Primers, probes and kits for detection of hepatitis delta virus
Patent Information
- Application Number
- CN202510844650.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-23
- Publication Date
- 2026-06-23
Smart Images
Figure CN122256568A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection technology, specifically relating to primers, probes, and kits for the detection of hepatitis E virus. Background Technology
[0002] In my country, hepatitis E virus (HEV) is the leading cause of acute viral hepatitis, and the number of cases is increasing year by year. Patients with chronic liver disease, pregnant women, and the elderly are high-risk groups for HEV infection, which can also lead to various extrahepatic clinical manifestations, posing a serious threat to patients' health. Currently, the clinical diagnosis of hepatitis E in my country mainly relies on HEV IgM antibody testing, but serological testing alone is insufficient to accurately determine whether a patient is currently infected with hepatitis E. Furthermore, previous hepatitis E antigen testing methods have suffered from low sensitivity and short positive cycles. Therefore, there is an urgent need for accurate and effective etiological detection methods, especially nucleic acid detection technology, to improve the diagnostic accuracy of hepatitis E.
[0003] Currently, the main methods for detecting HEV RNA include real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR), reverse transcription loop-mediated isothermal amplification (RT-LAMP), and ERA. Among these, RT-qPCR has been widely used in clinical laboratories for the quantitative detection of nucleic acids of other viruses, and has also found some application in the detection of hepatitis E nucleic acid. It features high sensitivity, specificity, and good reproducibility, but it also suffers from problems such as complex operation, high cost, and susceptibility to contamination. ERA utilizes a special primer design and enzyme system to achieve nucleic acid amplification under isothermal conditions, offering advantages such as speed, sensitivity, and specificity. Furthermore, it is relatively simple to operate and requires less sophisticated equipment.
[0004] Existing studies have proposed asymmetric primer PCR technology, which utilizes a pair of primers of unequal concentration to generate a large number of single-stranded products in the later stages of the PCR reaction, facilitating subsequent experiments that require single-stranded DNA as a template, such as sequencing and hybridization probe preparation. However, the large-scale clinical application of asymmetric primer PCR technology is limited by core drawbacks such as insufficient sensitivity, cumbersome operation, and lack of quantitative function. Furthermore, there is currently no method for detecting HEV using asymmetric primer ERA technology in rapid clinical diagnostic applications.
[0005] Therefore, there is an urgent need to explore and establish an asymmetric primer ERA detection system for HEV detection and diagnosis, so as to accurately distinguish hepatitis E virus from other similar viruses or pathogens and provide new technical support for clinical diagnosis. Summary of the Invention
[0006] To address the problems of existing technologies, this invention provides specific primer pairs and probes for hepatitis E virus detection. Asymmetric specific primer pairs and corresponding probes are designed to target upstream and downstream regions of the hepatitis E virus gene as amplification segments, ensuring the conservation and specificity of the target sequence. The asymmetric primer ERA isothermal amplification technology can rapidly and specifically amplify the target nucleic acid sequence, contributing to early and accurate diagnosis of the disease.
[0007] To achieve the above objectives, the present invention employs the following technical solution:
[0008] On one hand, the present invention provides an asymmetric primer set for detecting hepatitis E virus, comprising an upstream primer, a downstream primer, and a probe, wherein the upstream primer has a nucleotide sequence as shown in SEQ ID NO.3; the downstream primer has a nucleotide sequence as shown in SEQ ID NO.4; and the probe has a nucleotide sequence as shown in SEQ ID NO.7.
[0009] Hepatitis E virus (HEV) may initially be present in low concentrations in patients, and its genome is a single-stranded positive-sense RNA, making it prone to degradation. Traditional detection methods may fail to accurately detect low-copy-number viral nucleic acids, leading to missed diagnoses. While ERA (extracorporeal membrane oxygenation) detection methods offer advantages such as speed, sensitivity, and specificity compared to traditional techniques like PCR, traditional ERA methods typically require heating to denature and open the double-stranded DNA product before fluorescent probe hybridization, increasing operational steps and time, and reducing hybridization efficiency. Therefore, they may still suffer from insufficient sensitivity and specificity. Based on the principle of asymmetric primer PCR, this invention innovatively introduces an asymmetric primer ERA detection system. By designing specific primers and optimizing reaction conditions, highly efficient amplification of HEV nucleic acid can be achieved, enabling accurate detection even at extremely low viral nucleic acid concentrations, thereby improving detection sensitivity.
[0010] Compared with conventional ERA detection techniques, the asymmetric primer ERA detection technology provided by this invention has significant advantages. Firstly, it can directly generate a large amount of single-stranded DNA, eliminating the need for complex methods to convert double-stranded DNA into single strands. Direct and efficient hybridization of single-stranded products offers higher detection sensitivity than hybridization after denaturation of double-stranded products. Therefore, for certain specific detection targets, asymmetric primer ERA amplification helps improve detection sensitivity and specificity. For example, in detecting single nucleotide polymorphisms (SNPs), by designing appropriate asymmetric primers, amplification can be made more biased towards specific alleles, thus more accurately detecting SNP sites. Secondly, it eliminates the need for circular opening and other operational steps, simplifying the process and making it faster and more convenient. In pathogen detection, tumor gene detection, and other fields, the asymmetric primer ERA isothermal amplification technology provided by this invention can rapidly and specifically amplify target nucleic acid sequences, contributing to early and accurate disease diagnosis.
[0011] However, in practical applications, asymmetric primer ERA detection technology has significant advantages over conventional ERA technology and asymmetric primer PCR technology, but it also faces unique technical challenges. First, the primer design in asymmetric primer ERA detection systems has strict requirements on primer length; ERA primers typically need to be 28-32 nt (longer than conventional PCR primers), as shorter primers will significantly reduce amplification speed and sensitivity. Simultaneously, fluorescent or strip-type ERA requires specifically designed probes (such as those modified with THF sites). Second, in terms of primer ratio optimization, the proportion of primers in asymmetric ERA is usually higher than that in traditional asymmetric PCR, and it is necessary to avoid primer dimers interfering with the formation of recombinant complexes. Furthermore, ERA detection systems rely on multi-enzyme systems (recombinases, polymerases, etc.), and unequal primer amounts may disrupt enzyme synergy, leading to a decrease in single-strand yield. Therefore, in the construction of asymmetric primer ERA detection systems, primers, probes, recombinases, and other amplification reagents all need to be carefully designed, screened, and optimized to improve the sensitivity and specificity of the detection results. In some embodiments of the present invention, experimental results demonstrate that the sensitivity and specificity of the asymmetric primer ERA detection system provided by the present invention are significantly improved, the amplification speed is extremely fast, and compared with asymmetric primer PCR detection, no thermal cycler is required, which greatly simplifies the equipment requirements.
[0012] On the other hand, the present invention provides a nucleic acid detection system for hepatitis E virus, comprising the asymmetric primer set and nucleic acid isothermal amplification reaction reagent as described above.
[0013] The technical principle of the asymmetric primer ERA detection system is similar to that of conventional ERA technology. First, a recombinase binds to the primers, searches for complementary sequences on the template DNA, and opens the double strand. Then, a new DNA strand is synthesized under the action of DNA polymerase. The difference lies in the unequal concentrations of the upstream and downstream primers. In the early stages of amplification, since both primers are present, double-stranded DNA synthesis proceeds normally, and the product increases exponentially. As the reaction progresses, the low-concentration primers are gradually depleted, while the high-concentration primers continue to guide the synthesis of single-stranded DNA, ultimately producing mainly single-stranded DNA synthesized under the guidance of the high-concentration primers. Then, an ERA fluorescent probe is introduced into the amplification product. After the specific probe binds to the single-stranded target sequence, a specific local double strand is formed. Specific exonucleases in the reaction system recognize the specific DNA double strand bound to the probe and cleave the probe at specific sites. The fluorescent and quenching groups on the probe are separated, generating a fluorescence signal proportional to the amount of target DNA amplified. The fluorescence intensity increases with amplification.
[0014] In some embodiments, the present invention designs and screens the sequences of asymmetric primers and probes. This invention uses the upstream and downstream regions of the hepatitis E virus gene as target amplification segments, designing three upstream and downstream primers and three probes. The provided primers are combinations of specifically modified upstream and downstream primers. The specifically modified upstream and downstream primers are tailed primers, each consisting of a template hybridization region and a template extension region. Both the template hybridization region and the template extension region are template complementary sequences. The template hybridization region is the base sequence used for amplification, and the template extension region is a base sequence extending along the 3' axis. An Abasic-type base site separates the template hybridization region and the template extension region. This special modification design improves the sensitivity and specificity of ERA primer amplification. The experimental results of this invention show that, after combining the nine primer pairs with the probe, only the asymmetric primer ERA detection system constructed using the upstream primer shown in SEQ ID NO.3, the upstream primer shown in SEQ ID NO.4, and the probe shown in SEQ ID NO.7 can significantly improve the sensitivity, specificity, and detection efficiency of hepatitis E virus detection.
[0015] In asymmetric ERA detection systems, the ratio of upstream to downstream primers significantly affects the specificity and sensitivity of the detection results. Therefore, in some embodiments, this invention also verified the necessity of selecting a 1:30 ratio of upstream to downstream primer concentrations. Results showed that when the ratio of upstream to downstream primer concentrations is higher than 1:30, the proportion of restriction primers in the detection system is too high, prematurely consuming the template and generating a large amount of double-stranded DNA, leading to insufficient amplification of the target single-stranded DNA and reducing the single-stranded yield. When the ratio of upstream to downstream primer concentrations is lower than 1:30, the proportion of restriction primers is too low, primers are exhausted prematurely, leaving a large amount of unused template and non-restriction primers. The single-stranded amplification stage is slowed down due to insufficient template, resulting in a decrease in overall amplification efficiency. Therefore, only by selecting a 1:30 ratio of upstream to downstream primer concentrations can the detection efficiency, sensitivity, and specificity of the asymmetric primer ERA detection system be improved.
[0016] Furthermore, asymmetric primer ERA detection systems rely on multi-enzyme systems (recombinases, polymerases, etc.). For example, recombinases bind to primers to form nucleoprotein filaments. This complex scans the double-stranded DNA template, searching for homologous sequences complementary to the primers. Once found, the recombinase catalyzes a strand exchange reaction, partially unwinding the template DNA double strand (forming a D-loop structure), exposing the single-stranded template region, creating conditions for primer annealing and extension. Meanwhile, DNA polymerases synthesize new DNA strands using deoxyribonucleotide triphosphates after primer-template binding. In addition, the recombinases in ERA detection systems consume a large amount of ATP to initiate the strand exchange reaction. To maintain the ATP concentration in the reaction system, an energy regeneration system, such as a creatine phosphate system or a pyruvate kinase system, is usually required. This energy regeneration system significantly affects ATP regeneration and the efficient operation of the recombinase. Therefore, the type of reagents, such as amplifying enzymes, in asymmetric primer ERA detection systems can significantly interfere with the synergistic effect between the primers and the recombinases, thus affecting the sensitivity, specificity, and detection efficiency.
[0017] Therefore, to ensure the specificity and sensitivity of the amplification products and improve amplification efficiency, the specific selection of recombinase, DNA polymerase, and energy regeneration system was compared and screened in some embodiments of the present invention. The results showed that the ERA detection system constructed using recombinases of phage UvsX and UvsY proteins, Klenow polymerase, and an energy regeneration system composed of phosphocreatine and creatine kinase exhibited good specificity and high sensitivity. This is because, compared to the commonly used RecA recombinase, UvsY in the UvsX / UvsY system acts as a loading factor, helping UvsX to rapidly bind with primers to form a complex, significantly reducing the amount of UvsX and ATP used, and the UvsX / UvsY system has a wider temperature adaptability. Klenow polymerase has high reliability, improving the specificity of the amplification products. Furthermore, the energy regeneration system using phosphocreatine + creatine kinase has higher stability and reaction efficiency than the phosphoenolpyruvate + pyruvate system, ensuring the continuous and efficient operation of the recombinase under isothermal conditions through continuous ATP regeneration, further improving the efficiency and specificity of the amplification reaction.
[0018] Furthermore, the nucleic acid isothermal amplification reaction reagent is any one or more recombinase-mediated isothermal amplification reaction reagents selected from ERA, RPA, and RAA, including bacteriophage uvsX protein and bacteriophage uvsY protein.
[0019] Furthermore, the nucleic acid isothermal amplification reaction reagent also includes phosphocreatine kinase, creatine kinase, and a large fragment of Klenow polymerase.
[0020] Furthermore, the nucleic acid isothermal amplification reaction reagent includes tris(hydroxymethyl)aminomethane-acetic acid buffer, potassium acetate, magnesium acetate, dithiothreitol, polyethylene glycol, ATP, phosphatase, creatine kinase, phage UvsX protein, phage UvsY protein, Klenow polymerase large fragment, exonuclease III, reverse transcriptase, and dNTPs.
[0021] In another aspect, the present invention provides a method for detecting hepatitis E virus, which uses the asymmetric primer set or the nucleic acid detection system described above for detection.
[0022] Furthermore, the method includes the following steps:
[0023] S1: Premixed reagent for constructing the template nucleic acid amplification reaction system;
[0024] S2: Insert the premixed reagent tube into the fluorescence isothermal amplification instrument to carry out the amplification reaction.
[0025] Furthermore, the concentration ratio of the upstream primer to the downstream primer in the nucleic acid amplification reaction system described in step S1 is 1:(5-100).
[0026] Preferably, the concentration ratio of the upstream primer to the downstream primer in the nucleic acid amplification reaction system described in step S1 is 1:30.
[0027] Furthermore, the amplification reaction in step S2 is carried out at a temperature of 37–45°C for 20–30 minutes.
[0028] In some implementations, the asymmetric ERA detection system is amplified and detected at the same temperature of 37–45°C. Amplification and detection are performed in the same reaction tube. The first step involves incubation in a metal bath or water bath at 37–45°C for 10–15 minutes. After removing the reaction tube and mixing it by inverting it 7–10 times, the reagent tube is inserted into a fluorescence isothermal amplification instrument at a preset temperature of 37–45°C for 5–10 minutes of fluorescence signal acquisition. The total reaction time is 20–25 minutes.
[0029] In another aspect, the present invention provides the use of an asymmetric primer set for preparing an ERA amplification detection reagent to improve the sensitivity of hepatitis E virus nucleic acid detection, characterized in that the asymmetric primer set includes an upstream primer, a downstream primer and a probe, wherein the upstream primer has a nucleotide sequence as shown in SEQ ID NO.3; the downstream primer has a nucleotide sequence as shown in SEQ ID NO.4; and the probe has a nucleotide sequence as shown in SEQ ID NO.7.
[0030] The present invention has the following beneficial effects:
[0031] 1. Primer and probe sequences were designed and screened to construct an asymmetric ERA detection system that can specifically recognize the nucleic acid sequence of hepatitis E virus, reduce non-specific binding with other irrelevant nucleic acids, thereby improving the specificity of detection and ensuring the accuracy of detection results.
[0032] 2. The concentration ratio of upstream and downstream primers and nucleic acid amplification reaction reagents were optimized. A concentration ratio of 1:30 and nucleic acid amplification reagents containing recombinases of phage UvsX protein and phage UvsY protein, Klenow polymerase and creatine phosphokinase / creatine kinase system were used, which significantly improved the amplification efficiency of the detection system.
[0033] 3. The asymmetric ERA detection system can achieve efficient amplification of hepatitis E virus nucleic acid, and can accurately detect it even when the viral nucleic acid content is extremely low, thereby improving the sensitivity of detection.
[0034] 4. Asymmetric ERA detection technology is an isothermal amplification technique that can amplify nucleic acids at a constant temperature, eliminating the need for a cumbersome temperature cycling process, greatly shortening the detection time, and enabling rapid detection of hepatitis E virus nucleic acid, providing support for timely diagnosis and treatment of patients.
[0035] 5. The reaction system of asymmetric ERA detection technology is relatively simple, requiring no special instruments or equipment, and can be carried out under ordinary laboratory conditions. At the same time, its operation procedure is also relatively simple, reducing the impact of human factors on the detection results and improving the stability and repeatability of the detection. Attached Figure Description
[0036] Figure 1 The primer screening results are for hepatitis E virus gene detection.
[0037] Figure 2 The results of probe screening for hepatitis E virus gene detection.
[0038] Figure 3 This is a sensitivity verification result for hepatitis E virus gene detection.
[0039] Figure 4 This is a specificity verification result for hepatitis E virus gene detection. Detailed Implementation
[0040] To make the above-mentioned objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. The illustrative embodiments and descriptions of the present invention are only used to explain the present invention and are not intended to limit the present invention.
[0041] Unless otherwise specified, all raw materials used in the examples are commercially available.
[0042] Example 1: Design and screening of asymmetric primer sets
[0043] I. Primer Screening
[0044] Based on NCBI data, a specific region of the hepatitis E virus gene was selected as the target sequence (as shown in SEQ ID NO. 10). According to the primer design principles of ERA technology, the primer length should be 28–35 bp, and the probe length should be 44–52 bp, with the 5' end of the THF site being at least 30 nt and the 3' end at least 15 nt. THF replaces a base located between the fluorophore and the quencher, and the interval between the dT-fluorophore or dT-quencher and the THF base is 0, 1, or 2. The amplified fragment should not exceed 500 bp, and the GC content should be 30%–60%. ERA primers and probes targeting the hepatitis E virus gene were designed using Primer Premier 5 and preliminarily validated. Three upstream and three downstream primers with the lowest probability of secondary structure, hairpin structure, and primer dimer formation were selected as candidate primers. The reporter probe was modified with the fluorophore FAM at the 5' end and the quencher BHQ1 at the 3' end. Relevant sequences are shown in Table 1.
[0045] Table 1. Design of asymmetric ERA primers and probe sequences for the hepatitis E virus gene.
[0046]
[0047]
[0048] The optimal primer pairs were screened and validated using an asymmetric ERA detection system. All primers and probes were synthesized by General Biotechnology (Anhui) Co., Ltd. The asymmetric ERA detection system consisted of a 50 μL amplification reaction system and a 5 μL detection system, as shown in Tables 2 and 3, respectively.
[0049] Table 2 Amplification reaction system
[0050]
[0051] Table 3 Detection System
[0052]
[0053]
[0054] The nucleic acid template in Table 2 above is a positive plasmid for hepatitis E virus. Based on the hepatitis E virus gene target sequence, a characteristic region was selected as the target amplification segment (sequence shown in SEQ ID NO.10), which was constructed into the vector pUC57 to prepare a positive plasmid for hepatitis E virus. The plasmid DNA was synthesized by Nanjing Qingke Biotechnology Co., Ltd.
[0055] Table 1 shows the following combinations of upstream and downstream primers:
[0056] S1: F1R1; S2: F1R2; S3: F1R3; S4: F2R1; S5: F2R2; S6: F2R3; S7: F3R1; S8: F3R2; S9: F3R3.
[0057] The amplification and detection steps are as follows:
[0058] (1) Prepare 50 μL of amplification reaction system and 5 μL of detection system according to the components and dosages shown in Tables 2 and 3 respectively. After preparation, add the amplification reaction system and detection system to the reaction tube and mix well to obtain the premixed solution.
[0059] (2) Incubate the premixed reaction tube in a metal bath or water bath at 37–45°C for 10–15 min (preferably 42°C, 15 min in this embodiment). Remove the reaction tube, invert it 7–10 times to mix, and then insert it into a fluorescence isothermal amplification instrument (Syndagene, GS8) with a preset temperature of 37–45°C for 5–10 min (preferably 5 min in this embodiment) to collect fluorescence signals. The detection efficiency verification results of the 9 primer combinations are as follows: Figure 1 As shown.
[0060] During fluorescence signal acquisition, the positive fluorescence signal increases linearly at a certain slope. As the reaction time continues to extend, the fluorescence detection signal eventually reaches a plateau. The higher the slope of the fluorescence signal increase, the higher the detection efficiency, meaning that the combination of crRNA and primer pair has higher detection efficiency. Under the same template concentration, primer pair combinations with a higher slope of fluorescence signal increase are preferred. Figure 1 As shown in the fluorescence curves, the fluorescence signal growth rate of primer combination S7(F3R1) is higher than that of other primer combinations, and the slope of fluorescence growth is the highest. This indicates that when the designed F3R1 primer combination is used to detect the hepatitis E virus gene, it amplifies the target product faster and in greater quantities, resulting in higher amplification efficiency, making it the preferred combination.
[0061] Meanwhile, the present invention also uses 10 4 copies / ul, 10 3 copies / ul, 10 2 Using hepatitis E virus plasmid DNA of 10 copies / ul and 10 copies / ul as templates, the detection sensitivity of the 9 primer combinations was further verified by the above amplification and detection methods. The detection results are shown in Table 4.
[0062] Table 4. Sensitivity verification results of the 9 primer combinations
[0063]
[0064]
[0065] Note: "+" indicates detected; "-" indicates not detected.
[0066] As shown in Table 4, the asymmetric ERA detection system constructed using the F3R1 primer pair achieved a detection sensitivity of 10 copies / μL, while the detection sensitivity of other primer combinations could only reach a maximum of 10. 2 The results showed that the primer pair F3R1, with a ratio of copies / μL, indicates that the asymmetric ERA detection system constructed using this primer pair is highly sensitive and is therefore the preferred combination.
[0067] In addition, the present invention also uses 2.5 × 102 Using plasmid DNA copies / ul, 75 ng / ul human genomic nucleic acid, and 120 ng / ul E. coli nucleic acid as templates, at a concentration of 2.5 × 10⁻⁶... 2 The plasmid DNA in copies / ul was used as a positive control template. The specificity of the nine primer combinations was further verified using the above amplification and detection methods. The detection results are shown in Table 5.
[0068] Table 5. Specificity verification results of the 9 primer combinations
[0069] Primer combination plasmid DNA Human genome nucleic acid E. coli nucleic acid F1R1 + - - F1R2 + + - F1R3 + - - F2R1 + - - F2R2 + + - F2R3 + - - F3R1 + - - F3R2 + + - F3R3 + - -
[0070] Note: "+" indicates detected; "-" indicates not detected.
[0071] The results in Table 5 show that, apart from the asymmetric primer ERA detection system constructed with primer pairs F1R2, F2R2, and F3R2, other detection systems and methods can only specifically detect the hepatitis E virus gene, but do not cross-react with human genomic nucleic acid or Escherichia coli genomic nucleic acid. Among them, only the asymmetric primer ERA detection system with primer pair F3R1 has the best detection sensitivity and amplification efficiency. Therefore, primer pair F3R1 is the preferred choice.
[0072] II. Probe Screening
[0073] Based on the primer pair (F3R1) obtained through the above screening, this embodiment further verified the specificity, sensitivity, and detection efficiency of probe BP1. Three probes for ERA-specific amplification of specific regions were designed as shown in Table 6. These probes were combined with primer pair F3R1, and 50 μL amplification reaction systems and 5 μL detection systems were constructed according to the components and amounts shown in Tables 2 and 3, respectively. Detection was performed according to the amplification and detection steps, and the comparison results of detection efficiency are as follows: Figure 2 As shown, the templates used for sensitivity and specificity verification are the same as those used for primer sensitivity and specificity verification. The comparison results are shown in Tables 7 and 8.
[0074] Table 6 Probe screening for hepatitis E virus genes
[0075]
[0076] Table 7. Sensitivity verification results of the three probes.
[0077] probe <![CDATA[10 4 copies / ul]]> <![CDATA[10 3 copies / ul]]> <![CDATA[10 2 copies / ul]]> 10 copies / ul BP1 + + + + BP2 + + + - BP3 + + + -
[0078] Note: "+" indicates detected; "-" indicates not detected.
[0079] Table 8. Specificity verification results of the three probes
[0080] probe plasmid DNA Human genome nucleic acid E. coli nucleic acid BP1 + - - BP2 + - - BP3 + + -
[0081] Note: "+" indicates detected; "-" indicates not detected.
[0082] As shown in the fluorescence curves, the fluorescence signal growth rate of probe BP1 is higher than that of other probes, and the slope of fluorescence growth is the highest, indicating that probe BP1 has the best detection efficiency when used to detect the hepatitis E virus gene. The results in Tables 7 and 8 show that only the asymmetric ERA detection system based on probe BP1 achieves a detection sensitivity of 10 copies / μL, and it can specifically detect only the hepatitis E virus gene, without cross-reactivity with human genomic nucleic acid or E. coli genomic nucleic acid, indicating that this detection system has the best sensitivity and specificity. Therefore, probe BP1 is the preferred choice.
[0083] Example 2: Sensitivity and specificity verification of the asymmetric ERA detection system provided by the present invention
[0084] Based on the primer pair F3R1 and probe BP1 screened in Example 1, the optimal asymmetric ERA detection system provided by this invention was constructed. This example further examines the sensitivity and specificity of this asymmetric ERA detection system for the detection of hepatitis E virus genes.
[0085] I. Sensitivity Verification
[0086] The sensitivity validation of the asymmetric ERA detection system was performed according to the amplification reaction system shown in Table 2 and the detection system shown in Table 3 of Example 1. The template in the amplification reaction system was hepatitis E virus plasmid DNA diluted to different concentrations, with the hepatitis E virus plasmid concentration being 10... 3 copies / ul, 500 copies / ul, 10 2 Plasmids with concentrations of 1 copy / µl, 50 copies / µl, 10 copies / µl, and 5 copies / µl were used as positive templates, with water as the negative template. The loading volume for each template was 2µl. The amplification and detection steps were the same as in Example 1, and the detection results are as follows: Figure 3 As shown.
[0087] pass Figure 3 The results show that when the asymmetric primer ERA detection system based on primer pair F3R1 and probe BP1 is used to detect the hepatitis E virus gene, 5 copies / ul of plasmid template can be detected in the reaction, indicating that the detection system and method have high sensitivity when used for hepatitis E virus detection.
[0088] II. Specificity Validation
[0089] The specificity verification of the asymmetric ERA detection system was performed according to the amplification reaction system shown in Table 2 and the detection system shown in Table 3 of Example 1. The template in the amplification reaction system was 2.5 × 10⁻⁶. 2 Using plasmid DNA copies / ul, 75 ng / ul human genomic nucleic acid, and 120 ng / ul E. coli nucleic acid as templates, at a concentration of 2.5 × 10⁻⁶... 2 The plasmid DNA copies / ul served as a positive control template, with each template loaded at a volume of 2ul. The amplification and detection procedures were the same as in Example 1. The detection results are as follows: Figure 4 As shown.
[0090] It can be seen that only the plasmid DNA showed a linear increase in fluorescence value, while the templates of human genomic nucleic acid and E. coli nucleic acid did not show fluorescence growth. This indicates that the asymmetric primer ERA detection system and method constructed based on primer pair F3R1 and probe BP1 can only specifically detect the hepatitis E virus gene, and has no cross-reaction with human genomic nucleic acid and E. coli genomic nucleic acid. This shows that the asymmetric primer ERA detection system and method provided by this invention has good specificity.
[0091] Example 3: Screening of reagents for isothermal amplification of nucleic acid
[0092] Compared to asymmetric primer PCR, asymmetric primer ERA detection technology faces complex challenges in primer and probe design. Furthermore, because the ERA detection system relies on a multi-enzyme system (recombinase, polymerase, etc.), unequal primer amounts can disrupt enzyme synergy, leading to decreased single-strand yield. Therefore, the selection of reaction reagents in the amplification system is crucial. This example further investigates the effects of recombinase, DNA polymerase, and the energy regeneration system for maintaining ATP concentration in the asymmetric ERA detection system on the asymmetric ERA detection system, validating the necessity of using the amplification reaction system shown in Table 2. The construction of the asymmetric ERA detection system is basically the same as Tables 2 and 3 of Example 1, except that the recombinase, DNA polymerase, and energy regeneration substances are the reagents shown in Table 9, and the amplification and detection steps are the same as in Example 1. The templates for sensitivity and specificity verification are the same as those used in the primer sensitivity and specificity verification of Example 1, and the detection results are shown in Tables 10 and 11.
[0093] Table 9 Test Combinations for Nucleic Acid Isothermal Amplification Reagents
[0094]
[0095] Table 10 Sensitivity verification results for the four test combinations
[0096] Test combination <![CDATA[10 4 copies / ul]]> <![CDATA[10 3 copies / ul]]> <![CDATA[10 2 copies / ul]]> 10 copies / ul Combination 1 + + + + Combination 2 + + - - Combination 3 + + - - Combination 4 + + + -
[0097] Note: "+" indicates detected; "-" indicates not detected.
[0098] Table 11 Sensitivity verification results of the four test combinations
[0099] Test combination plasmid DNA Human genome nucleic acid E. coli nucleic acid Combination 1 + - - Combination 2 + - - Combination 3 + + - Combination 4 + - -
[0100] Note: "+" indicates detected; "-" indicates not detected.
[0101] As shown in Tables 10 and 11, among the asymmetric primer ERA detection systems constructed based on the four amplification reagent combinations, only combinations 1, 2, and 4 specifically detected the hepatitis E virus gene, without detecting human genomic nucleic acid or E. coli genomic nucleic acid. Only combination 1 achieved a detection sensitivity of 10 copies / μL, while the other two detection systems only reached a maximum sensitivity of 10. 2 The results suggest that the ratio of copies / μL may be due to the fact that, compared to RecA recombinase, the phage UvsX protein, with the assistance of UvsY protein, forms a more stable recombinase-primer complex, significantly improving the efficiency of single-stranded DNA invading the double-stranded template. Simultaneously, the large fragment of Klenow polymerase provides high fidelity, enhancing amplification accuracy and avoiding non-specific amplification. Furthermore, the phosphocreatine / creatine kinase system provides a more sustained and gradual ATP regeneration capacity than the phosphoenolpyruvate / pyruvate kinase system, preventing energy depletion in the later stages of the reaction and further improving amplification efficiency and sensitivity.
[0102] In summary, when the asymmetric primer ERA detection system provided by this invention uses bacterial UvsX protein and bacteriophage UvsY protein, a large fragment of Klenow polymerase, and a phosphocreatine / creatine kinase system as amplification reagent, the system significantly improves the specificity, sensitivity, and amplification efficiency of asymmetric primer ERA detection through the synergistic effect of highly efficient recombinase combination, high-fidelity polymerase, and stable energy system.
[0103] Example 4: Optimization of Asymmetric Primer Concentration Ratio
[0104] The detection principle of the asymmetric ERA detection system is similar to that of conventional ERA technology, the difference being the unequal concentrations of upstream and downstream primers. In the early stages of amplification, the presence of both primers allows for normal double-stranded DNA synthesis, resulting in exponential product growth. As the reaction progresses, the low-concentration primers are gradually depleted, while the high-concentration primers continue to guide single-stranded DNA synthesis, ultimately producing primarily single-stranded DNA synthesized under the guidance of the high-concentration primers. A fluorescent probe is then introduced into the amplification product. The specific probe binds to the single-stranded target sequence, forming a specific local double strand. Specific exonucleases in the reaction system recognize the specific DNA double strand bound to the probe and cleave the probe at specific sites. The fluorescent and quenching groups on the probe are separated, generating a fluorescence signal proportional to the amount of target DNA amplified; the fluorescence intensity increases with amplification. Therefore, the ratio of upstream to downstream primers significantly affects the sensitivity and specificity of the detection method. Therefore, this embodiment further investigated the effect of primer ratio in the amplification reaction system on the detection results. The amplification reaction system was constructed using the four upstream and downstream primer concentrations shown in Table 12. The other reagents and dosages were the same as those in Tables 2 and 3 of Example 1. The sensitivity and specificity of the detection system were verified using the same method as in Example 2. The detection results are shown in Tables 12 and 13.
[0105] Table 12. Sensitivity verification results of asymmetric primers
[0106] Test group upstream primer Downstream primer 100copies / ul 10 copies / ul 5copies / ul Test Group 1 21nM 105nM + - - Test Group 2 21nM 630nM + + + Test Group 3 21nM 2100nM + + - Test group 4 21nM 3150nM + - -
[0107] Note: "+" indicates detected; "-" indicates not detected.
[0108] Table 13 Specificity validation results of asymmetric primers
[0109]
[0110]
[0111] Note: "+" indicates detected; "-" indicates not detected.
[0112] As shown in Tables 12 and 13, among the four primer concentration ratio detection systems, test group 4 failed to detect the hepatitis E virus gene, while test groups 1-3 could only specifically detect the hepatitis E virus gene, without detecting human genomic nucleic acid or Escherichia coli genomic nucleic acid. Only test group 2 (upstream primer 21 nM, downstream primer 630 nM, i.e., upstream and downstream primer concentration ratio of 1:30) achieved a detection sensitivity of 5 copies / ul, indicating that the detection system at this concentration ratio had the best amplification efficiency, high sensitivity, and good specificity. The reason is that when the proportion of restriction primers is too high (test group 1), template resources are consumed prematurely, resulting in a large amount of double-stranded DNA and insufficient amplification of the target single-stranded DNA, thus reducing the single-stranded yield. Consequently, there is insufficient single-stranded DNA binding to the fluorescent probe, leading to reduced amplification efficiency and sensitivity. Conversely, when the proportion of restriction primers is too low (test groups 3 and 4), they are exhausted prematurely, leaving a large amount of unused template and non-restriction primers. Insufficient template during the single-stranded amplification stage affects the specificity and sensitivity of the amplification. In summary, the optimal concentration ratio of upstream and downstream primers in the asymmetric ERA detection system is 1:30.
[0113] Example 5: Clinical Sample Validation of the Asymmetric ERA Detection System
[0114] To verify the application effect of the asymmetric ERA detection system provided by this invention in clinical sample testing, this embodiment further validates the system using 20 collected samples containing hepatitis E virus (from Suzhou Municipal Hospital). The hepatitis E virus nucleic acid detection system is an asymmetric ERA detection system constructed based on the primer pairs and probes screened in Example 1. The detection results are shown in the table below.
[0115] Table 14 Results of Asymmetric ERA Fluorescence Detection of Hepatitis E Virus Nucleic Acid Samples
[0116]
[0117] Note: "+" indicates a positive result; "-" indicates a negative result.
[0118] As shown in Table 14, the detection results of hepatitis E virus samples using the asymmetric ERA fluorescence detection method are completely consistent with the actual positive and negative results of the samples. This indicates that the asymmetric ERA fluorescence detection method provided by this invention also has superior specificity and sensitivity in clinical applications, and the detection process is simple and efficient, solving the problem of time-consuming and labor-intensive processes in existing technologies.
[0119] Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.
[0120] Sequence Listing SEQ ID NO.10:
[0121] Hepatitis E virus gene target sequence:
[0122] GCAGACCACGTATGTGGTCGATGCCATGGAGGCCCATCAGTTCATTAAGGCTCCTGGC
[0123] ATTACTACTGCCATTGAGCAGGCTGCTCTGGCTGCGGCCAATTCCGCCTTGGCGAATG
[0124] CTGTGGTGGTCCGGCCGTTCTTATCTCGTGTACAAACTGAGATTCTTATTAATTTGATG
[0125] CAACCCCGGCAGTTGGTTTTCCG.
Claims
1. An asymmetric primer set for detecting hepatitis E virus, characterized in that, It includes an upstream primer, a downstream primer, and a probe, wherein the upstream primer has the nucleotide sequence shown in SEQ ID NO.3; the downstream primer has the nucleotide sequence shown in SEQ ID NO.4; and the probe has the nucleotide sequence shown in SEQ ID NO.
7.
2. A nucleic acid detection system for hepatitis E virus, characterized in that, Includes the asymmetric primer set and nucleic acid isothermal amplification reaction reagent as described in claim 1.
3. The nucleic acid detection system as described in claim 2, characterized in that, The nucleic acid isothermal amplification reaction reagent is any one or more recombinase-mediated isothermal amplification reaction reagents of ERA, RPA, and RAA, including bacteriophage uvsX protein and bacteriophage uvsY protein.
4. The nucleic acid detection system as described in claim 3, characterized in that, The nucleic acid isothermal amplification reaction reagent also includes phosphocreatine kinase, creatine kinase, and a large fragment of Klenow polymerase.
5. The nucleic acid detection system as described in claim 4, characterized in that, The nucleic acid isothermal amplification reaction reagents include tris(hydroxymethyl)aminomethane-acetic acid buffer, potassium acetate, magnesium acetate, dithiothreitol, polyethylene glycol, ATP, phosphatidylinosylphosphatase, creatine kinase, phage uvsX protein, phage uvsY protein, Klenow polymerase large fragment, exonuclease III, reverse transcriptase, and dNTPs.
6. A method for detecting hepatitis E virus, characterized in that, The detection is performed using the asymmetric primer set described in claim 1 or the nucleic acid detection system described in any one of claims 2-5.
7. The detection method as described in claim 6, characterized in that, Includes the following steps: S1: Premixed reagent for constructing the template nucleic acid amplification reaction system; S2: Insert the premixed reagent tube into the fluorescence isothermal amplification instrument to carry out the amplification reaction.
8. The detection method as described in claim 7, characterized in that, The concentration ratio of the upstream primer to the downstream primer in the nucleic acid amplification reaction system described in step S1 is 1:(5-100).
9. The detection method as described in claim 7, characterized in that, The amplification reaction in step S2 is carried out at a temperature of 37–45°C for 20–30 minutes.
10. The use of an asymmetric primer set for preparing an ERA amplification detection reagent to improve the sensitivity of hepatitis E virus nucleic acid detection, characterized in that, The asymmetric primer set includes an upstream primer, a downstream primer, and a probe, wherein the upstream primer has the nucleotide sequence shown in SEQ ID NO.3; and the downstream primer has the nucleotide sequence shown in SEQ ID NO.
4. The probe has a nucleotide sequence as shown in SEQ ID NO.7.