Process for converting a carbon source into glycolic acid

Abstract

This invention discloses a method for converting a carbon source into glycolic acid. The method includes: providing a plastid comprising the gene sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3; transfecting the plastid into a bacterial strain to obtain a modified bacterial strain; and providing the carbon source to the modified bacterial strain, enabling the modified bacterial strain to convert the carbon source into glycolic acid. The method disclosed in this invention can improve the yield of glycolic acid production using a fully biosynthetic approach.

Description

Technical Field

[0001] This invention relates to a method for converting a carbon source into glycolic acid, and more particularly to a method for converting a carbon source into glycolic acid using microorganisms. Background Technology

[0002] Glycolic acid (GA) is the smallest α-hydroxy acid, also known as glycolic acid or glycolic acid. Containing both carboxyl and hydroxyl groups, GA exhibits the dual properties of both carboxylic acids and alcohols, thus possessing characteristics such as easy degradation and absorption, strong water solubility, and high permeability. Furthermore, GA and its polymers exhibit excellent biodegradability and biocompatibility, being degraded and metabolized into water and carbon dioxide within the body and subsequently excreted. Therefore, GA has a wide range of applications. For example, GA and its polymers can be used to release peptides and proteins, or as pharmaceutical intermediates in the preparation of esters of menthol and quinine, and in the synthesis of other drugs. Glycolic acid oligomers or derivatives can be used as food additives, reducing the growth of harmful microorganisms through acidification.

[0003] In existing technologies, glycolic acid is mainly produced by chemical synthesis methods (such as formaldehyde cyanation, chloroacetic acid hydrolysis, and formaldehyde hydrohydroxylation). However, these chemical synthesis methods suffer from problems such as harsh reaction conditions, highly toxic raw materials, high costs, difficulties in subsequent separation, and environmental pollution. Therefore, the development of microbial enzymatic catalysis and total biosynthesis methods has gradually replaced chemical synthesis methods, becoming the main method for producing glycolic acid.

[0004] It is worth noting that microbial enzymatic catalysis requires toxic and expensive acetonitrile or hydroxyacetonitrile (ethanol nitrile) as raw materials, which cannot meet the needs of industrial production. The total biosynthesis method shows great promise in the glycolic acid production market, but its large-scale application is still limited by production volume. Therefore, overcoming these shortcomings through process improvement has become one of the important issues that this industry aims to address. Summary of the Invention

[0005] To address the aforementioned technical problems, one of the technical solutions adopted by this invention is to provide a method for converting a carbon source into glycolic acid, comprising: providing a plastid comprising gene sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3; transfecting the plastid into a bacterial strain to obtain a modified bacterial strain; and providing the carbon source to the modified bacterial strain so that the modified bacterial strain converts the carbon source into glycolic acid.

[0006] Furthermore, the strain is a Gram-negative bacterium.

[0007] Furthermore, the strain is Escherichia coli, Gluconobacter sp., Rhodococcus, or Oxidobacterium.

[0008] Furthermore, the carbon source is ethylene glycol.

[0009] Furthermore, the modified strain has the ability to produce alcohol dehydrogenase to convert ethylene glycol into glycolaldehyde.

[0010] Furthermore, the modified strain has the ability to produce aldehyde dehydrogenase to convert ethanolaldehyde into glycolic acid.

[0011] Furthermore, the modified strain has the ability to produce bacterial heme to increase the yield of glycolic acid.

[0012] Furthermore, the GC% of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3 is 50-60%.

[0013] To solve the above-mentioned technical problems, another technical solution adopted by the present invention is to provide a method for converting a carbon source into glycolic acid, which utilizes a modified strain to convert the carbon source into glycolic acid; wherein the modified strain includes the gene sequences of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.

[0014] Furthermore, the modified strain has the ability to produce alcohol dehydrogenase, aldehyde dehydrogenase, and bacterial heme.

[0015] One of the beneficial effects of the present invention is that the method for converting carbon sources into glycolic acid provided by the present invention can improve the yield of glycolic acid production by the whole biosynthesis method through the technical solutions of "converting carbon sources into glycolic acid using modified strains" and "the modified strains include the gene sequences of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3".

[0016] To further understand the features and technical content of the present invention, please refer to the following detailed description and drawings of the present invention. However, the drawings provided are for reference and illustration only and are not intended to limit the present invention. Attached Figure Description

[0017] Figure 1 This is a flowchart of the method for converting a carbon source into glycolic acid according to the present invention.

[0018] Figure 2This is a schematic diagram of the plasmid used in the present invention.

[0019] Figure 3 This is a schematic diagram comparing SEQ ID NO:1 of the present invention with the existing EGADH gene sequence.

[0020] Figure 4 is from Figure 4A and Figure 4B The composition is shown in the schematic diagram comparing SEQ ID NO:2 of the present invention with the existing EGA1DH gene sequence.

[0021] Figure 5 This is a schematic diagram comparing SEQ ID NO:3 of the present invention with the existing VHb gene sequence.

[0022] Figure 6 The graphs and charts show the conversion of glycolic acid in the first embodiment of the present invention.

[0023] Figure 7 The bar chart and graph show the conversion of glycolic acid in the second embodiment of the present invention.

[0024] Figure reference numerals: S10~S30: steps. Detailed Implementation

[0025] The following specific embodiments illustrate the implementation of the method for converting a carbon source into glycolic acid disclosed in this invention. Those skilled in the art can understand the advantages and effects of this invention from the content disclosed in this specification. This invention can be implemented or applied through other different specific embodiments, and various details in this specification can also be modified and changed based on different viewpoints and applications without departing from the concept of this invention. Furthermore, the accompanying drawings of this invention are for simple illustrative purposes only and are not depictions of actual dimensions; this is stated beforehand. The following embodiments will further describe the relevant technical content of this invention in detail, but the disclosed content is not intended to limit the scope of protection of this invention.

[0026] It should be understood that the term "or" as used herein may, as the context dictates, include any combination of one or more of the associated listed items. Unless the context otherwise requires, the term "comprising" should be understood to imply inclusion of one or more of the stated integers or steps, but does not exclude any other integer or step or any other set of integers or steps. In this specification, the terms "comprising," "containing," "including," or "having" are used interchangeably.

[0027] Please see Figure 1 and Figure 2As shown, the present invention provides a method for converting a carbon source into glycolic acid, comprising: step S10: providing a plastid, the plastid comprising gene sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3; step S20: transferring the plastid into a strain to obtain a modified strain; and step S30: providing a carbon source to the modified strain so that the modified strain converts the carbon source into glycolic acid. More specifically, prior to step S10, a step of synthesizing a DNA sequence may be included, by artificially synthesizing a gene encoding a sequence with recognition suitability for the target strain, so that the target strain can recognize and produce the corresponding substance. The present invention may involve artificially synthesizing a gene encoding a sequence with recognition suitability for Gram-negative bacteria. For example, the strain of the present invention may be Escherichia coli, Gluconobacter sp., Rhodococcus, or Oxidogenic bacteria. However, the examples given above are merely one possible embodiment and are not intended to limit the present invention.

[0028] In embodiments of the present invention, SEQ ID NO:1 is a gene encoding alcohol dehydrogenase (EGADH) or a gene having more than 80% sequence identity with SEQ ID NO:1 and having EGADH activity; SEQ ID NO:2 is a gene encoding aldehyde dehydrogenase (EGAlDH) or a gene having more than 80% sequence identity with SEQ ID NO:2 and having EGADH activity; SEQ ID NO:3 is a gene encoding vitreoscilla hemoglobin (VHb) or a gene having more than 80% sequence identity with SEQ ID NO:3 and having VHb activity.

[0029]

[0030] ACCGTTCTGGATTTCCGCAGCTAA; The sequence of SEQ ID NO: 2 is

[0031] ATGGCAAAAATTGAACAAATAGCTAAGAAATCCGATGCGACTCGCTTG

[0032] TCTCGTAGAAACTTTCTGATGACCGCGGCGGGTGCCGGACTGATGTTT

[0033] GGCTTCGCCCGTAAAGCAGGCGCGGCGACCACCTTGCCGTCCGCCATG

[0034] CCGCCTGAGGCGGCGTTCGAGCCCAACATTTGGTGTGCAATCGCACCT

[0035] GACGGATCCATTAACGTGAACATTGTGCGTGCTGAAATGGGCCAACAC

[0036] GTTGGTACCGCTCTGGCGCGAATCATTGCCGACGAGATGGATGCGGAC

[0037] TGGGATAAAATTAAGATTACCCAAGTTGACACCGCGCCGAAGTGGGCA

[0038] GGTAAATATGTTACCGGTGGCAGCTGGTCCGTCTGGGATACTTGGGAC

[0039] ACCTTCCGTCAAGCAGGCGCAGCTGCGAGGTCTGTGATGATTGAAGAA

[0040] GGTGCGAAGTTGCTCGGTACTACGCCAGATCGTTGTACCGCCCATGAA

[0041] AGCGTTGTTAGCGCAGGTTCGAAATCCATCTCGTTCGGTGATATCGTG

[0042] GCGCGCGCGAAGCCGACCCGCACATTTACCCCGGAGGAGATGGCGAA

[0043] GCTGCCGCTTAAGCCGACTGGAAACCGCCGTCTGATTAGCAAACAGGT

[0044] TCCGGCTCTCGATATCCCGGACAAGACGACCGGTAAGGCGATTTATGG

[0045] CATCGATGTTAAATTGGACGGCATGGTCTACGGTCGTCCGAAGATGCC

[0046] GCCAACTCGCTATGCGGCTAAGGTTATTAGCGTCGACGACAGTGCAGC

[0047] TAAGAAGATTCCGGGCTACCTGCGTTATGTGGTCCTGGACGACCCGTC

[0048] TGGTATTGTGCCGGGTTGGGTTGTGGCGCTCGCGAAAACCTACCCGGC

[0049] GGCGATCCGTGCGGCGGATGCCCTGAAAGTGCAGTGGAATCCGGGCCC

[0050] GACCATCAACGTCAGGCGAAGCAGATATCATCGAGCATGGTCGGAAGCT

[0051] GGCCGCTGACCCGAAGATGGTACCCGCGTTTTTAACGATAAGGGTGT

[0052] CGATGAGGCATTAACCATCCACCCGGGTCAGGTTTTTGAGCGCTCCTA

[0053] TACCTGCGCAAGCGTGGCCATTATCAGTTGGAGCCGGTCAATGCCGT

[0054] GGCTCGCCACATCGACGGCATGTGGGAAATTCACACCGGCAACCAGTG

[0055] GCAGAGCCTGATCCTGCCACAGCTGGCTAAGAGCCTGCAAGTTCCGGA

[0056] AGAGCAGGTGGTTATGCGTACCTACATGCTGGGCGGTGGCTTCGGCCG

[0057] TCGTTTAAACGGCGATTACTGCATTCCGGCGGCCCTGGCTTCAAAGGC

[0058] GATTGGCGGCGCCCCAGTTAAACTAATACTGACCCGTTCTGATGACAT

[0059] GGAACTGGACAGCATCCGTTCCCCGTCCATCCAAACGATCAAAGTGGC

[0060] GCTGGACAACGATCGTAAGAAAATCGTGGGTATGGACTACGTGGCGGT

[0061] GGCGGGCTGGCCTACGCAGGTGATGGCACCGGCATTCCTGGCGACCGG

[0062] CGAAGATGGCAAAAAGTACGATCCATTCGCTATCGCTGGCGCGGATCA

[0063] TTGGTATGAGACCGGTCCGACCCGTGTGCGCGCCATCAGCAATGACCT

[0064] GGCGAACGCAACGTTCCGCCCGGGTTGGCTGAGAAGCGTATCTGCAGG

[0065] TTGGACCCCGTGGGCATTGGAGTGCTTTCTGGACGAGTTGGCCCACAG

[0066] CACCAAACAAGATCCGCTGGCTTTCCGTCTTAGCATGTTCACCGCTCAA

[0067] GGTCGCAACGCGGGACAAGCACCGAACAGCGTCGGTGGCGCGAAACG

[0068] TCAGGCGGCGGTGCTGCAGCGTTTGGCCGACAAAATCGGTTACGCAAA

[0069] TAAACAACTGCCGGCGGACACCGGTATTGGTATCGCCACGTCCTTCGG

[0070] CCAAGAAAGAGGTATGCCCACTTGGACCGCTGCGGCGGCACAAATTCA

[0071] CGTGGACCGCAAAACCGGTGTTGTTACCTGCCAGAAACTGTGGCTGGT

[0072] TCTGGATGCGGGCACGATTGTAGATCCGGGTGGCGCTCTGGCGCAGAC

[0073] GGAGGGTGCGGCTTTATGGGGTTTCAGCATGGCATTGTTTGAAGGTAC

[0074] TGAGATCGTCAACGGCACGATCAAAGATCGTAATCTGAATACCTACAC

[0075] CCCGTTGCGTATTCCGGACGTTCCGGACATTGACATCGAGTTTATTCAG

[0076] AATACCGAAAAGCCGACCGGCCTCGGTGAACCGGGTGTAACGGTTGTT

[0077] GCTCCGGCTATTGGTAACGCGATCTTTAATGCGGTTGGAATTCGCTTGC

[0078] GCCACATGCCGATGCGTCCGGCTGACGTGCGTCGTGAACTGCAACAGC

[0079] ATACCAGCTAA; and the sequence of SEQ ID NO: 3 is

[0080] ATGCTAGATCAGCAAACAATTAATATAATAAAGGCGACGGTGCCGGTT

[0081] CTGAAAGAGCACGGCGTGACCATTACCACTACCTTTTACAAAAACTTG

[0082] TTTGCAAAACATCCGGAAGTTCGTCCGTTGTTCGACATGGGTCGCCAA

[0083] GAGAGCCTGGAACAGCCAAAGGCTCTGGCTATGACCGTTCTCGCGGCG

[0084] GCGCAAAATATTGAAAACCTGCCGGCAATTCTGCCGGCAGTTAAGAAG

[0085] ATCGCGGTGAAGCACTGCCAGGCGGGTGTGGCCGCCGCGCATTATCCG

[0086] ATCGTGGGTCAGGAGCTGCTGGGCGCAATCAAAGAGGTCTTGGGCGAC

[0087] GCTGCTACCGATGATATCTTAGATGCTTGGGGTAAAGCGTATGGCGTT

[0088] ATTGCAGACGTGTTCATCCAGGTTGAGGCCGACCTGTACGCGCAAGCG

[0089] GTCGAATAA.

[0090] Because each species is affected by different codons during the process of converting genes into proteins, although DNA can be converted into RNA, without a corresponding tRNA, the conversion of genes into proteins cannot be successfully completed. Therefore, this invention optimizes the coding sequences of EGADH, EGA1DH, and VHb to ensure that the artificially synthesized gene coding sequences are suitable for the target strain. In other words, the gene sequences of this invention have been optimized according to the corresponding tRNA of the target strain. Please refer to... Figure 3 , Figure 4A , Figure 4B and Figure 5 These are schematic diagrams comparing SEQ ID NO:1 of the present invention with the existing EGADH gene sequence, SEQ ID NO:2 of the present invention with the existing EGADH gene sequence, and SEQ ID NO:3 of the present invention with the existing VHb gene sequence, respectively. Figure 3 , Figure 4A , Figure 4B and Figure 5 In the diagram, the red text indicates the differences between the optimized sequence and the original sequence in this invention.

[0091] Furthermore, factors influencing codon optimization include differences in ribosome dwell time between sequences. Optimization of ribosome dwell time involves sequencing codons with shorter dwell times, meaning the ribosome does not terminate extremely long (translation speed-related) codons. These codons tend to have low GC ratios (GC%).

[0092] In embodiments of the present invention, the GC% of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3 are all 50-60%. Specifically, the original EGADH sequence and the optimized EGADH sequence are both 1032 bp in length, with the original EGADH sequence having a GC% of approximately 63.57% and the optimized EGADH sequence having a GC% of approximately 56.2%. The original EGA1DH sequence and the optimized EGA1DH sequence are both 2316 bp in length, with the original EGA1DH sequence having a GC% of approximately 64.77% and the optimized EGA1DH sequence having a GC% of approximately 56.87%. The original VHb sequence and the optimized VHb sequence are both 441 bp in length, with the original VHb sequence having a GC% of approximately 45.35% and the optimized VHb sequence having a GC% of approximately 52.83%.

[0093] Since the bond between AT and GC is primarily a hydrogen bond, a higher bond energy results in greater stability during replication, leading to a lower error rate. In other words, GC% is related to the stability of subsequent gene replication and gene conversion into protein. As can be seen from the foregoing, the specific GC% of the gene sequence optimized in this invention helps to balance ribosome dwell time with the stability of transcription and translation.

[0094] In step S20, the plasmids are transferred into the bacterial strain using methods such as gene gun, electroporation, microinjection, and chemical transfer. Electroporation or chemical transfer is preferred. Electroporation involves applying a current to the bacterial strain for a very short time (microseconds to milliseconds), placing it in a high-voltage, low-capacitance environment. This creates a potential difference in the cell membrane, altering its structure and causing it to compress and thin, resulting in numerous tiny pores that allow the plasmids to pass through the cell membrane and enter the bacterial cell. In embodiments of the present invention, electroporation is preferably performed at a voltage of 0.5 kV for 10 mSec, more preferably at 1.5 kV for 5 mSec, and even more preferably at 1.0 kV for 5 mSec to obtain the maximum colony count. In another embodiment of the invention, the electroporation method can be performed using a MicroPulser Electroporator, following the BIORAD standard procedure (section 5, high-efficiency electroporation of E. coli).

[0095] Chemical transfection utilizes vectors carrying plasmids to allow foreign genes to enter cells via direct transmembrane penetration or membrane fusion. For example, the vector can be a liposome encapsulating foreign DNA. After being placed in a cell, the liposome integrates into the cell membrane, releasing the foreign DNA into the cell. Therefore, in this invention, the modified strain can produce at least alcohol dehydrogenase and aldehyde dehydrogenase, and a single strain can be used to convert a carbon source into glycolic acid.

[0096] In step S30, a carbon source is provided to the modified strain so that the strain converts the carbon source into glycolic acid. In this invention, the carbon source can be ethylene glycol. Specifically, the ethylene glycol can be derived from ethylene glycol produced by the modified blue-green bacteria converting carbon dioxide, ethylene glycol produced by the recycling and degradation of PET (degradation with ethylene glycol can break down waste PET into dimethyl terephthalate and ethylene glycol), and ethylene glycol produced by any chemical process.

[0097] Furthermore, the modified strain of the present invention can produce alcohol dehydrogenase and aldehyde dehydrogenase, thereby converting ethylene glycol into glycolaldehyde, and further converting glycolaldehyde into glycolic acid. The process of converting ethylene glycol into glycolic acid using the modified strain of the present invention is shown in the following general formula 1.

[0098]

[0099] First Embodiment

[0100] In the first embodiment of the present invention, *Escherichia coli* was used as the strain for modification. The constructed plasmids pAAL-122 and pAALV-122 were chemically transformed into the *E. coli* host *E. coli* DH5α. The difference between pAAL-122 and pAALV-122 is that pAAL-122 does not contain the VHb gene sequence. Subsequently, the strains were screened using antibiotics (30 mg / mL kanamycin LB solid medium) to identify the modified strains (SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3) that had successfully undergone homologous exchange. The single strains selected in the solid medium were placed in 4 mL of LB + kanamycin culture medium and cultured at 37°C with shaking at 170 rpm. The initial strain concentration (OD) was adjusted the following day. 600 The concentration (OD) of the strain was approximately 0.05. The strain was then cultured in 50 mL of medium, and samples were taken over time to analyze the OD concentration. 600 After the strain reached the early logarithmic growth phase (24 hours), 50 g / L ethylene glycol was added for a transformation test, and the conversion amount of glycolic acid was analyzed by HPLC. The results are as follows: Figure 6 As shown.

[0101] Second Embodiment

[0102] In the second embodiment of the present invention, *Gluconobacter sp.* was used as the strain for modification. The constructed plastids pAAL-122 and pAALV-122 were transformed into *Gluconobacter sp.* using electroporation. The strains were screened using 5 mg / mL kanamycin YPS solid medium (yeast extract 5 g / L, peptone 3 g / L, sorbitol 60 g / L, (NH4)2SO4 5 g / L, MgSO4·7H2O 5 g / L). Single strains selected from the solid medium were placed in 4 mL of YPS + kanamycin culture medium and cultured at 28°C with shaking at 170 rpm. The initial strain concentration (OD) was adjusted the following day. 600 The concentration (OD) of the strain was approximately 0.05. The strain was then cultured in 50 mL of medium, and samples were taken over time to analyze the OD concentration. 600 A conversion experiment was conducted by adding 50 g / L ethylene glycol after 24 hours, and the conversion amount of glycolic acid was analyzed by HPLC. The results are as follows: Figure 7 As shown.

[0103] It is worth mentioning that the modified strain of this invention has the ability to produce bacterial heme, as shown in Table 1 below. By transfecting the heme protein gene (VHb), the expression levels of EGADH and EGA1DH in the strain can be increased, thereby improving the yield of ethylene glycol to glycolic acid. In this document, yield refers to the amount of product that can be converted per liter of culture medium per unit time; conversion rate refers to the number of moles produced by conversion / the number of moles of initial feedstock. Unless otherwise specified, %, as mentioned herein, refers to mole percentage.

[0104] Table 1

[0105]

[0106] plasmid pAAL-122: possesses EGADH and EGA1DH, but lacks VHb.

[0107] plasmid pAALV-122: contains EGADH, EGA1DH and VHb.

[0108] Beneficial effects of the embodiments

[0109] One of the beneficial effects of the present invention is that the method for converting carbon sources into glycolic acid provided by the present invention can improve the yield of glycolic acid production by the whole biosynthesis method through the technical solutions of "converting carbon sources into glycolic acid using modified strains" and "the modified strains include the gene sequences of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3".

[0110] Furthermore, the modified strains of the present invention can increase the expression levels of EGADH and EGA1DH by transfecting the heme protein gene (VHb), thereby increasing the yield of ethylene glycol to glycolic acid.

[0111] The content disclosed above is only a preferred and feasible embodiment of the present invention, and is not intended to limit the scope of protection of the claims of the present invention. Therefore, all equivalent technical changes made based on the content of the present invention specification and drawings are included within the scope of protection of the claims of the present invention.

Claims

1. A method for converting a carbon source into glycolic acid, characterized in that, The method for converting the carbon source into glycolic acid includes: Provide plasmids, said plasmids comprising gene sequences of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3; The plasmids were transferred into the strain to obtain a modified strain; and The modified strain is provided with the carbon source so that it converts the carbon source into glycolic acid.

2. The method according to claim 1, characterized in that, The strain is a Gram-negative bacterium.

3. The method according to claim 1, characterized in that, The strains are Escherichia coli, Gluconobacter sp., Rhodococcus, or Oxidobacterium.

4. The method according to claim 1, characterized in that, The carbon source is ethylene glycol.

5. The method according to claim 4, characterized in that, The modified strain has the ability to produce alcohol dehydrogenase to convert ethylene glycol into ethanolaldehyde.

6. The method according to claim 5, characterized in that, The modified strain has the ability to produce aldehyde dehydrogenase to convert ethanolaldehyde into glycolic acid.

7. The method according to claim 1, characterized in that, The modified strain has the ability to produce bacterial heme, thereby increasing the yield of glycolic acid.

8. The method according to claim 1, characterized in that, The GC% of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 are all 50-60%.

9. A method for converting a carbon source into glycolic acid, characterized in that, The method for converting a carbon source into glycolic acid utilizes a modified strain to convert the carbon source into glycolic acid; wherein the modified strain includes the gene sequences of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:

3.

10. The method according to claim 9, characterized in that, The modified strain has the ability to produce alcohol dehydrogenase, aldehyde dehydrogenase and bacterial heme.

Images