Application of carvacol combined with astragaloside in preparation of medicine for treating endometritis
The combined use of carvacrol and astragaloside A has solved the problem of increased antibiotic resistance in the treatment of endometritis, achieving safe and effective drug treatment and significantly reducing inflammatory response and oxidative stress damage.
Patent Information
- Application Number
- CN202610706881.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-21
- Publication Date
- 2026-07-03
AI Technical Summary
In current technology, the treatment of endometritis mainly relies on antibiotic therapy, but long-term use leads to increased antibiotic resistance. There is limited research on the combined use of traditional Chinese medicine ingredients, and there is a lack of effective natural alternatives.
The combination of carvacrol and astragaloside A, two traditional Chinese medicine components, works synergistically to exert antibacterial and anti-inflammatory effects by inhibiting bacterial growth, regulating immune function, and antioxidative reactions, and is used to prepare a drug for treating endometritis.
It significantly reduces body temperature and weight in mice, alleviates tissue congestion and edema, downregulates pro-inflammatory factors, increases anti-inflammatory factors, relieves oxidative stress damage, and provides a safe treatment option without drug resistance.
Smart Images

Figure CN122320977A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, and in particular to the application of carvacrol combined with astragaloside A in the preparation of drugs for treating endometritis. Background Technology
[0002] Endometritis is a common disease in the livestock industry, affecting not only the reproductive performance of animals but also causing decreased milk production and increased culling rates. Currently, antibiotic therapy is commonly used to treat endometritis, but long-term use can lead to increased antibiotic resistance. Many traditional Chinese medicine components, such as carvacrol, berberine, astragaloside A, baicalin, and tanshinone IIA, possess certain antibacterial, anti-inflammatory, and antioxidant activities. Current research on Chinese medicine components for treating endometritis mainly focuses on the use of individual drugs, with limited research on the combined use of Chinese medicine components. Therefore, research on the combined use of Chinese medicine components against *Ralstonia pinnatifida* (…) is needed. R.pickettii Research on the therapeutic effects and mechanisms of induced endometritis is of great theoretical and practical significance for expanding the application prospects of traditional Chinese medicine components in the prevention and treatment of endometritis and reducing the economic losses caused by this disease. Summary of the Invention
[0003] The purpose of this invention is to provide the application of carvacrol combined with astragaloside A in the preparation of drugs for treating endometritis. This study selected five extracts of traditional Chinese medicine (carvacrol, berberine, astragaloside A, baicalin, and tanshinone IIA) as experimental materials to explore their effects on... R.pickettii The therapeutic effects and mechanisms of inducing endometritis in mice were investigated, thus providing a new strategy for "antibiotic reduction and antibiotic replacement".
[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides the application of carvacrol combined with astragaloside A in the preparation of drugs for treating endometritis.
[0005] Preferably, the concentration of carvacrol in the drug for treating endometritis is 0.007~0.3 mg / mL, and the concentration of astragaloside A in the drug for treating endometritis is 0.2~10 mg / mL.
[0006] This invention also provides a method for constructing a mouse endometritis model, comprising the following steps: The concentration for intrauterine perfusion in mice was 1×10 7 ~1×10 9 CFU / mL of Ralstonia pinnili ( R.pickettii ) 。
[0007] Preferably, the perfusion frequency is 1 to 3 times / day, the perfusion volume is 90 to 110 μL / day, and the perfusion duration is 6 to 8 days.
[0008] The present invention also provides a set of indicators for detecting endometritis in mice, wherein the indicators are any one or more of the following: body temperature, body weight, uterine index, inflammatory factor content, oxidative stress indicators, inflammatory factor mRNA expression level, and MAPK signaling pathway protein expression level.
[0009] Preferably, the method for determining the expression level of inflammatory factor mRNA includes the following steps: (1) Total RNA was extracted from uterine tissue samples and reverse transcribed to obtain cDNA; (2) Using cDNA as a template, qRT-PCR was performed to obtain the relative gene expression levels of inflammation-related factors in the sample.
[0010] Preferably, the inflammatory-related factor is one or more of TNF-α, IL-1β, IL-6, and IL-10; the qRT-PCR also uses GAPDH Genes are used as internal reference genes.
[0011] Preferably, the CDS nucleotide sequence of the TNF-α is shown in SEQ ID NO:1, the CDS nucleotide sequence of the IL-1β is shown in SEQ ID NO:2, the CDS nucleotide sequence of the IL-6 is shown in SEQ ID NO:3, and the CDS nucleotide sequence of the IL-10 is shown in SEQ ID NO:4. GAPDH The CDS nucleotide sequence is shown in SEQ ID NO:5.
[0012] Preferably, the nucleotide sequence of the forward primer of SEQ ID NO:1 is as shown in SEQ ID NO:6, and the nucleotide sequence of the reverse primer of SEQ ID NO:1 is as shown in SEQ ID NO:7; the nucleotide sequence of the forward primer of SEQ ID NO:2 is as shown in SEQ ID NO:8, and the nucleotide sequence of the reverse primer of SEQ ID NO:2 is as shown in SEQ ID NO:9; the nucleotide sequence of the forward primer of SEQ ID NO:3 is as shown in SEQ ID NO:10, and the nucleotide sequence of the reverse primer of SEQ ID NO:3 is as shown in SEQ ID NO:11; the nucleotide sequence of the forward primer of SEQ ID NO:4 is as shown in SEQ ID NO:12, and the nucleotide sequence of the reverse primer of SEQ ID NO:4 is as shown in SEQ ID NO:13; the nucleotide sequence of the forward primer of SEQ ID NO:5 is as shown in SEQ ID NO:14, and the nucleotide sequence of the reverse primer of SEQ ID NO:5 is as shown in SEQ ID NO:15.
[0013] The beneficial effects of this invention are as follows: This invention demonstrates that carvacrol combined with astragaloside IV has significant therapeutic benefits against Ralstonia pinnatifida-induced endometritis in mice: the two drugs exhibit synergistic antibacterial effects, rapidly reducing body temperature and slowing weight loss in mice, significantly decreasing uterine index, alleviating tissue congestion and edema, and significantly downregulating pro-inflammatory factors such as TNF-α, IL-1β, and IL-6 while upregulating the anti-inflammatory factor IL-10, thus inhibiting excessive activation of inflammatory signals; simultaneously, it reduces MDA, increases SOD and GSH levels, and alleviates oxidative stress damage. Therefore, the combination of carvacrol and astragaloside IV in this invention can effectively repair the pathological structure of the uterus, with superior effects compared to single drugs, and is safe and without significant toxicity, providing a safe and drug-resistant natural alternative for endometritis in livestock. Attached Figure Description
[0014] Figure 1 The effects of carvacrol combined with astragaloside A on body temperature and body weight in diseased mice were investigated. The control group consisted of PBS at pH 7.2; the carvacrol group consisted of 1 MIC carvacrol; the astragaloside A group consisted of 1 MIC astragaloside A; the low-dose combination group consisted of 1 / 8 MIC carvacrol and 1 / 8 MIC astragaloside A; the medium-dose combination group consisted of 1 / 4 MIC carvacrol and 1 / 4 MIC astragaloside A; the high-dose combination group consisted of 1 / 2 MIC carvacrol and 1 / 2 MIC astragaloside A; and the positive control group consisted of 0.005 mg / mL. -1Tetracycline solutions. The same lowercase letter indicates no significant difference (P>0.05, Duncan's tests), different lowercase letters indicate significant differences (P<0.05, Duncan's tests). The same uppercase letter indicates no significant difference (P>0.01, Duncan's tests), different uppercase letters indicate extremely significant differences (P<0.01, Duncan's tests), and the same applies below. Figure 2 The effect of carvacrol combined with astragaloside A on the uterine index in diseased mice; Figure 3 HE staining results of uterine tissue, including (A) blank control group; (B) model group; (C) carvacrol group; (D) astragaloside A group; (E) combined low-dose group; (F) combined medium-dose group; (G) combined high-dose group; (H) positive control group; Figure 4 The effect of carvacrol combined with astragaloside A on the content of inflammation-related cytokines in the uterine tissue of diseased mice was investigated. Among them, (A) TNF-α represents tumor necrosis factor-α; (B) IL-6 represents interleukin-6; (C) IL-1β represents interleukin-1β; (D) IL-10 represents interleukin-10, and the same applies below. Figure 5 The effect of carvacrol combined with astragaloside A on the mRNA expression of inflammation-related cytokines (TNF-α, IL-1β, IL-6 and IL-10) in the uterine tissue of diseased mice; Figure 6 The effect of carvacrol combined with astragaloside A on oxidative stress in the uterine tissue of diseased mice was investigated. (A) MDA represents malondialdehyde; (B) SOD represents superoxide dismutase; and (C) R-GSH represents reduced glutathione. Figure 7 The effect of carvacrol combined with astragaloside A on MAPK signaling pathway-related proteins in the uterine tissue of diseased mice was investigated. In Figure (A), A is the blank control group, B is the model group, C is the carvacrol group, D is the astragaloside A group, E is the combined low-dose group, F is the combined medium-dose group, G is the combined high-dose group, and H is the positive control group. Detailed Implementation
[0015] This invention provides the application of carvacrol combined with astragaloside A in the preparation of drugs for treating endometritis.
[0016] In this invention, the concentration of carvacrol in the drug for treating endometritis is preferably 0.007~0.3 mg / mL, more preferably 0.0078125~0.25 mg / mL, even more preferably 0.0015625~0.125 mg / mL, even more preferably 0.003125~0.0625 mg / mL, and the concentration of astragaloside A in the drug for treating endometritis is preferably 0.2~10 mg / mL, more preferably 0.25~8 mg / mL, even more preferably 0.5~4 mg / mL, even more preferably 1~2 mg / mL.
[0017] This invention also provides a method for constructing a mouse endometritis model, comprising the following steps: The concentration for intrauterine perfusion in mice was 1×10 7 ~1×10 9 CFU / mL R.pickettii.
[0018] In this invention, the concentration of the infusion is further preferably 1×10⁻⁶. 8 The perfusion rate is CFU / mL, the perfusion frequency is preferably 1 to 3 times / day, more preferably 1 time / day, the perfusion volume is preferably 90 to 110 μL / day, more preferably 95 to 105 μL / day, even more preferably 100 μL / day, and the perfusion duration is preferably 6 to 8 days, more preferably 7 days.
[0019] Research progress on the pharmacological effects of carvacrol
[0020] Carvacrol (also known as carawayol) is a small, natural monoterpene phenol that is mainly found in the essential oils of aromatic plants in the Lamiaceae family, especially in oregano. Origanum vulgare L.) and thyme ( Thymus mongolicus Carvacrol is found in high concentrations in essential oils such as Ronniger, and studies have shown that carvacrol has strong antibacterial, anti-inflammatory, and antioxidant activities.
[0021] In terms of antibacterial activity, carvacrol exhibits strong inhibitory effects against various Gram-positive and Gram-negative pathogens, including Staphylococcus aureus, methicillin-resistant Staphylococcus aureus, and Escherichia coli. Its mechanisms are mainly related to disrupting cell membrane integrity, altering cell membrane permeability, inhibiting biofilm formation, and interfering with the quorum sensing system. Furthermore, it can produce synergistic effects when used in combination with some antibiotics. Regarding anti-inflammatory effects, current research shows that carvacrol can reduce the levels of inflammatory mediators such as tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), interleukin-6 (IL-6), and iNOS. It also alleviates inflammatory responses by regulating related signaling pathways such as mitogen-activated protein kinase (MAPK), thus demonstrating a protective effect in various inflammatory injury models.
[0022] In terms of antioxidant activity, carvacrol possesses strong free radical scavenging capabilities, can reduce lipid peroxidation levels, and to some extent enhance antioxidant defense indicators such as superoxide dismutase (SOD), CAT, GPx, and L-glutathione reduced (R-GSH). Its mechanism of action may be related to the activation of Nrf2 / HO-1 and other related signaling pathways, enhancing the body's antioxidant defense system function, thereby alleviating cell and tissue damage caused by oxidative stress. Given carvacrol's multiple biological activities, including antibacterial, anti-inflammatory, and antioxidant properties, it has certain application value in drug development, food preservation, and functional formulation research. However, overall, research on its pharmacokinetic characteristics, bioavailability, and clinical translational effects is still insufficient and requires further in-depth investigation.
[0023] Research progress on the pharmacological effects of astragaloside A
[0024] The main source of astragaloside A (also known as astragaloside IV) is the legume Astragalus membranaceus (Astragalus membranaceus). Astragalus membranaceus (Fisch.) Bunge contains cycloatunane-type triterpenoid saponins. Many studies have shown that their pharmacological effects mainly focus on immunomodulation, anti-inflammation, and synergistic effects.
[0025] In terms of immunomodulation, astragaloside A can promote the proliferation of T lymphocytes and B lymphocytes and antibody production, and maintain immune homeostasis by regulating the function of macrophages, dendritic cells, and T cell subsets. Simultaneously, it can restore the Th17 / Treg cell balance in pathological models such as enteritis, indicating a significant bidirectional immunomodulatory function. Regarding anti-inflammation, current research shows that astragaloside A can reduce inflammatory damage in the intestines, lungs, cardiovascular system, and other tissues by downregulating the expression of pro-inflammatory factors such as IL-1β, IL-6, TNF-α, and IL-18, and inhibiting the activation of related signaling pathways such as MAPK, NF-κB, and NLRP3 inflammasomes. In terms of synergistic effects, astragaloside A can not only be combined with active ingredients of traditional Chinese medicine such as astragalus and Panax notoginseng, exhibiting synergistic protective effects across multiple targets and pathways, but can also be used in combination with some chemical drugs, showing good effects in reducing toxicity and enhancing efficacy, improving therapeutic sensitivity, and improving the inflammatory microenvironment. Overall, astragaloside A possesses both immunomodulatory and anti-inflammatory advantages and has good prospects for development as a combination drug.
[0026] Synergistic effect of carvacrol and astragaloside A
[0027] The combined use of carvacrol and astragaloside IV exhibits significant synergistic antibacterial and anti-inflammatory effects, primarily through multiple molecular mechanisms. In terms of antibacterial activity, carvacrol inhibits bacterial growth by disrupting the integrity of the bacterial cell membrane, increasing cell permeability, and causing leakage of intracellular substances. Astragaloside IV enhances the host's resistance to infection by regulating the body's immune function and increasing the activity of macrophages and T lymphocytes. In contrast, carvacrol primarily exerts its antibacterial effect by directly inhibiting the growth of pathogens; therefore, the two have a certain degree of complementarity in their mechanisms of action. When used in combination, the direct antibacterial effect of carvacrol and the immunomodulatory effect of astragaloside IV may work synergistically, thus demonstrating a certain advantage in inhibiting multidrug-resistant bacteria.
[0028] In terms of anti-inflammatory mechanisms, both carvacrol and astragaloside A are closely related to the regulation of the MAPK signaling pathway. Carvacrol can reduce the release of inflammatory factors such as TNF-α, IL-1β, and IL-6 by inhibiting the abnormal activation of key signaling molecules such as p38 mitogen-activated protein kinase (p38), extracellular signal-regulated kinase (ERK) 1 / 2, and c-Jun N-terminal kinase (JNK), thereby alleviating inflammatory responses and tissue damage. Astragaloside A also participates in the regulation of the MAPK signaling pathway and plays an important role in anti-inflammatory and immunomodulatory processes. Studies have shown that astragaloside A can inhibit excessive inflammatory responses and promote the restoration of inflammatory balance in the body by regulating the activation state of signaling molecules such as ERK1 / 2, p38, and JNK. When used in combination with carvacrol, the two may enhance the combined antibacterial and anti-inflammatory effects through synergistic intervention at different stages of the MAPK pathway. Specifically, this combined effect helps to suppress excessive inflammatory signals mediated by p38 and JNK, and may also improve the functional state of immune cells to some extent, thereby enhancing the host's ability to respond to infection and inflammatory damage.
[0029] Furthermore, carvacrol can play a role in alleviating MAPK-related cell damage by regulating antioxidant enzyme activity and reducing oxidative stress; astragaloside A can further enhance the overall anti-inflammatory effect by improving the immune microenvironment, promoting tissue repair, and regulating immune responses. Therefore, the combined use of these two products may exert synergistic effects through multiple mechanisms such as antibacterial, anti-inflammatory, antioxidant, and immunomodulatory mechanisms, and has certain research value and application potential in the prevention and treatment of bacterial infections and chronic inflammatory diseases.
[0030] MAPK signaling pathway and endometritis
[0031] The MAPK signaling pathway is a crucial molecular network in the inflammatory response of endometritis. Current research suggests that it primarily participates in the amplification of inflammation, cell damage, and tissue remodeling following pathogen stimulation through branches such as ERK, JNK, and p38. Chronic endometritis is essentially a persistent inflammatory state closely related to microbial infection, immune imbalance, and impaired endometrial receptivity, and the MAPK pathway serves as a vital link between these pathological changes and the expression of downstream inflammatory factors. In mechanistic studies, stimulation by lipopolysaccharide (LPS) or mixed bacteria significantly activates the phosphorylation of MAPK-related proteins such as p38 and ERK1 / 2 in endometrial tissue or endometrial epithelial cells, accompanied by elevated levels of pro-inflammatory factors such as TNF-α, IL-1β, IL-6, and IL-8, suggesting that the MAPK pathway is involved in the occurrence of endometritis and the amplification of the inflammatory cascade.
[0032] Further research revealed that MAPK signaling not only regulates acute inflammatory responses but is also closely related to EMT, cell migration, and fibrosis progression following persistent endometritis. For example, XBP1s can promote p38 and ERK1 / 2 phosphorylation by targeting MAP3K2, thereby exacerbating LPS-induced EMT in goat endometrial epithelial cells. However, this process can be significantly reversed after using the MAPK / ERK inhibitor PD98059.
[0033] In addition, the protective effects of various natural active ingredients in endometritis models are often manifested as the joint inhibition of the NF-κB / MAPK axis. That is, while reducing histopathological damage, they also reduce TLR2 / TLR4 expression, inhibit the phosphorylation of MAPK-related proteins, and downregulate the levels of pro-inflammatory cytokines. This further illustrates that the MAPK pathway is not only one of the important pathogenic mechanisms of endometritis, but also a potential intervention target.
[0034] Therefore, research on the relationship between the MAPK signaling pathway and endometritis has gradually expanded from "inflammatory activation" to the overall pathological process of "immune imbalance - barrier damage - tissue remodeling". However, the specific roles and clinical translational value of its different branches in acute and chronic endometritis still need further in-depth research.
[0035] The abbreviations used in this invention are explained below: ERK: Extracellular signal-regulated kinase; FICI: Fractional inhibitory concentration index; IL-1β: Interleukin-1β; IL-6: Interleukin-6; IL-10: Interleukin-10; JNK: c-JUN N-terminal kinase; MAPK: Mitogen-activated protein kinase; MBC: Minimum bactericidal concentration; MDA: Malondialdehyde; MIC: Minimum inhibitory concentration; R-GSH: Reduced glutathione; SOD: Superoxide dismutase; TNF-α: Tumor necrosis factor-α; P-p38: Phosphorylated p38 mitogen-activated protein kinase; p38: p38 mitogen-activated protein kinase; P-JNK: Phosphorylated c-JUN N-terminal kinase; P-ERK: Phosphorylated extracellular signal-regulated kinase.
[0036] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0037] Example 1
[0038] 1. Test materials
[0039] 1.1 Test animals and strains
[0040] 8-week-old SPF-grade female Kunming mice, purchased from Spf (Beijing) Co., Ltd., license number: SCXK(Beijing)2024-0001; R.pickettii (186282), purchased from North China National Innovation Link Biotechnology Co., Ltd. in the mall.
[0041] 1.2 Main reagents and drugs
[0042] Carvacrol, berberine, astragaloside, baicalin, tanshinone IIA were purchased from Shanghai Macklin Biochemical Co., Ltd., total RNA extraction reagent was purchased from Promega (Beijing) Biotechnology Co., Ltd., reverse transcription kit, qRT-PCR kit were purchased from Beijing Jinsha Biotechnology Co., Ltd., TNF-α, IL-1β, IL-6, IL-10 ELISA detection kits were purchased from Shanghai Enzyme-linked Biotechnology Co., Ltd., micro-reduced glutathione, superoxide dismutase, malondialdehyde detection kits were purchased from Nanjing Jiancheng Biotechnology Co., Ltd., rabbit-derived P-p38, p38, P-JNK1, JNK1, P-ERK1, rabbit-derived ERK1, β-Actin primary antibodies were purchased from Hangzhou Deg Biotechnology Co., Ltd., biotin-labeled goat anti-rabbit IgG (H+L) was purchased from Beijing Biosynthesis Biotechnology Co., Ltd.
[0043] 2. Test methods
[0044] 2.1 Establish a mouse endometritis model
[0045] (1) R.pickettiiPreparation of bacterial culture
[0046] After the activation of the strain is completed, select R.pickettii Pure bacterial colonies were inoculated into 10 mL of NB medium and incubated at 30°C for 16 h. After plate counting, the bacterial culture was serially diluted to 1×10⁻⁶. 8 CFU·mL -1 1×10 7 CFU·mL -1 1×10 6 CFU·mL -1 and 1×10 5 CFU·mL -1 Store at 4℃ for later use.
[0047] (2) R.pickettii Establishment of a mouse model of induced endometritis
[0048] Thirty 8-week-old female Kunming mice were used as experimental animals and were routinely acclimatized for one week before the formal experiment. The mice were randomly divided into 5 groups: blank group, low concentration group, low-to-medium concentration group, medium-to-high concentration group, and high concentration group, with 6 mice in each group. The uterus was perfused with 0 and 1 × 10⁻⁶ mice, respectively. 5 1×10 6 1×10 7 1×10 8 of R.pickettii 0.1 mL of bacterial culture was administered once daily for 7 consecutive days. Mice's body temperature and weight were measured daily; their mental state, coat condition, and uterine secretions were observed. On day 8, mice were euthanized, and the uterus was harvested for histopathological examination.
[0049] 2.2 Screening of in vitro antibacterial activity of traditional Chinese medicine extracts
[0050] (1) Preparation of Chinese herbal extract solutions
[0051] Accurately weigh 6.4 g each of astragaloside A, berberine, tanshinone IIA, and baicalin, and accurately weigh 6.246 mg of carvacrol. Prepare the above drugs into formulations with concentrations of 128, 64, 32, 16, 8, 4, 2, 1, 0.5, 0.25, and 0.125 mg / mL using standard methods. -1 The prepared solution should be stored at 4°C for later use.
[0052] (2) The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of each drug were determined by the tube dilution method.
[0053] The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the drug were determined using the tube dilution method. Eleven test tubes were used, and NB medium and a series of drug solutions of varying concentrations were added to achieve final concentrations ranging from 64 to 0.0625 mg / mL. - ¹. Vaccinate with 1×10 6 CFU·mL - ¹0.1 mL of bacterial suspension, with a negative control (bacterial suspension + NB + sterile water), at 37℃ and 180 r·min - ¹Incubate for 24 h. A blank control was also set up for plating: 100 μL of culture was inoculated onto NA plates and incubated at 30°C for 16 h, recording the colony count. The highest concentration with fewer colonies than the negative control but more than the blank control was defined as the MIC; the lowest concentration with fewer than 5 colonies or no growth was defined as the MBC. The obtained MIC and MBC were used for subsequent experiments.
[0054] 2.3 Screening of combination drug regimens
[0055] (1) Comparison of in vivo efficacy of different combined drugs
[0056] Prepare 1×10 8 CFU·mL - ¹Bacterial culture. Take 4 test tubes and add 0.25 mg·mL⁻¹ to each. - ¹Carvacrol 5 mL, then add an equal volume of 8 mg·mL⁻¹ - ¹Astragaloside A, 8 mg·mL - ¹Berberine, 16 mg·mL - ¹Baicalin, 8 mg·mL - ¹Tanshinone IIA, mixed well and ready for use. Thirty mice were randomly divided into a model group and four combination drug groups (carvacrol combined with berberine, astragaloside A, baicalin, and tanshinone IIA, respectively), with six mice in each group. All mice were intrauterinely infused with 100 μL of bacterial solution once daily for 7 days; from day 8 onwards, the corresponding drugs were infused according to Table 4 once daily for 3 days. Body temperature and weight were recorded on days 1, 8, 9, 10, and 11, and mental status, coat, and uterine secretions were observed.
[0057] (2) Synergistic antibacterial activity of carvacrol combined with astragaloside A in vitro
[0058] The fractional inhibitory concentration index (FICI) of carvacrol and astragaloside A combined was determined using the checkerboard method. The test concentrations of carvacrol were 1 / 16, 1 / 8, 1 / 4, 1 / 2, 1, and 2 MICs (concentrations of 0.0078125, 0.015625, 0.03125, 0.0625, 0.125, and 0.25 mg·mL, respectively). -1), the test concentrations of astragaloside IV were 1 / 16, 1 / 8, 1 / 4, 1 / 2, 1, and 2 MIC (the concentrations were 0.25, 0.5, 1, 2, 4, and 8 mg·mL -1 ). Prepare carvacrol solution and astragaloside IV solution at 4 MIC respectively, and serially dilute them to the above concentrations with two-fold dilution. Add 50 μL of each of the two drugs to each well. Add 1×10 8 CFU·mL -1 bacterial suspension 100 μL to each well, and incubate in an incubator at 30 °C for 16 h. The positive control group adds 100 μL of 1×10 8 CFU·mL -1 bacterial suspension and 100 μL of sterile distilled water, and the negative control group adds 100 μL of NB solution and 100 μL of sterile distilled water. The lowest drug concentration without visible bacterial growth to the naked eye is the minimum inhibitory concentration of the drug, and conduct 3 repeated experiments. The judgment criteria for the interaction of FICI: when FICI ≤ 0.5, it indicates a synergistic effect; when 0.5 < FICI ≤ 1, it indicates an additive effect; when 1 < FICI ≤ 2, it indicates no effect; when 2 < FICI, it indicates an antagonistic effect.
[0059] (3) Screening of the concentration gradient of combined use of carvacrol and astragaloside IV
[0060] Randomly divide 36 mice into 6 groups, and name them model group, combined drug use group A, combined drug use group B, combined drug use group C, combined drug use group D, and combined drug use group E, with 6 mice in each group.灌注 1×10 8 CFU·mL -1 bacterial suspension 100 μL into the uterus of all mice once a day for 7 consecutive days. Starting from the 8th day, perform perfusion according to Table 1 once a day for 3 consecutive days. Detect and record the body temperature and body weight of the mice on the 1st, 8th, 9th, 10th, and 11th days. During the experiment, observe the mental state, hair condition, and uterine secretions of each group of mice every day.
[0061] Table 1 Screening of the concentration gradient of combined use of carvacrol and astragaloside IV
[0062] 2.4, Therapeutic effect and mechanism study of combined use of carvacrol and astragaloside IV on endometritis in mice
[0063] Randomly divide 48 mice into 8 groups, and name them blank control group, model group, carvacrol group, astragaloside IV group, combined low, medium, and high dose groups, and positive control group, with 6 mice in each group. And, the blank control group perfuses PBS (pH 7.2) into the uterus until the end of the experiment, and the other groups perfuse 1×10 8 CFU·mL -1Bacterial solution was administered once daily for 7 consecutive days, with 100 μL of PBS and bacterial solution perfusion each day.
[0064] Starting from day 8, perfusion was administered according to Table 2, once daily for 3 consecutive days. On day 11, the mental state and coat condition of mice in each group were observed; body temperature and weight were measured; blood was collected, mice were euthanized, and relevant indicators were measured.
[0065] Table 2. Treatment and Mechanism of Carvacrol Combined with Astragaloside A in Mice with Endometritis
[0066] 3. Detection Indicators and Methods
[0067] 3.1 Observation of clinical indicators
[0068] Observe the mice's mental state and coat condition daily, and monitor their body temperature and weight.
[0069] 3.2 Sample Collection and Processing
[0070] On day 11, blood was collected from the mouse eyeballs and placed in anticoagulant tubes, then stored at 4°C for later use. Mice were euthanized, and the uterus was removed. After removing blood and moisture from the tissue surface, congestion and edema were observed. The weight of the mouse uterus was measured. Uterine tissue samples (central uterine region) were collected for sectioning and fixed in 4% paraformaldehyde solution for at least 24 hours. The remaining uterine samples were rapidly frozen in liquid nitrogen and stored at -80°C.
[0071] 3.3 Uterine Index Measurement
[0072] The mouse uterine index was calculated based on the recorded mouse body weight and uterine weight.
[0073] Uterine index = Uterine weight (g) / Body weight (g) × 100%
[0074] 3.4. Histopathological observation of uterine tissue
[0075] (1) Preparation of paraffin sections
[0076] Microscopic slides are prepared through steps such as fixation, dehydration, clearing, paraffin impregnation, embedding, and sectioning.
[0077] (2) Hematoxylin + Eosin (HE) staining
[0078] Follow the instructions for the HE staining kit.
[0079] 3.5 Measurement of inflammatory factor levels
[0080] Weigh 0.1 g of uterine tissue and mix it with 0.9 mL of PBS buffer (pH 7.4). Homogenize the mixture to prepare a 10% tissue homogenate suspension. Centrifuge the suspension and collect the supernatant after centrifugation. The levels of TNF-α, IL-1β, IL-6, and interleukin-10 (IL-10) in mouse uterine tissue were detected by ELISA. The entire assay was performed strictly according to the kit instructions.
[0081] 3.6 Measurement of Oxidative Stress Indicators
[0082] The prepared 10% mouse uterine tissue homogenate supernatant was diluted 10-fold, and the protein concentration of the homogenate supernatant samples from each group of mice was detected using the BCA microplate method. The absorbance values of each well were read at 562 nm using a microplate reader, a standard curve was constructed, and the protein content of the mouse uterine tissue was calculated according to the formula. Simultaneously, the malondialdehyde (MDA) content in mouse uterine tissue was determined using the TBA method, the SOD activity in mouse uterine tissue was detected using the WST-1 method, and the R-GSH content in mouse uterine tissue was determined using a colorimetric method. All the above measurements were performed strictly according to the manufacturer's instructions.
[0083] 3.7 Measurement of inflammatory factor mRNA expression
[0084] Total RNA was extracted from uterine tissue samples using the "Eastep® Super Total RNA Extraction Kit" manufactured by Shanghai Promega Biotechnology Co., Ltd. The concentration, purity, and integrity of the total RNA were measured using a Qubit 2.0 fluorometer, a NanoPhotometer® spectrophotometer, and an Agilent 2100 bioanalyzer, respectively. Reverse transcription and qRT-PCR were then performed using "UnionScript First-strand cDNA Synthesis Mix for qPCR (with dsDNase)" and "GS AntiQ qPCR Probe Master Mix" manufactured by Beijing Jinsha Biotechnology Co., Ltd., respectively. qRT-PCR primers were designed using Primer 6.0 and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The CDS nucleotide sequences of inflammation-related factors in this experiment are shown below.
[0085] The CDS (168 - 827) nucleotide sequence of TNF-α is shown as SEQ ID NO:1: atgagcacagaaagcatgatccgcgacgtggaactggcagaagaggcactcccccaaaagatggggggcttccagaactccaggcggtgcctatgtctcagcctcttctcattcctgcttgtggcaggggccaccacgctcttctgtctactgaacttcggggtgatcggtccccaaagggatgagaagttcccaaatggcctccctctcatcagttctatggcccagaccctcacactcacaaaccaccaagtggaggagcagctggagtggctgagccagcgcgccaacgccctcctggccaacggcatggatctcaaagacaaccaactagtggtgccagccgatgggttgtaccttgtctactcccaggttctcttcaagggacaaggctgccccgactacgtgctcctcacccacaccgtcagccgatttgctatctcataccaggagaaagtcaacctcctctctgccgtcaagagcccctgccccaaggacacccctgagggggctgagctcaaaccctggtatgagcccatatacctgggaggagtcttccagctggagaagggggaccaactcagcgctgaggtcaatctgcccaagtacttagactttgcggagtccgggcaggtctactttggagtcattgctctgtga。
[0086] The CDS (88 - 897) nucleotide sequence of IL-1β is shown in SEQ ID NO:2: atggcaactgttcctgaactcaactgtgaaatgccaccttttgacagtgatgagaatgacctgttctttgaagttgacggaccccaaaagatgaagggctgcttccaaacctttgacctgggctgtcctgatgagagcatccagcttcaaatctcgcagcagcacatcaacaagagcttcaggcaggcagtatcactcattgtggctgtggagaagctgtggcagctacctgtgtctttcccgtggaccttccaggatgaggacatgagcaccttcttttccttcatctttgaagaagagcccatcctctgtgactcatgggatgatgatgataacctgctggtgtgtgacgttcccattagacaactgcactacaggctccgagatgaacaacaaaaaagcctcgtgctgtcggacccatatgagctgaaagctctccacctcaatggacagaatatcaaccaacaagtgatattctccatgagctttgtacaaggagaaccaagcaacgacaaaatacctgtggccttgggcctcaaaggaaagaatctatacctgtcctgtgtaatgaaagacggcacacccaccctgcagctggagagtgtggatcccaagcaatacccaaagaagaagatggaaaaacggtttgtcttcaacaagatagaagtcaagagcaaagtggagtttgagtctgcagagttccccaactggtacatcagcacctcacaagcagagcacaagcctgtcttcctgggaaacaacagtggtcaggacataattgacttcaccatggaatccgtgtcttcctaa。
[0087] The CDS (79 - 576) nucleotide sequence of IL-6 is shown in SEQ ID NO:3: atgaagttcctctctgcaagagacttccatccagttgccttcttgggactgatgctggtgacaaccacggccttccctacttcacaagtccggagaggagacttcacagaggataccactcccaacagacctgtctataccacttcacaagtcggaggcttaattacacatgttctctgggaaatcgtggaaatgagaaaagagttgtgcaatggcaattctgattgtatgaacaacgatgatgcacttgcagaaaacaatctgaaacttccagagatacaaagaaatgatggatgctaccaaactggatataatcaggaaatttgcctattgaaaatttcctctggtcttctggagtaccatagctacctggagtacatgaagaacaacttaaaagataacaagaaagacaaagccagagtccttcagagagatacagaaactctaattcatatcttcaaccaagagataagctggagtcacagaaggagtggctaa。
[0088] The CDS (68 - 604) nucleotide sequence of IL-10 is shown in SEQ ID NO:4: atgcctggctcagcactgctatgctgcctgctcttactgactggcatgaggatcagcaggggccagtacagccgggaagacaataactgcacccacttcccagtcggccagagccacatgctcctagagctgcggactgccttcagccaggtgaagactttctttcaaacaaaggaccagctggacaacatactgctaaccgactccttaatgcaggactttaagggttacttgggttgccaagccttatcggaaatgatccagttttacctggtagaagtgatgccccaggcagagaagcatggcccagaaatcaaggagcatttgaattccctgggtgagaagctgaagaccctcaggatgcggctgaggcgctgtcatcgatttctcccctgtgaaaataagagcaaggcagtggagcaggtgaagagtgattttaataagctccaagaccaaggtgtctacaaggccatgaatgaatttgacatcttcatcaactgcatagaagcatacatgatgatcaaaatgaaaagctaa。
[0089] GAPDH The CDS (72 - 1073) nucleotide sequence is shown in SEQ ID NO:5 as follows:
[0090] In this experiment, the relative gene expression levels (Fold change, FC) of inflammation-related factors in each sample were measured using a 2-1 method. -ΔΔCT The method was used for calculation, and the measurement was repeated three times. GAPDH The gene was used as an internal reference gene, and the relevant qRT-PCR primer information is shown in Table 3.
[0091] Table 3 qRT-PCR primers
[0092] 3.8 Determination of MAPK signaling pathway protein expression levels
[0093] (1) Protein sample extraction
[0094] RIPAI lysis buffer (RIPA:PMSF:protein phosphatase inhibitor:antimicrobial peptide = 1000:10:10:1) was prepared beforehand on ice. Then, 50 mg of mouse uterine tissue from each group was weighed and 450 μL of RIPA lysis buffer was added. The tissue was then placed in a pre-chilled steel ball and homogenized using a homogenizer to obtain a 10% tissue homogenate. The steel ball was removed, and the tissue was lysed on ice for 15-30 min, followed by centrifugation at 15000 rpm for 4 min. The supernatant was collected.
[0095] (2) Quantitative analysis of protein sample concentration
[0096] Pilosed 5 μL of supernatant from each group into centrifuge tubes, added 45 μL of RIPA lysis buffer, and mixed thoroughly to form a 1% tissue homogenate. Protein concentrations for each sample were determined and processed according to the BCA kit instructions. Then, 10 μL of distilled water and 250 μL of working solution were added to the blank wells; and 10 μL of standard (524 μg / mL) was added to the standard wells. -1 Add 10 μL of the sample to be tested and 250 μL of working solution to the assay well. Adjust the concentration of each protein sample to the target concentration using RIPA lysis buffer. Mix each protein sample with protein loading buffer (4:1 ratio) and heat in a 100°C water bath for 10 min. Finally, aliquot the samples and store at -80°C.
[0097] (3) SDS-PAGE electrophoresis
[0098] Mount a 1.5 mm glass plate in the holder and prepare 12% separating gel and 5% stacking gel according to Table 4. Using a pipette, slowly press the separating gel into the glass plate along one side of the seam (to about 2 / 3 full), then add ultrapure water to cover the separating gel and let it stand at room temperature for 30 minutes. After the separating gel solidifies, remove the ultrapure water and use a pipette to slowly press the stacking gel into the glass plate along one side of the seam until it is full. Finally, slowly insert a 1.5 mm sample comb into the stacking gel, avoiding air bubbles, and let it stand at room temperature for 45 minutes. After the stacking gel solidifies, place the entire glass plate in the electrophoresis tank and pour in the electrophoresis buffer, then slowly remove the sample comb.
[0099] Add 5 μL of protein marker to the two outermost wells, and then add 5 μL of the protein sample to be tested to the remaining wells. Finally, perform electrophoresis at 80 V for 30 min, followed by electrophoresis at 120 V for 45 min.
[0100] Table 4 SDS-PAGE gel formulation
[0101] (4) Transfer membrane
[0102] Cut appropriate sizes of filter paper and PVDF membrane along the marker position and the edges of the separating and stacking gels. Immerse them in transfer buffer for 5 minutes, then cut the gels to the sizes described above. Assemble the transfer tank. Pour in the transfer buffer first, then connect the electrophoresis apparatus. Place ice packs around the edge of the transfer tank to prevent membrane burn. Transfer the membrane at 330 V for 60 minutes.
[0103] (5) Closed incubation
[0104] Place the PVDF membrane in an antibody incubation box, pour in 3 mL of enzyme-free blocking buffer, and incubate at room temperature for 75 rpm. -1 Block the membrane on a shaker for 30 min. Then, remove the enzyme-free blocking buffer and wash the membrane three times with 3 mL PBST on a shaker for 8 min each time. Add 3 mL of primary antibody solution and incubate at 4°C and 75 rpm. -1 Incubate in a shaking incubator for 12 h. Recover the primary antibody solution and wash the membrane three times with 3 mL PBST on a shaker for 8 min each time. Finally, pour in the secondary antibody solution and incubate at 37 °C and 75 r·min. -1 The membrane was incubated in a shaking incubator for 2 h, then the secondary antibody solution was recovered, and the membrane was washed three times with 3 mL PBST on a shaker for 8 min each time. The different antibody dilutions are shown in Table 5.
[0105] Table 5 Antibody Dilution Factors
[0106] (6) Development and analysis
[0107] The target band was determined using a chemiluminescence imager by reacting the ECL chemiluminescence reagent with the detected protein and then analyzing the grayscale values of the obtained band using Imagej.
[0108] 4. Data Statistical Analysis
[0109] The experimental data were statistically analyzed using Microsoft Office Excel 2025. SPSS 25.0 software was used for one-way ANOVA to detect significance (P < 0.05 was considered significant). Adobe Photoshop 2026 was used for graphing.
[0110] 5. Results and Analysis
[0111] 5.1, R. pickettii Results of establishing a mouse model of endometritis
[0112] Based on the results of clinical characteristic index testing, the group with the strongest inflammatory response was determined to use [the appropriate treatment / treatment]. R.pickettii Concentration (1×10) 8 CFU·mL -1 The bacterial inoculation dose for the endometritis model.
[0113] 5.2 Results of screening combination therapy regimens for treating R. pickettii-induced endometritis in mice
[0114] 5.2.1 Results of in vitro antibacterial activity of traditional Chinese medicine extracts
[0115] The experimental results showed that carvacrol exhibited the strongest antibacterial activity, with a MIC of 0.125 mg / mL. -1 MBC is 1 mg·mL -1 This indicates that it can effectively inhibit and kill even at low concentrations. R.pickettii The MIC of tanshinone IIA is 4 mg / mL. -1 MBC is 8 mg·mL -1 Although its antibacterial effect is not as strong as carvacrol, it still exhibits strong antibacterial and bactericidal abilities. The MICs of astragaloside A, berberine, and baicalin are 4 mg·mL⁻¹. -1 4 mg·mL -1 and 8 mg·mL -1 The MBC values were 16 mg·mL. -1 16 mg·mL -1 and 32 mg·mL -1This indicates that the antibacterial effects of the above three substances are inferior to those of carvacrol and tanshinone IIA, but they still show certain antibacterial activity.
[0116] 5.2.2 In vivo efficacy results of different drug combinations
[0117] Observations showed that mice in the combined drug groups I and II had significantly better mental state, coat condition, and uterine secretions than the other three experimental groups. On day 9, the body temperature of mice in combined drug groups I-IV was significantly lower than that of the model group (P<0.05), and only the mice in combined drug group I stopped developing a fever (body temperature 37.63±0.15℃). On day 10, only the mice in combined drug groups II and III showed a significant decrease in body temperature compared to their temperature on day 9, and the mice in combined drug group II began to defervescence (body temperature 37.97±0.12℃). The body temperature of mice in combined drug group I was significantly lower than that of the other experimental groups (P<0.01), but mice in this group died, with a mortality rate of 50%. On day 11, except for the combined drug group III, the body temperatures of mice in combined drug groups I, II, and IV returned to normal, with temperatures of 37.33±0.21℃, 37.10±0.17℃, and 37.57±0.21℃, respectively. Meanwhile, the mortality rate of mice in combined drug group I was 75%.
[0118] On day 9, there was no significant difference in body weight among mice in the combined drug groups I-IV, but all were significantly higher than those in the model group (P<0.05). On day 10, the body weight of mice in combined drug groups I and II was extremely significantly higher than that in the model group (P<0.01), while the body weight of mice in combined drug group IV was not significantly different from that in the model group (P<0.05). Only the body weight of mice in combined drug group I showed a significant increase compared to their body weight on day 9. On day 11, the body weight of mice in combined drug groups I and II was extremely significantly higher than that in combined drug groups III, IV, and the model group (P<0.01).
[0119] Overall, combination therapy groups I and II were more effective than combination therapy groups III and IV in slowing down the rise in body temperature and weight loss. However, mice in combination therapy group I (carvacrol combined with berberine) died during treatment, indicating a potential toxicity risk. Therefore, considering both efficacy and safety, combination therapy group II (carvacrol combined with astragaloside A) was selected for subsequent trials.
[0120] 5.2.3 Results of the in vitro synergistic antibacterial activity of carvacrol combined with astragaloside A
[0121] Carvacrol, when used in combination with astragaloside A, has the effect on... R.pickettii The minimum inhibitory concentration (MICcombi) for combined use was 0.03125 mg / mL. -1Astragaloside A, when used in combination with carvacrol, has the effect on... R.pickettii The MICcombi concentration was 0.5 mg / mL. -1 The MIC of carvacrol is 0.125 mg / mL. -1 The MIC of astragaloside A is 4 mg / mL. -1 Therefore, the FICI value of carvacrol combined with astragaloside A was calculated to be 0.375 using the checkerboard method (FIC carvacrol = 0.25, FIC astragaloside A = 0.125), indicating that carvacrol and astragaloside A have a synergistic antibacterial effect.
[0122] 5.2.4 Screening results for the optimal concentration of carvacrol combined with astragaloside A
[0123] Observations showed that, compared with the model group, the mice in the combined AE treatment group exhibited significant improvements in mental state, coat condition, and uterine secretions. (See Table 6 and...) Figure 4 As shown, on day 9, the body temperature of mice in the combined drug AE group was significantly lower than that in the model group (P<0.05), and the body temperature of mice in the combined drug A group was significantly lower (P<0.01), indicating that the antipyretic effect of its drug concentration was significantly stronger than that of other combined drug groups. On day 10, only mice in the combined drug A and B groups began to defervescence (body temperature 37.53±0.12℃ and 37.90±0.10℃, respectively). On day 11, the body temperature of mice in the combined drug AE group returned to normal.
[0124] On day 9, only mice in the combination therapy groups A, B, and C had significantly higher body weights than the model group (P<0.05). On day 10, only mice in the combination therapy group A had an increased body weight compared to their body weight on day 9. On day 11, mice in the combination therapy group AE had extremely significantly higher body weights than the model group (P<0.01). Meanwhile, only mice in the combination therapy groups A and B had higher body weights than their body weights on day 10.
[0125] In summary, the combined use of five different concentrations of carvacrol and astragaloside A effectively alleviated the clinical symptoms of endometritis in mice. Among them, the combined effects of 1 / 2 MIC carvacrol and 1 / 2 MIC astragaloside A, and 1 / 4 MIC carvacrol and 1 / 4 MIC astragaloside A showed better therapeutic effects, while the combined effect of 1 / 8 MIC carvacrol and 1 / 8 MIC astragaloside A was weaker. Therefore, this experiment selected the above three combined drug concentrations for subsequent research, and named them the high-dose combined group, the medium-dose combined group, and the low-dose combined group, respectively.
[0126] Table 6. Effects of different concentrations of carvacrol combined with different concentrations of astragaloside A on body temperature in diseased mice.
[0127] Note: Group A of combined medication: 1 / 2 MIC carvacrol and 1 / 2 MIC astragaloside A in combination; Group B of combined medication: 1 / 4 MIC carvacrol and 1 / 4 MIC astragaloside A in combination; Group C of combined medication: 1 / 4 MIC carvacrol and 1 / 8 MIC astragaloside A in combination; Group D of combined medication: 1 / 8 MIC carvacrol and 1 / 4 MIC astragaloside A in combination; Group E of combined medication: 1 / 8 MIC carvacrol and 1 / 8 MIC astragaloside A in combination, and so on.
[0128] 5.3 The therapeutic effect of carvacrol combined with astragaloside on R. pickettii-induced endometritis in mice.
[0129] 5.3.1 Effects on body temperature and weight
[0130] Depend on Figure 1 As shown in Figure A, the body temperature of mice in the blank control group and the six treatment groups was significantly lower than that in the model group (P<0.01). The body temperature of mice in the carvacrol group, astragaloside A group, and the combined low-dose group (37.70℃ < body temperature < 38.00℃) was significantly higher than that in the blank control group (P<0.01). The body temperature of mice in the combined medium-dose group, the combined high-dose group, and the positive control group (37.30℃ < body temperature < 37.50℃) was not significantly different from that in the blank control group (P>0.05). Figure 1 As shown in Figure B, compared with the blank control group, the body weight of mice in the model group and the six treatment groups was significantly reduced (P<0.01). Compared with the model group, except for the astragaloside IV group, the body weight of mice in the other five treatment groups was significantly increased (P<0.05). The body weight of mice in the combined medium-dose group, the combined high-dose group, and the positive control group (41.00 g < body weight < 44.20 g) was significantly higher than that of the other three treatment groups (36.90 g < body weight < 37.60 g) (P<0.01). In conclusion, the combined use of carvacrol and astragaloside IV has a greater effect on alleviating the increase in body temperature and decrease in body weight in diseased mice than carvacrol or astragaloside IV alone, and the higher the concentration of the two combined, the better the therapeutic effect.
[0131] 5.3.2 Effect on Uterine Index
[0132] Observations showed that, compared with the model group, the uterine congestion and edema were significantly improved in mice in all six treatment groups. Figure 2As shown, compared with the blank control group (uterine index 0.45±0.04%), the uterine index of the model group and the six treatment groups was significantly increased (P<0.05). Compared with the model group (uterine index 1.00±0.03%), the uterine index of the six treatment groups was extremely significantly decreased (P<0.01). The uterine index of the combined low-dose group was 0.76±0.03%, which was extremely significantly lower than that of the carvacrol group and the astragaloside IV group, and extremely significantly higher than that of the other three treatment groups (P<0.01). The uterine index of the combined medium-dose group was 0.61±0.04%, which was significantly higher than that of the combined high-dose group and the positive control group (P<0.05). The uterine index of the combined high-dose group was 0.53±0.02%, which was not significantly different from that of the positive control group (P>0.05). This indicates that the combined use of carvacrol and astragaloside at medium and high concentrations has a greater therapeutic effect on the increase of uterine index in diseased mice than the combined use of either drug alone or at low concentrations.
[0133] 5.3.3 Effects on uterine histopathology
[0134] Depend on Figure 3 As shown in Figure A, the endometrial structure of mice in the blank control group was intact, with neatly arranged luminal epithelial cells, abundant cytoplasm, and no shedding; the uterine glands had normal morphology, dense stroma, and no obvious inflammatory cell infiltration. Figure 3 As shown in Figure B, the uterine tissue structure of the mice in the model group was severely damaged, characterized by large-scale shedding and loss of the endometrial epithelium; significant edema and high looseness of the stroma, accompanied by extensive diffuse inflammatory cell infiltration; necrotic sloughed tissue and exudate were visible in the lumen, with obvious congestion. Figure 3 C and Figure 3 As shown in Figure D, compared with the model group, the uterine damage in mice in the carvacrol and astragaloside A groups was reduced. The epithelial structure was basically continuous, but mild local peeling was still visible; the infiltration of inflammatory cells in the interstitium was significantly reduced compared with the model group, but mild edema was still present. Figure 3 As shown in Figure E, the endometrial structure of mice in the combined low-dose group began to show signs of improvement, but some degree of interstitial loosening and scattered inflammatory cells were still observed, indicating a slightly better improvement than the single-drug group. Figure 3 As shown in Figure F, the combined medium-dose group showed significant therapeutic effects, with the endometrial epithelium essentially returning to its normal morphology, exhibiting numerous and tightly packed folds; stromal inflammatory cells were significantly reduced, tissue edema markedly subsided, and the overall structure tended towards normal. Figure 3 As shown in Figure G, the combined high-dose group showed the most ideal recovery of endometrial structure, with tissue morphology similar to the control group. The endometrial epithelium was intact and smooth, glands were evenly distributed, and no obvious inflammatory exudation or congestion was observed, demonstrating a strong anti-inflammatory and repairing effect. Figure 3As shown in H, the endometrial structure of the positive control group remained largely intact, and inflammatory cell infiltration and tissue edema were effectively controlled, with only a very small number of inflammatory lesions visible locally, serving as the expected treatment reference.
[0135] 5.4. The effect of carvacrol combined with astragaloside A on... R.pickettii Anti-inflammatory and antioxidant effects in mice with induced endometritis
[0136] 5.4.1 Effects on the levels of inflammatory factors in the uterus
[0137] Depend on Figure 4 As shown in A, B, and C, compared with the blank control group, the levels of inflammation-related cytokines TNF-α, IL-6, and IL-1β in the uterine tissue of mice in the model group were all significantly increased (P<0.01); the levels of TNF-α, IL-6, and IL-1β in all six treatment groups were significantly lower than those in the model group (P<0.01). The levels of TNF-α, IL-6, and IL-1β in the combined low-dose group were significantly lower than those in the carvacrol group and the astragaloside IV group (P<0.05). The levels of TNF-α and IL-1β in the combined medium-dose group were significantly lower than those in the combined low-dose group and significantly higher than those in the combined high-dose group (P<0.05), and there was no significant difference between them and the positive control group (P>0.05). The level of IL-6 in the combined medium-dose group was significantly higher than that in the combined high-dose group (P<0.01). Figure 4 As shown in Figure D, the IL-10 content in the uterine tissue of mice in the model group was significantly lower than that in the blank control group (P<0.01). The IL-10 content in all six treatment groups was significantly higher than that in the model group (P<0.05). There was no significant difference in IL-10 content among the carvacrol group, astragaloside A group, and positive control group (P>0.05), and the IL-10 content in the combined low-dose group was significantly higher than that in the above three treatment groups (P<0.01). The IL-10 content in the combined medium-dose group was significantly higher than that in the combined low-dose group and significantly lower than that in the combined high-dose group (P<0.01).
[0138] Therefore, this experiment shows that all six treatment groups effectively inhibited the increase of inflammatory cytokine levels in mouse uterine tissue and promoted the increase of anti-inflammatory cytokine levels. Among them, the levels of TNF-α, IL-6, and IL-1β in the uterine tissue of mice in the combined high-dose group were significantly lower than those in the other four treatment groups (excluding the positive control group) (P<0.05). The levels of IL-10 in the uterine tissue of mice in the combined medium-dose and combined high-dose groups were significantly higher than those in the other four treatment groups (P<0.01), indicating that the combined medium-dose and combined high-dose groups effectively inhibited the increase of inflammatory cytokine levels in mice in the uterine tissue of mice in the combined medium-dose and combined high-dose groups (P<0.01). R.pickettii Inducing inflammation in mice resulted in better therapeutic effects.
[0139] 5.4.2 Effects on the expression of inflammatory factor mRNA in uterine tissue
[0140] Depend on Figure 5 As shown in A, B, and C, compared with the blank control group, the relative expression levels of TNF-α, IL-6, and IL-1β mRNA in the uterine tissues of mice in the model group and the six treatment groups were significantly increased (P<0.01). Simultaneously, the relative expression levels of TNF-α, IL-6, and IL-1β mRNA in the uterine tissues of mice in the six treatment groups were significantly lower than those in the model group (P<0.01). The relative expression levels of the three inflammatory cytokine mRNAs in the combined low-dose group were significantly lower than those in the carvacrol group and the astragaloside IV group (P<0.01), and the relative expression levels of TNF-α and IL-6 mRNAs were significantly higher than those in the combined medium-dose group, the combined high-dose group, and the positive control group (P<0.05). Meanwhile, there was no significant difference in the relative expression level of IL-1β mRNA between the combined low-dose group and the combined medium-dose group and the positive control group (P>0.05), but its relative expression level of IL-1β mRNA was significantly higher than that in the combined high-dose group (P<0.05). Figure 5 As shown in Figure D, the relative expression levels of IL-10 mRNA in the uterine tissues of mice in the blank control group and the six treatment groups were significantly higher than those in the model group (P<0.01). Furthermore, the relative expression level of IL-10 mRNA in the uterine tissues of mice in the combined high-dose group was significantly the highest, followed by the combined medium-dose group (P<0.01).
[0141] In summary, the experimental results show that all six treatment groups effectively inhibited the expression of inflammatory cytokine mRNA in mouse uterine tissue and promoted the expression of anti-inflammatory cytokine mRNA. Meanwhile, the combined use of carvacrol and astragaloside A showed an effect on... R.pickettii The anti-inflammatory effect of carvacrol or astragaloside A inducing endometritis in mice was stronger than that of carvacrol or astragaloside A alone, and the higher the concentration of the two combined, the stronger the anti-inflammatory effect.
[0142] 5.4.3 Effects on oxidative stress indicators in uterine tissue
[0143] like Figure 6 As shown in Figure A, compared with the blank control group... R.pickettii The drug significantly increased MDA levels in the uterine tissues of mice in both the model group and the six treatment groups (P<0.01). Simultaneously, intrauterine instillation of the drug significantly reduced MDA levels in all six treatment groups compared to the model group (P<0.01). The combined medium-dose group, combined high-dose group, and positive control group showed significantly lower MDA levels compared to the other three treatment groups (P<0.01), indicating that these three treatments have a strong mitigating effect on oxidative stress induced by bacterial infection.
[0144] like Figure 6As shown in B and C, compared with the blank control group, the SOD activity and GSH content in the uterine tissue of mice in the model group and the six treatment groups were significantly reduced (P<0.01). After drug perfusion, the SOD activity and GSH content in the six treatment groups were significantly higher than those in the model group (P<0.01). Among them, the SOD activity and GSH content in the combined medium-dose group, the combined high-dose group, and the positive control group were significantly higher than those in the other three treatment groups (P<0.01), indicating that the above three drugs have a stronger scavenging effect on excess reactive oxygen species (ROS) in mouse uterine tissue and a better repair effect on the antioxidant capacity of diseased mouse uterine tissue.
[0145] 5.5. The regulatory effect of carvacrol combined with astragaloside on the MAPK signaling pathway in R. pickettii-induced endometritis mice.
[0146] Depend on Figure 7 As shown, compared with the blank control group, the relative expression levels of P-p38, P-JNK1, and P-ERK1 in the uterine tissues of mice in the model group and the six treatment groups were significantly upregulated (P<0.05). Compared with the model group, drug perfusion significantly downregulated the relative expression levels of the three phosphorylated proteins in the six treatment groups (P<0.01), indicating that carvacrol, astragaloside IV, and their different concentrations in combination can inhibit the overactivation of the MAPK signaling pathway in the uterine tissues of mice with endometritis. In addition, the relative expression levels of the three phosphorylated proteins in the carvacrol group and the astragaloside IV group were significantly higher than those in the other four treatment groups (P<0.01). The relative expression levels of the three phosphorylated proteins in the high-dose combination group were significantly lower than those in the low-dose combination group and the medium-dose combination group (P<0.05). This indicates that the high-concentration combination of carvacrol and astragaloside IV can inhibit the expression of phosphorylated proteins of p38, JNK1, and ERK1 to a greater extent.
[0147] Example 2
[0148] 1. R.pickettii Establishment of a mouse model of induced endometritis
[0149] Our laboratory successfully isolated [a specific substance] from the uterus of a cow suffering from endometritis. R.pickettii However, considering the problems of complex origins, insufficient phenotypic stability, and weak reproducibility of isolated strains, this study selected standard strains with clear origins, well-defined genetic backgrounds, and stable properties for experimental purposes. *Rowstoneella* spp. Ralstonia In genus R.pickettii It is a non-fermenting, Gram-negative bacillus that can cause severe inflammatory diseases such as meningitis, endocarditis, and osteomyelitis in immunocompromised patients. Furthermore, R.pickettiiIt is a waterborne bacterium that can reproduce in environments with extremely low nutrient concentrations, survive in a wide temperature range (15~42℃), and can even penetrate 0.2µm filter membranes. Endometritis is a common reproductive system disease in female animals, causing irreversible structural changes to the uterine wall and resulting in loss of reproductive capacity. Clinical symptoms in affected dairy cows include fever, anorexia, decreased milk production, and purulent uterine discharge. *Escherichia coli* is one of the main pathogens causing endometritis in livestock; it is a Gram-negative bacterium that can invade endometrial cells. This study found that by instilling 1×10... 8 CFU·mL -1 R.pickettii This treatment significantly increased body temperature and decreased body weight in mice, accompanied by lethargy, localized hair loss, and increased purulent uterine discharge. Simultaneously, HE staining results showed that at this bacterial concentration, the endometrial epithelial cells of the mouse uterine tissue were extensively sloughed off, the stroma was significantly edematous and highly porous, and accompanied by a large amount of diffuse inflammatory cell infiltration; the lumen was significantly congested, and necrotic sloughed tissue and inflammatory exudate were visible. These experimental results are consistent with previous studies on mouse endometritis. In summary, uterine perfusion of 1×10 8 CFU·mL -1 R.pickettii It can induce the establishment of a mouse model of endometritis.
[0150] 2. The rationality of the combined use of carvacrol and astragaloside A
[0151] Carvacrol is a monoterpenoid phenolic compound with antioxidant, anti-inflammatory, anticancer, antipyretic, and analgesic biological properties, and it exhibits significant antibacterial activity against both Gram-negative and Gram-positive bacteria. Astragaloside A is one of the main active components of the traditional Chinese medicine Astragalus membranaceus, possessing various biological activities such as antioxidant, anti-inflammatory, anti-fibrotic, and anti-apoptotic effects. Studies have shown that astragaloside A can also regulate pathways such as Nrf2 / HO-1, MAPK, and AMPK, broadly participating in antioxidant and energy metabolism regulation. Berberine, as one of the most promising antibacterial drugs, exhibits broad-spectrum antiviral and antifungal activity both in vitro and in vivo. Furthermore, studies have shown that berberine is also an antibiotic adjuvant, capable of reversing fungal and bacterial resistance. Baicalin is a flavonoid compound extracted from the roots of Astragalus membranaceus, possessing various biological properties and pharmacological functions, including antibacterial, anti-inflammatory, anti-allergic, and anticancer effects. Studies have shown that baicalin can inhibit the expression of pro-inflammatory factors (TNF-α, IL-1β, MIP-2, and MCP-1), reduce the activity of ROS-generating enzyme (NOX2), and enhance the functional effect of NRF2 nuclear translocation. Tanshinone IIA, as one of the most representative substances of tanshinone, has antibacterial and anti-biofilm activities without inducing drug resistance. This study found that carvacrol... R.pickettiiBoth the MIC and MBC are the smallest. It shows that at a lower concentration, thymol has a stronger antibacterial effect on R.pickettii than the other four traditional Chinese medicine extracts. The reason may be that thymol has strong lipophilicity and can easily penetrate the lipid bilayer structure of the bacterial cell membrane, resulting in the destruction of the integrity of the bacterial cell membrane, thereby changing the permeability and depolarization of the bacterial cell membrane. At the same time, thymol has a delocalized electron system, which can cause ion leakage, ATP loss, and extracellular outflow of intracellular substances in bacteria, ultimately leading to bacterial lysis and death.
[0152] Although there have been many studies on the synergistic antibacterial effect of thymol and antibiotics, the research on the synergistic antibacterial effect of thymol combined with other traditional Chinese medicine extracts is still limited. In this experiment, the effect of thymol combined with berberine and thymol combined with astragaloside IV on alleviating fever and weight loss in mice was significantly stronger than that of thymol combined with baicalin and thymol combined with tanshinone IIA. It shows that the former two have a stronger therapeutic effect on murine endometritis. In addition, a higher mortality rate of mice occurred during the experiment when thymol was combined with berberine, which may be due to the damage of berberine to the DNA of spleen cells and kidney cells in mice, and because the kidney is the main target organ of drug adverse effects, the degree of damage to kidney cell DNA is the greatest. After 72 hours of medication, there was no significant difference in the body temperature of mice between thymol combined with berberine and thymol combined with astragaloside IV. It shows that there is no obvious difference in the therapeutic effect of thymol combined with berberine and thymol combined with astragaloside IV on murine endometritis. Therefore, in this experiment, thymol combined with astragaloside IV was selected as R.pickettii the therapeutic drug for inducing murine endometritis. The checkerboard method is usually used to detect the interaction effect when two drugs are used in combination, and to judge whether their effect is synergistic (FICI ≤ 0.5), additive (0.5 < FICI ≤ 1), no effect (1 < FICI ≤ 2) or antagonistic (2 < FICI). In this study, the FICI value of thymol combined with astragaloside IV was 0.375, indicating that the combination of the above two had a synergistic antibacterial effect.
[0153] Understanding the relationship between dosage, blood drug concentration, and clinical response (efficacy and adverse reactions) is crucial for the safe and effective use of medications in individual patients. This helps determine the appropriate starting dose, the optimal dosage adjustment regimen (based on the specific patient's needs), and the highest effective dose (the dose exceeding which will not produce additional therapeutic effects or drug side effects). Carvacrol and astragaloside IV do not always exhibit a linear dose-response relationship. In this study, all five different concentrations of the combined medication effectively alleviated the clinical symptoms of fever and weight loss in mice. Therefore, this study used combinations of low doses (1 / 8 MIC carvacrol combined with 1 / 8 MIC astragaloside IV), medium doses (1 / 4 MIC carvacrol combined with 1 / 4 MIC astragaloside IV), and high doses (1 / 2 MIC carvacrol combined with 1 / 2 MIC astragaloside IV) for subsequent trials.
[0154] 3. Protective effect of carvacrol combined with astragaloside A on mice with endometritis
[0155] Fever, lethargy, poor appetite, weight loss, and a foul-smelling, brownish-yellow mucopurulent discharge containing flocculent material or placental fragments are prominent clinical symptoms of endometritis in dairy cows. This study found that medium- and high-dose combination of carvacrol and astragaloside A significantly reduced the incidence of fever and weight loss in affected mice compared to carvacrol or astragaloside A alone, or even low-dose combination of both.
[0156] The uterine index is a direct indicator of the degree of inflammatory response. In mice with endometritis, changes such as uterine tissue swelling or congestion lead to an increased uterine index. This study found that the uterine index in the model group and the six treatment groups was significantly higher than that in the blank control group, and the uterine index in the six treatment groups was significantly lower than that in the model group, consistent with previous research results. This indicates that all six drugs can effectively alleviate the clinical symptoms of uterine redness and swelling in diseased mice. Furthermore, the combined use of carvacrol and astragaloside A had a greater therapeutic effect on uterine redness and swelling in diseased mice than either carvacrol or astragaloside A alone, and the higher the concentration of the combined combination, the better the therapeutic effect. Numerous studies have shown that uterine tissue sections from mice with endometritis exhibit more inflammatory cells, congestion, bleeding, endometrial tissue damage, and endometrial epithelial cell necrosis than normal uterine tissue sections. The results of this study show that the uterine tissue structure of mice in the model group was the most severely damaged, while the uterine tissue structure of mice in the six treatment groups showed significant improvement compared to the model group. Among them, the high-concentration combination of carvacrol and astragaloside A had the strongest repair effect on uterine tissue structural damage.
[0157] 4. The regulatory effects of carvacrol combined with astragaloside on inflammatory response and oxidative stress.
[0158] The regulation of pro-inflammatory and anti-inflammatory cytokines plays a central role in triggering appropriate inflammatory responses to prevent bacterial infection. TNF-α, IL-6, and IL-1β are key pro-inflammatory cytokines. Furthermore, multiple studies have shown that endometritis is associated with elevated levels of pro-inflammatory cytokines. TNF-α plays a crucial role in immune regulation, fever, inflammatory responses, tumor suppression, and viral replication inhibition. TNF-α binding to its receptor activates three intracellular signaling pathways, including NF-κB, MAPK-JNK, and caspase-8-mediated pathways, thereby promoting various biological functions such as inflammatory responses and cell survival, proliferation, differentiation, and apoptosis. In addition, low concentrations of TNF-α promote cell proliferation, while high concentrations inhibit cell proliferation and induce apoptosis. IL-6 can induce the expression of multiple proteins that trigger acute inflammation and plays an important role in human cell proliferation and differentiation. IL-6 overexpression and dysregulation of the IL-6 signaling pathway can lead to inflammation, autoimmune diseases, and cancer. IL-1β, as one of the most potent pro-inflammatory cytokines, can induce inflammatory responses in almost all tissues and organs and was initially thought to be a major endogenous pyrogen causing fever. Simultaneously, IL-1β exhibits diverse properties in responses to infection, injury, and immune challenges. IL-10, as one of the most important anti-inflammatory cytokines, can inhibit the activity of inflammatory Th (T-helper) cells and further reduce the production of pro-inflammatory cytokines; it can regulate immune responses and further alleviate immunopathological damage, thereby maintaining tissue homeostasis. Regarding the content and relative mRNA expression levels of pro-inflammatory and anti-inflammatory cytokines in the uterine tissue of diseased mice, this study found that the combination of carvacrol and astragaloside IV had a greater inhibitory effect on the expression of pro-inflammatory cytokines and a greater promoting effect on the expression of anti-inflammatory cytokines than carvacrol or astragaloside IV alone, and the higher the concentration of the combined drugs, the stronger the effect. This may be because both carvacrol and astragaloside IV can inhibit the expression of inflammatory cytokines and promote the expression of anti-inflammatory cytokines, thus resulting in a synergistic anti-inflammatory effect when used in combination.
[0159] The release of pro-inflammatory mediators leads to the accumulation of reactive oxygen species (ROS). While normal concentrations of ROS participate in gene expression and cell signaling regulation, excessive ROS accumulation can cause cell damage, triggering lipid and protein peroxidation, increasing MDA levels, inhibiting SOD activity, and reducing GSH levels. MDA, as the end product of lipid peroxidation, is currently used as a biomarker to measure oxidative stress levels in various biological samples. SOD can eliminate superoxide anion (O2) through dismutation reactions. - O2 -Superoxide dismutase (SOD) readily causes oxidative damage to cells, thereby triggering oxidative stress in the body. Meanwhile, SOD also has biological functions such as alleviating inflammation. Resin-GSH (R-GSH) is an endogenous antioxidant (which, along with glutathione peroxidase, reduces hydrogen peroxide and lipid peroxides), present in almost all cells at high concentrations. Regarding the MDA content, SOD activity, and R-GSH content in the uterine tissue of diseased mice, this study found that all six drugs reduced oxidative stress damage and improved the antioxidant capacity of diseased mice. Furthermore, the combined effect of carvacrol and astragaloside A was stronger than either drug alone, and the higher the concentration of the combined drugs, the stronger the effect. This is because carvacrol can alleviate oxidative stress damage through three pathways: directly scavenging excess ROS, activating the endogenous antioxidant defense system, and inhibiting the continuous production of ROS by mitochondria. Astragaloside A can alleviate mitochondrial dysfunction and podocyte apoptosis by upregulating the Nrf2-ARE / TFAM signaling pathway. It can also inhibit excessive ROS production and reduce MDA content by upregulating the activities of SOD, glutathione peroxidase, and catalase. Thus, the combination of the two has a synergistic anti-oxidative stress effect.
[0160] 5. The regulatory effect of carvacrol combined with astragaloside on the MAPK signaling pathway
[0161] R.pickettii It is an aerobic Gram-negative bacterium whose outer membrane is mainly composed of lipopolysaccharide (LPS), which can activate the MAPK signaling pathway. When the MAPK signaling pathway is activated through a complex cascade reaction, it upregulates the expression of pro-inflammatory cytokines and chemokines, ultimately leading to inflammatory damage in uterine tissue. Subsequently, the release of pro-inflammatory mediators induces ROS accumulation, resulting in a decrease in antioxidants, including R-GSH and SOD. In this study, the relative expression levels of phosphorylated p38, JNK1, and ERK1 proteins, the contents and relative mRNA expression levels of TNF-α, IL-6, and IL-1β, and the MDA content were all significantly increased in the uterine tissue of the model group mice, while the R-GSH content and SOD activity were significantly decreased, indicating that... R.pickettii—The MAPK signaling pathway—Inflammation—ROS accumulation—Activation of a series of responses to oxidative stress. In a study of LPS-induced sepsis in mice, Yan et al. found that carvacrol significantly inhibited IL-6 production by regulating the ERK1 / 2 pathway in macrophages, thereby alleviating the inflammatory response in macrophages. In a study of LPS-induced myocardial dysfunction in mice, Xu et al. found that carvacrol significantly inhibited the expression of TNF-α, IL-6, and IL-1β through the TLR4 / NF-κB / MAPK signaling pathway, thereby alleviating the inflammatory response and reducing oxidative stress levels in mice. In a study of the therapeutic mechanism of endometritis, Liang et al. found that carvacrol significantly inhibited the expression of inflammatory factors such as TNF-α, IL-6, and IL-1β by inhibiting the activation of the NF-κB and MAPK signaling pathways, thereby alleviating the inflammatory response in mice. This is consistent with the conclusion in this experiment that the carvacrol group reduced the inflammatory response and ultimately lowered oxidative stress levels by inhibiting the MAPK signaling pathway. Chen et al.'s study on intermittent hypoxia-induced inflammatory dysfunction found that astragaloside IV significantly inhibited the expression of IL-8, IL-1β, and IL-6 by suppressing the TLR4-mediated MAPK / NF-κB signaling pathway in Beas-2B cells, thereby alleviating the inflammatory response and oxidative stress levels. Wang et al.'s study on LPS-induced endometritis in mice found that astragaloside IV significantly reduced the expression of IL-1β and TNF-α by inhibiting the TLR4-mediated NF-κB, p38, and JNK signaling pathways, thereby alleviating the inflammatory response and oxidative stress levels. This is consistent with the conclusion in this experiment that the astragaloside IV group reduced the inflammatory response and ultimately lowered oxidative stress levels by inhibiting the MAPK signaling pathway. Furthermore, this study found that the combination of carvacrol and astragaloside IV significantly inhibited the expression of phosphorylated p38, JNK1, and ERK1 proteins in the uterine tissue of diseased mice compared to carvacrol or astragaloside IV alone, and carvacrol and astragaloside IV share the same regulatory mechanism. Therefore, in the treatment of... R.pickettii In the induction of endometritis in mice, carvacrol and astragaloside A synergistically regulate the MAPK signaling pathway.
[0162] in conclusion
[0163] 1. For 7 consecutive days, 100 μL of a 1×10⁻⁶ solution was perfused into the uterus of mice. 8 CFU·mL -1 of R.pickettii Successfully established R.pickettii Induced mouse endometritis model.
[0164] 2. The combined use of carvacrol and astragaloside A on... R.pickettii The treatment effect of inducing endometritis in mice was optimal, and the combination of the two had a synergistic antibacterial effect.
[0165] 3. The combination of carvacrol and astragaloside A can effectively alleviate [the symptoms]. R.pickettii The mechanism of action of inducing endometritis in mice is as follows: by inhibiting the overactivation of the MAPK signaling pathway, the levels of inflammatory cytokines and their mRNA expression levels are reduced, while the levels of anti-inflammatory cytokines and their mRNA expression levels are increased, thereby inhibiting oxidative stress response and ultimately alleviating pathological damage to the uterus.
[0166] As can be seen from the above embodiments, the present invention provides the application of carvacrol combined with astragaloside A in the preparation of a drug for treating endometritis. The present invention confirms that carvacrol combined with astragaloside A is effective against *Ralstonia pinnatifida* (…). R.pickettii The combination of carvacrol and astragaloside A in this invention has significant therapeutic benefits in treating mouse endometritis: It exhibits a synergistic antibacterial effect, rapidly reducing mouse body temperature, improving weight loss, significantly decreasing uterine index, alleviating tissue congestion and edema, and significantly downregulating pro-inflammatory factors such as TNF-α, IL-1β, and IL-6 while upregulating the anti-inflammatory factor IL-10, thus inhibiting excessive activation of inflammatory signals. Simultaneously, it reduces MDA, increases SOD and GSH levels, and alleviates oxidative stress damage. Therefore, the combination of carvacrol and astragaloside A in this invention can effectively repair the pathological structure of the uterus, with superior effects compared to single drugs, and is safe and has no significant toxicity, providing a safe and drug-free natural alternative for endometritis in livestock.
Claims
1. Application of carvacrol combined with astragaloside in the preparation of drugs for treating endometritis.
2. The application according to claim 1, characterized in that, The concentration of carvacrol in the drug for treating endometritis is 0.007~0.3 mg / mL, and the concentration of astragaloside A in the drug for treating endometritis is 0.2~10 mg / mL.
3. A method for constructing a mouse model of endometritis, characterized in that, Includes the following steps: The concentration for intrauterine perfusion in mice was 1×10 7 ~1×10 9 CFU / mL of Ralstonia pinnili.
4. The construction method according to claim 3, characterized in that, The perfusion frequency is 1 to 3 times / day, the perfusion volume is 90 to 110 μL / day, and the perfusion duration is 6 to 8 days.
5. A set of indicators for detecting endometritis in mice, characterized in that, The indicators are any one or more of the following: body temperature, body weight, uterine index, inflammatory factor content, oxidative stress indicators, inflammatory factor mRNA expression level, and MAPK signaling pathway protein expression level.
6. The indicator according to claim 5, characterized in that, The method for determining the expression level of inflammatory factor mRNA includes the following steps: (1) Total RNA was extracted from uterine tissue samples and reverse transcribed to obtain cDNA; (2) Using cDNA as a template, qRT-PCR was performed to obtain the relative gene expression levels of inflammation-related factors in the sample.
7. The indicator according to claim 6, characterized in that, The inflammatory-related factors are one or more of TNF-α, IL-1β, IL-6, and IL-10; the qRT-PCR also used GAPDH Genes are used as internal reference genes.
8. The indicator according to claim 7, characterized in that, The CDS nucleotide sequence of the TNF-α is shown in SEQ ID NO:1, the CDS nucleotide sequence of the IL-1β is shown in SEQ ID NO:2, the CDS nucleotide sequence of the IL-6 is shown in SEQ ID NO:3, and the CDS nucleotide sequence of the IL-10 is shown in SEQ ID NO:
4. GAPDH The CDS nucleotide sequence is shown in SEQ ID NO:
5.
9. The indicator according to claim 8, characterized in that, The nucleotide sequence of the forward primer of SEQ ID NO:1 is as shown in SEQ ID NO:6, and the nucleotide sequence of the reverse primer of SEQ ID NO:1 is as shown in SEQ ID NO:7; The nucleotide sequence of the forward primer of SEQ ID NO:2 is as shown in SEQ ID NO:8, and the nucleotide sequence of the reverse primer of SEQ ID NO:2 is as shown in SEQ ID NO:9; The nucleotide sequence of the forward primer of SEQ ID NO:3 is as shown in SEQ ID NO:10, and the nucleotide sequence of the reverse primer of SEQ ID NO:3 is as shown in SEQ ID NO:11; The nucleotide sequence of the forward primer of SEQ ID NO:4 is as shown in SEQ ID NO:12, and the nucleotide sequence of the reverse primer of SEQ ID NO:4 is as shown in SEQ ID NO:13; The nucleotide sequence of the forward primer of SEQ ID NO:5 is as shown in SEQ ID NO:14, and the nucleotide sequence of the reverse primer of SEQ ID NO:5 is as shown in SEQ ID NO:15.