A rare ginsenoside composition and its preparation method
By using β-glucosidase N81W-W195E and aspartic protease to catalyze the conversion of ginsenoside Rb1 into rare ginsenoside CK under mesophilic and weakly acidic conditions, and mixing it with ginseng fermentation products, the problems of insufficient specificity of rare ginsenoside compositions in anti-aging and low enzymatic conversion efficiency in existing technologies were solved. This enabled the efficient preparation of rare ginsenoside compositions with clear anti-aging effects, which significantly delayed aging in mice.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- XIAN GIANT BIOGENE TECH CO LTD
- Filing Date
- 2026-04-27
- Publication Date
- 2026-06-30
AI Technical Summary
In the existing technology, the anti-aging efficacy of ginsenoside compositions is unclear and lacks specificity. Furthermore, the efficiency and controllability of enzymatic conversion of rare ginsenoside CK are low, making it difficult to achieve efficient conversion under single reaction conditions using a single glucosidase.
A rare ginsenoside composition with definite anti-aging effects was prepared by using a single β-glucosidase N81W-W195E and aspartic protease derived from Aspergillus niger to catalyze the conversion of ginsenoside Rb1 into rare ginsenoside CK under medium temperature and weak acidic conditions, and then mixing it with ginseng fermentation products.
The efficiency and controllability of enzymatic conversion were improved, and a rare ginsenoside composition with clear anti-aging effects was prepared, which significantly improved the antioxidant capacity of mice and delayed aging.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This patent application belongs to the field of pharmaceutical biotechnology, specifically relating to a rare ginsenoside composition with anti-aging effects and its preparation method. Background Technology
[0002] Aging is a biological process in which cellular and bodily functions systematically decline with age, characterized by imbalances in tissue homeostasis, decreased organ function, and increased disease risk. Faced with the global challenge of an aging population, anti-aging has become a widely discussed topic of social concern.
[0003] Ginseng (Panax ginseng CA Meyer) is a perennial herbaceous plant belonging to the genus Panax in the family Araliaceae. It is a precious medicinal material in traditional Chinese medicine, often referred to as the "King of Herbs." The natural distribution of ginseng is mainly concentrated in East Asia. Its use as a medicinal plant in my country can be traced back more than two thousand years. The *Shennong Bencao Jing* (Shennong's Classic of Materia Medica) lists it as a superior-grade herb, describing its effects as "tonifying the five internal organs, calming the spirit, stabilizing the soul, stopping palpitations, dispelling evil influences, improving eyesight, and enhancing intelligence." Modern pharmacological research reveals that the various ginsenosides and other active ingredients in ginseng exhibit broad therapeutic potential, including anti-cancer, anti-inflammatory, antiviral, hypoglycemic, and hepatoprotective effects.
[0004] Ginsenosides Rb1, Rb2, Rc, Rd, Rf, and Rg1 are the main saponins in ginseng, accounting for more than 90% of the total saponins. They have a variety of biological effects, but their bioavailability is low. They need to be metabolized in the body into rare ginsenosides in order to exert their activity.
[0005] In existing technologies, the biomodification of ginseng using microbial fermentation or enzyme engineering has attracted considerable attention in the industry. These processes can promote the conversion of low-activity saponins in raw ginseng into rarer ginseng saponins, achieving targeted enrichment of the desired active ingredients while improving bioavailability and reducing the amount of raw material required. Furthermore, the bioconversion process can effectively reduce the inherent dryness associated with ginseng and improve tolerance to long-term use; therefore, functional products based on fermented ginseng are increasingly gaining market attention.
[0006] However, the products obtained from the aforementioned fermentation process are usually mixtures of various ginsenosides, with up to dozens of rare ginsenoside components. Due to the significant differences in pharmacological activity among ginsenosides with different structural types, and the fact that some components even exhibit antagonistic effects at their target sites, the structure-activity relationship of these products is ambiguous, and their efficacy is broadly defined. Although such compositions exhibit broad-spectrum biological activity in areas such as whitening, anti-anemia, anti-inflammation, neuroprotection, and immunomodulation, their potency and specificity are insufficient, and there are no ginsenoside compositions with clearly defined and prominent efficacy in any particular area, especially in anti-aging.
[0007] As a ginseng fermentation product with clear and prominent immune-enhancing activity, Chinese patent application publication CN119453464A discloses a ginseng fermentation product obtained by fermenting a ginseng fermentation substrate using microbial strains. The content of rare ginsenosides Rk1, Rg5, Rk3, Rh4 and Rg3 (including S-Rg3 and R-Rg3) with immune-enhancing activity accounts for more than 85% by weight of the total ginsenosides.
[0008] According to existing research findings, the rare ginsenosides Rk1, Rg5, Rk3, Rh4 and Rg3 (including S-Rg3 and R-Rg3) also have anti-aging effects. Therefore, the ginseng fermentation products disclosed in Chinese patent application publication CN 119453464A can also be used for anti-aging.
[0009] On the other hand, rare ginsenoside CK (20-O-β-D-glucopyranosyl-20(S)-protopanaxadiol, abbreviated as CK) is an intestinal metabolite of diol-type ginsenosides, and its content in ginseng plants is less than 0.01%, belonging to rare natural active ingredients. Recent research results indicate that rare ginsenoside CK has good anti-aging activity.
[0010] However, the content of ginsenoside CK in natural plants is extremely low (usually below 0.01%), making it difficult to meet application requirements through direct extraction. Therefore, using ginsenosides Rb1, Rb2, and Rc as substrates, enzymatic and microbial transformation methods have become the main approach.
[0011] From the perspective of efficiency and controllability, enzymatic methods are more suitable for the conversion of ginsenosides. The pathway for converting the prototype ginsenoside Rb1 into the rare ginsenoside CK is Rb1→Rd→F2→CK, with each step involving hydrolysis to remove a glucose at a different position. Glucosidases can catalyze this reaction. However, it is difficult to find a single glucosidase that can catalyze every step of the above pathway. Different glucosidases and different reaction conditions are needed for different steps to complete the entire conversion pathway. This reduces the efficiency and controllability of enzymatic conversion. Summary of the Invention
[0012] The purpose of this invention is to provide a method for efficiently converting ginsenoside Rb1 into ginsenoside CK using a single glucosidase, and further to prepare a method for preparing a functional composition using rare ginsenosides CK, Rk1, Rg5, Rk3, Rh4 and Rg3 (including S-Rg3 and R-Rg3) as the main raw materials, as well as the functional composition prepared by the above method.
[0013] Chinese invention patent application publication CN120060215A discloses sulfur-oxidizing leaf fungus (… Sulfolobus solfataricus The β-glucosidase SS-BGL is derived from *Sulphurella*, a genus of thermophilic archaea. Because thermophilic archaea appeared early in evolution, their enzyme proteins often possess broad activities, meaning a single enzyme protein can exhibit the biological activities of multiple enzymes with similar mechanisms of action. The aforementioned β-glucosidase SS-BGL possesses extensive hydrolytic activity, including β-D-glucosidase, β-D-galactosidase, β-D-hydroxyglucosidase, and α-glucosidase activities. It has been shown to be able to convert ginsenoside Rb1 into ginsenoside CK using ginsenoside Rb1 as a substrate.
[0014] On the other hand, referring to Chinese invention patent application publication CN119162155A (the entire text of which is incorporated herein by reference), β-glucosidase N81W-W195E is a modified form of *Acidophilus thermophilus* derived from *Acidophilus thermophilus*. Sulfolobus acidocaldarius A variant of the wild-type β-glucosidase, whose amino acid sequence is shown in SEQ ID No:2, which can catalyze the conversion of ginsenoside Rg1 to ginsenoside Rk3.
[0015] Because of acidophilic thermosulfuric leaf mold ( Sulfolobus acidocaldarius ) and sulfur-bearing leaf fungi ( Sulfolobus solfataricus Since they belong to the same genus *Sulphurella* and are closely related, the inventors wondered if the aforementioned β-glucosidase N81W-W195E could also convert ginsenoside Rb1 into ginsenoside CK using it as a substrate. However, after verification, β-glucosidase N81W-W195E alone could not catalyze the conversion of ginsenoside Rb1 into ginsenoside CK. The entire reaction pathway Rb1→Rd→F2→CK stopped at F2, while F2→CK was basically not carried out. That is, β-glucosidase N81W-W195E does not have the ability to catalyze the conversion of ginsenoside F2 into ginsenoside CK.
[0016] Then, the inventors accidentally discovered that by adding aspartic protease from Aspergillus niger to a reaction system containing β-glucosidase N81W-W195E, the catalytic properties of β-glucosidase N81W-W195E could be altered, enabling it to catalyze the conversion of ginsenoside F2 into ginsenoside CK.
[0017] Furthermore, the inventors discovered that by combining ginseng hydrolysate containing ginsenoside CK produced using the above method with ginseng fermentation product containing rare ginsenosides Rk1, Rg5, Rk3, Rh4 and Rg3 (including S-Rg3 and R-Rg3) prepared using the preparation method of ginseng fermentation product disclosed in Chinese Patent Application Publication CN119453464A, a rare ginsenoside efficacy composition with good anti-aging effects can be prepared.
[0018] The inventors completed this invention based on the above findings. This invention includes: 1. A method for preparing a rare ginsenoside efficacy composition, comprising: A mixture of ginsenosides containing ginsenoside Rb1, β-glucosidase N81W-W195E, and aspartic protease from Aspergillus niger were added to the reaction system. Ginsenoside Rb1 was converted into ginsenoside CK via ginsenoside F2, resulting in a product containing ginsenoside CK. The product containing ginsenoside CK was freeze-dried or vacuum-dried to obtain ginseng hydrolysate; and The ginseng hydrolysate is mixed with ginseng fermentation product containing ginsenosides Rk1, Rg5, Rk3, Rh4 and Rg3 to obtain the rare ginsenoside efficacy composition.
[0019] 2. The method according to item 1, wherein the temperature of the reaction system is 45~65℃, preferably 50~60℃, more preferably 55±2℃.
[0020] 3. The method according to item 1, wherein the pH of the reaction system is 3 to 6, preferably 3.5 to 5, and more preferably 4 ± 0.2.
[0021] It should be noted that the β-glucosidase N81W-W195E is a stable enzyme that is acid and heat stable. It retains 90% of its activity after treatment at 100℃ for 30 min and 93.2% of its activity after treatment at pH 1 for 30 min. However, this invention does not employ high-temperature and / or strongly acidic reaction conditions. This is because while high temperature and / or strong acidity imply high reaction rates and low pollution, they are more conducive to the dehydration of ginsenoside Rb1 (generating ginsenosides Rk1, Rk3, etc.) rather than glycosylation (generating ginsenosides F2, CK, etc.). This invention uses moderate-temperature and weakly acidic conditions, a result of comprehensively considering factors such as reaction efficiency and controllability.
[0022] 4. The method according to item 1, wherein the reaction time of step A is 10 to 100 hours, preferably 30 to 60 hours, more preferably 50 to 70 hours, and even more preferably 55 to 65 hours.
[0023] 5. The method according to item 1, wherein, based on the total ginsenosides in the ginsenoside mixture as 100% by weight, the content of ginsenoside Rb1 is ≥70% by weight.
[0024] 6. The method according to item 1, wherein, relative to 1 kg of ginsenoside Rb1 in the ginsenoside mixture, 10,000 to 50,000,000 U, preferably 100,000 to 10,000,000 U, more preferably 200,000 to 5,000,000 U, and even more preferably 500,000 to 2,000,000 U of the β-glucosidase N81W-W195E is added.
[0025] 7. The method according to claim 1, wherein, relative to 1 million U of the β-glucosidase N81W-W195E, 100 to 10,000 U, preferably 200 to 5,000 U, more preferably 500 to 2,000 U of the aspartic protease is added.
[0026] 8. The method according to item 1, wherein, based on the total ginsenosides in the ginsenoside mixture as 100% by weight, the content of ginsenoside Rb1 is ≥70% by weight; and based on the total ginsenosides in the ginsenoside hydrolysate as 100% by weight, the content of ginsenoside CK is ≥40% by weight.
[0027] 9. The method according to claim 1, further comprising preparing the ginseng fermentation product containing ginsenosides Rk1, Rg5, Rk3, Rh4 and Rg3 using the method of claim 9 of Chinese Patent Application Publication CN119453464A (the entire contents of which are incorporated herein by reference).
[0028] 10. The method according to item 1, wherein the weight ratio of the ginseng fermentation product to the ginseng enzymatic hydrolysate is 1:0.01 to 1:10, more preferably 1:0.1 to 1:1, more preferably 1:0.4 to 1:0.6, and even more preferably 1:0.5.
[0029] 11. The method according to item 1, wherein the rare ginsenoside efficacy composition is in solid or liquid form.
[0030] 12. A rare ginsenoside efficacy composition prepared by any one of the methods in items 1 to 11.
[0031] Invention Effects The preparation method of the rare ginsenoside efficacy composition of the present invention uses a single glucosidase to catalyze the efficient conversion of ginsenoside Rb1 to ginsenoside CK under a single reaction condition, thereby improving the efficiency and controllability of the enzymatic conversion.
[0032] The rare ginsenoside functional composition obtained by the preparation method of the rare ginsenoside functional composition of the present invention has a clear and prominent anti-aging effect. Attached Figure Description
[0033] Figure 1 This is an SDS-PAGE electrophoresis image of the target protein.
[0034] Figure 2 The liquid phase detection results are for the ginsenoside mixture prepared in Example 2.
[0035] Figure 3 The liquid phase detection results are for the ginseng enzymatic hydrolysate prepared in Example 3.
[0036] Figure 4 The liquid phase detection results are for the ginseng enzymatic hydrolysate prepared in Comparative Example 1.
[0037] Figure 5 The liquid phase detection results are for the ginseng enzymatic hydrolysate prepared in Comparative Example 2.
[0038] Figure 6 The liquid phase detection results are for the ginseng enzymatic hydrolysate prepared in Comparative Example 3.
[0039] Figure 7 The liquid phase detection results are for the ginseng enzymatic hydrolysate prepared in Comparative Example 4. Detailed Implementation
[0040] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0041] Example 1: Expression and purification of β-glucosidase N81W-W195E 1) Preparation of shuttle plasmid: Codon optimization was performed on the yeast expression system according to the amino acid sequence of β-glucosidase N81W-W195E (SEQ ID NO:2) to obtain the recombinant β-glucosidase N81W-W195E gene sequence (SEQ ID NO:1). The obtained target gene sequence was synthesized by Qingke Biotechnology Co., Ltd., and the synthesized gene was ligated into the pPIC9K plasmid to obtain the pPIC9K-N81W-W195E plasmid.
[0042] 2) Preparation of yeast expression strain: The pPIC9K-N81W-W195E plasmid was linearized and transformed into Pichia pastoris X-33 competent cells. Transformants were screened to obtain the yeast expression strain.
[0043] 3) Induction of target protein expression: Select a single colony of the constructed yeast expression strain and add it to 5 ml Activation was achieved by culturing in YPD liquid medium at 30℃ and 200rpm for 48h. A 1% inoculum was transferred to a 500ml Erlenmeyer flask (containing 200ml of YPD culture medium) and cultured at 30℃ and 200rpm for 24h, serving as the seed for the next fermentation tank. 3L of BSM medium was prepared and added to a 5L fermenter, sterilized at 121℃ for 20min, and after cooling to 30℃, the pH was adjusted to 5.0. The seed from the next fermentation tank was then added to the fermenter via flame inoculation. When the OD600 reached 70, 50% glycerol was added until the OD600 reached approximately 120. Addition was stopped, and once dissolved oxygen rebounded to 100%, methanol was added for induction. During induction, dissolved oxygen was controlled to be no lower than 30%, and the pH to be approximately 5.0. Induction lasted 40h, after which fermentation was terminated. The culture medium was centrifuged at 12000rpm for 2min, and the supernatant was collected. Protein yield and purity were determined using the BCA method and SDS-PAGE method. BCA results showed that the protein concentration in the fermentation broth was 6.5 g / L.
[0044] 4) Purification of the target protein: The fermentation broth was centrifuged to remove the bacterial cells, resulting in a semi-clear liquid. The fermentation supernatant was salted out, and the precipitate was collected to obtain a crude purified sample. After reconstitution of the crude purified sample, it was subjected to ion exchange chromatography to obtain a refined purified sample. The protein SDS-PAGE electrophoresis image is shown below. Figure 1 As shown.
[0045] Example 2: Preparation of a mixture of ginsenosides Preparation of the ginsenoside mixture: Ginseng was subjected to pulverization, extraction, filtration, resin adsorption, ethanol analysis, decolorization, concentration, and drying to obtain the ginsenoside mixture. The liquid chromatography analysis results of this ginsenoside mixture are shown below. Figure 2 The content of Rb1 was 74%, the content of Rd was 3.7%, and it contained no CK.
[0046] Example 3: Combination transformation of β-glucosidase N81W-W195E and aspartic protease derived from Aspergillus niger into a mixture of ginsenosides containing ginsenoside Rb1 to generate ginsenoside CK. 1 kg of the ginsenoside mixture prepared in Example 2, 1 million U of the β-glucosidase N81W-W195E prepared in Example 1, and 1000 U of aspartic protease (derived from Aspergillus niger, CAS No. 9025-49-4, non-glycosidase activity, purchased from Beijing Puxitang Biotechnology Co., Ltd., catalog number A11981) were dissolved in a 0.5 mM citrate-sodium citrate buffer system at pH 4.0. The enzyme was hydrolyzed at 55℃±2 for 60 h, with the rotation speed set at 240 rpm and the pH maintained at 4±0.2 throughout the hydrolysis process.
[0047] Aspartic protease activity is defined as the amount of enzyme required to hydrolyze casein to produce 1 μg of tyrosine in 1 minute at 40°C and pH 3.0, which is defined as 1 unit of enzyme activity (1U).
[0048] β-glucosidase activity is defined as the amount of enzyme required to release 1 micromole of p-nitrophenol per minute from p-nitrophenol β-glucoside at 80°C and pH 3.0, which is defined as 1 unit of enzyme activity (1U).
[0049] After enzymatic hydrolysis, the precipitate was centrifuged at 8000-10000 rpm for 10 min at 4℃. The precipitate was collected and vacuum dried at 50-65℃ for 12 h under a vacuum of ≤-0.09 MPa. After drying, the precipitate was pulverized and passed through a 140-mesh sieve to obtain ginseng enzymatic hydrolysate.
[0050] Detection and Analysis Rare ginsenoside F2 standard (purchased from Anpuyun Laboratory Supplies (Shanghai) Co., Ltd., purity ≥98%) was dissolved in methanol at concentrations of 1 mg / mL, 0.8 mg / mL, 0.6 mg / mL, 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, and 0.8 mg / mL before being injected into the sample. Rare ginsenoside CK standard (purchased from Anpuyun Laboratory Supplies (Shanghai) Co., Ltd., purity ≥98%) was dissolved in methanol at concentrations of 2 mg / mL, 1.6 mg / mL, 1.2 mg / mL, 0.8 mg / mL, and 0.4 mg / mL before injection. The ginseng hydrolysate obtained above was dissolved in methanol to prepare a 2 mg / mL injection solution.
[0051] Based on the standard curves for rare ginsenoside F2 and rare ginsenoside CK, the content of rare ginsenoside CK in the ginseng hydrolysate was calculated to be 42.9%, and the content of rare ginsenoside F2 was calculated to be 11.6%. Liquid chromatography results are shown below. Figure 3 The molecular weight of ginsenoside Rb1 is 1109.31, and the molecular weight of ginsenoside CK is 621.88. The theoretical conversion content of ginsenoside Rb1 to CK is 56.06%. Based on the actual conversion content of ginsenoside CK being 42.9%, the conversion rate of ginsenoside Rb1 to ginsenoside CK is 76.52%.
[0052] Comparative Example 1: β-glucosidase N81W-W195E alone could not generate CK when converting a mixture of ginsenosides containing ginsenoside Rb1, and the conversion stopped at F2. The ginsenoside mixture was converted as in Example 3 to prepare ginseng hydrolysate, except that only glucosidase N81W-W195E was used, and aspartic protease was not used.
[0053] The results of liquid chromatography analysis of the obtained ginseng enzymatic hydrolysate are shown below. Figure 4 The ginseng hydrolysate contained 62% rare ginsenoside F2 and 0.3% rare ginsenoside CK, with a conversion rate of 0.54% from ginsenoside Rb1 to ginsenoside CK.
[0054] Comparative Example 2: The reaction of aspartic protease alone converting a mixture of ginsenosides containing ginsenoside Rb1 failed. The ginsenoside mixture was converted as in Example 3 to prepare ginseng hydrolysate, except that only aspartic protease was used and glucosidase N81W-W195E was not used.
[0055] The results of liquid chromatography analysis of the obtained ginseng enzymatic hydrolysate are shown below. Figure 5 The ginsenoside Rb1 content in the ginseng hydrolysate was 71%, the ginsenoside Rd content was 2.8%, and the ginsenoside CK content was 0, indicating that the conversion reaction could not proceed.
[0056] Comparative Example 3: The combination of β-glucosidase N81W-W195E + aspartic protease + protease inhibitor transformed a mixture of ginsenosides containing ginsenoside Rb1, with most of the conversion occurring at F2, producing only a small amount of CK. The ginsenoside mixture was converted as in Example 3 to prepare ginseng hydrolysate, except that the citric acid-sodium citrate buffer solution also contained 5 µM of pepstatin A (aspartic protease inhibitor, purchased from Shanghai Beyotime Biotechnology Co., Ltd., catalog number SG2016).
[0057] The results of liquid chromatography analysis of the obtained ginseng enzymatic hydrolysate are shown below. Figure 6 The ginseng hydrolysate contained 49.3% rare ginsenoside F2 and 4.1% rare ginsenoside CK, with a conversion rate of 7.3% from ginsenoside Rb1 to ginsenoside CK.
[0058] Comparative Example 4: The combination of β-glucosidase N81W-W195E+ pepsin transformed a mixture of ginsenosides containing ginsenoside Rb1 to produce ginsenoside F2, but not ginsenoside CK. The ginsenoside mixture was converted as in Example 3 to prepare ginseng hydrolysate, except that 1000 U of pepsin (extracted from porcine gastric mucosa, CAS No. 9001-75-6, non-glycosidase activity, purchased from Merck Life Sciences, catalog number 516360) was used.
[0059] The results of liquid chromatography analysis of the obtained ginseng enzymatic hydrolysate are shown below. Figure 7The ginseng hydrolysate contained 63.5% rare ginsenoside F2 and 2% rare ginsenoside CK, with a conversion rate of 0.36% from ginsenoside Rb1 to ginsenoside CK.
[0060] It should also be noted that the inventors are conducting further research on why the combination of β-glucosidase N81W-W195E and aspartic protease derived from Aspergillus niger can convert ginsenoside Rb1 into ginsenoside CK via ginsenoside F2. Based on existing experimental results, the inventors hypothesize that: 1. The β-glucosidase N81W-W195E is derived from *Acidophilus thermophilus* (a type of fungus). Sulfolobus acidocaldarius ), acidophilic thermosulfuric leaf fungus ( Sulfolobus acidocaldarius It is an archaea that appeared early in biological evolution.
[0061] 2. In the early stages of biological evolution, enzyme proteins often possessed broad activities—a single enzyme protein could exhibit the biological activities of multiple enzymes with similar mechanisms of action. Therefore, the catalytic center of the β-glucosidase N81W-W195E is not specifically matched with a particular type of glycosidic bond, but is more flexible, potentially matching different types of glycosidic bonds under the influence of different reaction environments or other molecules. That is, the β-glucosidase N81W-W195E possesses a molecular basis for altering its catalytic properties.
[0062] 3. The aspartic protease derived from *Aspergillus niger* may partially cleave β-glucosidase N81W-W195E in the reaction system, or it may interact with β-glucosidase N81W-W195E even without cleavage, thereby altering the spatial conformation of β-glucosidase N81W-W195E and causing a change in its catalytic center state, thus altering the catalytic properties of β-glucosidase N81W-W195E. In other words, the aspartic protease derived from *Aspergillus niger* provides the conditions for altering the catalytic properties of β-glucosidase N81W-W195E.
[0063] Example 4: Preparation of a rare ginsenoside composition Fermented ginseng powder 1 was prepared according to the description in Example 1 of Chinese Patent Application Publication CN119453464A.
[0064] The fermented ginseng powder 1 and the ginseng enzymatic hydrolysate prepared in Example 3 above were mixed evenly at a ratio of 1:0.5 to prepare a composition, which is referred to as the composition.
[0065] Example 5: Effects of the composition on a D-galactose aging model mouse. The above composition was used to conduct an anti-aging efficacy evaluation test.
[0066] 1. Establishment of a D-galactose aging model mouse model and gavage dosage After one week of acclimatization, Kunming mice weighing 25-30g were randomly divided into three groups of eight mice each: a normal control group, a model group, and a combination therapy group. Except for the normal control group, the other mice received daily intraperitoneal injections of D-galactose 200 mg / kg (0.2 mL / 20g) to induce modeling. The normal control group received an equal volume of physiological saline daily. Simultaneously with modeling, the mice were administered the corresponding 250 mg / kg composition via gavage daily, while the normal control and model groups received 0.2 mL of physiological saline daily via gavage. This treatment continued for six weeks. During the experiment, the mice had free access to food and water.
[0067] 2. Experimental Indicators and Methods After administration, mice were fasted for 12 hours but allowed free access to water. Blood was collected from the orbital cavity, and the mice were euthanized. The livers of the mice were harvested, and the liver tissue was prepared into a 10% homogenate with ice-cold physiological saline. After centrifugation, the supernatant was collected, and the activities of malondialdehyde (MDA), glutathione peroxidase (GSH-Px), and superoxide dismutase (SOD) in the liver tissue and serum of the mice were detected according to the kit instructions.
[0068] 3. Experimental Results 3.1 Effects of the composition on MDA, SOD, and GSH-PX in mouse liver As shown in Table 1, compared with the normal group, the activity of SOD and GSH-PX in the liver of mice in the model group was decreased, and the content of MDA was increased, and the difference was significant. P <0.01%. Compared with the model group, the activity of SOD and GSH-PX in the composite group was significantly increased, and the content of MDA was significantly decreased ( P <0.01).
[0069] Table 1. Effects of different dosage groups on SOD, MDA, and GSH-PX levels in mouse liver ( - X ±S)
[0070] Note: ** P <0.01 vs. normal group; ## P <0.01 vs model group 3.2 Effects of different dosage groups on serum MDA, SOD, and GSH-PX levels in mice As shown in Table 2, compared with the normal group, the activities of SOD and GSH-PX in the serum of mice in the model group were decreased, and the content of MDA was increased, and the differences were significant. P <0.01, P <0.05%. Compared with the model group, the activities of SOD and GSH-PX in the composition group were significantly increased (P <0.01), MDA content decreased significantly ( P <0.05).
[0071] Table 2. Effects of different dosage groups on serum SOD, MDA, and GSH-PX levels in mice ( - X ±S)
[0072] Note: * P <0.05, ** P <0.01 vs. normal group; # P <0.05, ## P <0.01 vs model group In conclusion, the combination of fermented ginseng powder and ginseng enzymatic hydrolysate can significantly enhance the antioxidant activity of mouse serum and liver, thereby delaying aging in mice.
[0073] Sequence information SEQ ID NO:1 1 ATGCTGTCCT TCCCGAAAGG CTTCAAATTT GGTTGGTCCC AGAGCGGTTT CCAGAGCGAAATGGGTACCC 71 CGGGCAGCGA AGATCCGAAC TCTGATTGGC ACGTGTGGGT CCACGACCGT GAAAATATCGTATCCCAGGT 141 TGTGAGCGGT GACCTGCCGG AAAACGGCCC TGGTTATTGG GGTAACTACA AACGCTTTCACGACGAAGCG 211 GAGAAAATCG GTCTGAACGC AGTTCGTATC TGGGTTGAAT GGAGCCGTAT CTTCCCGCGTCCGCTGCCGA 281 AGCCGGAAAT GCAAACTGGC ACCGACAAAG AAAACAGCCC TGTTATCTCT GTTGATCTGAACGAAAGCAA 351 ACTGCGCGAA ATGGATAACT ACGCTAATCA CGAAGCGCTG AGCCACTACC GTCAGATTCTGGAGGATCTG 421 CGCAACCGCG GTTTTCATAT CGTTCTGAAC ATGTACCACT GGACTCTGCC GATCTGGCTGCATGATCCGA 491 TCCGCGTTCG TCGTGGTGAT TTTACGGGCC CGACCGGCTG GCTGAACTCC CGCACCGTTTACGAATTCGC 561 GCGCTTTTCT GCGTACGTCG CGGAAAAACT GGACGACCTG GCGTCTGAAT ACGCTACCATGAATGAGCCA 631 AACGTCGTAT GGGGCGCGGG TTACGCGTTC CCGCGCGCTG GCTTCCACC GAACTATCTGAGCTTCCGCC 701 TGTCTGAAAT CGCAAAGTGG CTGAATATCA TTCAGGCCCA CGCTCGCGCG TATGATGCGATCAAAAGCGT 771 TAGCAAAAAA TCCGTTGGTA TCATCTACGC AAACACTTCC TACTACCCTC TGCGCCCGCAGGACAACGA 841 GCAGTCGAAA TCGCGGAACG CCTGAACCGT TGGTCCTTCT TCGACTCTAT CATTAAAGGCGAAATCACCT 911 CCGAAGGCCA AAACGTGCGT GAAGATCTGC GTAATCGTCT GGACTGGATC GGTGTGAACTACTACACGCG 981 TACGGTCGTA ACCAAAGCGG AATCTGGTTA TCTGACTCTG CCGGGTTACG GTGACCGTTGTGAACGTAAC 1051 AGCCTGTCTC TGGCAAATCT GCCAACCAGC GACTTTGGCT GGGAATTTTTCCCGGAAGGC CTGTACGATG 1121 TTCTGCTGAA GTATTGGCGC TACGGTCTGC CGCTGTACGT TATGGAGAACGGTATTGCTG ATGATGCTGA 1191 TTATCAGCGT CCGTATTATC TGGTTAGCCA CATCTACCAA GTGCATCGTGCACTGAACGA AGGTGTAGAC 1261 GTTCGTGGCT ACCTGCACTG GAGCCTGGCA GACAACTACG AATGGTCTTCTGGTTTCTCT ATGCGTTTCG 1331 GCCTGCTGAA AGTCGACTAC CTGACCAAGC GTCTGTATTG GCGTCCTTCCGCTCTGGTTT ACCGTGAAAT 1401 CACTCGTAGC AACGGTATCC CGGAAGAACT GGAACATCTG AACCGCGTGCCTCCGATTAA ACCGCTGCGC 1471 CAC SEQ ID NO:2 1 MLSFPKGFKF GWSQSGFQSE MGTPGSEDPN SDWHVWVHDR ENIVSQVVSG DLPENGPGYW 61 GNYKRFHDEA EKIGLNAVRI WVEWSRIFPR PLPKPEMQTG TDKENSPVIS VDLNESKLRE 121 MDNYANHEAL SHYRQILEDL RNRGFHIVLN MYHWTLPIWL HDPIRVRRGD FTGPTGWLNS 181 RTVYEFARFS AYVAEKLDDL ASEYATMNEP NVVWGAGYAF PRAGFPPNYL SFRLSEIAKW 241 LNIIQAHARA YDAIKSVSKK SVGIIYANTS YYPLRPQDNE AVEIAERLNR WSFFDSIIKG 301 EITSEGQNVR EDLRNRLDWI GVNYYTRTVV TKAESGYLTL PGYGDRCERN SLSLANLPTS 361 DFGWEFFPEG LYDVLLKYWR YGLPLYVMEN GIADDADYQR PYYLVSHIYQ VHRALNEGVD 421 VRGYLHWSLA DNYEWSSGFS MRFGLLKVDY LTKRLYWRPS ALVYREITRS NGIPEELEHL 481 NRVPPIKPLR H。
Claims
1. A method for preparing a rare ginsenoside efficacy composition, comprising: A mixture of ginsenosides containing ginsenoside Rb1, β-glucosidase N81W-W195E, and aspartic protease from Aspergillus niger were added to the reaction system. Ginsenoside Rb1 was converted into ginsenoside CK via ginsenoside F2, resulting in a product containing ginsenoside CK. The product containing ginsenoside CK was freeze-dried or vacuum-dried to obtain ginseng hydrolysate; and The ginseng hydrolysate is mixed with ginseng fermentation product containing ginsenosides Rk1, Rg5, Rk3, Rh4 and Rg3 to obtain the rare ginsenoside efficacy composition.
2. The method according to claim 1, wherein, The temperature of the reaction system is 45~65℃, preferably 50~60℃, and more preferably 55±2℃.
3. The method according to claim 1, wherein, The pH of the reaction system is 3 to 6, preferably 3.5 to 5, and more preferably 4 ± 0.
2.
4. The method according to claim 1, wherein, The reaction time for step A is 10 to 100 hours, preferably 30 to 60 hours, more preferably 50 to 70 hours, and even more preferably 55 to 65 hours.
5. The method according to claim 1, wherein, Based on the total ginsenosides in the ginsenoside mixture as 100% by weight, the content of ginsenoside Rb1 is ≥70% by weight.
6. The method according to claim 1, wherein, Relative to 1 kg of ginsenoside Rb1 in the ginsenoside mixture, 10,000 to 50,000,000 U, preferably 100,000 to 10,000,000 U, more preferably 200,000 to 5,000,000 U, and even more preferably 500,000 to 2,000,000 U of the β-glucosidase N81W-W195E are added.
7. The method according to claim 1, wherein, In addition to 1 million U of the β-glucosidase N81W-W195E, 100-10000 U, preferably 200-5000 U, more preferably 500-2000 U of the aspartic protease is added.
8. The method according to claim 1, wherein, Based on the total ginsenosides in the ginsenoside mixture as 100% by weight, the content of ginsenoside Rb1 is ≥70% by weight; and based on the total ginsenosides in the ginsenoside hydrolysate as 100% by weight, the content of ginsenoside CK is ≥40% by weight.
9. The method according to claim 1, further comprising preparing the ginseng fermentation product containing ginsenosides Rk1, Rg5, Rk3, Rh4 and Rg3 using the method of claim 9 in Chinese patent application publication CN119453464A.
10. The method according to claim 1, wherein, The weight ratio of the ginseng fermentation product to the ginseng enzymatic hydrolysate is 1:0.01 to 1:10, more preferably 1:0.1 to 1:1, even more preferably 1:0.4 to 1:0.6, and even more preferably 1:0.
5.
11. The method according to claim 1, wherein, The rare ginsenoside efficacy composition is in solid or liquid form.
12. A rare ginsenoside efficacy composition prepared by any one of claims 1 to 11.
Citation Information
Patent Citations
Method for large-scale production of rare ginsenoside Rk3
CN119162155A
Ginseng fermentation product rich in various rare ginsenosides and preparation method thereof
CN119453464A
Beta-glycosidase SS-BGL mutant for preparing rare ginsenoside and application of beta-glycosidase SS-BGL mutant
CN120060215A