An optimized transient expression vector, transfection method and application thereof

Abstract

This invention provides an optimized transient expression vector, transfection method, and its applications, relating to the field of transgenic technology. This invention combines UCOE and SINEUP elements to construct a transient expression vector, achieving synergistic effects and further increasing the transient expression level of the target protein while ensuring protein purity and activity. The transient expression vector provided by this invention is highly versatile, applicable to various target proteins and mammalian cells, easy to modify, and has a wide range of applications.

Description

Technical Field

[0001] This invention belongs to the field of transgenic technology, and relates to transient expression vectors, specifically to an optimized transient expression vector, a transfection method, and its applications. Background Technology

[0002] As a major obstacle in research and development and production, the instability of recombinant drug cell lines during the production process has become an urgent problem to be solved. It is generally believed that the integration site of the expression vector and transgene silencing caused by epigenetic factors are important reasons. Stable epigenetic mechanisms include heritable epigenetic markers and position effects such as histone modification (hypoacetylation) and DNA methylation. At the same time, unstable chromatin factors, such as changes in higher-order chromatin structure caused by non-integration site reasons, may also be important reasons affecting expression, including changes in open chromatin levels and interactions between chromatin.

[0003] Ubiquitous chromatin opening elements (UCOEs) are gene fragments embedded in methylated CpG islands and containing bidirectional promoters. When linked upstream of a vector promoter, they possess both chromatin remodeling capabilities and the ability to resist gene silencing. Studies have found that UCOEs derived from the human HNRNPA2B1 / CBX3 locus can increase the expression level of recombinant proteins in CHO cells by 3-10 times. Gao Huizhen et al. obtained multiple porcine UCOE sequences through homology alignment of HNRNPA2B1 / CBX3 and screened one porcine UCOE that could stably and efficiently express the reporter gene green fluorescent protein GFP, further demonstrating that UCOEs can enhance the expression of exogenous genes (Gao Huizhen. Screening and functional identification of porcine cis-acting elements UCOEs [J]. Henan Agricultural University, 2014.).

[0004] In recent years, recombinant antibodies and protein drugs have been widely used in clinical practice, but their prices remain very high due to low production efficiency. In the complex production process of recombinant antibodies and protein drugs, the efficient expression of the vector is one of the key technical factors affecting production efficiency. Although there are many solutions for efficient expression vectors, the central problem remains overcoming the position effect and silencing effect in transgene expression. Host cells transformed with exogenous genes need to undergo continuous and stable expression in bioreactors for tens of days or even longer. The silencing mechanism often leads to the premature suppression of the vector transferred to cells for expression. Therefore, achieving continuous and efficient production of transgenes in mammalian cells remains a major technical challenge in genetically engineered cell production.

[0005] Optimizing the cis-acting elements of exogenous genes can effectively improve their expression efficiency. This method mainly involves optimizing the expression vector, including optimizing the promoter, enhancer, adding introns, using unconfined chromatin elements (UCOEs), and adding matrix nuclear attachment regions (MARs). Unconfined chromatin elements (UCOEs) can form open chromatin on the promoter. Open chromatin is usually in a depolymerized state in the cellular structure, located in the interphase nucleus, and replicates in the early stages of the cell cycle. Its histones are highly acetylated, and the CpG dinucleotides of the linked DNA are usually unmethylated. In mammalian cell expression vectors, regulatory sequences, such as UCOE / MAR sequences, are often added near the promoter to intervene in epigenetic modifications near the promoter and overcome transgene silencing effects. Recent studies have reported that gene-specific regulatory long non-coding RNAs (lncRNAs) can be used to regulate translation. These new synthetic and natural antisense lncRNAs, known as sineups, primarily function by enhancing ribosome recruitment of target mRNAs, thereby increasing the translation of specific mRNA targets without affecting RNA expression levels. Sineup activity depends on both the binding domain (BD) and the effector domain (ED). The BD is mainly used for specific binding of target molecules, while the ED mainly contains some Alu and SINEB2 elements, which activate transcription. Furthermore, sineups can have different effects on the expression of cytoplasmic and secreted proteins. Yao et al. first reported an increase in monoclonal antibody production using sineups, achieving a 50% increase in antibody production without modifying the cell genome (Yao Y, et al. RNAe: An effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat[J]. Nucleic Acids Research, 2015).

[0006] Prior art CN105624156B investigated artificial non-coding RNAs containing inverted SINEB2 repeat sequences and their use in enhancing target protein translation. Specifically, this invention provides a nucleic acid molecule that is: (1) an RNA molecule composed of: a pairing region complementary to the target mRNA, an inverted SINEB2 sequence, an optional poly(A) signaling region, and optional regulatory elements; or (2) a DNA molecule capable of transcribing the RNA molecule. This technique only investigated the application of SINEUP-related elements in enhancing target protein translation and did not study UCOE or UCOE combined with SINEUP. Summary of the Invention

[0007] This invention addresses the shortcomings of existing technologies, such as the weak ability of single elements to enhance protein expression and the cumbersome, inefficient, and difficult-to-modify transfection steps of combined elements. It provides an optimized transient expression vector, transfection method, and its applications. This invention combines UCOE and SINEUP elements to construct a transient expression vector, achieving synergistic enhancement and further increasing the transient expression level of the target protein while ensuring protein purity and activity.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] On the one hand, the present invention provides an optimized transient expression carrier, which simultaneously includes UCOE elements and SINEUP elements.

[0010] Specifically, the UCOE element contains the gene sequence shown in SEQ ID NO.1, and also contains UCOE elements with other sequences. As long as they meet the characteristics of UCOE elements, their combination with SINEUP elements is not affected by the specific sequence.

[0011] Specifically, the SINEUP element comprises a binding domain (BD) and an effector domain (ED). The binding domain contains the gene sequence shown in SEQ ID NO. 2 or SEQ ID NO. 3. The BD is primarily used for specifically binding to target molecules. This invention designs a BD sequence based on the target protein sequence. Specifically, the BD sequence is designed around the start AUG codon, with an overlapping 5' UTR and a portion of the coding sequence. Theoretically, the SINEUP element can be specifically designed and modified for any target protein gene. Then, simply replacing the corresponding portion of the synthesized integrative plasmid with the modified sequence containing the new target protein gene allows for transfection, enhancing the expression of the new target protein.

[0012] More specifically, the effective domain includes the gene sequence shown in SEQ ID NO.4.

[0013] Specifically, the binding domain and the effect domain are connected via a Linker.

[0014] Preferably, the Linker may be the sequence shown in SEQ ID NO.5.

[0015] Specifically, the transient expression vector further includes the target protein gene and a vector backbone.

[0016] More specifically, the target protein includes secreted proteins or antibodies.

[0017] Preferably, the target protein includes, but is not limited to, TGF-Beta RII protein or EGFP.

[0018] More specifically, the vector backbone is a mammalian cell expression vector backbone, and the mammalian cell expression vector includes, but is not limited to: pcDNA3.1, PTT5, pCMV or pIRESpuro.

[0019] Specifically, the transient expression vector may also contain a reporter gene or an antibiotic resistance gene.

[0020] More specifically, the reporter gene includes, but is not limited to, genes for fluorescent proteins or luciferases.

[0021] Preferably, the fluorescent protein includes, but is not limited to, GFP, RFP, YFP, or BFP.

[0022] Preferably, the luciferase includes, but is not limited to: firefly luciferase, Gaussia luciferase, Renidae luciferase, or nano-luciferase.

[0023] Preferably, the antibiotic resistance gene includes, but is not limited to: G418, puromycin, hygromycin B, bleomycin, or Norlesmycin.

[0024] On the other hand, the present invention provides a transfection method, wherein the transfection method involves transfecting the target cells with the above-mentioned transient expression vector using a transfection reagent.

[0025] Preferably, the transfection reagent includes, but is not limited to, PEI, liposome transfection reagent, or electrotransfection reagent.

[0026] Preferably, the target cells include, but are not limited to, human cell lines, Chinese hamster cell lines, or rat cell lines.

[0027] Preferably, the target cells are HEK293 cells, CHO cells, Vero cells, or HeLa cells.

[0028] Preferably, the target cells can be HEK293F cells, HEK293T cells, Expi 293F cells, CHO-S cells, Expi-CHO-S cells, Vero cells, or HeLa cells.

[0029] On the other hand, the present invention provides the application of the above-mentioned transient expression vector or the above-mentioned transfection method in enhancing cellular protein expression.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] 1. This invention combines UCOE and SINEUP elements to construct transient expression vectors, which can synergistically enhance protein expression.

[0032] 2. The transient expression vector provided by this invention has strong versatility, is suitable for various target proteins and mammalian cells, is easy to modify, and has a wide range of applications. Attached Figure Description

[0033] Figure 1 This is a map of the pcDNA3.1-UCOE plasmid.

[0034] Figure 2 This is a map of the pcDNA3.1-sineup plasmid.

[0035] Figure 3 This is a map of the pcDNA3.1-UCOE-sineup plasmid.

[0036] Figure 4 The data represent the expression levels of the protein TGF-Beta RII in HEK293f cells transiently transfected with plasmid TGF-Beta RII / pcDNA 3.1-UCOE-sineup; different letters in the bar chart indicate significant differences between data (P<0.05).

[0037] Figure 5 The data show the relative fluorescence intensity of EGFP in CHO-S cells transiently transfected with plasmid EGFP / pcDNA 3.1-UCOE-sineup. Detailed Implementation

[0038] It is worth noting that the raw materials used in this invention are all commercially available products, and their sources are not specifically limited.

[0039] Example 1: Recombinant expression vector and its preparation method

[0040] (1) Construction of pcDNA3.1-Control: The Kozak sequence (specific sequence: GCCACCATG), the signal peptide sequence (specific sequence: SEQ ID NO. 7), and the EcoRV restriction site were added before the TGF-Beta RII protein gene sequence (specific sequence is shown in SEQ ID NO. 6), and the construction was completed by inserting it into the pcDNA3.1(-) vector through the KpaI and HindIII restriction sites; The Kozak sequence was added before the EGFP protein gene sequence (specific sequence is shown in SEQ ID NO. 8), and the construction was completed by inserting it into the pcDNA3.1(-) vector through the KpaI and HindIII restriction sites.

[0041] (2) Construction of pcDNA3.1-UCOE: Based on the reported sequence (GenBank: MP176334.1), a 1.5kb UCOE sequence was artificially synthesized (NruI and MluI restriction sites were introduced at the 5′ and 3′ ends, respectively; see SEQ ID NO.1 for the specific sequence). The sequence was subcloned into the (1) pcDNA3.1-Control vector to obtain pcDNA3.1-UCOE. The plasmid map is shown in [link to plasmid map]. Figure 1 .

[0042] SEQ ID NO.1 (UCOE sequence):

[0043] GCCTACAGCTCAAGCCACATCCGAAGGGGGAGGGAGCCGGGAGCTGCGCGCGGGGCCGCCGGGGGGAGGGGTGGCACCGCCCACGCCGGGCGGCCACGAAGGGCGGGGCAGCGGGCGCGCGCGCGGCGGGGGGAGGGGCCGGCGCCGCGCCCGCTGGGAATTGGGGCCCTAGGGGGAGGGCGGAGGCGCCGACGACCGCGGCACTTACCGTTCGCGGCGTGGCGCCCGGTGGTCCCCAAGGGGAGGGAAGGGGGAGGCGGGGCGAGGACAGTGACCGGAGTCTCCTCAGCGGTGGCTTTTCTGCTTGGCAGCCTCAGCGGCTGGCGCCAAAACCGGACTCCGCCCACTTCCTCGCCCGCCGGTGCGAGGGTGTGGAATCCTCCAGACGCTGGGGGAGGGGGAGTTGGGAGCTTAAAAACTAGTACCCCTTTGGGACCACTTTCAGCAGCGAACTCTCCTGTACACCAGGGGTCAGTTCCACAGACGCGGGCCAGGGGTGGGTCATTGCGGCGTGAACAATAATTTGACTAGAAGTTGATTCGGGTGTTTCCGGAAGGGGCCGAGTCAATCCGCCGAGTTGGGGCACGGAAAACAAAAAGGGAAGGCTACTAAGATTTTTCTGGCGGGGGTTATCATTGGCGTAACTGCAGGGACCACCTCCCGGGTTGAGGGGGCTGGATCTCCAGGCTGCGGATTAAGCCCCTCCCGTCGGCGTTAATTTCAAACTGCGCGACCGTTTCTCACCTGC(3) Construction of pcDNA3.1-sineup:

[0044] Designing the BD sequence: Starting from the start codon AUG in the pcDNA3.1-Control vector, extend 40 bases to the 5' end and 29 bases to the 3' end, for a total of 72 bases, which is the (-40nt / +32nt) form. The antisense strand sequence of this 72-base sequence is used as the BD sequence for construction (the BD sequence of TGF-Beta RII protein is shown in SEQ ID NO.2, and the BD sequence of EGFP protein is shown in SEQ ID NO.3).

[0045] The components of the Sineup are shown in Table 1. The ED sequence is shown in SEQ ID NO.4, and the Linker sequence is shown in SEQ ID NO.5.

[0046] Table 1

[0047] BD sequence (72nt) Linker (21nt) ED sequence (167nt)

[0048] The artificially synthesized sineup element sequence was inserted into (1) pcDNA3.1-Control via NheI / NotI restriction sites. The resulting pcDNA3.1-sineup plasmid is shown in the image. Figure 2 .

[0049] SEQ ID NO.2 (TGF-Beta RII protein BD sequence):

[0050] AGCACCCATAGTAGTAGAGTATCAGTTTCCATGGTGGCGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGT;

[0051] SEQ ID NO.3 (EGFP protein BD sequence):

[0052] CCAGTGAACAATTCTTCTCCTTTAGACACCATGGTGGCGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGT;

[0053] SEQ ID NO.4 (ED sequence):

[0054] CAGTGCTAGAGGAGGTCAGAAGAGGGCATTGGATCCCCCAGAACTGGAGTTATAC GGTAACCTCGTGGTGGTTGTGAACCACCATGTGGATGGATATTGAGTTCCAAACACTG GTCCTGTGCAAGAGCATCCAGTGCTCTTAAGTGCTGAGCCATCTCTTTAGCTCC;

[0055] SEQ ID NO.5 (Linker sequence):

[0056] GCCCACATGGAATCCATTGTG;

[0057] SEQ ID NO.6 (TGF-Beta RII protein gene sequence):

[0058]

[0059] SEQ ID NO.7 (Signal peptide gene sequence):

[0060] ATGGAAACTGATACTCTACTACTATGGGTGCTGCTGCTGTGGGTCCCTGGCTCCAC CGGC;

[0061] SEQ ID NO.8 (EGFP protein gene sequence):

[0062] GTGTCTAAAGGAGAAGAATTGTTCACTGGAGTCGTACCTATCCTTGTGGAACTTGATGGAGATGTGAACGGACATAAATTCTCCGTATCTGGAGAAGGAGAAGGAGATGCAACGTATGGAAAGTTAACTCTTAAATTTATCTGCACAACAGGAAAGCTCCCAGTGCCTTGGCCTACACTTGTGACAACACTTACGTATGGAGTGCAATGCTTCTCACGCTATCCTGATCAC ATGAAACAACATGATTTCTTCAAGTCCGCAATGCCTGAAGGATATGTGCAAGAAAGAACAATCTTCTTCAAGGACGATGGAAACTATAAGACGCGTGCAGAAGTGAAATTTGAAGGAGATACACTTGTGAACAGAATCGAACTTAAAGGAATCGATTTCAAGGAGGATGGAAACATCCTTGGACATAAACTTGAATATAACTATAACTCTCATAACGTGTATATCATGGCAGATAAACAGAAGAATGGGATCAAAGTGAACTTTAAGATACGGCATAACATCGAAGATGGATCTGTGCAACTTGCAGATCATTATCAACAGAATACTCCTATCGGAGATGGACCTGTGCTTCTTCCTGATAACCATTATCTTTCTACACAATCTGCACTTTCTAAAGATCCTAACGAGAAGCGAGACCACATGGTGCTTCTTGAATTTGTGACAGCAGCAGGAATCACACTTGGAATGGATGAACTTTATAAA;

[0063] (4) Construction of pcDNA3.1-UCOE + sineup:

[0064] The 1.5kb UCOE sequence synthesized in step (1) (with NruI and MluI restriction sites introduced at the 5′ and 3′ ends, respectively) was cloned into the pcDNA3.1-sineup vector described above by enzyme digestion and ligation to complete the construction, resulting in pcDNA3.1-UCOE+sineup. The plasmid map is shown below. Figure 3 .

[0065] Example 2: Transfection with recombinant expression vector

[0066] (1) PEI transfection of HEK293f cells

[0067] Transfected target protein: TGF-Beta RII;

[0068] Transfection molecules: pcDNA3.1-control, pcDNA3.1-UCOE, pcDNA 3.1-sineup, pcDNA 3.1-UCOE+sineup.

[0069] Transfection experimental steps:

[0070] On the day of transfection, adjust the cell density to 4–5E^6 cells / mL and perform transfection according to the following conditions: DNA: 1.3 mg / L, PEI: 4 mg / L. First, dilute the DNA with 10% transfection volume of serum-free medium (Yoyi, catalog number YY293CD05.001) and filter aseptically. Then, incubate the diluted DNA with PEI (Polysciences, catalog number 24765-1) for 15–30 min. Finally, slowly add the mixture to the cells and incubate on a shaker for 6–7 days. Shaker parameters: temperature 36.5℃, rotation speed: 110 rpm, CO2 concentration: 8%.

[0071] (2) Transfection of CHO-S cells with liposome reagent

[0072] Transfected target protein: EGFP;

[0073] Transfection molecules: pcDNA3.1-control, pcDNA3.1-UCOE, pcDNA 3.1-sineup, pcDNA 3.1-UCOE+sineup

[0074] Transfection experimental steps:

[0075] On the day of transfection, the cell density was adjusted to 5-6E^6 cells / mL with fresh culture medium. Transfection was performed using the Lipofectamine 3000 liposome kit (Invitrogen, catalog number L3000-015). The medium was changed 5 hours after transfection to reduce cytotoxicity.

[0076] Example 1: Detection of target protein

[0077] (1) TGF-Beta RII protein titer detection

[0078] Liquid chromatography analysis was performed using a Waters Alliance HPLC instrument and an AbSolut A (GALAK, B2120A107P) analytical column. Standards at concentrations of 0.1 mg / mL, 0.25 mg / mL, 0.5 mg / mL, 1.0 mg / mL, and 2 mg / mL were prepared, and peak area linearity was fitted to achieve a correlation coefficient R0. 2 Approximately 1. The three cell groups from Example 2 were used as experimental groups, and cells transfected with the original vector without modification were used as the control group. On day 6 post-transfection, the expression supernatant was collected, centrifuged, and filtered. The supernatant was analyzed by HPLC, and the protein expression level (Titer) was calculated based on the peak area. Three parallel experiments were set up for each group. The results are shown in Table 2, and the statistical results are shown in […]. Figure 4 The results showed that UCOE and sineup elements can enhance protein expression respectively, and the combination of UCOE and sineup elements can synergistically enhance the effect and further increase the transient expression level of the target protein.

[0079] Table 2 Protein Titer Data for Different Groups

[0080]

[0081] (2) Affinity determination of TGF-Beta RII protein using the Biocore method

[0082] Biacore affinity assays were performed using a GE 8K microarray with HBS-EP+ as the experimental buffer at 25°C. The ligand was diluted to 5 μg / mL and immobilized onto a Protein A chip at a flow rate of 10 μL / min for 20 s. The analyte hTGFβ1 was serially diluted to 0, 1, 3, 9, 27, and 81 nM at a flow rate of 30 μL / min, bound for 300 s, dissociated for 900 s, and regenerated with 10 mM Glycine-HCl (pH 1.5) at a flow rate of 100 μL / min for 30 s. This process was repeated once. Specific results are shown in Table 3. The results indicate that adding UCOE or Sineup elements alone or in combination to the vector did not significantly change the affinity for the target protein, suggesting that UCOE and Sineup elements have minimal impact on its functionality.

[0083] Table 3. Affinity data of the target protein TGFβRII

[0084] experimental group ka(1 / Ms) kd(1 / s) KD(M) Control 1.55E+05 2.16E-03 1.40E-08 UCOE 1.33E+05 2.85E-03 2.14E-08 Sineup 1.41E+05 2.03E-03 1.44E-08 UCOE+Sineup 1.28E+05 2.09E-03 1.63E-08

[0085] (3) Flow cytometry detection of EGFP protein: Cells were centrifuged at 1000 rpm for 5 min to remove the culture medium, resuspended in 200 μL phosphate-buffered saline (PBS), and EGFP fluorescence was detected by flow cytometry (Attune, model Nxt). The results are shown in the figure. Figure 5 Compared with the control group, UCOE and Sineup elements alone can also enhance EGFP fluorescence intensity, but their effect is not as significant as the combined effect of UCOE and Sineup.

[0086] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A transient expression vector, characterized in that, The transient expression vector contains both UCOE and SINEUP elements.

2. The transient expression vector of claim 1, wherein, The UCOE element contains the sequence shown in SEQ ID NO.

1.

3. The transient expression vector of claim 1, wherein, The SINEUP element comprises a binding domain and an effect domain, wherein the binding domain comprises the sequence shown in SEQ ID NO.2 or SEQ ID NO.

3.

4. The transient expression carrier according to claim 3, characterized in that, The effective domain contains the sequence shown in SEQ ID NO.

4.

5. The transient expression vector according to claim 4, characterized in that, The binding domain and the effect domain are connected by a linker, the sequence of which is shown in SEQ ID NO.

5.

6. The transient expression vector according to any one of claims 1-5, characterized in that, The transient expression vector also includes the target protein gene and the vector backbone.

7. The transient expression vector according to claim 6, characterized in that, The target protein may include secreted proteins or antibodies.

8. The transient expression vector according to claim 7, characterized in that, The target protein is either TGF-Beta RII protein or EGFP.

9. The transient expression vector according to claim 6, characterized in that, The vector backbone is a mammalian cell expression vector backbone, and the mammalian cell expression vector includes pcDNA3.1, PTT5, pCMV or pIRESpuro.

10. The transient expression carrier according to claim 1, characterized in that, The transient expression vector also contains a reporter gene or an antibiotic resistance gene.

11. The transient expression carrier according to claim 10, characterized in that, The reporter gene includes the gene for a fluorescent protein or a luciferase.

12. The transient expression carrier according to claim 11, characterized in that, The fluorescent protein includes GFP, RFP, YFP, or BFP; the luciferase includes firefly luciferase, Gaussia luciferase, Renida luciferase, or nano-luciferase.

13. The transient expression carrier according to claim 10, characterized in that, The antibiotic resistance genes include G418, puromycin, hygromycin B, bleomycin, or Norsmin.

14. A transfection method, characterized in that, The transient expression vector according to any one of claims 1-13 is used to transfect target cells with a transfection reagent.

15. The transfection method according to claim 13, characterized in that, The transfection reagents include PEI, liposome transfection reagents, or electrotransfection reagents.

16. The transfection method according to claim 13, characterized in that, The target cells are human cell lines, Chinese hamster cell lines, or rat cell lines.

17. The transfection method according to claim 16, characterized in that, The target cells are HEK293 cells, CHO cells, Vero cells, or HeLa cells.

18. The use of the transient expression vector according to any one of claims 1-13 or the transfection method according to any one of claims 14-17 in enhancing cellular protein expression.

Images