the dilution ratio is greater than 0.05 according to a two-sample t-test compared to the original reagent group, it is considered an acceptable operating condition. R is required. 2 The amplification efficiency is between 90% and 110%, and the value is not less than 0.99.

[0037] In some embodiments, the reaction system in step S40 is suitable for multiplex RT-qPCR detection, i.e., two or more primer pairs are added to the same well. For example, when simultaneously detecting *Lactobacillus curlis* and *Gardnerella vaginalis*, the total concentration of each primer pair is set to 0.2 μmol / L, the total primer concentration is 0.8 μmol / L, and the remaining components are prepared in the aforementioned proportions. The melting curve should show two independent and sharp peaks, corresponding to the Tm values ​​of the amplicon for the two target bacteria, respectively.

[0038] Secondly, this application provides an optimized kit for vaginal flora detection, comprising the following components: (a) Diluted 2×One-Step SYBR Green reagent, which is prepared by mixing a commercially available stock solution with a diluent containing 0.2 mmol / L of dNTP mixture and 1 mmol / L of Mg. 2+ This component was aliquoted into 0.2 mL PCR tubes at 100 μL / tube and stored at -20°C. (b) Diluted iScript reverse transcriptase, which is premixed with commercially available stock solution and diluent, and glycerol is added to a final concentration of 25%, and 0.1% bovine serum albumin (BSA) to prevent low-concentration enzyme from being inactivated by surface adsorption during storage or pipetting; this component is dispensed in 20 μL / tubes and stored at -20°C; (c) Specific primer pairs: one primer pair is provided for each of Lactobacillus curvularis, Lactobacillus indolentus, Gardnerella vaginalis, Atobacillus vaginalis and Prevotella spp., with a concentration of 10 μmol / L for each primer pair, and dispensed in 100 μL / tube. (d) Nuclease-free water, 500 μL / bottle; (e) The instruction manual details the preparation method, thermal cycling parameters, and data analysis rules for the 8 μL reaction system.

[0039] In some embodiments, component (a) is provided as a lyophilized powder. Prior to lyophilization, the premix is ​​mixed with 5% trehalose (w / v), aliquoted into 384-well plates, each well containing the equivalent of 8 μL of 2× reagent lyophilized material required for the reaction, and then lyophilized and sealed for storage. Activity is restored by adding 4 μL of reconstitution buffer (containing 0.2 mmol / L dNTPs, 1 mmol / L MgCl2, and 5% trehalose) before use.

[0040] In some embodiments, the kit also includes a positive control RNA. This positive control consists of a target bacterial 16S rRNA fragment synthesized in vitro, purified, quantified, and prepared into 10... 7 10 5 10 3 Copy three concentration gradients per microliter, 50 microliters per tube per gradient, and store at -80°C for quality control of each batch of tests.

[0041] In some implementations, all liquid components are packaged in a 384-well reservoir format, compatible with the HamiltonSTARlet automated liquid handling workstation. Users simply place the reservoir in the designated location on the workstation, and the program automatically aspirates and transfers each component to the PCR plate, completing the reaction system construction and minimizing human error.

[0042] Thirdly, this application provides the application of the aforementioned methods or kits in the microecological diagnosis of bacterial vaginosis. Specifically, this includes: after RNA extraction from 200 clinical vaginal swab samples, five key bacterial groups (Lactobacillus curvularia, Lactobacillus indolentus, Gardnerella vaginalis, Atobacillus vaginalis, and Prevotella spp.) are simultaneously detected using an 8 μL reaction system. The Lactobacillus dominance index (LAI = Lactobacillus curvularia copy number / total pathogen copy number) is calculated based on the absolute copy number of each bacterial group. A LAI less than 1 indicates dysbiosis.

[0043] The following describes embodiments of this application. The embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting this application. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products that can be obtained commercially. Example 1

[0044] An 8 μL reaction system was constructed using stock solutions: 4 μL of 2×One-Step SYBR Green reagent (stock solution), 0.1 μL of iScript reverse transcriptase (stock solution), 0.25 μL each of primers (final concentration 0.3125 μmol / L), and 2 μL of template RNA (10... 3 Up to 10 8 (Cellular equivalent), NFW 1.4 μL. Thermal cycling program as described in S50. Example 2

[0045] Use a 2x dilution of reagent: 2 μL of stock solution + 2 μL of diluent (containing 0.2 mmol / L dNTP and 1 mmol / L Mg). 2+ The iScript enzyme was prepared by adding 0.05 μL of stock solution to 0.05 μL of the same diluent, and the other components were the same as in Example 1. Example 3

[0046] The reagents were diluted 3 times: 2× reagent consisted of 1.33 μL stock solution + 2.67 μL diluent, iScript enzyme consisted of 0.033 μL stock solution + 0.067 μL diluent, and the remaining components were the same as in Example 1.

[0047] Comparative Example 1 The reagent was diluted 3 times, but the diluted solution did not contain dNTPs or Mg. 2+ It contains only Tris-HCl buffer (pH 8.3).

[0048] Comparative Example 2 A standard 20 μL reaction system was used, with the original reagent solution employed, and all other conditions were the same as in Example 1.

[0049] For each of the above embodiments and comparative examples, the RNA template of *E. coli* (10) was detected. 3 Up to 10 8 (cell equivalents), each concentration was repeated 8 times, and the mean Ct value, standard deviation, amplification efficiency, and R were calculated. 2 Values. The results are shown in Table 1.

[0050] Table 1 From Table 1 and Figure 1 As can be seen, Examples 1 to 3 maintained an amplification efficiency of 90% to 110% and R0 even with a significant reduction in reagent usage. 2 Higher than 0.99, and 10 3 The standard deviation of the Ct value for low-concentration templates was less than 0.5, indicating good repeatability. Comparative Example 1 did not supplement dNTPs and Mg. 2+The amplification efficiency decreased significantly, and the Ct value drifted noticeably. Although Comparative Example 2 had the best performance, it required 7.5 times more reagents than Example 3, resulting in high costs.

[0051] Further validation of multiplex detection capability: Under the conditions of Example 3, primer pairs of *Lactobacillus curlis* and *Gardnerella vaginalis* (0.2 μmol / L final concentration each) were added simultaneously to detect the mixed template. The melting curve showed two independent peaks (Tm 82.5℃ and 86.3℃, respectively), and the standard curve R... 2 The values ​​were 0.994 and 0.992, respectively, with amplification efficiencies of 95.7% and 96.9%, indicating that multiplex detection is feasible.

[0052] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An optimization method for a reaction kit for vaginal flora detection, characterized in that, Includes the following steps: S1: Extract total RNA from a vaginal microbial sample, wherein the microorganisms include Lactobacillus curvularis, Lactobacillus indolentus, Gardnerella vaginalis, Atobacillus vaginalis, Lactobacillus janniae, Lactobacillus gasseri, Moscurvy, Prevotella, Streptococcus, Escherichia coli, or Candida. S2: The extracted RNA is serially diluted to obtain the equivalent of 10 3 Up to 10 8 A cell equivalent of template RNA solution; S3: Prepare the RT-qPCR reaction system, in which 2×One-Step SYBR Green reagent is added as stock solution, 2-fold dilution, or 3-fold dilution, and iScript reverse transcriptase is added as stock solution, 2-fold dilution, or 3-fold dilution. The dilution contains 0.2 mmol / L dNTP mixture and 1 mmol / L Mg. 2+ ; S4: Construct the RT-qPCR reaction system with the following components added in the following amounts: 4 μL of 2×One-Step SYBR Green reagent, 0.1 μL of iScript reverse transcriptase, 0.25 μL of upstream primer, 0.25 μL of downstream primer, 2 μL of template RNA, and 1.4 μL of nuclease-free water. The final concentration of both upstream and downstream primers is 0.3125 μmol / L. S5: Place the constructed reaction plate in a real-time quantitative PCR instrument and execute the thermal cycling program: 50 degrees Celsius for 30 minutes, 95 degrees Celsius for 10 seconds, followed by 35 amplification cycles, each cycle including 95 degrees Celsius for 20 seconds, 58 degrees Celsius for 30 seconds, and 72 degrees Celsius for 50 seconds. Finally, perform melting curve analysis: 95 degrees Celsius for 15 seconds and 55 degrees Celsius for 15 seconds. S6: Evaluate the amplification performance of the reagent system at different dilution ratios based on the linear relationship between Ct value and standard curve, and determine the minimum effective reagent concentration that can be stably used for vaginal flora detection.

2. The method according to claim 1, characterized in that, In step S1, RNA extraction employs a combination of glass bead mechanical disruption and thermal phenol extraction, specifically including: [The text abruptly shifts to a seemingly unrelated topic about RNA extraction using glass beads and a phenol-containing method.] 9 450 μL of lysis buffer and 0.3 g of 0.1 mm diameter glass beads were added to a sample of bacterial cells and processed at 5500 rpm for 30 seconds in a sample homogenizer. The lysis buffer consisted of Buffer RLT, TE buffer, and 30 mM DTT. Then, 500 μL of acidic phenol was added, vortexed for 10 seconds, and heated in a dry bath at 60°C for 10 minutes. Next, 100 μL of a solution of chloroform and isoamyl alcohol at a volume ratio of 24:1 was added, vortexed for 10 seconds, and centrifuged at 12000 rpm for 5 minutes. 400 μL of the supernatant was mixed with an equal volume of 99% ethanol and loaded onto a Zymo-Spin™ IICR column. After washing and DNase I digestion, RNA was purified by elution with 200 μL of nuclease-free water.

3. The method according to claim 1, characterized in that, In step S2, RNA gradient dilution was performed using nuclease-free water for 10... -1 Up to 10 -6 Each of the tenfold dilutions corresponds to 10... 8 Up to 10 3 The amount of starting template equivalent to cells.

4. The method according to claim 1, characterized in that, In step S3, the 2×One-Step SYBR Green reagent 2-fold dilution is prepared by mixing 1 volume of stock solution with 1 volume of dilution, and the 3-fold dilution is prepared by mixing 1 volume of stock solution with 2 volumes of dilution; the iScript reverse transcriptase 2-fold dilution is prepared by mixing 1 volume of stock solution with 1 volume of dilution, and the 3-fold dilution is prepared by mixing 1 volume of stock solution with 2 volumes of dilution; the dilution is composed of a Tris-HCl buffer system, a 0.2 mmol / L dNTP mixture and a 1 mmol / L MgCl2, with a pH of 8.

3.

5. The method according to claim 1, characterized in that, In step S4, the primers are oligonucleotide sequences designed for the 16S rRNA gene or specific functional genes of the target bacterial species, and the final primer concentration is 0.25 to 0.5 micromoles per liter.

6. The method according to claim 1, characterized in that, In step S5, the annealing temperature of the thermal cycling process is 55 to 62 degrees Celsius, the extension time is 30 to 60 seconds, and the number of cycles is 30 to 40.

7. The method according to claim 1, characterized in that, In step S6, the standard curve is plotted with the logarithm of template RNA concentration on the x-axis and Ct value on the y-axis, and the linear correlation coefficient R is... 2 A concentration not lower than 0.99 indicates an amplification efficiency of 90% to 110%; the slope, intercept, and R0 of the standard curve obtained by diluting the reagent 2-fold or 3-fold... 2 When the value is not statistically significantly different from that of the original reagent, the dilution ratio is considered an acceptable operating condition.

8. The method according to claim 1, characterized in that, The method is applicable to multiplex RT-qPCR detection systems, in which specific primer pairs targeting two or more vaginal flora are added simultaneously in the same reaction well, with the final concentration of each primer being 0.15 to 0.3 μmol / L and the total primer concentration not exceeding 1.2 μmol / L.

9. An optimized kit for vaginal flora detection, characterized in that, Includes the following components: (a) A diluted 2×One-Step SYBR Green reagent, which is prepared by mixing a commercially available 2×One-Step SYBR Green reagent stock solution with a diluent containing 0.2 mmol / L of dNTP mixture and 1 mmol / L of Mg. 2+ ; (b) A diluted iScript reverse transcriptase, which is prepared by mixing a commercially available iScript reverse transcriptase stock solution with a diluent containing 0.2 mmol / L of dNTP mixture and 1 mmol / L of Mg. 2+ ; (c) A specific primer pair for at least one vaginal flora, said flora being selected from Lactobacillus curvularis, Lactobacillus indolentus, Gardnerella vaginalis, Atobacillus vaginalis, Lactobacillus janniae, Lactobacillus gasseri, Moscurvy, Prevotella, Streptococcus, Escherichia coli or Candida. (d) Nuclease-free water.

10. The reagent kit according to claim 9, characterized in that, The diluted 2×One-StepSYBR Green reagent in component (a) is provided as a lyophilized powder, to be reconstituted with a reconstitution buffer containing 0.2 mmol / L dNTP mixture and 1 mmol / L MgCl2 before use; the diluted iScript reverse transcriptase in component (b) is provided as a stable solution containing glycerol.

Images