A high-sensitivity nucleic acid detection method based on cas13a and cas12a cascade autocatalytic amplification and application
By employing a positive feedback autocatalytic cycle between Cas13a and Cas12a, the problem of limited detection sensitivity in CRISPR nucleic acid detection technology is solved, achieving high-sensitivity detection without pre-amplification, which is suitable for portable point-of-care testing and applications targeting multiple RNA targets.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- BODITAI (XIAMEN) BIOTECHNOLOGY CO LTD
- Filing Date
- 2026-02-12
- Publication Date
- 2026-06-26
Smart Images

Figure CN122279006A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a highly sensitive nucleic acid detection method and its application based on the cascade autocatalytic amplification of Cas13a and Cas12a. Background Technology
[0002] Nucleic acids (including viral RNA, microRNA, circulating tumor DNA (ctDNA), etc.) are crucial biomarkers in disease diagnosis, pathogen screening, and health monitoring. Especially in early cancer diagnosis and infectious disease surveillance, achieving high sensitivity, high specificity, and rapid detection of trace amounts of nucleic acids is of paramount importance.
[0003] The CRISPR / Cas system, derived from the natural adaptive immune defense mechanisms of bacteria and archaea, has been developed in recent years as a highly promising gene-editing tool. Nucleic acid detection technologies based on CRISPR-Cas subtypes (such as Cas12, Cas13, and Cas14) have become a research hotspot in the field of biological detection due to their high specificity, room-temperature reaction characteristics, and signal amplification potential. Typical technologies, such as the Cas13-based SHERLOCK technology and the Cas12-based DETECTR technology, have been successfully applied in the accurate detection of various pathogens.
[0004] However, the core mechanism of existing detection technologies largely relies on the direct activation of Cas proteins by target nucleic acids, thereby utilizing their trans-cleavage activity to cleave reporter molecules in a single step. This mode of action has significant limitations in signal amplification, and insufficient detection sensitivity is common for targets with extremely low abundance. To improve detection sensitivity, pre-amplification techniques such as recombinase polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP) are typically used. While this strategy can improve detection sensitivity to some extent, it also increases the complexity of the operational procedures, raises the risk of sample cross-contamination, and increases the overall detection cost.
[0005] Developing novel CRISPR detection strategies that eliminate the need for pre-amplification and rely on enzyme-mediated reaction networks for autonomous signal cascade amplification is a core research direction for improving detection sensitivity and simplifying operational procedures. Although existing studies have attempted to construct cascaded systems of multiple Cas systems, their design concepts are limited to unidirectional serial modes, and innovative configurations that can form self-sustaining loops and achieve exponential signal amplification have not yet been developed.
[0006] It is evident that existing CRISPR nucleic acid detection technologies generally suffer from limitations in detection sensitivity and the need to rely on target pre-amplification steps, which to some extent restricts the application scope of CRISPR detection technologies. Summary of the Invention
[0007] To address the aforementioned challenges, this invention provides a highly sensitive nucleic acid detection method and application based on cascaded autocatalytic amplification of Cas13a and Cas12a. This invention achieves exponential signal amplification by constructing a positive feedback loop between Cas13a and Cas12a, achieving extremely high detection sensitivity without the need for isothermal pre-amplification steps, simplifying the operation process and reducing the risk of contamination.
[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A highly sensitive nucleic acid detection method based on the autocatalytic amplification of Cas13a and Cas12a cascades includes the following steps: S1. Extract the nucleic acid RNA from the sample to be tested to obtain a sample containing the target RNA; S2. The RNA sample containing the target is added to the first CRISPR-Cas13a system and incubated at 35-38°C for 15-25 min to allow Cas13a to recognize and activate the target, initially cleaving the inhibitory Cas12a activator to obtain the reaction system. The first CRISPR-Cas13a system contains the Cas13a protein (LwaCas13a), its matching first guide RNA (Cas13acrRNA), and the inhibitory Cas12a activator. S3. Add the second CRISPR-Cas12a system to the reaction system obtained in step S2 and continue incubation for 15-25 min to initially activate Cas12a, causing it to cleave the hairpin probe, release the trigger RNA, and trigger the autocatalytic cycle. The second CRISPR-Cas12a system includes the Cas12a protein (LbCas12a), its matching second guide RNA (Cas12acrRNA), the DNA / RNA hybridization hairpin probe (DNA / RNA Hairpin Reporter), the Split Cas13a activator fragment F (Split Cas13a Activator F), and the fluorescent reporter molecule (Reporter) cleaved by the Cas12a protein. S4. Use a real-time or endpoint fluorescence quantitative PCR instrument to monitor the fluorescence intensity of the reaction system. By comparing the fluorescence signal intensity of the sample with that of the negative control, the presence and relative content of the target RNA can be determined.
[0009] Preferably, the first guide RNA described in step S2 is complementary to the target and simultaneously activates the trans-cleavage activity of Cas13a.
[0010] Preferably, the repressive Cas12a activator in step S2 comprises a template strand and a complementary strand, wherein the nucleotide sequence of the template strand is shown in SEQ ID NO.3, and the nucleotide sequence of the complementary strand is shown in SEQ ID NO.4.
[0011] Preferably, the second guide RNA described in step S3 is a sequence that specifically binds to the repressive activator, and its nucleotide sequence is shown in SEQ ID NO.5.
[0012] Preferably, the DNA / RNA hybridization hairpin probe consists of an activated Cas12a protein cleavage site and a closed trigger RNA sequence; the trigger RNA sequence is complementary to the target.
[0013] Preferably, in step S3, the Split Cas13a activator fragment F is complementary to the trigger RNA to form a complete Cas13a activator; the nucleotide sequence of the fluorescent reporter molecule cleaved by the Cas12a protein is FAM-CCCCCC-BHQ1.
[0014] The present invention also provides a detection kit for implementing the method, comprising premix A and premix B; premix A comprising the Cas13a protein, the first guide RNA, the repressive Cas12a activator, and a reaction buffer; premix B comprising the Cas12a protein, the second guide RNA, the DNA / RNA hybridization hairpin probe, the Split Cas13a activator fragment F, the fluorescent reporter molecule, and a reaction buffer.
[0015] Preferably, the reaction buffer in the premix A and premix B is formulated with 450-550 mM NaCl, 80-120 mM Tris-HCl, 80-120 mM MgCl2, and 8-12 mM DTT.
[0016] The present invention also provides an application of the high-sensitivity nucleic acid detection kit in the preparation of low-abundance RNA detection products, wherein the low-abundance RNA includes viral RNA, microRNA, mRNA or fragments thereof.
[0017] Preferably, the viral RNA is the RNA of human immunodeficiency virus, hepatitis C virus, influenza virus, SARS-CoV-2 virus, or respiratory syncytial virus.
[0018] The invention will now be further explained using HIV RNA as a target.
[0019] The target RNA is HIV RNA, and its nucleotide sequence is shown in SEQ ID NO.1; the nucleotide sequence of the Cas13a crRNA is shown in SEQ ID NO.2.
[0020] HIV RNA: CAAAUGUUAAAAGAAACCAUCAAUGAGGAAGCUGCAGAAUGGGAUGAAAUGCAUCCCUG (SEQ IDNO.1); Cas13a crRNA: 5'-GACCACCCAAAAAAUGAAGGGGACUAAAAC AUCCCAUUCUGCAGCUUCCUCAUU -3' (SEQ ID NO.2).
[0021] The Cas13a crRNA is a crRNA sequence designed for HIV-1 (Sequence ID: EU770743.1). The HIV RNA is a chemically synthesized HIV-1 RNA sequence used for experimental verification. The Cas13a crRNA can recognize HIV RNA and activate the trans-cleavage activity of Cas13a.
[0022] The Inhibitory Cas12a Activator comprises a sense strand and an antisense strand (i.e., a template strand and a complementary strand), wherein the nucleotide sequence of the sense strand (template strand) is shown in SEQ ID NO.3; and the nucleotide sequence of the antisense strand (complementary strand) is shown in SEQ ID NO.4.
[0023] Inhibitory Cas12a Activator Chain of Justice (TS): 5'-TTGTAGAACTATACAA UUUUU CAAAGAGACCTAAACATTAA-3' (SEQ ID NO. 3); Inhibitory Cas12a Activator Antisense Stratum (NTS): 5'-TTAATGTTTAGGTCTCTTTG TTGTATAGTTCTACAA-3' (SEQ ID NO.4).
[0024] The nucleotide sequence of the Cas12a crRNA is shown in SEQ ID NO.5; the DNA / RNA HairpinReporter is a DNA / RNA Hairpin, and its nucleotide sequence is shown in SEQ ID NO.6; the nucleotide sequence of the Split Cas13a Activator F is shown in SEQ ID NO.7; the nucleotide sequence of the Split Cas13a Activator R is shown in SEQ ID NO.8; and the nucleotide sequence of the Reporter is shown in SEQ ID NO.9.
[0025] Cas12a crRNA: 5'-UAAUUUCUACUAAGUGUAGAU GGUCUCUUGUUGUAUAGUU -3' (SEQ ID NO. 5); DNA / RNA Hairpin: 5'-ACGT CUGCAGAAUGGGAU TGTTTTTCAATCCCATTCTGCAGACGTGACGTACG-3' (SEQ ID NO. 6); Split Cas13a Activator F: AAUGAGGAAG (SEQ ID NO.7); Split Cas13a Activator R (trigger RNA): CUGCAGAAUGGGAU (SEQ ID NO.8); Reporter: FAM-CCCCCC-BHQ1 (SEQ ID NO.9).
[0026] In the above sequence, the Inhibitory Cas12a Activator sense strand (TS) and the Inhibitory Cas12a Activator antisense strand (NTS) anneal in a 1:1.5 ratio to form double-stranded DNA (dsDNA). When the RNA loop (UUUUU) on the TS strand of this double-stranded DNA is present, the activity of Cas12a is inhibited. After the RNA loop is cleaved, the double-stranded DNA binds to Cas12a crRNA, activating the trans-cleavage activity of Cas12a and cleaving the DNA / RNA hairpin. The DNA / RNA hairpin is a DNA / RNA chimeric molecule with a stem-loop structure. Its structure includes: (i) a double-stranded DNA / RNA hybrid stem region, (ii) a single-stranded DNA loop region containing the Cas12a trans-cleavage site, and (iii) a single-stranded DNA "tail" located at the 3' end. In the initial state, the trigger RNA is partially complementary to the DNA stem region and is in a closed, non-functional state. When Cas12a is activated, its trans-cleavage activity acts simultaneously on the loop region and the linker DNA at the 3' tail of the hairpin probe, causing the hairpin structure to be completely cleaved and destroyed, thereby releasing the free "trigger RNA".
[0027] The Split Cas13a Activator F, when present alone, cannot activate the trans-cleavage activity of Cas13a. However, upon release of the trigger RNA, it binds to Split Activator-13a-F, forming a complete RNA activator that can be recognized and activated by the Cas13a-crRNA complex. This reactivates the trans-cleavage activity of Cas13a. The newly activated Cas13a then cleaves more RNA loops on the repressive Cas12a activators, activating more Cas12a and releasing even more trigger RNA. This cycle repeats continuously, forming a positive feedback autocatalytic amplification loop.
[0028] The Reporter has a fluorescent group FAM and a quenching group BHQ1. After the trans-cleavage activity of Cas12a is activated, it cleaves the Reporter, causing the fluorescent group and the quenching group at both ends of the Reporter to separate and emit a fluorescent signal.
[0029] The detection method provided by this invention is based on an autocatalytic cycling network consisting of a Cas13a-crRNA1 complex, a Cas12a-crRNA2 complex, and three key functional nucleic acid probes (inhibitory Cas12a activator, DNA / RNA hairpin, and split Cas13a activator F) (the schematic diagram of the technical solution is shown in the figure). Figure 1 (As shown).
[0030] Taking HIV as an example, crRNA designed for HIV RNA guides the Cas13a protein to specifically bind to and recognize the target RNA, inducing a conformational change in Cas13a and activating its trans-cleavage activity. This activates the Cas13a activator (TS) to cleave the RNA loop on the inhibitory Cas12a activator strand. Before cleavage, this RNA loop, due to its steric hindrance, inhibits the trans-cleavage activity of the Cas12a protein, keeping it in a "closed" or "low-activity" state. Once this RNA loop is cleaved, the inhibition is released, and Cas12a is fully activated, thus trans-cleaving the DNA portion on the DNA / RNA hairpin. The retained "trigger RNA" can act as SplitCas13a Activator R, binding with SplitCas13a Activator F to form a new Cas13a activator. This activator then binds to the Cas13a crRNA, reactivating the trans-cleavage activity of Cas13a (at this point, the initial target RNA is not required). The newly activated Cas13a then cleaves more RNA loops on the Inhibitory Cas12a Activator TS strand, activating more Cas12a and releasing more trigger RNA. This cycle repeats, forming a positive feedback autocatalytic amplification loop.
[0031] In the reaction system, single-stranded DNA reporter molecules (ssDNA-FQ) labeled with a fluorescent group (F) and a quencher group (Q) are also added. Once Cas12a is activated (whether initially activated by Cas13a or subsequently activated during cycling), its sustained trans-cleavage activity indiscriminately cleaves these reporter molecules, leading to fluorescence recovery. Due to the large amount of activated Cas12a generated by the autocatalytic cycle, the reporter molecules are extensively cleaved, producing a very strong fluorescence signal.
[0032] Therefore, compared with the prior art, the present invention has the following advantages: (1) Ultra-high sensitivity: By constructing a positive feedback autocatalytic cycle between Cas13a and Cas12a, the signal is amplified exponentially, reaching the aM detection level, which significantly surpasses the traditional single-stage CRISPR detection method and some methods that require pre-amplification.
[0033] (2) No pre-amplification required: Due to its strong signal amplification capability, this method can directly detect RNA in the original sample without relying on nucleic acid pre-amplification steps such as RPA and LAMP, which simplifies the operation process, shortens the total detection time (can be completed within 1 hour), and completely avoids the false positive problem caused by aerosol contamination of amplification products.
[0034] (3) High specificity and low background: The detection specificity is jointly guaranteed by the two-level crRNA recognition of Cas13a and Cas12a, and the probability of false activation is extremely low. The unique "inhibitory activator" design ensures that Cas12a activity is effectively inhibited when there is no target, further reducing the background signal and false positive risk.
[0035] (4) Constant temperature rapid detection: The entire reaction process is carried out at a single temperature (37°C), without the need for thermal circulation equipment, which makes it easy to develop into a portable, point-of-care testing (POCT) product.
[0036] (5) Modular and versatile: The platform is modular in design. By changing the crRNA sequence and the corresponding probe set, it can be quickly adapted to detect different RNA targets. It has broad application prospects in the fields of infectious disease diagnosis, early tumor screening, and gene expression analysis.
[0037] In summary, this invention has the advantages of high sensitivity, good specificity, speed and simplicity, and has broad application prospects in the detection of different RNA targets (such as miRNA, viral RNA, and mRNA). Attached Figure Description
[0038] Figure 1 This is a schematic diagram of the technical principle of the present invention; Figure 2 A diagram showing the effect of RNA loops at different positions on inhibiting the trans-cleavage activity of the CRISPR / Cas12a system; Figure 3 A magnified view of the Cas13a / Cas12a cascade of RNA loops of different lengths; Figure 4 Effects of different combinations of Split Cas13a Activator F and R activating the trans-cleavage activity of Cas13a; Figure 5 The detection limit results for HIV RNA target detection are shown in the figure. Figure 6This is a graph showing the specificity results of HIV RNA target detection. Detailed Implementation
[0039] The present invention will be further described below with reference to embodiments. These embodiments are provided to facilitate understanding of the invention and are not intended to limit the invention. Those skilled in the art can make various modifications based on the basic idea of the invention, but all modifications are within the scope of the invention as long as they do not depart from the basic concept. In the following detection methods, NC is a blank control, and the blank control is ultrapure sterilized water.
[0040] Example 1: A High-Sensitivity Nucleic Acid Detection Method Based on Cas13a / Cas12a Cascade Autocatalytic Amplification and Its Application Sequence Design Since a key step in the detection method of this invention is the blocking and unblocking of the Inhibitory Cas12a Activator, the design of the blocking mechanism for the Inhibitory Cas12a Activator is extremely important. This invention first explores the location and size of the RNA loop in the TS strand of the Inhibitory Cas12a Activator. In this invention, TS and NTS refer to crRNA; TS is complementary to crRNA, and NTS is not complementary to crRNA.
[0041] Design functional Cas12a crRNA sequences and matching activators that can activate Cas12a: Cas12a crRNA: 5'-UAAUUUCUACUAAGUGUAGAU GGUCUCUUGUUGUAUAGUU -3' (SEQ ID NO. 5); Activator NTS: 5'-TTAATGTTTAGGTCTCTTTGTTGTATAGTTCTACAA-3' (SEQ ID NO. 4).
[0042] The trans-cleavage activity of Cas12a was determined using Reporter: Reporter: Its nucleotide sequence is 5'-FAM-CCCCCC-BHQ1-3'.
[0043] The following inhibitory Cas12a activator sequences were designed based on different positions of the RNA loop on the TS: Inhibitory Cas12a Activator TS-0: 5'-TTGTAGAACTATACAACAAAGAGACCTAAACATTAA-3'; Inhibitory Cas12a Activator TS-1: 5'-TTGTAGAACTA UUUUU TACAACAAAGAGACCTAAACATTAA-3'; Inhibitory Cas12a Activator TS-2: 5'-TTGTAGAACTATACAA UUUUU CAAAGAGACCTAAACATTAA-3' (SEQ ID NO. 2); Inhibitory Cas12a Activator TS-3: 5'-TTGTAGAACTATACAACAAAG UUUUU AGACCTAAACATTAA-3'; The four types of Inhibitory Cas12a Activator TS were annealed with Activator NTS at a ratio of 1:1.5 to form double-stranded DNA (i.e., Activator double strands).
[0044] Prepare the reaction buffer according to the formula and concentration in Table 1 below: Table 1. Formulation table of the reaction buffer of the present invention
[0045] Prepare the CRISPR mixture according to the formula and concentration in Table 2 below: Table 2 Formulation and dosage of the CRISPR mixture of the present invention
[0046] 2 μL of different activator double strands (1 μM) were added to each of the prepared CRISPR mixtures, for a total volume of 25 μL. The reaction was performed on the Hongshi SLAN-96S fully automated medical PCR analysis system at 37℃ for 30 min. Fluorescence signals were detected and the results analyzed. Figure 2 As shown, it can be seen that the double-stranded activator formed by annealing Inhibitory Cas12a Activator TS-2 and Activator NTS can effectively inhibit the activity of Cas12a. Therefore, when designing the Inhibitory Cas12a Activator TS sequence, the RNA loop is selected in the middle of the strand (10 bases away from the PAM region).
[0047] Next, based on the different sizes of RNA loops on TS, the inhibitory Cas12a activator sequences were designed as follows: Inhibitory Cas12a Activator TS-2: 5'-TTGTAGAACTATACAA UUUUU CAAAGAGACCTAAACATTAA-3'; Inhibitory Cas12a Activator TS-4: 5'-TTGTAGAACTATACAA UUUUUUUUUU CAAAGAGACCTAAACATTAA-3'; Inhibitory Cas12a Activator TS-5: 5'-TTGTAGAACTATACAA UUUUUUUUUUUUUUU CAAAGAGACCTAAACATTAA-3'; Inhibitory Cas12a Activator TS-6: 5'-TTGTAGAACTATACAA UUUUUUUUUUUUUUUUUUUU CAAAGAGACCTAAACATTAA-3'.
[0048] Four types of Inhibitory Cas12a Activator TS were annealed with Activator NTS at a ratio of 1:1.5 to form double-stranded DNA (Activator double strand).
[0049] Simultaneously, Cas13a crRNA and target RNA were designed to cleave RNA loops on double-stranded DNA: First, download an HIV-1 sequence from the NCBI database.
[0050] HIV RNA: 5'-CAAAUGUUAAAAGAAACCAUCAAUGAGGAAGCUGCAGAAUGGGAUGAAAUGCAUCCCGUG-3' (SEQ ID NO. 1); Design of Cas13a crRNA based on HIV RNA: Cas13a crRNA: 5'-GACCACCCAAAAAAUGAAGGGGACUAAAAC AUCCCAUUCUGCAGCUUCCUCAUU -3' (SEQ ID NO.2).
[0051] Prepare CRISPR mixture 2 according to the formula and concentration in Table 3 below: Table 3. Formulation and dosage of CRISPR Mixture 2
[0052] 2 μL of HIV RNA (1 μM) and 2 μL of different activator double strands (1 μM) were added to CRISPR mixture 2 prepared in Table 3, for a total volume of 25 μL. The reaction was performed on the Hongshi SLAN-96S fully automated medical PCR analysis system at 37℃ for 30 min. Fluorescence signals were detected and the results analyzed. Figure 3 As shown, the double-stranded activator formed by annealing Inhibitory Cas12a Activator TS-2 and Activator NTS can optimally activate the activity of Cas12a after Cas13a cleaves the RNA loop. Therefore, when designing the Inhibitory Cas12a Activator TS sequence, the size of the RNA loop was chosen to be 5nt.
[0053] Another key step in this invention is the secondary activation of Cas13a by Split Cas13a Activator F and trigger RNA. Split Cas13a Activator F alone cannot activate Cas13a, but when Split Cas13a Activator F is combined with trigger RNA (Split Cas13a Activator R), it can effectively activate Cas13a. Therefore, different combinations of Split Cas13a Activator F and Split Cas13a Activator R are designed.
[0054] Split Cas13a Activator F1:AAUGAGGAAGCUGCAGAA; Split Cas13a Activator R1:UGGGAU; Split Cas13a Activator F2:AAUGAGGAAGCUGCAG; Split Cas13a Activator R2:AAUGGGAU; Split Cas13a Activator F3:AAUGAGGAAGCUGC; Split Cas13a Activator R3: AGAAUGGGAU; Split Cas13a Activator F4:AAUGAGGAAGCU; Split Cas13a Activator R4:GCAGAAUGGGAU; Split Cas13a Activator F5:AAUGAGGAAG (SEQ ID NO.7); Split Cas13a Activator R5:CUGCAGAAUGGGAU (SEQ ID NO.8); Split Cas13a Activator F6:AAUGAGGA; Split Cas13a Activator R6:AGCUGCAGAAUGGGAU.
[0055] The Reporter-U was designed to demonstrate the trans-cutting activity of Cas13a: Design Reporter-U: 5'-FAM-UUUUUU-BHQ1-3' Prepare CRISPR mixture 3 according to the formula and concentration in Table 4 below: Table 4. Formulation and dosage of CRISPR Mixture 3
[0056] 2 μL of different combinations of Split Cas13a Activator F (1 μM) and trigger RNA (1 μM) (1 μL each) were added to the CRISPR mixture 3 prepared in Table 4, for a total volume of 25 μL. The reaction was performed on the Hongshi SLAN-96S fully automated medical PCR analysis system at 37℃ for 30 min. Fluorescence signals were detected and the results analyzed. Figure 4 As shown, the combination of SplitCas13a Activator F5 and Split Cas13a Activator R5 activates the highest Cas13a cleavage activity, while the presence of Split Cas13a Activator F3 alone does not activate Cas13a cleavage activity.
[0057] Example 2: Sensitivity Analysis of a High-Sensitivity Nucleic Acid Detection Method Based on Cas13a and Cas12a Cascade Autocatalytic Amplification and Its Application The specific testing methods are as follows: S1. Sample processing: Take a high-concentration 100μM HIV RNA template and perform 10-fold serial dilutions to obtain HIV RNA templates with concentrations of 1nM, 100pM, 10pM, 1 pM, 100fM, 10fM, 1fM, 100aM, and 10aM.
[0058] S2. First, prepare premix solution A and premix solution B according to the formulas and concentrations in Tables 5 and 6 below: Table 5. Formulation and dosage of premix A of the present invention
[0059] Table 6 Formulation and dosage of premix B
[0060] Different concentrations of target RNA samples (5 μL) were mixed with premix solution A and incubated at 37°C for 20 minutes to allow Cas13a to recognize and activate the target, thereby initially cleaving the repressive Cas12a activator.
[0061] S3. Then, premixed solution B is added to the above reaction system, and incubation continues at 37°C for 20 minutes. At this point, the initially activated Cas12a begins to work, cleaving the hairpin probe, releasing trigger RNA, and triggering an autocatalytic cycle. The fluorescence signal begins to accumulate and amplify at this stage.
[0062] S4. Use a real-time or endpoint-based quantitative PCR instrument to monitor the fluorescence intensity of the reaction system. For example... Figure 5 As shown, the detection limit of HIV RNA by the high-sensitivity nucleic acid detection method based on Cas13a / Cas12a cascade autocatalytic amplification in this invention is 100 aM.
[0063] Example 3: Specificity Analysis of a High-Sensitivity Nucleic Acid Detection Method Based on Cas13a / Cas12a Cascade Autocatalytic Amplification and Its Application S1. Sample Processing: Hepatitis C virus (HCV) RNA, H1N1, SARS-CoV-2, and RSV synthetic RNA were diluted to the same concentration (100 pM) and used as targets for specific analysis. The target design numbers are shown in Table 7 below. Table 7. Concentration and composition of different target RNAs
[0064] S2. The solution was prepared using the system described in Example 2. Samples of different RNAs (5 μL) were mixed with premixed solution A and incubated at 37°C for 20 minutes to allow Cas13a to recognize the target and activate it, thereby initially cleaving the repressive Cas12a activator.
[0065] S3. Add premixed solution B to the above reaction system and continue incubation at 37°C for 20 minutes. At this point, the initially activated Cas12a begins to work, cleaving the hairpin probe, releasing trigger RNA, and triggering an autocatalytic cycle. The fluorescence signal begins to accumulate and amplify at this stage.
[0066] S4. Use a real-time or endpoint-based quantitative PCR instrument to monitor the fluorescence intensity of the reaction system. For example... Figure 6 As shown, the high-sensitivity nucleic acid detection method based on Cas13a / Cas12a cascade autocatalytic amplification in this invention has superior specificity.
[0067] It should be noted that the above-described embodiments should be understood as illustrative, not as limiting the scope of protection of this invention. The scope of protection of this invention is defined by the claims. For those skilled in the art, some non-essential improvements and adjustments made to this invention without departing from the essence and scope of this invention still fall within the scope of protection of this invention.
Claims
1. A highly sensitive nucleic acid detection method based on the autocatalytic amplification of Cas13a and Cas12a cascades, characterized in that, Includes the following steps: S1. Extract the nucleic acid RNA from the sample to be tested to obtain a sample containing the target RNA; S2. Add the RNA sample containing the target to the first CRISPR-Cas13a system and incubate at 35~38℃ for 15~25 min to allow Cas13a to recognize and activate the target, and initially cleave the repressive Cas12a activator to obtain the reaction system; the first CRISPR-Cas13a system contains Cas13a protein, its matching first guide RNA, and the repressive Cas12a activator; S3. Add the second CRISPR-Cas12a system to the reaction system obtained in step S2 and continue incubation for 15-25 min to initially activate Cas12a, causing it to cleave the hairpin probe, release the trigger RNA, and trigger the autocatalytic cycle. The second CRISPR-Cas12a system includes the Cas12a protein, its matching second guide RNA, the DNA / RNA hybridization hairpin probe, the SplitCas13a activator fragment F, and the fluorescent reporter molecule cleaved by the Cas12a protein. S4. Use a real-time or endpoint fluorescence quantitative PCR instrument to monitor the fluorescence intensity of the reaction system. By comparing the fluorescence signal intensity of the sample with that of the negative control, the presence and relative content of the target RNA can be determined.
2. The high-sensitivity nucleic acid detection method as described in claim 1, characterized in that, The guide RNA described in step S2 is complementary to the target and simultaneously activates the trans-cleavage activity of Cas13a.
3. The high-sensitivity nucleic acid detection method as described in claim 1, characterized in that, The repressive Cas12a activator in step S2 includes a template strand and a complementary strand, the nucleotide sequence of which is shown in SEQ ID NO.3; the nucleotide sequence of which is shown in SEQ ID NO.
4.
4. The high-sensitivity nucleic acid detection method as described in claim 1, characterized in that, The second guide RNA described in step S3 is a sequence that specifically binds to the repressive activator, and its nucleotide sequence is shown in SEQ ID NO.
5.
5. The high-sensitivity nucleic acid detection method as described in claim 1, characterized in that, The DNA / RNA hybridization hairpin probe consists of an activated Cas12a protein cleavage site and a closed trigger RNA sequence; the trigger RNA sequence is complementary to the target.
6. The high-sensitivity nucleic acid detection method as described in claim 1, characterized in that, In step S3, the SplitCas13a activator fragment F is complementary to the trigger RNA to form a complete Cas13a activator; the nucleotide sequence of the fluorescent reporter molecule cleaved by the Cas12a protein is FAM-CCCCCC-BHQ1.
7. A test kit for implementing the method according to any one of claims 1-6, characterized in that, It includes premix A and premix B; premix A includes the Cas13a protein, the first guide RNA, the repressive Cas12a activator, and a reaction buffer; premix B includes the Cas12a protein, the second guide RNA, the DNA / RNA hybridization hairpin probe, the Split Cas13a activator fragment F, the fluorescent reporter molecule, and a reaction buffer.
8. The high-sensitivity nucleic acid detection kit as described in claim 7, characterized in that, The reaction buffer formulations in premixed solution A and premixed solution B include 450~550mM NaCl, 80~120mM Tris-HCl, 80~120mM MgCl2, and 8~12mM MTT.
9. The use of the high-sensitivity nucleic acid detection kit as described in any one of claims 7 to 8 in the preparation of a low-abundance RNA detection product, wherein the low-abundance RNA includes viral RNA, microRNA, mRNA, or fragments thereof.
10. The application according to claim 9, characterized in that, The viral RNA is the RNA of human immunodeficiency virus, hepatitis C virus, influenza virus, SARS-CoV-2 virus, or respiratory syncytial virus.