DNA biosensor-based method for detecting genetic markers of disease resistance in livestock and poultry

Abstract

This invention relates to the fields of molecular breeding and biodetection technology, specifically disclosing a method for detecting genetic markers of disease resistance in livestock and poultry based on a DNA biosensor. The method includes: using a hairpin probe with a stem consisting of 7 base pairs and a loop consisting of 23 nucleotides, the loop being completely complementary to the flanking target sequence at the M307 locus of the porcine FUT1 gene; immobilizing the probe on a gold electrode with a 5' thiol-modified electrode; incubating and sealing the probe to obtain the sensor; hybridizing the probe with the whole blood of the pig being tested after lysis and dilution, without the need for nucleic acid amplification; and measuring the signal value using electrochemical impedance spectroscopy to determine the genotype. This invention utilizes the conformational barrier effect of the hairpin probe to achieve specific recognition of single-base mismatches under amplification-free and label-free conditions, eliminating dependence on PCR instruments and electrophoresis systems. The method is simple to operate, time-saving, and provides a reliable approach for rapid on-site disease resistance breeding and screening.

Description

Technical Field

[0001] This invention relates to the fields of molecular breeding and biological detection technology, and in particular to a method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors, for direct typing detection of single nucleotide polymorphism at the M307 site of the α-(1,2)fucotransferase 1 gene in pigs. Background Technology

[0002] Post-weaning diarrhea and edema in piglets are among the major diseases causing economic losses in pig farming. The presence of the F18 Escherichia coli receptor on the surface of the small intestinal mucosal epithelial cells determines the susceptibility of piglets to this pathogen, and the expression of this receptor is controlled by the FUT1 (α-(1,2)fucosyltransferase 1) gene. The G / A point mutation at nucleotide 307 of the FUT1 gene open reading frame (M307 site) has been proven to be closely related to the resistance of piglets to F18 Escherichia coli: AA genotype individuals show resistance, while AG and GG genotype individuals show sensitivity. In breeding pigs, genotyping screening at the FUT1 M307 site and retaining AA genotype individuals in the core breeding group can effectively reduce the incidence of diarrhea and edema in offspring piglets.

[0003] Currently, for genotyping of the porcine FUT1 M307 locus, molecular detection methods based on PCR amplification are commonly used in this field, including PCR-restriction fragment length polymorphism analysis (PCR-RFLP), TaqMan probe-based quantitative PCR, and direct sequencing of PCR products. While these methods can achieve accurate genotyping under laboratory conditions, they all share common problems such as complex operating procedures, reliance on precise temperature control equipment and specialized technicians, and long processing times. These methods are difficult to adapt to the rapid on-site testing needs in non-laboratory environments such as farms and grassroots veterinary stations. For example, publication number CN10172470... Chinese Patent 5A discloses a molecular detection kit for resistance in porcine F18 Escherichia coli and its application. Based on the polymorphism of the M307 site of the α(1,2)fucosyltransferase gene, it uses specific primers for PCR amplification. The amplified products are digested with Hin6Ⅰ restriction endonuclease and then analyzed by agarose gel electrophoresis. The genotype is determined based on the electrophoretic bands. This method usually takes more than 4 hours from sample collection to obtaining the test results, and requires reagents and equipment such as DNA extraction kits, PCR instruments, restriction endonucleases, and gel electrophoresis systems, which has significant limitations in practical application in breeding fields.

[0004] Therefore, how to achieve label-free, highly specific, and highly sensitive direct typing detection of the FUT1 M307SNP site in porcine whole blood samples without nucleic acid extraction and amplification is an unsolved technical problem in this field. Summary of the Invention

[0005] The technical problem to be solved by this invention is that the existing technology has problems such as the need for nucleic acid amplification, complex operation, reliance on precision equipment, and long time consumption. To this end, we propose a method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors.

[0006] To achieve the above objectives, this application adopts the following technical solution: a method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors, comprising the following steps: Step 1: A hairpin probe is used, which consists of a stem and a loop. The stem is 7 base pairs long and is formed by hybridization of two complementary sequences, 5'-GCGAGTC-3' and 5'-GACTCGC-3'. The loop is 23 nucleotides long and is completely complementary to the target sequence of the porcine FUT1 gene M307 site and its flanking position. The base corresponding to the M307 site is located in the center of the loop sequence. The 5' end of the hairpin probe is fixed to the surface of the gold electrode by thiol modification, and the 3' end is not connected to a reporter group. Step 2: The hairpin probe solution is dropped onto the surface of the gold electrode and incubated to allow the thiol group at the 5' end of the probe to form a gold-sulfur bond with the surface of the gold electrode. Then, the electrode surface is sealed with 6-mercapto-1-hexanol to obtain the DNA biosensor. Step 3: After lysis and dilution, the whole blood sample of the pig to be tested is brought into contact with the DNA biosensor to carry out a hybridization reaction. No nucleic acid amplification is performed during the hybridization process. Step 4: Measure the electrochemical impedance spectroscopy of the sensor before and after hybridization to obtain the signal value reflecting the degree of change in the charge transfer resistance of the sensor interface before and after hybridization. Determine the genotype of the sample to be tested at the M307 site of the FUT1 gene based on the signal value.

[0007] Preferably, the nucleotide sequence of the hairpin probe is as shown in SEQ ID NO:1, and its 5' end is modified with a thiol-C6 group; The target sequence includes a fully complementary target sequence SEQ ID NO:2 and a single-base mismatch target sequence SEQ ID NO:3, wherein SEQ ID NO:2 is 100% complementary to the loop sequence and has a G base at position M307, and SEQ ID NO:3 has a single-base mismatch with the loop sequence at position M307.

[0008] Preferably, in step two, the fixed concentration of the hairpin probe is 2.0 μM, and the incubation time is 16 hours; The concentration of 6-mercapto-1-hexanol was 1 mM, and the blocking time was 1 hour.

[0009] Preferably, the hybridization reaction time in step three is 30 minutes, and the hybridization temperature is room temperature.

[0010] Preferably, the pretreatment method for the whole blood sample of the pig to be tested in step three is as follows: take the whole blood sample containing EDTA, add cell lysis buffer containing 2% Triton X-100, 200mM Tris-HCl and 20mM EDTA at a volume ratio of 1:1, incubate at room temperature for 5 minutes, and then dilute with detection buffer at a ratio of 1:10.

[0011] Preferably, the measurement conditions for electrochemical impedance spectroscopy in step four are as follows: frequency range from 0.1 Hz to 100 kHz, AC amplitude of 5 mV, DC potential as open circuit potential, a three-electrode system, with the modified gold electrode as the working electrode, the Ag / AgCl electrode as the reference electrode, and the platinum wire electrode as the counter electrode, and the detection buffer is a 10 mM Tris-HCl buffer containing 50 mM NaCl.

[0012] Preferably, the signal value in step four is the charge transfer resistance change rate ΔR. ct / R ct0 Its calculation method is: ΔR ct =R ct1 -R ct0 , where R ct0 R is the charge transfer resistance before hybridization. ct1 This represents the charge transfer resistance after hybridization.

[0013] Preferably, the method has a detection limit of 0.13 nM under amplification-free conditions, a linear range of 0.5 nM to 100 nM, and a signal ratio of more than 3.5 times for a completely complementary target sequence to a single-base mismatch target sequence in pure buffer, and a signal ratio of more than 2.7 times for a completely complementary target sequence to a single-base mismatch target sequence in whole blood lysis dilution buffer.

[0014] Preferably, after completing one detection, the DNA biosensor is regenerated by immersing it in a 10mM Tris-HCl regeneration solution containing 50mM NaOH for 30 seconds. The pH value of the regeneration solution is 12.5. The regenerated biosensor can be reused no more than 3 times.

[0015] Preferably, this method is used for direct typing of the G / A single nucleotide polymorphism at the M307 site of the porcine α-(1,2)fucotransferase 1 gene. When the signal value is greater than or equal to 27%, it is determined to be the AA genotype; when the signal value is between 15% and 27%, it is determined to be the AG genotype; and when the signal value is less than 15%, it is determined to be the GG genotype.

[0016] The technical effects and advantages of this invention are as follows: In this invention, a hairpin probe with a conformation completely complementary to the M307 site of the FUT1 gene is designed. Utilizing the conformational barrier effect of the stem-loop structure during hybridization, specific identification of single-base mismatches is achieved without nucleic acid extraction and amplification. The method immobilizes the probe on a gold electrode surface via thiol self-assembly and directly reads the change in interfacial charge transfer resistance before and after hybridization using electrochemical impedance spectroscopy, thereby determining the genotype of the sample. Compared to existing detection methods that rely on PCR amplification and enzyme digestion electrophoresis, this approach eliminates the dependence on thermal cyclers, restriction endonucleases, and gel electrophoresis systems, simplifying the detection process to direct measurement after simple lysis and dilution of whole blood samples, significantly shortening detection time and reducing operational complexity. Simultaneously, the conformational regulation mechanism of the hairpin probe allows the sensor to maintain reliable resolution of single-base mutations even in the complex matrix of unpurified whole blood, solving the problem of insufficient SNP differentiation ability of traditional linear probes under label-free conditions. This method combines ease of operation and detection specificity, providing a practical and feasible technical approach for rapid on-site screening in livestock and poultry disease-resistant breeding. Attached Figure Description

[0017] The disclosure of this invention is illustrated with reference to the accompanying drawings. It should be understood that the drawings are for illustrative purposes only and are not intended to limit the scope of protection of this invention. In the drawings, the same reference numerals are used to refer to the same parts: Figure 1 This is a linear fitting graph of the standard curve of the present invention; Figure 2 This is a bar chart comparing the single-base mismatch discrimination capability signals of the present invention; Figure 3 This is a bar chart comparing the signals of the hairpin probe and the linear probe sensor of the present invention. Figure 4 This is a graph showing the stability of the sensor of the present invention when stored at 4°C over time. Figure 5 This is a bar chart showing the selectivity of the sensor of the present invention for non-target nucleic acids. Detailed Implementation

[0018] It is readily understood that, based on the technical solution of this invention, those skilled in the art can propose various interchangeable structural methods and implementations without altering the essential spirit of the invention. Therefore, the following detailed embodiments and accompanying drawings are merely illustrative examples of the technical solution of this invention and should not be considered as the entirety of the invention or as limitations or restrictions on the technical solution of this invention.

[0019] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0020] The term "hairpin probe" refers to a single-stranded DNA molecule whose 5' and 3' end sequences are complementary and can form a hairpin-type secondary structure with a stem and loop through self-hybridization.

[0021] The term "amplification-free" refers to a testing process that does not include any nucleic acid amplification steps such as PCR or isothermal amplification.

[0022] The term "label-free" means that the DNA probe itself is not covalently linked to any electrochemically active reporter group, fluorescent group, or enzyme label, and the signal generation depends solely on the changes in the physicochemical properties of the electrode interface caused by DNA hybridization.

[0023] This invention uses the M307 site of the porcine FUT1 gene as the detection target. The coding region sequence of the FUT1 gene can be obtained from the NCBI database. The M307 site is located at the 307th nucleotide of the open reading frame. The wild type has a G base and the mutant has an A base. Around the flanking region of the M307 site, this invention designs a specific hairpin probe and completes the sensor preparation and detection through the following steps.

[0024] Step 1: Hairpin Probe Sequence Design The hairpin probe consists of a stem and a loop. The stem is 7 base pairs long and is formed by hybridization of complementary sequences at the 5' and 3' ends of the probe, with sequences of 5'-GCGAGTC-3' and 5'-GACTCGC-3', respectively, and a GC content of 57%. The loop is 23 nucleotides long and is completely complementary to the target sequence flanking the M307 site of the FUT1 gene. The base corresponding to the M307 site is located in the center of the loop sequence. The 5' end of the hairpin probe is fixed to the gold electrode surface by a thiol modification. A 6-carbon alkyl chain is connected between the thiol and the 5' end as a flexible linker to reduce steric hindrance. No reporter group is connected to the 3' end.

[0025] The nucleotide sequence of the hairpin probe is shown in SEQ ID NO:1, consisting of 37 nucleotides in length, and its sequence composition is as follows: 5'-HS-(CH2)6-GCGAGTCCATCCTCTACCTACGTCTACTCAGACTCGC-3'; The 5' end GCGAGTC is the stem 5' end sequence, CATCCTCTACCTACGTCTACTCA is the loop targeting sequence (23 nucleotides), and the 3' end GACTCGC is the stem 3' end sequence; the base corresponding to the M307 site is located in the center of the loop.

[0026] Simultaneously, a fully complementary target sequence and a single-base mismatch target sequence were synthesized. The fully complementary target sequence (SEQ ID NO:2) is 23 nt in length and its sequence is 5'-GTGAGTAGACGTAGGTAGAGGAT-3', which is complementary to the loop sequence and has a G base at M307. The single-base mismatch target sequence (SEQ ID NO:3) is 23 nt in length and its sequence is 5'-GTGAGTAGACGTAGATAGAGGAT-3', which has a single-base mismatch with the loop sequence at M307. Neither target sequence contains any label.

[0027] Step 2: Pretreatment of gold electrodes The gold electrode (2 mm in diameter) was polished to a mirror finish on chamois leather using 1.0 μM, 0.3 μM, and 0.05 μM α-alumina pastes, respectively. After each polishing, the electrode was ultrasonically cleaned with ultrapure water for 3 minutes. The polished electrode was then activated by cyclic voltammetry in 0.5 M H2SO4, with a scan range of -0.2 V to +1.6 V, a scan rate of 100 mV / s, and 20 scan cycles, until the cyclic voltammetry curves overlapped and a stable gold oxide reduction peak was obtained. The activated gold electrode was then rinsed with ultrapure water and dried with high-purity nitrogen.

[0028] Step 3: Fixing the hairpin probe on the gold electrode surface The hairpin probe powder was dissolved in TE buffer to prepare a 100 μM stock solution. Before use, it was diluted to the required concentration with 10 mM Tris-HCl fixation buffer (pH 7.4, containing 1 mM TCEP to maintain the reduced state of thiol groups) containing 1 M NaCl. 2 μM of hairpin probe solution was dropped onto the pretreated gold electrode surface (10 μL per electrode) and incubated at room temperature in the dark for 16 hours to allow the thiol groups at the 5' end of the probe to form stable gold-sulfur bonds with the gold electrode surface. After incubation, the electrode surface was gently rinsed with Tris-HCl buffer to remove unbound free probes.

[0029] Step 4: Sealing treatment of electrode surface The electrode with the hairpin probe immobilized was immersed in a 1 mM 6-mercapto-1-hexanol solution and sealed at room temperature for 1 hour. 6-mercapto-1-hexanol binds to the gold electrode surface through its thiol groups, forming a monolayer on the active sites of the electrode surface not occupied by the probe. This reduces the non-specific adsorption of sample proteins and nucleic acids in subsequent detection and optimizes the spatial orientation of the probe on the electrode surface. After sealing, the electrode was thoroughly rinsed with Tris-HCl buffer and dried with high-purity nitrogen to obtain the DNA biosensor. If the prepared sensor is not used immediately, it should be stored in a detection buffer at 4°C.

[0030] Step 5: Electrochemical Impedance Spectroscopy Measurement and Data Analysis All electrochemical measurements were performed on a CHI 660E electrochemical workstation using a three-electrode system: a modified gold electrode as the working electrode, an Ag / AgCl electrode (saturated KCl) as the reference electrode, and a platinum wire electrode as the counter electrode; the detection buffer was a 10mM Tris-HCl buffer (pH 7.4) containing 50mM NaCl.

[0031] AC impedance spectroscopy measurement parameters: frequency range 0.1Hz to 100kHz, AC amplitude 5mV, DC potential as open circuit potential. Before measurement, equilibrate the sensor in the detection buffer for about 10 minutes, monitor the open circuit potential until the drift is less than 1mV / min, then measure the initial impedance spectrum before hybridization and record the charge transfer resistance R. ct0 .

[0032] Hybridization experiment: Immerse the sensor in detection buffer containing different concentrations of target sequences or whole blood lysate samples, incubate at room temperature for 30 minutes, remove and gently rinse the electrode surface with detection buffer, immediately perform post-hybridization impedance spectroscopy measurement, and record R. ct1 The equivalent circuit fitting of the impedance data uses the Randles model (including solution resistance R). s Charge transfer resistance R ct Constant phase angle element CPE and Warburg impedance Zw), charge transfer resistor R ct As a parameter for quantitative analysis; signal changes are expressed as ΔR ct / R ct0 ×100% represents, where ΔR ct =R ct1 -R ct0 .

[0033] Step Six: Pre-processing of Whole Blood Samples Take 100 μL of porcine EDTA-anticoagulated whole blood sample and add 2× cell lysis buffer (containing 2% Triton X-100, 200 mM Tris-HCl, 20 mM EDTA, pH 8.0) at a 1:1 volume ratio. Gently invert and mix 3 times, then incubate at room temperature for 5 minutes. After lysis, dilute the lysis buffer 1:10 with detection buffer and use it directly for sensor detection. This procedure does not involve nucleic acid extraction and purification steps.

[0034] Example 1: In this example, by setting different fixed concentrations of probes, using fully complementary target sequences and single-base mismatched target sequences as detection objects, the response signals and single-base discrimination capabilities of the sensors at each concentration are compared, thereby determining the optimal fixed concentration of the hairpin probe on the gold electrode surface.

[0035] Five probes with fixed concentration gradients were set up for the experiment: 0.5 μM, 1.0 μM, 2.0 μM, 3.0 μM, and 5.0 μM. Three parallel electrodes were prepared for each concentration. Sensor preparation and detection were performed according to steps one through five of the sensor preparation procedure. The hybridization time was fixed at 30 minutes. The completely complementary target sequence (SEQ ID NO:2, 1 nM) and the single-base mismatch target sequence (SEQ ID NO:3, 1 nM) were used as detection targets, and the change rate of charge transfer resistance ΔR before and after hybridization was recorded. ct / R ct0 The experimental results are shown in Table 1.

[0036] Table 1 Sensor response signals at different probe concentrations: Probe concentration (μM) <![CDATA[Complementary target ΔR ct / R ct0 (%, mean ± SD)]]> <![CDATA[Mismatched target ΔR ct / R ct0 (%, mean ± SD)]]> Complementary / Mismatched Signal Ratio 0.5 19.2±2.8 8.5±1.5 2.26 1.0 31.8±3.4 10.8±1.7 2.94 2.0 39.5±3.6 11.2±1.8 3.53 3.0 42.3±4.0 16.8±2.2 2.52 5.0 44.8±4.3 24.5±2.8 1.83 As shown in Table 1, as the probe concentration increased from 0.5 μM to 2.0 μM, the response signal of the complementary target sequence gradually increased from 19.2% to 39.5%, while the signal of the mismatch target sequence only increased slightly from 8.5% to 11.2%. The ratio of complementary to mismatch signals increased from 2.26 to 3.53 times. This indicates that at lower probe densities, increasing the number of probes can effectively improve hybridization efficiency and enhance the ability to distinguish single-base mismatches. When the probe concentration continued to increase to 3.0 μM and 5.0 μM, the increase in the complementary signal slowed down significantly (from 39.5% to only 44%). The complementary signal ratio (CFR) decreased from 3.53 to 1.83 times, while the mismatch signal ratio (CFR) increased significantly (from 11.2% to 24.5%). This was likely due to excessively high probe density causing crowding on the electrode surface and creating steric hindrance between adjacent probes, which hindered the effective hybridization of the target sequence and the probe. At the same time, the densely packed probes created a microenvironment on the electrode surface that was conducive to the non-specific adsorption of mismatched target sequences, resulting in an abnormally high CFR. Based on the above results, 2.0 μM was determined to be the optimal probe fixation concentration, at which the complementary signal ratio reached its maximum value of 3.53 times.

[0037] Example 2: This example compares the sensor's response to fully complementary target sequences and single-base mismatched target sequences at different hybridization times to determine the optimal hybridization time that can ensure both detection efficiency and reliable single-base differentiation.

[0038] A sensor was fabricated using a fixed concentration of 2.0 μM probe. Six hybridization time gradients were set: 5 min, 10 min, 20 min, 30 min, 45 min, and 60 min. Three parallel electrodes were set at each time point, with fully complementary target sequences (1 nM) and single-base mismatch target sequences (1 nM) as the detection targets, respectively. Impedance measurements were performed and ΔR was calculated according to the aforementioned method. ct / R ct0 The experimental results are shown in Table 2.

[0039] Table 2 Sensor response signals at different hybridization times: Hybridization time (min) <![CDATA[Complementary target ΔR ct / R ct0 (%, mean ± SD)]]> <![CDATA[Mismatched target ΔR ct / R ct0 (%,mean ± SD)]]> Complementary / Mismatched Signal Ratio 5 8.5±1.6 5.9±1.2 1.44 10 19.8±2.6 8.2±1.5 2.41 20 31.2±3.2 9.8±1.7 3.18 30 39.5±3.6 11.2±1.8 3.53 45 42.8±4.0 15.5±2.3 2.76 60 44.2±4.3 19.8±2.6 2.23 As shown in Table 2, within the hybridization time range of 5 to 30 minutes, the response signal of the complementary target sequence continuously increased with time, rising from 8.5% to 39.5%, indicating that the hybridization reaction had not yet reached equilibrium within this time period. Extending the hybridization time helps more target sequences bind to the probe. At 30 minutes, the complementary signal tended to saturate. Further extending the time to 60 minutes, the signal only increased from 39.5% to 44.2%, with a significant slowdown in the increase. Meanwhile, the signal of the mismatched target sequence increased slowly before 30 minutes (from 5.9% to 11.2%), but the rate of increase accelerated after 30 minutes, reaching 45%. The ratio reached 15.5% at 30 minutes and 19.8% at 60 minutes. This phenomenon caused the complementary to mismatch signal ratio to peak at 3.53 times at 30 minutes, and then gradually decreased to 2.23 times at 60 minutes. The abnormal increase in mismatch signal under long-term incubation may be related to the following factors: under long-term incubation conditions, the probability of partial non-specific binding between the mismatch target sequence and the probe increases; the probe stem may undergo slight structural relaxation after being soaked in buffer for a long time, which reduces the conformational energy barrier; considering both detection efficiency and single-base discrimination ability, 30 minutes was determined to be the optimal hybridization time.

[0040] Example 3: Based on the optimal conditions determined in Examples 1 and 2 (probe concentration fixed at 2.0 μM, hybridization time of 30 minutes), a standard curve was established using a completely complementary target sequence (SEQ ID NO:2), and the detection limit of this method was determined.

[0041] The fully complementary target sequence was serially diluted 10-fold with detection buffer to prepare target sequence solutions with concentrations of 0.05 nM, 0.1 nM, 0.5 nM, 1.0 nM, 5.0 nM, 10 nM, 50 nM, and 100 nM. Five parallel electrodes were set up for each concentration, and a blank buffer control was also set up (n=5). Impedance measurements were performed as described above, and ΔR was recorded at each concentration. ct / R ct0 The values ​​and experimental results are shown in Table 3.

[0042] Table 3 Sensor response signals at different target sequence concentrations: Target sequence concentration (nM) logC <![CDATA[ΔR ct / R ct0 (%, mean ± SD) CV(%) Difference from blank control 0.05 -1.30 4.2±1.3 31.0 Not significant (p>0.05) 0.1 -1.00 7.5±1.8 24.0 Significant (p<0.05) 0.5 -0.30 19.8±2.7 13.6 Significant (p<0.001) 1.0 0.00 39.5±3.6 9.1 Significant (p<0.001) 5.0 0.70 60.2±4.8 8.0 Significant (p<0.001) 10.0 1.00 71.5±5.2 7.3 Significant (p<0.001) 50.0 1.70 86.8±6.0 6.9 Significant (p<0.001) 100.0 2.00 96.5±6.8 7.0 Significant (p<0.001) Blank control — 3.8±1.2 31.6 — As can be seen from Table 3, within the concentration range of 0.5 nM to 100 nM, the sensor response signal ΔR ct / R ct0 The value increases systematically with increasing target sequence concentration, and the ΔR value for the concentration range of 0.5 nM to 100 nM... ct / R ct0Linear regression analysis was performed on the mean and the corresponding logC value, yielding the linear regression equation: ΔR ct / R ct0 (%) = 31.46 × logC(nM) + 35.66, correlation coefficient R 2 =0.994, indicating a good linear relationship between the sensor response and the logarithm of the target sequence concentration within this concentration range; the linear fitting plot of the standard curve is shown in [reference needed]. Figure 1 , Figure 1 The horizontal axis represents the logarithm of the target sequence concentration, logC (nM), and the vertical axis represents ΔR. ct / R ct0 (%), each data point is the mean of five parallel measurements, the error bars represent ±SD, the black dashed line in the figure is the linear fitting line, its interval covers the logC range (-0.30 to 2.00) corresponding to 0.5nM to 100nM.

[0043] The signal threshold was calculated as 7.4% by adding three times the standard deviation (3 × 1.2% = 3.6%) to the mean signal of the blank control (3.8%). This threshold falls between the measured signal at 0.05 nM (4.2 ± 1.3%) and the measured signal at 0.1 nM (7.5 ± 1.8%), indicating that 0.1 nM is the lowest distinguishable concentration obtained by this method. The linear regression equation ΔR based on the concentration range of 0.5 nM to 100 nM was then used. ct / R ct0 (%) = 31.46 × logC(nM) + 35.66 (R) 2 =0.994), substituting the threshold of 7.4% into the equation for extrapolation, the corresponding theoretical detection limit is 0.13 nM. Given that the measured signal at 0.05 nM is not significantly different from the blank, and the threshold is between 0.05 nM and 0.1 nM, the extrapolated 0.13 nM can be used as a reference value for the theoretical lower limit of detection under ideal conditions. When the target sequence concentration is 0.05 nM, the average signal is only 4.2%, which is lower than the detection limit level, and the coefficient of variation is as high as 31.0%, which is not significantly different from the blank control (p>0.05). False negative results may occur in actual sample testing.

[0044] Example 4: This example aims to systematically verify the ability of the prepared sensor to distinguish single-base mutations of the G / A mutation at the FUT1 M307 site. The sensor was prepared under the determined optimal conditions (probe concentration fixed at 2.0 μM, hybridization time 30 min). The detection targets were a fully complementary target sequence (SEQ ID NO:2, 1 nM and 10 nM), a single-base mismatch target sequence (SEQ ID NO:3, 1 nM and 10 nM), a non-complementary random sequence (10 nM, sequence 5'-ACTGACTGACTGACTGACTGAC-3', with no homology to the loop sequence of SEQ ID NO:1), and a blank buffer. Five parallel electrodes were set up for each group, and ΔR was recorded. ct / R ct0 The values ​​and experimental results are shown in Table 4.

[0045] Table 4. Sensor response signals to different target sequences: target sequence type Concentration (nM) <![CDATA[ΔR ct / R ct0 (%, mean ± SD) CV (%) Complementary / Mismatched Signal Ratio Perfectly complementary 1 39.5±3.6 9.1 — Perfectly complementary 10 71.5±5.2 7.3 — Single base mismatch 1 11.2±1.8 16.1 — Single base mismatch 10 20.3±2.6 12.8 — Non-complementary random sequences 10 5.2±1.4 26.9 — Blank buffer solution — 3.8±1.2 31.6 — Complementary contrast mismatch (1nM) — — — 3.53 Complementary contrast mismatch (10nM) — — — 3.52 As shown in Table 4, at a concentration of 1 nM, the ΔR generated by the completely complementary target sequence ct / R ct0 The signal strength of the target sequence was 39.5 ± 3.6%, while the signal strength of the single-base mismatch target sequence was 11.2 ± 1.8%, with a signal ratio of approximately 3.53. At a concentration of 10 nM, the signal strength of the perfectly complementary sequence was 71.5 ± 5.2%, and the signal strength of the single-base mismatch sequence was 20.3 ± 2.6%, with the signal ratio remaining at approximately 3.52, indicating that the sensor's ability to distinguish single-base mismatches remained stable within the test concentration range. The signal strength of the non-complementary random sequence (10 nM) was 5.2 ± 1.4%, which was not significantly different from the signal strength of the blank buffer (3.8 ± 1.2%) (p > 0.05), indicating that the sensor did not respond to non-target sequences. An independent samples t-test was used to statistically analyze the complementary and mismatch signals at a concentration of 1 nM, and the difference between the two reached a highly significant level (t = 15.32, p < 0.001). The signal comparison histogram for different target sequences is shown below. Figure 2 , Figure 2 Dark gray bars represent fully complementary target sequences, light gray bars represent single-base mismatch target sequences, and white bars represent non-complementary random sequences and blank controls, respectively. Error bars represent ±SD (n=5). The complementary and mismatch target columns are connected by a horizontal line and marked with three asterisks to indicate extremely significant differences at the p<0.001 level.

[0046] The above results indicate that the hairpin probe sensor of the present invention can effectively distinguish single-base mismatches at the FUT1 M307 site. This distinguishing ability may be attributed to the unique stem-loop secondary structure of the hairpin probe: when the fully complementary target sequence binds to the loop, the hybridization free energy is sufficient to overcome the binding energy barrier of the stem base pair, causing the stem to open and the probe to undergo a significant change from the hairpin conformation to the linear conformation, resulting in a significant increase in the charge transfer resistance at the electrode interface; while when the single-base mismatch target sequence binds to the loop, the hybridization free energy is reduced by about 2-4 kcal / mol due to the single base mismatch, which is insufficient to open the stem base pair, and the degree of probe conformational change is limited, thus generating a weaker impedance signal.

[0047] Example 5: This example aims to verify the actual detection performance of the prepared sensor in whole blood samples without nucleic acid extraction, so as to evaluate the applicability of the method in real samples.

[0048] EDTA-anticoagulated whole blood samples were taken from healthy pigs (the FUT1 M307 site was verified to be of the GG genotype by sequencing). The samples were lysed and diluted according to step six above. A fully complementary target sequence (SEQ ID NO:2) and a single-base mismatch target sequence (SEQ ID NO:3) were added to the whole blood lysis dilution buffer, with final concentrations of 1 nM and 10 nM, respectively. A whole blood lysis dilution buffer without the target sequence and a pure buffer buffer control were also set up. Five parallel electrodes were set up for each group, and the detection was performed according to the above method. The experimental results are shown in Table 5.

[0049] Table 5. Sensor detection performance under whole blood lysis dilution background: Sample type Add target sequence Concentration (nM) <![CDATA[ΔR ct / R ct0 (%, mean ± SD) CV (%) Complementary / Mismatched Signal Ratio Pure buffer solution Complementary 1 39.5±3.6 9.1 — Whole blood lysis fluid Complementary 1 35.8±4.2 11.7 — Pure buffer solution Complementary 10 71.5±5.2 7.3 — Whole blood lysis fluid Complementary 10 62.4±5.8 9.3 — Pure buffer solution Mismatch 1 11.2±1.8 16.1 — Whole blood lysis fluid Mismatch 1 12.8±2.3 18.0 — Pure buffer solution Mismatch 10 20.3±2.6 12.8 — Whole blood lysis fluid Mismatch 10 22.5±2.9 12.9 — Whole blood lysis fluid No additives — 7.8±1.9 24.4 — Pure buffer solution No additives — 3.8±1.2 31.6 — Whole blood lysis fluid Complementary contrast mismatch (1nM) — — — 2.80 Whole blood lysis fluid Complementary contrast mismatch (10nM) — — — 2.77 Table 5 shows that, against the background of whole blood lysis dilution buffer, the response signal of the 1 nM complementary target sequence was 35.8 ± 4.2%, a decrease of approximately 9.4% compared to 39.5 ± 3.6% in pure buffer; the response signal of the 10 nM complementary target sequence was 62.4 ± 5.8%, a decrease of approximately 12.7% compared to 71.5 ± 5.2% in pure buffer; the background signal of the whole blood lysis dilution buffer itself (without added target sequence) was 7.8 ± 1.9%, higher than the 3.8 ± 1.2% of the pure buffer. This may be due to the non-specific adsorption of residual cell debris and contaminating proteins on the electrode surface; in the region In terms of distinguishing ability, the signal ratio of complementary to mismatched pairs in whole blood lysis buffer was 2.80-fold at 1 nM and 2.77-fold at 10 nM. Although this was lower than the 3.53-fold in pure buffer, it still maintained effective distinguishability. Possible reasons for the signal decrease include: complex components in whole blood lysis buffer (such as contaminating proteins and lipids) partially blocking hybridization sites on the electrode surface; increased sample viscosity leading to a decrease in the diffusion rate of the target sequence; and increased background signal leading to a decrease in the signal-to-noise ratio. Nevertheless, the sensor still maintained acceptable single-base distinguishing ability in the complex matrix of whole blood, demonstrating the feasibility of this method in real samples without nucleic acid extraction.

[0050] Example 6: In this example, a whole blood sample of a pig with a known FUT1 M307 genotype was used to verify the method of the present invention with actual samples in order to evaluate the detection accuracy of the method.

[0051] Forty-five whole blood samples from pigs were collected and their genotypes were verified by PCR product sequencing. These included 15 samples of the AA genotype (resistant), 12 samples of the AG genotype (sensitive), and 18 samples of the GG genotype (sensitive). The samples were sourced from qualified breeding farms, and the pig breeds were Subaru and Large White. 100 μL of whole blood was collected from each sample, and the samples were lysed and diluted according to step six above. The prepared sensor was used for detection, with three parallel electrodes set up for each sample, and ΔR was recorded. ct / R ct0 The values ​​and experimental results are shown in Table 6.

[0052] Table 6. Detection results of whole blood samples from pigs with known genotypes: genotype Sample size <![CDATA[ΔR ct / R ct0 (%, mean ± SD) Minimum value (%) Maximum value (%) 95% confidence interval (%) AA 15 36.8±5.2 27.5 45.8 34.0-39.6 AG 12 19.5±3.6 14.2 26.1 17.2-21.8 GG 18 11.8±2.8 7.8 17.2 10.4-13.2 As shown in Table 6, the ΔR of the 15 AA genotype samples ct / R ct0The mean signal strength was 36.8 ± 5.2%, ranging from 27.5% to 45.8%. The mean signal strength of the 12 AG genotype samples was 19.5 ± 3.6%, approximately 53.0% of the mean signal strength of the AA genotype samples, ranging from 14.2% to 26.1%. The mean signal strength of the 18 GG genotype samples was 11.8 ± 2.8%, approximately 32.1% of the mean signal strength of the AA genotype samples, ranging from 7.8% to 17.2%. One-way ANOVA was used to compare the three groups, with an F-value of 102.5 and p < 0.001, indicating a highly significant difference in signal strength among the three genotypes. Further post-hoc multiple comparisons using the LSD method showed highly significant differences between AA and AG, AA and GG, and AG and GG (p < 0.01).

[0053] The detection results of this method were compared with the PCR sequencing results. The genotype determination results of all 45 samples were consistent with the sequencing results. Based on the above results, the genotype interpretation criteria are established as follows: ΔR ct / R ct0 A value ≥27% indicates AA genotype (resistance); ΔR ct / R ct0 Values ​​between 15% and 27% are considered AG genotype (sensitive); ΔR ct / R ct0 A value <15% indicates the GG genotype (sensitive).

[0054] Example 7: This example compares the performance differences between hairpin probes and conventional linear probes under the same detection conditions to verify the advantages of hairpin probe conformation design in distinguishing single base mismatches.

[0055] The linear probe was designed as a 23-nucleotide single-stranded DNA modified with thiol, the sequence of which is completely identical to the loop sequence of the hairpin probe (i.e., the complementary strand of the sequence shown in SEQ ID NO:2, with thiol modification at the 5' end). The linear probe sensor was prepared under the exact same conditions as the hairpin probe sensor: probe fixation concentration of 2.0 μM, fixation time of 16 hours, and 6-mercapto-1-hexanol blocking for 1 hour. The detection conditions were also kept consistent: hybridization was performed using a completely complementary target sequence (1 nM) and a single-base mismatch target sequence (1 nM), respectively, for 30 minutes, with five parallel electrodes set up for each group. The experimental results are shown in Table 7.

[0056] Table 7 Comparison of hairpin probe and linear probe sensors: probe type <![CDATA[Complementary target ΔR ct / R ct0 (% , mean ± SD)]]> <![CDATA[Mismatched target ΔR ct / R ct0 (%,mean ± SD)]]> Complementary / Mismatched Signal Ratio hairpin probe 39.5±3.6 11.2±1.8 3.53 Linear probe 30.2±3.5 19.8±2.5 1.53 As shown in Table 7, the linear probe sensor's response signal to a perfectly complementary target sequence was 30.2±3.5%, lower than the hairpin probe's 39.5±3.6%; its response signal to a single-base mismatch target sequence was 19.8±2.5%, significantly higher than the hairpin probe's 11.2±1.8%; the complementarity to mismatch signal ratio was only 1.53 times, far lower than the hairpin probe's 3.53 times; the signal comparison histogram for the two probes is shown below. Figure 3 , Figure 3 Dark red bars represent the response signals of perfectly complementary target sequences, light red bars represent the response signals of single-base mismatched target sequences, and error bars represent ±SD (n=5). Figure 3 It can be clearly seen that the hairpin probe is significantly better than the linear probe at distinguishing between complementary targets and mismatched targets.

[0057] The reason for the poor distinguishing ability of linear probes is analyzed as follows: Linear probes lack the conformational constraints of stem-loop secondary structures. When hybridized with both perfectly complementary target sequences and single-base mismatched target sequences, they form linear double strands. The difference in charge transfer resistance at the electrode interface between the two mainly stems from the slight influence of single-base mismatch on the rigidity of the double strand and the electron transfer efficiency. This difference is difficult to reliably distinguish under label-free impedance detection mode. In contrast, hairpin probes undergo a significant transformation from a closed hairpin conformation to an open linear conformation during hybridization. This conformational change has a much greater impact on the properties of the electrode interface than the subtle differences of single-base mismatches. Therefore, it can achieve efficient distinction of single-base mismatches under label-free conditions. This comparative result fully demonstrates the necessity of the hairpin probe conformational design of this invention.

[0058] Example 8: This example systematically evaluates the reproducibility and storage stability of the DNA biosensor to verify the reliability of the method in practical applications.

[0059] (1) Reproducibility experiment Five batches of sensors were independently prepared under the same conditions, with five parallel electrodes in each batch, for a total of 25 electrodes. Detection was performed using a 1 nM completely complementary target sequence (SEQ ID NO:2), and ΔR was recorded. ct / R ct0 The values ​​were calculated, and the coefficients of variation within and between batches were determined. The experimental results are shown in Table 8.

[0060] Table 8. Inter-batch and intra-batch reproducibility of sensors: Batch number Number of electrodes <![CDATA[ΔR ct / R ct0 (%, mean ± SD) Intra-batch CV (%) 1 5 38.6±2.5 6.5 2 5 40.2±2.8 7.0 3 5 37.5±2.3 6.1 4 5 39.8±3.0 7.5 5 5 38.1±2.6 6.8 All batches 25 38.8±2.8 7.2 (intra-batch mean), 9.6 (inter-batch mean) As shown in Table 8, the ΔR of the 25 electrodes ct / R ct0The average value was 38.8%, with the intra-batch coefficient of variation ranging from 6.1% to 7.5%, and the inter-batch coefficient of variation at 9.6%. The electrochemical DNA sensor was affected by various factors during its preparation, such as the polishing state of the electrode surface, probe immobilization efficiency, and ambient temperature and humidity. The 9.6% inter-batch coefficient of variation is within an acceptable range in similar electrochemical sensor studies. This result indicates that the sensor preparation method of the present invention has good reproducibility, and sensors prepared in different batches can provide relatively consistent detection results.

[0061] (2) Stability test Sensors prepared in the same batch were stored in a detection buffer at 4°C and retrieved on days 0, 1, 3, 5, 7, 10, and 14 for detection using a 1 nM fully complementary target sequence. Five parallel electrodes were used at each time point. The experimental results are shown in Table 9, and the stability-time curves are shown in [Figure 1]. Figure 4 , Figure 4 The horizontal axis represents the retention time, and the vertical axis represents the relative response signal, with the signal on day 0 as 100%. The black solid line connects the mean values ​​at each time point. Error bars represent ±SD (n=5), and the gray horizontal dashed line is the 90% signal retention reference line. Figure 4 It can be seen that the sensor signal decreased slowly in the first 5 days of storage, and remained above 90% on the 5th day; after the 7th day, the decay rate accelerated, and by the 14th day it dropped to about 68% of the initial signal.

[0062] Table 9: Sensor stability at 4℃: Storage time (days) <![CDATA[ΔR ct / R ct0 (%, mean ± SD) Relative to the initial signal (%) Difference from Day 0 0 39.5±3.6 100.0 — 1 38.9±3.4 98.5 Not significant (p>0.05) 3 37.8±3.7 95.7 Not significant (p>0.05) 5 36.2±3.9 91.6 Not significant (p>0.05) 7 34.5±4.2 87.3 Significant (p<0.05) 10 30.1±4.5 76.2 Significant (p<0.01) 14 26.8±4.8 67.8 Significant (p<0.01) As shown in Table 9, after 5 days of storage at 4℃, the response signal of the sensor was 91.6% of the initial signal, and the difference compared with day 0 was not statistically significant (t=1.58, p>0.05). After 7 days of storage, the signal decayed to 87.3% of the initial signal, and the difference was significant (t=2.15, p<0.05). After 14 days of storage, the signal further decayed to 67.8%. Possible reasons for the signal decay with prolonged storage time include: the gold-sulfur bond formed between the 5' end thiol group of the probe and the gold electrode surface undergoes partial oxidation or hydrolysis during long-term storage, causing the probe to gradually detach from the electrode surface; the stem-ring structure of the hairpin probe may undergo slow conformational relaxation or degradation during long-term storage in solution. The above results indicate that the sensor can be stably stored at 4℃ for at least 5 days, which can meet the transportation and short-term storage requirements from the laboratory to the farm.

[0063] Example 9: This example is used to verify the selectivity of the sensor for non-target nucleic acid sequences, ensuring that the detection results are not interfered with by nucleic acids from other regions of the pig genome and common pathogens.

[0064] Other common gene sequences in the pig genome (GAPDH gene fragment, β-actin gene fragment, mitochondrial 16S rRNA gene fragment) and nucleic acid sequences of common pig pathogens (partial conserved regions of classical swine fever virus CSFV, porcine circovirus type 2 PCV2, and porcine reproductive and respiratory syndrome virus PRRSV) were selected as interfering substances, all at a concentration of 10 nM. Simultaneously, a completely complementary target sequence (SEQ ID NO:2, 1 nM) was set as a positive control, and blank buffer as a negative control. Five parallel electrodes were set for each group, and detection was performed according to the aforementioned method. The experimental results are shown in Table 10, and the signal comparison bar chart is shown below. Figure 5 , Figure 5 Dark green bars represent fully complementary target sequences (1 nM), light green bars represent various non-target nucleic acids (10 nM), and white dashed-bordered bars represent blank controls. Error bars represent ±SD (n=5). Three asterisks above the complementary target bars indicate highly significant differences from other groups (p<0.001); ns above the non-target nucleic acid bars indicate no significant difference from the blank controls. Figure 5 It can be clearly seen that only the complementary target sequence produces a significant signal, while the signals of all non-target nucleic acids are at the same level as the blank control.

[0065] Table 10: Sensor selectivity for non-target nucleic acids: Test nucleic acid type Concentration (nM) <![CDATA[ΔR ct / R ct0 (%, mean ± SD) CV (%) Difference from blank control Fully complementary target sequences 1 39.5±3.6 9.1 Significant (p<0.001) GAPDH gene fragment 10 5.8±1.4 24.1 Not significant (p>0.05) β-actin gene fragment 10 5.3±1.3 24.5 Not significant (p>0.05) 16S rRNA gene fragment 10 6.5±1.6 24.6 Not significant (p>0.05) CSFV nucleic acid fragments 10 6.8±1.5 22.1 Not significant (p>0.05) PCV2 nucleic acid fragments 10 7.2±1.7 23.6 Not significant (p>0.05) PRRSV nucleic acid fragments 10 6.1±1.4 23.0 Not significant (p>0.05) Blank buffer solution — 3.8±1.2 31.6 — As shown in Table 10, the ΔR generated by all non-target nucleic acid sequences at a concentration of 10 nM ct / R ct0 The signal values ​​were all in the range of 5.3% to 7.2%, and there was no statistically significant difference compared with the blank buffer signal (3.8±1.2%) (one-way ANOVA F=1.82, p>0.05); while the signal generated by the 1 nM completely complementary target sequence (concentration of only 1 / 10 of the interfering substances) was as high as 39.5±3.6%, which was significantly different from the blank control and the signals of each interfering substance (p<0.001). These results indicate that the sensor of the present invention has high selectivity for the FUT1 M307 target sequence and is not affected by other regions of the pig genome or nucleic acids of common pig pathogens in the detection of pig whole blood samples, and has good detection specificity.

[0066] Example 10: This example is used to evaluate the performance changes of the sensor after multiple regeneration cycles, verify its feasibility of reuse, and provide specific experimental data support.

[0067] The completed hybridization sensor was immersed in regeneration buffer (10mM Tris-HCl buffer containing 50mM NaOH, pH 12.5) for 30 seconds to denature the double-stranded DNA formed by hybridization under alkaline conditions, causing the target sequence to dissociate from the probe. It was then thoroughly rinsed with detection buffer (pH 7.4), dried with high-purity nitrogen, and reused for detection. Five consecutive "hybridization-detection-regeneration" cycles were performed using the same sensor, with 1 nM of completely complementary target sequence used for each hybridization, and a hybridization time of 30 minutes. Three parallel sensors were set up for each group, and the ΔR of each cycle was recorded. ct / R ct0 Value and regenerated R ct0 Recovery rate, experimental results are shown in Table 11.

[0068] Table 11 Sensor Regeneration and Reuse Performance: Number of times used <![CDATA[ΔR ct / R ct0 (%, mean ± SD) Relative to the first signal (%) <![CDATA[R ct0 Recovery rate (%, mean ± SD) 1st time 39.5±3.6 100.0 100.0 2nd time 38.2±3.5 96.7 96.5±3.8 3rd time 36.8±3.9 93.2 94.2±4.2 4th 34.5±4.2 87.3 91.5±4.8 5th 31.2±4.8 79.0 87.8±5.5 As shown in Table 11, after two regeneration cycles, the sensor response signal remained at 96.7% of the initial signal, with an Rct0 recovery rate of 96.5%. After three regeneration cycles, the signal was 93.2% of the initial signal, with a recovery rate of 94.2%. By the fifth regeneration cycle, the signal had decreased to 79.0% of the initial signal, with a recovery rate of 87.8%. Possible reasons for the gradual signal decay with increasing regeneration cycles include: the alkaline conditions of the NaOH regeneration solution causing some damage to the gold-sulfur bonds on the probe and gold electrode surfaces, leading to partial probe desorption; and the regeneration process... Incomplete dissociation of the target sequence during the process resulted in a small amount of residual target sequence occupying part of the probe's hybridization site, affecting the next round of detection. Repeated rinsing and nitrogen drying caused cumulative mechanical damage to the electrode surface. The above results indicate that the sensor can be reused within a limited number of times (no more than 3 times) and its performance remains good (signal retention rate of 96.7% for the second time and 93.2% for the third time). However, considering the accuracy and comparability of the detection results, it is recommended to use a newly prepared sensor each time in actual livestock and poultry breeding screening. If reuse is required, the number of uses should not exceed 3 times.

[0069] In summary, this invention provides a method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors, used for direct typing detection of single nucleotide polymorphisms at the M307 locus of the porcine α-(1,2)fucotransferase 1 gene. Its beneficial effects are mainly reflected in the following aspects: (1) By using a hairpin structure probe, the probe conformation change is used to achieve efficient identification of single base mismatch. The ratio of complementary to mismatch signals can reach more than 3.5 times in pure buffer solution and still remains more than 2.7 times in whole blood lysis dilution solution, which solves the problem of insufficient single base discrimination ability of traditional SNP electrochemical sensors in livestock and poultry whole blood samples. (2) This method does not require nucleic acid extraction and nucleic acid amplification steps. Whole blood samples can be directly detected after simple lysis and dilution. The entire process from sample reception to obtaining test results takes about 42 minutes, which is significantly shorter than the more than 4 hours of the existing PCR-RFLP method. The detection time is greatly shortened, and no sophisticated equipment such as PCR instrument and electrophoresis instrument is required, which significantly reduces reagent costs. (3) The method still maintains good detection performance in complex biological matrix of whole blood. The detection results of 45 pig whole blood samples with known genotypes are completely consistent with the PCR sequencing results. There are extremely significant differences between the signal values ​​of the three genotypes (p<0.001), which proves the reliability of the method in actual sample detection. (4) It has high detection sensitivity, with a detection limit of 0.13 nM and a linear range of 0.5 nM to 100 nM (R²=0.994). (5) The sensor preparation method has good reproducibility, with a batch-to-batch coefficient of variation of about 9.6%, and can be stably stored at 4℃ for at least 5 days; (6) The sensor can be reused within a limited number of times (not exceeding 3 times), with a signal retention rate of 96.7% for the second time and 93.2% for the third time; (7) It has good selectivity for other regions of the pig genome and nucleic acids of common pathogens, and is not affected by non-target sequences.

[0070] The technical scope of this invention is not limited to the content described above. Those skilled in the art can make various modifications and variations to the above embodiments without departing from the technical concept of this invention, and all such modifications and variations should fall within the protection scope of this invention.

Claims

1. A method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors, characterized in that, Includes the following steps: Step 1: A hairpin probe is used, which consists of a stem and a loop. The stem is 7 base pairs long and is formed by hybridization of two complementary sequences, 5'-GCGAGTC-3' and 5'-GACTCGC-3'. The loop is 23 nucleotides long and is completely complementary to the target sequence of the porcine FUT1 gene M307 site and its flanking position. The base corresponding to the M307 site is located in the center of the loop sequence. The 5' end of the hairpin probe is fixed to the surface of the gold electrode by thiol modification, and the 3' end is not connected to a reporter group. Step 2: The hairpin probe solution is dropped onto the surface of the gold electrode and incubated to allow the thiol group at the 5' end of the probe to form a gold-sulfur bond with the surface of the gold electrode. Then, the electrode surface is sealed with 6-mercapto-1-hexanol to obtain the DNA biosensor. Step 3: After lysis and dilution, the whole blood sample of the pig to be tested is brought into contact with the DNA biosensor to carry out a hybridization reaction. No nucleic acid amplification is performed during the hybridization process. Step 4: Measure the electrochemical impedance spectroscopy of the sensor before and after hybridization to obtain the signal value reflecting the degree of change in the charge transfer resistance of the sensor interface before and after hybridization. Determine the genotype of the sample to be tested at the M307 site of the FUT1 gene based on the signal value.

2. The method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors according to claim 1, characterized in that: The nucleotide sequence of the hairpin probe is shown in SEQ ID NO:1, and its 5' end is modified with a thiol-C6 group; The target sequence includes a fully complementary target sequence SEQ ID NO:2 and a single-base mismatch target sequence SEQ ID NO:3, wherein SEQ ID NO:2 is 100% complementary to the loop sequence and has a G base at position M307, and SEQ ID NO:3 has a single-base mismatch with the loop sequence at position M307.

3. The method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors according to claim 1 or 2, characterized in that: In step two, the hairpin probe was fixed at a concentration of 2.0 μM and the incubation time was 16 hours. The concentration of 6-mercapto-1-hexanol was 1 mM, and the blocking time was 1 hour.

4. The method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors according to claim 1 or 2, characterized in that: The hybridization reaction in step three takes 30 minutes and is carried out at room temperature.

5. The method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors according to claim 1 or 2, characterized in that: The pretreatment method for the whole blood sample of the pig to be tested in step 3 is as follows: take the whole blood sample with EDTA, add cell lysis buffer containing 2% Triton X-100, 200mM Tris-HCl and 20mM EDTA at a volume ratio of 1:1, incubate at room temperature for 5 minutes, and then dilute with detection buffer at a ratio of 1:

10.

6. The method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors according to claim 1 or 2, characterized in that: The measurement conditions for electrochemical impedance spectroscopy in step four are as follows: frequency range from 0.1 Hz to 100 kHz, AC amplitude of 5 mV, DC potential as open circuit potential, a three-electrode system with the modified gold electrode as the working electrode, the Ag / AgCl electrode as the reference electrode, and the platinum wire electrode as the counter electrode, and the detection buffer is a 10 mM Tris-HCl buffer containing 50 mM NaCl.

7. The method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors according to claim 6, characterized in that: The signal value mentioned in step four is the charge transfer resistance change rate ΔR. ct / R ct0 Its calculation method is: ΔR ct =R ct1 -R ct0 , where R ct0 R is the charge transfer resistance before hybridization. ct1 This represents the charge transfer resistance after hybridization.

8. The method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors according to claim 1 or 2, characterized in that: The method has a detection limit of 0.13 nM under amplification-free conditions, a linear range of 0.5 nM to 100 nM, and a signal ratio of more than 3.5 times for completely complementary target sequences to single-base mismatch target sequences in pure buffer, and a signal ratio of more than 2.7 times for completely complementary target sequences to single-base mismatch target sequences in whole blood lysis dilution buffer.

9. The method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors according to claim 1 or 2, characterized in that: After completing one detection, the DNA biosensor is regenerated by immersing it in a 10mM Tris-HCl regeneration solution containing 50mM NaOH for 30 seconds. The pH value of the regeneration solution is 12.

5. The regenerated biosensor can be reused no more than 3 times.

10. The method for detecting genetic markers of disease resistance in livestock and poultry based on DNA biosensors according to claim 1 or 2, characterized in that: This method is used for direct typing of the G / A single nucleotide polymorphism at the M307 site of the porcine α-(1,2)fucotransferase 1 gene. When the signal value is greater than or equal to 27%, it is identified as the AA genotype; when the signal value is between 15% and 27%, it is identified as the AG genotype; and when the signal value is less than 15%, it is identified as the GG genotype.

Images