Indexing techniques for tagmented dna libraries

By indexing DNA samples in a flow cell, the problems of expensive and time-consuming instruments in the DNA fragmentation and labeling process in existing technologies are solved, enabling efficient and low-cost DNA sample analysis.

CN122374829APending Publication Date: 2026-07-10ILLUMINA INC
View PDF 24 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ILLUMINA INC
Filing Date
2024-12-13
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Existing technologies suffer from expensive and time-consuming instruments in DNA fragmentation and labeling processes, and it is difficult to effectively track and combine different DNA samples.

Method used

Flow cell technology is used to index multiple DNA samples in a single flow cell, enabling the labeling and analysis of DNA samples through unique sequences, spatial indexing, or a combination of both.

Benefits of technology

It enables efficient analysis of multiple DNA samples in a single flow cell, reducing instrument costs and time consumption, and improving the tracking and combination capabilities of DNA samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122374829A_ABST
    Figure CN122374829A_ABST
Patent Text Reader

Abstract

Tagmentation and subsequent processing, such as extension reactions, are used to generate fully- adapted DNA fragments. Several flow cell architectures, methods, and / or kits are described that enable these fully-adapted DNA fragments to be indexed in some form so that fragments from several different DNA samples can be analyzed on the same flow cell.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-references to related applications

[0002] This application claims the benefits of U.S. Provisional Application Serial No. 63 / 715,950, filed November 4, 2024, and U.S. Provisional Application Serial No. 63 / 715,419, filed November 1, 2024, and U.S. Provisional Application Serial No. 63 / 611,026, filed December 15, 2023, and U.S. Provisional Application Serial No. 63 / 610,279, filed December 14, 2023, the contents of each of which are incorporated herein by reference in their entirety.

[0003] Reference to sequence list

[0004] The accompanying sequence list is incorporated herein by reference in its entirety. The file is named ILI276BPCT_IP-2749-PCT_Sequence_Listing.xml, is 17,739 bytes in size, and was created on December 5, 2024. Background Technology

[0005] Double-stranded deoxyribonucleic acid (dsDNA) target molecules can be fragmented and labeled to generate libraries of smaller double-stranded DNA molecules, which can then undergo additional processing to generate single-stranded DNA molecules (ssDNA). These smaller single-stranded DNA molecules can be used as templates in DNA sequencing reactions. Templates enable the production of short read lengths, which can then be aligned during data analysis to reconstruct longer nucleotide sequences by comparing overlapping short reads. Some methods for fragmentation and labeling of double-stranded DNA generate excessive waste, involve expensive instrumentation for fragmentation, and are time-consuming. Furthermore, some fragmentation and labeling methods are limited in their ability to combine and track different DNA samples. Summary of the Invention

[0006] The flow cells, methods, and / or kits disclosed herein enable some form of indexing so that multiple DNA samples (or fragments thereof) can be introduced into and analyzed on a single flow cell. In some cases, indexing is achieved with a unique sequence incorporated into each transposon complex used to label a particular DNA sample and generate a perfectly fitted fragment of that particular DNA sample. In these cases, these perfectly fitted fragments are indexed. In other cases, indexing is achieved through "spatial indexing," where fragments of a particular DNA sample are located in a specific region or area of ​​the flow cell. In still other cases, both fragment indexing and spatial indexing are used. In yet another example, parallel processing of DNA samples is used as a form of indexing. Attached Figure Description

[0007] The features of this disclosure will become apparent from the following detailed description and accompanying drawings, in which similar reference numerals correspond to similar but possibly different parts. For the sake of brevity, reference numerals or features having the functions previously described may be described in conjunction with or without conjunction with other accompanying drawings in which they appear.

[0008] Figure 1 This is a top view of the flow cell;

[0009] Figure 2A yes Figure 1 A cross-sectional view of a flow channel architecture of a flow pool, which includes recesses separated by gap regions;

[0010] Figure 2B yes Figure 1 A cross-sectional view of another flow channel architecture of the flow pool, which includes a single lane;

[0011] Figure 3 This is a schematic diagram for primer identification;

[0012] Figure 4 This is a schematic diagram of a flow cell and DNA samples conjugated with different recognition primers introduced into the flow cell at predetermined regions / areas.

[0013] Figure 5A and Figure 5B Different examples of transposon complexes that can be used in different examples of the methods disclosed herein are depicted;

[0014] Figure 6 The light-triggered DNA intercalators in non-intercalation and intercalation forms are shown;

[0015] Figure 7 The diagram schematically illustrates a lane in a flow cell during the sequential steps of a method that uses light to trigger different zones of the lane;

[0016] Figures 8A to 8F Different examples of transposon complexes that can be used in different examples of the methods disclosed herein are depicted;

[0017] Figure 9 An example method using solution-based label fragmentation is illustrated schematically;

[0018] Figure 10 The diagram schematically illustrates several flow cell recesses that bind individual binding complexes;

[0019] Figure 11 The formation of two different binding complexes is illustrated schematically;

[0020] Figure 12The diagram illustrates an example of using solution-based tag fragmentation to generate binding complexes, and another example of using a combination of spatial tags and target primers to bind the binding complexes into a flow cell.

[0021] Figure 13 The diagram illustrates another example method of using solution-based tag fragmentation to generate binding complexes and using a light-triggered activation mechanism to attach the binding complexes to the surface of a flow cell.

[0022] Figure 14 A kit for preparing semi-active transposon dimers and the dimers formed using the kit are illustrated schematically.

[0023] Figure 15 The use is illustrated schematically. Figure 14 The reagent kit forms dimers and some dimers in the dimers attach to the solid carrier;

[0024] Figure 16 A recessed portion of a flow cell having a surface-bonded transposable for use with a semi-active transposable dimer is schematically shown, with the illustration depicting two different surface-bonded transposable complexes.

[0025] Figure 17 The diagram schematically illustrates cis and trans tag fragmentation using semi-active transposon dimers, as well as the tag-fragmented DNA strands after transposase removal;

[0026] Figure 18 The illustration schematically shows three different DNA samples fragmented with three unique indexed semi-active transposon dimer tags;

[0027] Figures 19A to 19D The diagram schematically depicts different surface tag fragmentation that can occur on DNA samples that have already been fragmented with semi-active transposon dimer tags;

[0028] Figures 20A to 20D Each is described separately. Figures 19A to 19D A schematic flowchart illustrating the details of tag fragmentation;

[0029] Figure 21 The illustration schematically shows the tag fragmentation results when two surface tag fragmentation events occur between two half-tag fragmentation sites on a DNA sample;

[0030] Figure 22 This is a schematic flowchart depicting another example of surface tag fragmentation that can occur on a DNA sample that has already been fragmented with a semi-active transposon dimer tag;

[0031] Figure 23schematically depicted Figure 22 Details of label fragmentation for different examples (A to D) of the methods shown;

[0032] Figure 24A It is a sectional perspective view of a spatial indexing device;

[0033] Figure 24B Includes perspective views and schematic diagrams of three different encapsulation compounds;

[0034] Figure 25A This is a cross-sectional perspective view of a pendant drop array plate being moved to an operable position above an example flow cell;

[0035] Figure 25B yes Figure 25A An enlarged view of the recessed subset;

[0036] Figure 26A This is a schematic and perspective flowchart illustrating the bonding method for flow cell precursors;

[0037] Figure 26B Is Figure 26A A cross-sectional view of the apparatus used in the joining method;

[0038] Figure 27 This is a top view of the flow cell precursor, in which a DNA sample is introduced into a predetermined area;

[0039] Figure 28A This is a diagram illustrating an example method of using a wrapper container to implement space indexing;

[0040] Figure 28B The selective attachment of two different encapsulation containers at two different regions of the flow cell and the release of two different DNA samples from the two different encapsulation containers were depicted.

[0041] Figure 29 It is a graph depicting the percentage of mapped readings (Y-axis) for two control samples (L1, L3) and four example samples (L5, L7);

[0042] Figure 30 This is a schematic diagram of haplotype test results from tag fragmentation and sequencing runs (A to H) and phasing from whole-genome sequencing reads (samples 1 to 4);

[0043] Figure 31A and Figure 31B A general homodimer that can be used in the methods described in the series of Figures 33 is depicted;

[0044] Figure 32A An example of a unique double-addition index chain that can be used in the methods described in the series of Figures 33 is schematically depicted;

[0045] Figure 32B Another example of a general homodimer and a corresponding unique double-addition index chain that can be used in the methods described in the series of Figures 33 is depicted;

[0046] Figure 32C Another example of a general homodimer and a corresponding unique double-addition index chain that can be used in the methods described in the series of Figures 33 is depicted;

[0047] Figure 33A and Figure 33B Together, another example approach using solution-based label fragmentation is illustrated.

[0048] Figure 33C It shows that they can be combined Figure 33A and Figure 33B Additional procedures executed by the method;

[0049] Figure 34 It is a graph depicting the percentage of reads identified per index in a mixed sample;

[0050] Figure 35 It is a graph depicting the percentage of reads identified per index in a mixed sample of transposable complexes with varying volumes.

[0051] Figure 36 It is a graph depicting the percentage of reads identified per index in a mixed sample with varying merge volumes; and

[0052] Figure 37 Various sequencing metrics were described for a mixture containing 64 samples. Detailed Implementation

[0053] Some examples disclosed in this article enable fragments from several different DNA samples to be indexed and thus analyzed on the same flow cell surface.

[0054] Other examples disclosed in this paper combine several unindexed samples together for tagging, fragmentation, and sequencing, and in parallel, expose these samples to single nucleotide polymorphism (SNP) assays or whole-genome sequencing. The results of the parallel procedures are compared to identify which haplotype belongs to which sample.

[0055] definition

[0056] Unless otherwise specified, the terms used herein should be understood to have their common meanings in the relevant fields. Several terms used herein and their meanings are listed below.

[0057] As used herein, the singular forms “a,” “an,” and “the” include both the singular and plural forms unless the context clearly indicates otherwise. As used herein, the term “comprising” is synonymous with “including,” “containing,” or “characterized in,” and is inclusive or open-ended, and does not exclude additional unlisted elements or method steps.

[0058] Throughout this specification, the terms "an example," "another example," and "example" refer to specific elements described in connection with that example (e.g., features, structures, compositions, configurations, and / or characteristics) included in at least one example described herein, and may or may not exist in other examples. Furthermore, it should be understood that the elements used in any example may be combined in any suitable manner across various examples, unless the context explicitly states otherwise.

[0059] The terms top, bottom, lower, upper, and above are used herein to describe flow cells and / or their various components. It should be understood that these directional terms are not intended to suggest a particular orientation, but rather to specify the relative orientation between components. The use of directional terms should not be construed as limiting the examples disclosed herein to any particular orientation.

[0060] The terms first, second, etc. are not intended to suggest a particular orientation or order, but are used to distinguish one component from another.

[0061] It should be understood that the ranges provided herein include the specified range and any values ​​or sub-ranges within the specified range, as if such values ​​or sub-ranges were expressly listed. For example, the range of about 400 nm to about 1 µm (1000 nm) should be interpreted as including not only the expressly listed limit of about 400 nm to about 1 µm, but also individual values ​​such as about 708 nm, about 945.5 nm, etc., and sub-ranges such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc.

[0062] The terms “substantially” and “about” as used throughout this disclosure (including the claims) are used to describe and indicate minor fluctuations, such as those caused by variations in the processing. For example, these terms may refer to less than or equal to ±5% of a specified value, such as less than or equal to ±2% of a specified value, such as less than or equal to ±1% of a specified value, such as less than or equal to ±0.5% of a specified value, such as less than or equal to ±0.2% of a specified value, such as less than or equal to ±0.1% of a specified value, such as less than or equal to ±0.05% of a specified value.

[0063] Adaptor: A linear oligonucleotide sequence that can be fused to a nucleic acid molecule, for example, by ligation or tag fragmentation, or can be generated from the 3' end of a nucleic acid molecule via an extension reaction. Suitable adaptor lengths can range from about 10 nucleotides to about 100 nucleotides, or from about 12 nucleotides to about 60 nucleotides, or from about 15 nucleotides to about 50 nucleotides. Adaptors can include any combination of nucleotides and / or nucleic acids. In some examples, an adaptor can include an amplification domain, such as having a universal nucleotide sequence, such as a P5 or P7 sequence, which can be used as a template amplification and cluster generation initiation point. For example, an adaptor can contain at least a portion of a sequence complementary to a primer (which includes a universal nucleotide sequence) that binds to a flow cell surface. In this example, the adaptor sequence can hybridize with the primer that binds to the complementary flow cell surface during amplification and cluster generation. In some examples, an adaptor can also include a sequencing primer sequence (i.e., a sequencing binding site) or a sequencing sample index (i.e., a barcode sequence). Combinations of different adaptors can be incorporated into nucleic acid molecules, such as DNA fragments generated via tag fragmentation.

[0064] Amplification: The replication of one or more nucleic acid templates, including their fragments, and thus creating multiple copies of one or more nucleic acid templates. Amplification may include one or more of the following: bridging amplification reaction, isothermal bridging amplification reaction, rolling circle amplification (RCA) reaction, modified rolling circle multiple substitution amplification, helicase-dependent amplification reaction, recombinase-dependent amplification reaction, single-stranded DNA-binding (SSB) protein-mediated isothermal amplification, polymerase chain reaction (PCR), strand displacement reaction, ligase chain reaction, transcription-mediated reaction, loop-mediated amplification reaction, other suitable reactions, and combinations thereof.

[0065] Amplification domain: Part of the adaptor with a universal nucleotide sequence, such as the P5 or P7 sequence or its complement, which can be used as a template for amplification and the starting point for cluster generation.

[0066] Attachment / attached: refers to a state in which two things are directly or indirectly, and physically or chemically, joined, fastened, adhered, connected, or combined with each other. As an example of chemical attachment, nucleic acids can be attached to polymer hydrogels via covalent or non-covalent bonds. Covalent bonds are characterized by the sharing of electron pairs between atoms. As an example, covalent attachment includes bonds generated using click chemistry techniques. Non-covalent bonds are physical bonds that do not involve the sharing of electron pairs and can include, for example, non-specific interactions (e.g., hydrogen bonds, ionic bonds, van der Waals forces) or specific interactions (e.g., affinity interactions (e.g., hydrophilic and hydrophobic interactions), receptor-ligand interactions, antibody-epitope interactions, avidin-biotin interactions, streptavidin-biotin interactions, lectin-carbohydrate interactions, etc.). Exemplary examples are set forth in U.S. Patent Nos. 6,737,236 B1, 7,259,258 B2, 7,375,234 B2, and 7,427,678 B2; and U.S. Patent Publication No. 2011 / 0059865 A1, each of which is incorporated herein by reference in its entirety.

[0067] In some examples, molecules (e.g., nucleic acids, enzymes) remain immobilized or attached to a solid support under conditions intended for use (e.g., in applications requiring nucleic acid amplification and / or sequencing). In other embodiments, molecules are reversibly immobilized or attached and can be removed from the solid support using cleavable sites, adapters, etc.

[0068] Clusters / Oligonucleotide Clusters / Coalesces: Local groups or collections of DNA or RNA molecules on a nucleotide sample carrier, such as a flow cell, particles, polymer scaffold, or other solid surface. Specifically, clusters comprise tens, hundreds, thousands, or more copies of cloned (i.e., identical) DNA or RNA segments. For example, in one or more examples, a cluster comprises a group of oligonucleotides immobilized in a segment of a flow cell or other nucleotide sample slide. In some examples, a cluster may contain one or more multiplying structures, such as, for example, clones or nanospheres. In some examples, clusters are uniformly spaced or organized into a systematic structure within a patterned flow cell. In contrast, in some examples, clusters are randomly organized within an unpatterned flow cell. In typical examples, clusters are products of an amplification reaction. Oligonucleotide clusters can be imaged using one or more light signals, pH changes, conductivity changes, and other signals. For example, images of oligonucleotide clusters can be captured by a camera during sequencing cycles. The image captures light emitted by complexes of illuminated fluorescently labeled nucleotides incorporated into oligonucleotides, fluorescently labeled nucleotides bound but not incorporated into oligonucleotides, and other fluorescently labeled complexes associated with incorporated or bound nucleotides from one or more clusters on the flow cell. Examples of other sequencing procedures are described herein. In some embodiments, the clusters may be monoclonal or polyclonal.

[0069] Correspondingly: When a primer "corresponds" to an amplification domain, it means that the primer and the amplification domain have the same sequence, so that a copy of the amplification domain generates a sequence complementary to the primer.

[0070] Deposition: Any suitable application technique, which can be manual or automated, and in some cases, results in modification of surface properties. Generally, deposition can be performed using vapor deposition, coating, grafting, and other techniques. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, thick coating or dip coating, doctor blade coating, agitation dispensing, flow-through coating, aerosol printing, screen printing, micro-contact printing, inkjet printing, etc.

[0071] Recess: A discrete concave or recessed feature in a substrate or a layer of the substrate (e.g., a patterned resin), having a surface opening at least partially surrounded by a gap region of the substrate or layer. The recess may have any of a variety of shapes at its opening on its surface, including, for example, circular, elliptical, square, polygonal, star-shaped (with any number of vertices), etc. The cross-section of the recess, orthogonal to the surface, may be curved, square, polygonal, hyperbolic, conical, angular, etc. The recess may also have more complex framework structures, such as ridges, stepped features, etc.

[0072] DNA sample: Genetic material extracted from cells, wherein the genetic material comprises DNA molecules. DNA molecules are polymers of nucleotides of any length, including deoxyribonucleotides, deoxyribonucleotide analogs, or complementary deoxyribonucleotides derived from RNA (ribonucleic acid) samples. DNA samples are double-stranded. DNA samples may include naturally occurring DNA, which comprises nitrogenous heterocyclic bases (nucleobases such as adenine, thymine, cytosine, and / or guanine), sugars (particularly deoxyribose, i.e., sugars lacking the hydroxyl group at the 2' position of the ribose), and a backbone containing phosphodiester bonds. Similar structures may have alternative backbone bonds, including any of the various backbone bonds known in the art.

[0073] DNA samples can be genomic DNA (gDNA), which can be isolated from one or more cells, bodily fluids (e.g., whole blood, blood spots, saliva), or tissues. gDNA can be prepared by lysing cells containing that DNA. Cells can be lysed under conditions that substantially preserve the integrity of the cellular gDNA. In one particular example, thermal lysis can be used to lyse cells. In another particular example, cell exposure to an alkaline pH can be used to lyse cells with relatively little damage to the gDNA. Any of a variety of alkaline compounds can be used for lysis, including, for example, potassium hydroxide, sodium hydroxide, etc. Additionally, relatively undamaged gDNA can be obtained from cells lysed by enzymes that degrade the cell wall. Cells lacking a cell wall, either naturally or due to enzyme removal, can also be lysed by exposure to osmotic stress. Other conditions that can be used for cell lysis include exposure to detergents, mechanical damage, ultrasonic heat treatment, pressure differentials such as French press equipment or Dounce homogenization. Reagents that stabilize gDNA can be included in the cell lysate or isolated gDNA sample, including, for example, nuclease inhibitors, chelating agents, salts, buffers, etc. Crude cell lysates containing gDNA can be used without further separation of gDNA. In one example, whole blood samples can be lysed using a lysis buffer without inorganic salts, and the crude lysate can be exposed to specific processing steps to generate a composite crude lysate. This composite crude lysate can also be used as a DNA sample without further separation or purification.

[0074] DNA samples are an example of nucleic acid samples. Nucleic acid samples are samples containing DNA and / or RNA derived from any living organism, including, for example, animals, plants, fungi, and microorganisms. Such samples can be derived from one or more biological fluids, cells, tissues, organs, or organisms that contain nucleic acids or mixtures of nucleic acids containing at least one nucleic acid sequence. Such samples can include, but are not limited to, sputum / oral fluid, amniotic fluid, blood, blood fractions, fine-needle biopsy samples (such as surgical biopsies, fine-needle biopsies, etc.), urine, peritoneal fluid, pleural fluid, etc. While samples are often taken from human subjects (such as patients), samples can be derived from any mammal, including but not limited to dogs, cats, horses, goats, sheep, cattle, pigs, etc. Alternatively, samples can be microorganisms, such as bacteria, viruses, or fungi. Samples can be used directly when obtained from a biological source or after pretreatment to alter the properties of the sample. For example, such pretreatment can include preparing plasma from blood, diluting viscous fluids, etc. Pretreatment methods may include, but are not limited to, filtration, precipitation, dilution, distillation, mixing, centrifugation, freezing, lyophilization, concentration, amplification, nucleic acid fragmentation, inactivation of interfering components, addition of reagents, lysis, etc. If such pretreatment methods are used on a sample, they typically result in the retention of the nucleic acid of interest in the test sample, sometimes at a concentration proportional to that in an untreated test sample (e.g., a sample not subjected to any such pretreatment methods). For the purposes of the methods described herein, such “treated” or “processed” samples are still considered biological “test” samples. A “nucleic acid sample” may also include nucleic acid sequence information stored in memory and originally obtained from a source such as one or more biological fluids, cells, tissues, organs, or organisms.

[0075] Each: When used to refer to a set of items, each identifies an individual item in the set, but not necessarily every item in the set. Exceptions may occur if explicitly stated or otherwise specified in the context.

[0076] Flow cell: A container having a closed flow channel in which a reaction can take place, or a container having a channel open to the surrounding environment in which a reaction can take place. A container having an open flow channel may be referred to herein as an open wafer flow cell. Any example of a flow cell may include an inlet for delivering reagents to the channel and an outlet for removing reagents from the channel. In some examples, a flow cell enables the detection of reactions occurring therein. For example, a flow cell may include one or more transparent surfaces that allow optical detection of arrays, optically labeled molecules, etc.

[0077] Flow channel: A region defined between two joined or otherwise attached components or within a lane such that the lane is open to the surrounding environment. Flow channels can selectively receive liquid samples. In some examples, flow channels may be defined between two patterned sequencing surfaces or between a patterned sequencing surface and a cap, and are therefore in fluid communication with one or more components of the sequencing surface.

[0078] Fragment: A portion or fragment of a DNA sample. A "partially fitted fragment" is a portion or fragment of a DNA sample that has been tagged and fragmented and therefore contains an adaptor attached to the 5' end of the DNA fragment. A "fully fitted fragment" is a portion or fragment of a DNA sample with adaptors attached at both the 3' and 5' ends of the DNA fragment.

[0079] Fragmentation: The breaking of nucleic acids into shorter lengths. Fragmentation methods include enzymatic methods, physical methods (including sonication, nebulization, needle shearing, microwave, etc.), and chemical methods (including depurination, hydrolysis, oxidation, etc.). As used herein, the terms "enzyme fragmentation," "enzyme-based fragmentation," or "enzyme fragmentation" refer to the enzyme that fragments nucleic acids. Enzymes can be a single enzyme or two or more enzymes working together to fragment nucleic acids. Some enzymes act on single-stranded nucleic acids, while others act on double-stranded nucleic acids, and still others act on one strand of a double-stranded nucleic acid. Fragmenting enzymes can cleave nucleic acids randomly or specifically. Examples of fragmenting enzymes include transposases, restriction enzymes, argonautes, CRISPR-associated nucleases (Cas), endonucleases, exonucleases, topoisomerases, and fragmentases. ™ (New England Biolabs, Ipswich, MA). Preferred fragmentation implementations include methods that fragment while preserving the proximity information of the fragments.

[0080] Primers: Single-stranded nucleic acid molecules capable of hybridizing with a target sequence, such as adaptors attached to fragments. As an example, flow cell surface-bound primers can be used as starting points for fragment amplification and cluster generation. As another example, flow cell surface-bound primers can act as hybridization sites for spatial tags and are therefore used for targeted attachment of specific transposon complexes and DNA samples. Furthermore, primers capable of hybridizing with fragments or fragment amplicones (e.g., sequencing primers) can be introduced to initiate the synthesis of a new strand complementary to the fragment or fragment amplicon. Any primer can comprise any combination of nucleotides or their analogues. In some examples, primers are single-stranded oligonucleotides or polynucleotides. Primer length can be any number of bases long. In the examples, each of the flow cell surface-bound primers and sequencing primers is a short chain, ranging from 10 to 60 bases, or 20 to 40 bases.

[0081] Nanospheres: Multicomponents containing multiple copies of a target nucleic acid molecule. Rolling circle amplification / replication can be used to form nucleic acid nanospheres. These nucleic acid copies can be arranged one after another in a continuous linear strand of nucleotides. These nucleic acid copies can produce the folded configuration of the nanospheres. The multiple copies of the target nucleic acid molecule in the nucleic acid nanospheres can each contain an adaptor sequence with a known sequence to facilitate amplification or sequencing. The adaptor sequence for each target nucleic acid molecule can be the same or different. Nucleic acid nanospheres can be mounted on the surface of a solid support. Nanospheres can be attached to the surface of a solid support by any suitable method. Examples of such methods include nucleic acid hybridization, biotin-streptavidin binding, thiol binding, photoactive binding, covalent binding, antibody-antigen, physical constraint via hydrogels or other porous polymers, or combinations thereof. In some cases, nanospheres can be digested with enzymes (such as nucleases) to produce smaller nanospheres or fragments derived from the nanospheres.

[0082] Patterning / Randomization: In some embodiments, the solid carrier includes a patterned surface suitable for immobilizing molecules (such as enzymes, nucleic acids, and their complexes) in an ordered pattern. A “patterned surface” refers to the arrangement of different regions or features in or on an exposed layer of the solid carrier. Features may be separated by gap regions that contribute to the patterning. In some embodiments, the gap regions may have different heights, creating a plateau pattern of holes or raised areas. In other embodiments, the gap regions may have different surface charges. In still other embodiments, the gap regions may have different attachment portions. In some embodiments, the pattern can be any suitable pattern, such as a grid pattern, a radial pattern, and combinations thereof. In some embodiments, the patterned surface may contain predetermined locations of features, but these features are not arranged in a repeating pattern. Examples of grid patterns include rectangular patterns, hexagonal patterns, triangular patterns, and other suitable grid patterns. The regions used for immobilizing molecules can be recessed, raised, or planar regions relative to the gap regions. These regions can be fabricated using a variety of techniques commonly known in the art, including but not limited to photolithography, imprinting, molding, micro-etching, and combinations thereof. As those skilled in the art will appreciate, the techniques used will depend on the composition and shape of these regions. For example, regions used to anchor molecules on a patterned surface can be holes, pits, channels, pillars, struts, ridges, stripes, vortices, lines, and other suitable morphologies. For example, holes can have any shape of opening, such as circular, elliptical, or polygonal (e.g., hexagonal, octagonal, square, rectangular, elliptical, etc.). Exemplary patterned surfaces that can be used in the methods and compositions described herein are described in U.S. Patent No. 8,778,849 B2, the entire contents of which are incorporated herein by reference.

[0083] In some embodiments, the solid support includes a surface adapted to immobilize molecules (such as enzymes, nucleic acids, and complexes thereof) in a random distribution over the solid support. Exemplary random distributions over a solid support are described in U.S. Patent No. 8,241,573 B2, the entire contents of which are incorporated herein by reference.

[0084] Polymerase Cloning: Some embodiments further include rolling circle amplification / replication for forming a polymerase clone. As used herein, the term "polymerase clone (polony / polonies)" refers to a nucleic acid library molecule cloned and amplified in solution or on a vector to generate an amplicon that can be used as a template molecule for sequencing. In some aspects, linear library molecules may be circularized to generate circularized library molecules, and these circularized library molecules may be cloned and amplified in solution or on a vector to generate polyplets. In some aspects, polyplets may serve as nucleic acid template molecules that can be sequenced. Polyplets are sometimes referred to as polymerase clones. In some aspects, polymerase clones contain nucleotide chains.

[0085] Sequencing Procedure: The term "read" or "sequence read" (or sequencing read) refers to a sequence obtained from a portion of a nucleic acid sample. A read can be represented by a string of nucleotides sequenced from any part or all of a nucleic acid molecule. Typically, although not mandatory, a read represents a short sequence of adjacent base pairs in the sample. Reads can be symbolically represented by the base pair sequence (A, T, C, or G) of a portion of the sample. Reads can be stored in a storage device and processed as appropriate to determine whether the read matches a reference sequence or meets other criteria. Reads can be obtained directly from the sequencing device or indirectly from stored sequence information about the sample. In some cases, a read is a DNA sequence of sufficient length (e.g., at least about 25 bp) that can be used to identify larger sequences or regions, for example, that can be aligned and specifically assigned to chromosomal or genomic regions or genes. For example, a sequence read can be a short nucleotide string (e.g., 20-150 bases) sequenced from a nucleic acid fragment, a short nucleotide string at one or both ends of a nucleic acid fragment, or the sequencing of an entire nucleic acid fragment present in a biological sample. Sequence reads can be obtained by any method known in the art. For example, sequence reads can be obtained in a variety of ways, such as using sequencing technologies or using probes, such as in hybridization arrays or capture probes, or amplification technologies.

[0086] The implementation scheme described herein can be used with any suitable sequencing chemistry, such as sequencing by synthesis (SBS), binding sequencing, ligation sequencing, or nanopore sequencing.

[0087] SBS can be performed with or without a reversible terminator. For example, SBS can be initiated by contacting the target nucleic acid with one or more nucleotides (e.g., labeled, synthetic, modified nucleotides, or combinations thereof), a DNA polymerase, etc. Those features of the primer extension using the target nucleic acid as a template will be incorporated into the detectable labeled nucleotide. Using a modified polymerase can significantly reduce the incorporation time used in sequencing runs. Optionally, the labeled nucleotide may also include a reversible termination property that terminates further primer extension once the nucleotide is added to the primer. For example, a nucleotide analog with a reversible terminator motif can be added to the primer such that subsequent extension does not occur until a deblocking agent is delivered to remove that motif. Thus, in an embodiment using reversible termination, a deblocking agent can be delivered to the flow cell (before or after detection). Washing can be performed between the individual delivery steps. This cycle can then be repeated n times to extend the primer by n nucleotides, thereby detecting a sequence of length n. Exemplary SBS procedures, fluid systems, and detection platforms readily adaptable for use with arrays generated by the methods of this disclosure are described, for example, in the following documents: Bentley et al., Nature 456:53-59 (2008); WO 2004 / 018497 A2; WO 1991 / 006678 A1; WO2007 / 123744 A2; U.S. Patents 7,057,026 B2, 7,329,492 B2, 7,211,414 B2, 7,315,019 B2, 7,405,281 B2, and 8,343,746 B2. MiNISeq, such as that from Illumina, Inc. (San Diego, CA), can also be used. ™ MiSeq ™ (For example, MiSeq) ™ i100), NextSeq ™ HiSeqX ™ and NovaSeq ™ The sequencing instrument generates sequence reads.

[0088] An example of SBS is called conjugation sequencing. A specific implementation of conjugation sequencing involves the following cycle: initiating sequencing of a template with a reversible blocking agent at the 3' end to prevent the incorporation of additional bases; interrogating the template by flooding the flow cell with fluorescently labeled bases without the blocking agent and measuring the emission signal of the conjugated bases; activating the 3' end by removing the reversible blocking agent; and incorporating a complementary base from the unlabeled blocking nucleotide. Reads obtained using conjugation sequencing can be obtained using Onso, such as those from Pacific Biosciences of California, Inc. (Menlo Park, CA). ™ Instrument generation for sequencing instruments. Another specific implementation of sequencing can be affinity sequencing. In affinity sequencing, a core is labeled with a fluorescent dye called an affinity agent. A potential cycle of affinity sequencing involves providing a polymerase and reagents for reversibly terminated nucleotides to a template immobilized on a solid surface, deblocking the incorporated nucleotides, allowing a set of four types of affinity agents to flow, washing away unbound affinity agents, detecting incorporated bases / nucleotides, and removing bound affinity agents. The steps in the affinity sequencing cycle can be performed in other orders. Affinity sequencing is described in Arslan, S., Garcia, FJ, Guo, M. et al., “Sequencing by avidity enables high accuracy with low reagent consumption.” Nat Biotechnol 42, 132–138 (2024). https: / / doi.org / 10.1038 / s41587-023-01750-7, the full text of which is incorporated herein by reference. Reads obtained using affinity sequencing can be obtained using technologies such as AVITI from Element Biosciences (San Diego). ™ Instrument generation for sequencing instruments.

[0089] An example of an SBS using an open flow cell without a reversible terminator is published in Almogy, G., (2022) “Cost-efficient whole genome-sequencing using novel mostly naturalsequencing-by-synthesis chemistry and open fluidics platform” https: / / doi.org / 10.1101 / 2022.05.29.493900, the full text of which is incorporated herein by reference. Sequence reads using an open flow cell can be generated using instruments such as the UG 100™ sequencer from Ultima Genomics, Inc. (Fremont, CA).

[0090] Some SBS implementations include detecting protons released during nucleotide incorporation into the extension product. For example, sequencing based on the detection of released protons can utilize electrical detectors and related techniques described in U.S. Patent Nos. 8,262,900 B2, 7,948,015 B2, 8,349,167 B2, and U.S. Patent Publication 2010 / 0137143 A1, each of which is incorporated herein by reference in its entirety.

[0091] Sequence reads can be sequenced using instruments such as the DNBSEQ™ sequencing instrument from MGI TechCo., Ltd. (Shenzhen, China) and the SURFSeq instrument from GeneMind Biosciences Co., Ltd. (Shenzhen, China). ™ FASTASeq ™ and GenoLab ™ The sequencing instrument is used to generate it.

[0092] Some implementations can utilize methods involving real-time monitoring of DNA polymerase activity. For example, nucleotide incorporation can be detected via fluorescence resonance energy transfer (FRET) interactions between a polymerase carrying a fluorophore and a γ-phosphate-labeled nucleotide, or by utilizing a zero-mode waveguide. Techniques and reagents for FRET-based sequencing are described in, for example, the following publications: Levene et al., Science 299, 682-686 (2003); Lundquist et al., Opt. Lett. 33, 1026-1028 (2008); and Korlach et al., Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), each of which is incorporated herein by reference in its entirety. The technique for sequencing using a zero-mode waveguide is described in U.S. Patent No. 6,917,726 B2, which is incorporated herein by reference in its entirety.

[0093] Solid substrate: The terms “solid substrate,” “solid surface,” and other grammatical equivalents herein refer to any substrate suitable for, or that can be modified to be suitable for, the attachment of enzymes, nucleic acids, and their complexes. As those skilled in the art will understand, the number of possible substrates is very large. Possible substrates include, but are not limited to, glass and modified or functionalized glass, polymers (including acrylics, polystyrene and copolymers of styrene and other materials), polypropylene, polyethylene, polybutene, polyurethane, and polytetrafluoroethylene (e.g., Teflon from Chemours). ™ Solid carriers may include polyamides (i.e., nylon), polysaccharides, nitrocellulose, ceramics, resins, silica or silica-based materials (including silicon and modified silicon), carbon, metals, fiber bundles, quartz, metal oxides, inorganic oxides, other suitable transparent materials, other suitable opaque materials, other suitable translucent materials, and combinations thereof. The composition and geometry of the solid carrier may vary depending on its application.

[0094] In some embodiments, the solid carrier or solid surface is a planar structure, such as a flow cell, glass slide, chip, microchip, array, microarray, wafer, panel, charging pad, and / or mesh. The planar structure can be a single-surface structure with a single surface having sample / reaction sites. The planar structure can also be a dual-surface structure. An example of a dual-surface structure includes a top substrate with a top surface having sample / reaction sites, a bottom substrate with a bottom surface having sample / reaction sites, and a spacer layer separating the top and bottom substrates. The solid carrier or solid surface can be open to directly apply fluid. An example of an open solid carrier or open solid surface is an open flow cell with a single surface structure and no inlet port. In some embodiments, the solid carrier is not necessarily planar, such as the surface of a hole, tube, or other container. Non-limiting examples include the surface of a microcentrifuge tube, the pores of a multi-well plate, etc.

[0095] In some implementations, the solid carrier includes one or more surfaces of a flow cell. As defined herein, the term "flow cell" refers to a solid surface over which one or more fluid reagents can flow. Examples of flow cells, associated fluid systems, and detection platforms readily applicable to the methods of this disclosure are described in, for example, the following documents: Bentley et al., Nature 456:53-59 (2008), WO 2004 / 018497 A2; U.S. Patent No. 7,057,026 B2; WO 1991 / 06678 A1; WO 2007 / 123744 A2; U.S. Patent No. 7,329,492 B2; U.S. Patent No. 7,211,414 B2; U.S. Patent No. 7,315,019 B2; U.S. Patent No. 7,405,281 B2; and U.S. Patent Publication 2008 / 0108082 A1, each of which is incorporated herein by reference in its entirety. In some embodiments, the flow cell may include one or more flow lanes. For a flow pool with multiple flow lanes, each of these flow lanes can be picked up independently, or two or more flow lanes can be picked up as a group.

[0096] In some embodiments, the solid carrier or solid surface is a non-planar structure, such as the inner and / or outer surface of beads, microspheres, and / or tubes or containers. The terms “beads,” “microspheres,” or “particles,” or their grammatical equivalents, refer herein to small, discrete particles. Suitable bead compositions include, but are not limited to, plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thorium oxide sol, carbon graphite, titanium dioxide, latex, and polysaccharides (e.g., Dextran). ™ Sepharose™ cellulose), polyamide, cross-linked micelles, Teflon ™ Any other materials outlined herein for solid supports may be used. The “Microsphere Detection Guide” from Bangs Laboratories, Fishers Ind., Fisher, Indiana, is a useful guide. In some embodiments, the microspheres are magnetic microspheres or beads. The beads need not be spherical; irregular particles may be used. Alternatively or otherwise, the beads may be porous. Bead sizes range from nanometers (i.e., 100 nm) to millimeters (i.e., 1 mm), with beads of about 0.2 micrometers to about 200 micrometers being preferred, and beads of about 0.5 micrometers to about 5 micrometers being particularly preferred, but smaller or larger beads may be used in some embodiments.

[0097] Tag fragmentation: The process in which a DNA sample is cleaved / fragmented and labeled (e.g., labeled with an adaptor) for analysis. Tag fragmentation is an in vitro transposition reaction.

[0098] Transfer and non-transfer chains: The term "transfer chain" refers to a sequence containing a transfer portion at the transposon end. Similarly, the term "non-transfer chain" refers to a sequence containing a non-transfer portion at the transposon end. The 3' end of the transfer chain binds to or transfers into the double-stranded segment during tag fragmentation. The non-transfer chain does not bind to or transfer into the double-stranded segment during tag fragmentation. In the example, both the transfer and non-transfer chains contain at least partially complementary portions that are covalently bound together.

[0099] Transposase (or Transposase Enzyme): An enzyme capable of forming a functional complex with a composition containing transposon ends (e.g., a transposon, a transposon end, or a transposon-terminal composition) and catalyzing, for example, in an in vitro transposition reaction (i.e., tag fragmentation) the insertion or transposition of the transposon-terminal composition into a double-stranded DNA sample incubated therewith. Transposases as described herein may also include integrase from retrotransposons and retroviruses. Although many examples described herein refer to Tn5 transposases and / or highly active Tn5 transposases, it should be understood that any transposase capable of inserting a 5'-tag with sufficient efficiency into the transposon end and fragmenting the DNA sample for its intended purpose may be used.

[0100] Transposon / Transposon Complex: An entity formed between a transposase and a nucleic acid. Typically, the nucleic acid is a double-stranded nucleic acid containing a transposase integration recognition site. For example, a transposon complex can be the product of incubating a transposase with double-stranded transposon DNA under conditions supporting the formation of a non-covalent complex. Double-stranded transposon DNA can include, for example, Tn5 DNA, a portion of Tn5 DNA, transposon end compositions, mixtures of transposon end compositions, or other double-stranded DNA capable of interacting with transposases, such as highly active Tn5 transposases.

[0101] Transposon ends: Double-stranded nucleic acid strands exhibiting only the nucleotide sequence (“transposon end sequence”) necessary for forming a complex with the transposase that functions in tag fragmentation. The double-stranded nucleic acid strands at the transposon ends may include any nucleic acid or nucleic acid analog suitable for forming a functional complex with the transposase. For example, transposon ends may contain native DNA or DNA analogs (containing modified bases and / or the backbone) and may contain nicks in one or both strands.

[0102] Transposases, transposons, and transposon complexes are generally known to those skilled in the art, as illustrated in the disclosure of U.S. Patent Publication 2010 / 0120098 A2, the entire contents of which are incorporated herein by reference. While many embodiments described herein relate to Tn5 transposases and / or highly active Tn5 transposases, it should be understood that any transposon system capable of inserting transposon elements with sufficient efficiency to label target nucleic acids can be used. In specific embodiments, preferred transposon systems are capable of inserting transposon elements in a random or nearly random manner to label target nucleic acids.

[0103] Flow pool

[0104] Each of the methods and kits disclosed herein uses or includes a flow cell. The architecture and / or surface chemistry of the flow cell may vary between methods and / or kits, and details of the flow cell used in a particular method and / or kit will be described in detail with reference to that particular method and / or kit.

[0105] This section provides descriptions of some of the architectures and surface chemistry used in each example of the flow cells disclosed herein.

[0106] A top view of an example flow cell 10 Figure 1 As shown in the image. (Refer to...) Figure 2A and Figure 2BSome examples of the flow cell 10 discussed include two opposing substrates 12 and 12' or 14 and 14'. Other examples of the flow cell 10 include a substrate 12 or 14, which may have a coverslip or other cover bonded to a portion of the substrate 12 or 14. Still other examples of the flow cell 10 include a substrate 12 or 14 that is not bonded to another component but is open to the surrounding environment. Such an open substrate 12 or 14 having a polymer hydrogel, an amplification primer set (primers 16, 18 and 16', 18'), and in some cases transposon complexes 38A, 38B, or 38C, 38D may also be referred to herein as a flow cell precursor (e.g., when used in the open-binding method described in FIG. 26).

[0107] exist Figure 2A and Figure 2B In the example shown, the flow channel 20 is defined between two opposing substrates 12 and 12' or 14 and 14'. In other examples, the flow pool 10 includes a substrate 12 or 12' or 14 or 14', and a cap (not shown) attached to the substrate 12 or 12' or 14 or 14'. In these examples, the flow channel 20 is defined between the substrate 12 or 12' or 14 or 14' and the cap. In an open-wafer configuration, the flow channel 20 may be defined by a lane 36 (see [link to relevant documentation]). Figure 2B ).

[0108] exist Figure 2A and Figure 2B Different substrates 12, 12', 14, or 14' are shown. These substrates 12, 12', 14, and 14' are examples of solid carriers.

[0109] exist Figure 2B In the example shown, substrates 14 and 14' are single-layer structures. Examples of suitable single-layer structures for substrates 14 and 14' include epoxysiloxanes, glass, modified or functionalized glass, polymeric materials (including acrylic acid, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutene, polyurethane, and polytetrafluoroethylene (such as TEFLON from Chemours)). ® ), cyclic olefin / cyclic olefin polymers (COP) (such as ZEONOR from Zeon) ® Polyimide, nylon (polyamide), ceramic / ceramic oxides, silica, fused silica or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaO2). x Materials include hafnium oxide (HfO2), carbon, and metals. In any of the examples disclosed herein, substrates 14, 14' may be selected to be transparent to visible light.

[0110] exist Figure 2A In the examples shown, substrate 12 or 12' is a multilayer structure. The multilayer structure of substrates 12, 12' includes base supports 22, 22' and patterned material 24, 24' on the base supports 22, 22'. In any of the examples disclosed herein, components of substrates 12, 12' may be selected to be transparent to visible light.

[0111] The base supports 22, 22' can be any of the examples described herein for the single-layer structure of substrates 14, 14'. The patterning materials 24, 24' can be any material capable of being patterned with the recesses 26, 26'.

[0112] In the example, the patterning materials 24, 24' can be inorganic oxides, which are selectively applied to the substrate carriers 22, 22' in a desired pattern, for example via vapor deposition, aerosol printing, or inkjet printing. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., HfO2), etc. In another example, the patterning materials 24, 24' can be a resin matrix material applied to the substrate supports 22, 22' and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, bubble coating, spin coating, spray coating, agitation dispensing, ultrasonic spraying, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), imprinting, embossing, molding, micro-etching, printing, etc. Some examples of suitable resins include resins based on polyhedral oligomeric silsesquioxanes, non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opening epoxides), acrylic resins, acrylate resins, methacrylate resins, and amorphous fluoropolymer resins (e.g., CYTOP from Bellex, USA). ® ) and their combinations.

[0113] In the examples, substrates 12, 12', or 14, 14' can be circular with a diameter ranging from about 2 mm to about 300 mm, or they can be rectangular sheets or panels with a maximum size of about 10 feet (about 3 meters). In one example, substrates 12, 12', or 14, 14' are wafers with a diameter ranging from about 200 mm to about 300 mm. The wafers can then be diced to form individual flow cell substrates. In another example, substrates 12, 12', or 14, 14' are dies with a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it should be understood that substrates 12, 12', or 14, 14' with any suitable size can be used. Alternatively, a panel with a larger surface area than a 300 mm circular wafer can be used as a rectangular support. The panel can then be diced to form individual flow cells.

[0114] Flow cell 10 also includes flow channel 20. Although Figure 1 Several flow channels 20 are shown, but it should be understood that the flow pool 10 may include any number of flow channels 20 (e.g., a single channel 20, four channels 20, etc.). Each flow channel 20 may be isolated from each other flow channel 20 in the flow pool 10 such that fluid introduced into any particular flow channel 20 does not flow into any adjacent flow channel 20.

[0115] At least a portion of the flow channel 20 can be defined in the substrates 12, 12' or 14, 14' using any suitable technique, which depends in part on the material of the substrates 12, 12' or 14, 14'. In the case of an open wafer flow cell, the entire flow channel 20 may be defined by lanes 36 defined in the substrates 12 or 14. In both examples, at least a portion of the flow channel 20 is etched into a glass substrate or engraved into a plastic substrate, such as substrates 14, 14'. In another example, at least a portion of the flow channel 20 may be patterned into a resin matrix material of a multilayer structure using photolithography, nanoimprint lithography, etc. In the closed version of the flow cell 10, a separate material (e.g., interposer 28) may be applied to the substrates 12, 12' or 14, 14' such that interposer 28 defines at least a portion of the walls of the flow channel 20. An example of interposer 28 is the pre-cut interposer 98 shown in FIG. 26. Although the channel 36 is shown as being defined in layer 24 or substrate 14, it should be understood that the surface of layer 24 (in which the recess 26 is defined) or substrate 14 may be substantially flat, and the intermediate layers 28, 98 placed on the surface may define the swim lane 36.

[0116] In the example, the flow channel 20 has a generally rectangular configuration with rounded ends. The length and width of the flow channel 20 may be smaller than the length and width of the substrates 12, 12' or 14, 14', respectively, such that portions of the substrate surface surrounding the flow channel 20 can be used to attach to another substrate 12, 12' or 14, 14' or to a cover to define the periphery of the open flow channel 20. In some cases, the width of each flow channel 20 may be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or greater. In some cases, the length of each flow channel 20 may be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm, or greater. The width and / or length of each flow channel 20 may be greater than, less than, or between the values ​​specified above. In another example, the flow channel 20 is square (e.g., 10 mm × 10 mm).

[0117] For example, when using microcontact, aerosol, or inkjet printing to deposit the intermediate layer 28 that partially defines the walls of the flow channels, the depth / height of each flow channel 20 can be as small as a few monolayer thicknesses. In other examples, the depth / height of each flow channel 20 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or greater. In one example, the depth / height can range from about 10 μm to about 100 μm. In another example, the depth / height is about 5 μm or less. It should be understood that the depth / height of each flow channel 20 can also be greater than, less than, or in between the values ​​specified above. For example, when using recesses 26, 26', the depth / height of the flow channels 20 can also vary along the length and width of the flow cell 10.

[0118] Figure 2A The example flow pool architecture includes recesses 26, 26' separated by gap regions 34, 34'. Many different layouts of the recesses 26, 26' are conceivable, including regular, repeating, and irregular patterns. In the example, the recesses 26, 26' are arranged in a hexagonal grid for tight packing and improved density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern may be in an xy format of rows and columns. In some other examples, the layout or pattern may be a repeating arrangement of the recesses 26, 26' and gap regions 34, 34'. In still other examples, the layout or pattern may be a random arrangement of the recesses 26, 26' and gap regions 34, 34'.

[0119] The layout or pattern can be characterized relative to the density (number) of the recesses 26, 26' in the defined area. For example, the recesses 26, 26' can be approximately 2 million per mm. 2The density exists. The density can be adjusted to different densities, including, for example, approximately 100 particles / mm². 2 Approximately 1,000 pieces / mm 2 Approximately 100,000 pieces / mm 2 Approximately 1 million / mm 2 Approximately 2 million / mm 2 Approximately 5 million / mm 2 Approximately 10 million per mm 2 Approximately 50 million per mm 2 The density may be greater or less. It should also be understood that the density may be between a value selected from the lower limit and an upper limit of the above range, or other densities may be used (outside the given range). For example, a high-density array may be characterized by recesses 26, 26' separated by less than about 100 nm, a medium-density array may be characterized by recesses 26, 26' separated by about 400 nm to about 1 µm, and a low-density array may be characterized by recesses 26, 26' separated by more than about 1 µm.

[0120] The layout or pattern of the recesses 26, 26' can also be characterized by the average pitch or spacing (center-to-center spacing) from the center of one recess 26, 26' to the center of the adjacent recess 26, 26', or the average pitch or spacing (edge-to-edge spacing) from the right edge of one recess 26, 26' to the left edge of the adjacent recess 26, 26'. The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be irregular, in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.1 µm, about 0.5 µm, about 1 µm, about 5 µm, about 10 µm, about 100 µm, or larger or smaller. The average pitch of a particular pattern can be between a value selected from the lower limit and an upper limit of the above range. In the example, the pitch (center-to-center spacing) of the recesses 26, 26' is about 1.5 µm. Although example average pitch values ​​have been provided, it should be understood that other average pitch values ​​may be used.

[0121] The size of each recess 26, 26' can be characterized by its volume, opening area, depth, and / or diameter. For example, the volume can be approximately 1 × 10⁻⁶. −3 μm 3 Approximately 100 μm 3 Within a range, for example, approximately 1 × 10 −2 μm 3 Approximately 0.1 μm 3 Approximately 1μm 3 Approximately 10μm 3It can be larger or smaller. For example, the opening area can be approximately 1 × 10⁻⁶. −3 μm 2 Approximately 100 μm 2 Within a range, for example, approximately 1 × 10 −2 μm 2 Approximately 0.1 μm 2 Approximately 1μm 2 At least approximately 10 μm 2 The depth can range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or greater or smaller. For yet another example, the diameter or length and width can range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or greater or smaller.

[0122] Figure 2A An example flow cell architecture includes recesses 26, 26' defined in corresponding swimlanes 36, 36'. This architecture may be ideal for substrate 12 when used to form an open wafer flow cell 10. Although not shown, it should be further understood that the recesses 26, 26' may be defined on a substantially flat substrate surface (i.e., not in swimlanes 36, 36'), and the interposer 28 may completely define the sidewalls of the closed flow cell 10. Figure 2A The flow pool architecture can be considered patterned.

[0123] Figure 2B The example flow cell architecture also includes lanes 36, 36' without recesses 26, 26'. In this example, lanes 36, 36' extend just shorter than the full length and full width of substrates 14, 14', such that gap regions 34, 34' are formed around the periphery of lanes 36, 36'. Figure 2B The flow pool architecture can be used in any of the methods disclosed herein. Figure 2B The flow pool architecture can be considered unpatterned.

[0124] In any of the examples disclosed herein, Figure 2A or Figure 2B The flow cell architecture shown includes polymer hydrogels 32, 32'.

[0125] Polymer hydrogels 32 and 32' can be poly(N-(5-azidoacetamidopentyl)acrylamide-copolymer-acrylamide) (PAZAM) or another acrylamide copolymer disclosed herein, polyethylene glycol (PEG)-acrylate, PEG-diacrylate, PEG-amine, PEG-carboxylic acid ester, PEG-dithiol, PEG-epoxide, PEG-isocyanate, PEG-maleimide, crosslinked poly(methyl methacrylate) (PMMA), polyvinylpyrrolidone (PVPON), polyvinyl alcohol (PVA), polyethylene oxide-polypropylene oxide block copolymer (PEO-PPO), poly(hydroxyethyl methacrylate) (PHEMA), poly(N, N'-Dimethylacrylamide (PAZNAM), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid)-poly(ethylene glycol) block copolymer, poly(ethylene glycol)-poly(lactic acid-co-glycolic acid) block copolymer, poly(acrylic acid-copoly-vinyl sulfonic acid), poly(acrylamide-copoly-vinyl sulfonic acid), poly(L-aspartic acid), poly(asparagine), adipic acid dihydrazide-modified or aldehyde-modified poly(L-glutamic acid), bisacrylamide, or hydrogels based on one or more of polylysine, starch, agar, agarose, heparin, alginate, alginate sulfate, dextran sulfate, hyaluronic acid, pectin, carrageenan, gelatin, chitosan, cellulose and collagen, or combinations or mixtures thereof.

[0126] In one example, polymer hydrogels 32, 32' comprise an acrylamide copolymer. In this example, the acrylamide copolymer has structure (I):

[0127]

[0128] in:

[0129] R A It is an azide or tetrazine or any other functional group that can be attached to alkyne, amino, alkenyl, alkynyl, halogen, hydrazone, hydrazine, carboxyl, hydroxyl, tetrazolium, nitro ketone, sulfate or thiol;

[0130] R B H or optionally substituted alkyl;

[0131] R C R D and R E Each is independently selected from the group consisting of H and optionally substituted alkyl groups;

[0132] -(CH2) p Each of the following can be optionally replaced;

[0133] p is an integer in the range of 1 to 50;

[0134] n is an integer in the range of 1 to 50,000; and

[0135] m is an integer in the range of 1 to 100,000.

[0136] A specific example of an acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide (PAZAM).

[0137] Those skilled in the art will recognize that the arrangement of the recurring “n” and “m” features in structure (I) is representative, and that monomeric subunits can exist in the polymer structure in any order (e.g., random, block, patterned, or a combination thereof).

[0138] The molecular weight of the acrylamide copolymer can be in the range of about 5 kDa to about 1500 kDa or about 10 kDa to about 1000 kDa, or in a specific example it can be about 312 kDa.

[0139] In some examples, the acrylamide copolymer is a linear polymer. In other examples, the acrylamide copolymer is a crosslinked polymer with different degrees of crosslinking.

[0140] In some examples, polymer hydrogels 32, 32' can be variations of structure (I). In one example, the acrylamide unit can be N,N-dimethylacrylamide (N,N-dimethylacrylamide). () Replacement. In another example, the acrylamide unit in structure (I) can be replaced. Replace, where R D R E and R F Each is either H or C1-C6 alkyl, and R G and R H Each is a C1-C6 alkyl group (instead of H, as in the case of acrylamide). In this example, q can be an integer ranging from 1 to 100,000. In another example, N,N-dimethylacrylamide may be used in addition to the acrylamide unit. In this example, in addition to the recurring "n" and "m" features, structure (I) may also include , where R D R E and R F Each is either H or C1-C6 alkyl, and R G and R H Each is a C1-C6 alkyl group. In this example, q can be an integer in the range of 1 to 100,000.

[0141] As another example of polymer hydrogels 32, 32', the repeating "n" feature in structure (I) can be replaced by a monomer including a heterocyclic azide group having structure (II):

[0142]

[0143] Where R 1 R1 is H or a C1-C6 alkyl group; R2 is H or a C1-C6 alkyl group; L is a linking group comprising a straight chain having 2 to 20 atoms selected from carbon, oxygen, and nitrogen, and 10 optional substituents on the carbon and any nitrogen atom in the chain; E is a straight chain comprising 1 to 4 atoms selected from carbon, oxygen, and nitrogen, and optional substituents on the carbon and any nitrogen atom in the chain; A is an amide having an H or C1-C4 alkyl group attached to N and N being N-substituted; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members existing as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.

[0144] As yet another example, polymeric hydrogels 32, 32' may include repeating units of each of structures (III) and (IV):

[0145] and

[0146] Where R 1a R 2a R 1b and R 2b Each of them is independently selected from hydrogen, optionally substituted alkyl, or optionally substituted phenyl; R 3a and R 3b Each of them is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl, or optionally substituted C7-C14 arylalkyl; and each L 1 and L 2 Independently selected from optionally substituted alkylene linkages or optionally substituted heteroalkylene linkages.

[0147] Polymer hydrogel 32, 32' R A The group can attach to the 5' terminal group of primers 16 and 18 in the amplification primer set, and in some examples, can attach to the terminal functional group of the transposon complex (i.e., depending on the 5' or 3' terminal functional group of the transposon complex). In other examples, biotin is transmitted via R... A Some R in the group AGroups (e.g., azide, tetrazine, or other functional groups that can be attached to alkynes) are attached to the surface of the polymer hydrogel (e.g., 32, 32'). In one specific example, biotin is attached to a connector, such as bicyclic [6.1.0]nonyne (BCN), which can be covalently attached to R A Some R in the group A Group. Streptomycin can be attached to biotin bound to the hydrogel at the beginning or during examples of the methods disclosed herein to attach biotinylated primers 16, 18 or biotinylated transposon complexes. When biotin is attached to the polymer hydrogel, in order to form a biotinylated polymer hydrogel, biotin and any connectors used with biotin can be added to the polymer hydrogel (e.g., 32, 32') before or after the polymer hydrogel (e.g., 32, 32') is applied to the recesses 26, 26'.

[0148] The polymeric hydrogel 32 can be added to a liquid carrier and applied to substrates 12, 14 using any suitable deposition technique. In the example, the polymeric hydrogel solution / mixture is deposited as a blanket and then removed from the gap region 34 using polishing. Polishing leaves the polymeric hydrogel 32 intact in the recess 26 or lane 36. In some examples, a similar process can be used to add the polymeric hydrogel 34' to substrates 12', 14' before bonding the two substrates 12, 12' or 14, 14' together.

[0149] like Figure 2A and Figure 2B As shown, flow cell 10 includes primers 16, 18 and 16', 18', respectively, attached to polymer hydrogels 32, 32'. Primers 16, 18 and 16', 18' are each part of a primer set for sequentially paired end sequencing. As an example, primer sets may include any combination of P5 and P7 primers, P15 and P7 primers, or PA, PB, PC, and PD primers as described herein. For example, primer sets may include any two PA, PB, PC, and PD primers, or any combination of one PA primer and one PB, PC, or PD primer, or any combination of one PB primer and one PC or PD primer, or any combination of one PC primer and one PD primer. Primers 16 and 16' have the same sequence, and primers 18 and 18' have the same sequence.

[0150] Examples of P5 and P7 primers were used on the surface of a commercial flow cell sold by Illumina Inc., for example, in HiSeq. ™ HiSeqX ™ MiSeq ™ MiSeqDX™ MiNISeq ™ NextSeq ™ NextSeqDX ™ NovaSeq ™ iSEQ ™ Genome Analyzer ™ Sequencing was performed on other instrument platforms. The P5 primer (which can be a cleavable primer due to its cleavable nucleobase uracil or "n") is:

[0151] P5 #1: 5' → 3'

[0152] AATGATACGGCGACCACCGAGAUCTACAC(SEQ.ID.NO.1);

[0153] P5 #2: 5'→3'

[0154] AATGATACGGCGACCACCGAGAnCTACAC (SEQ.ID.NO.2)

[0155] Where “n” is inosine in SEQ.ID.NO.2; or

[0156] P5 #3: 5' → 3'

[0157] AATGATACGGCGACCACCGAGAnCTACAC (SEQ.ID.NO.3)

[0158] Where “n” is the en-thymidine (i.e., en-dT) in SEQ.ID.NO.3.

[0159] The P7 primer (which can be a cleavable primer) can be any of the following:

[0160] P7 #1: 5' → 3'

[0161] CAAGCAGAAGACGGCATACGAnAT (SEQ.ID.NO.4)

[0162] Where “n” is 8-oxoguanine in SEQ.ID.NO.4;

[0163] P7 #2: 5'→3'

[0164] CAAGCAGAAGACGGCATACnAGAT (SEQ.ID.NO.5)

[0165] Where “n” is 8-oxoguanine in SEQ.ID.NO.5;

[0166] P7 #3: 5'→3'

[0167] CAAGCAGAAGACGGCATACnAnAT (SEQ.ID.NO.6)

[0168] Two instances of "n" are 8-oxoguanine in SEQ.ID.NO.6;

[0169] P7 #4: 5'→3'

[0170] CAAGCAGAAGACGGCATACGAUAT (SEQ.ID.NO.7); or

[0171] P7 #5: 5' → 3'

[0172] CAAGCAGAAGACGGCATACUAGAT (SEQ.ID.NO.8).

[0173] The P15 primer (shown as a cleavable primer) is:

[0174] P15: 5' → 3'

[0175] AATGATACGGCGACCACCGAGAnCTACAC (SEQ.ID.NO.9)

[0176] Where "n" stands for allyl-T (i.e., a thymidine nucleotide analog with an allyl functional group).

[0177] The other primers mentioned above (PA-PD, shown as non-cleavable primers) include:

[0178] PA 5' → 3'

[0179] GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ.ID.NO.10);

[0180] PB 5' → 3'

[0181] CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT(SEQ.ID.NO.11);

[0182] PC 5' → 3'

[0183] ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ.ID.NO.12); and

[0184] PD 5' → 3'

[0185] GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ. ID. NO. 13).

[0186] Although not shown in the example sequences of PA to PD, it should be understood that any of these primers 16, 18 may contain a cleavage site at any point in the strand, such as uracil, 8-oxoguanine, allyl-T, etc. Primers 16, 18, or 16', 18' in any given primer set include orthogonal cleavage sites. In this respect, "orthogonal" means that the cleavage site of one primer 16, 16' in that set is insensitive to the cleavage agent used for the cleavage site of another primer 18, 18' in that set. Therefore, cleavage at one cleavage site will not affect the other cleavage site.

[0187] Each of the primers 16, 18, or 16', 18' disclosed herein may also include a polyT sequence at the 5' end of the primer sequence. In some examples, the polyT region contains 2 to 20 T bases. As a specific example, the polyT region may contain 3, 4, 5, 6, 7, or 10 T bases.

[0188] The 5' end of each primer 16, 18, or 16', 18' may also contain a linker. Surface functional groups containing terminal alkyne groups or those that can attach to the polymer hydrogel 32, 32' (e.g., R...) can be used. A Any connector with another suitable terminal functional group. In one example, primers 16, 18, or 16', 18' are terminated with a hexynyl functional group.

[0189] Primers 16, 18, or 16', 18' can be added to a carrier fluid (e.g., water containing a neutral buffer and / or salt), and this fluid can be introduced into flow cell substrates 12, 14, or 12', 14' and incubated. Grafting can be performed at a temperature ranging from about 55°C to about 65°C for about 20 minutes to about 60 minutes. In one example, grafting is performed at 60°C for about 30 minutes or 60 minutes. It should be understood that lower temperatures and longer times or higher temperatures and shorter times can also be used. During grafting, the 5' ends of primers 16, 18, or 16', 18' are attached to at least some of the surface groups in the surface groups of the polymer hydrogels 32, 32', and have no affinity for the gap regions 34, 34' or other edge portions of substrates 12, 14, or 12', 14'.

[0190] As will be discussed in more detail with reference to various methods and / or kits, some examples of flow cells have R that are directly or indirectly (e.g., via connectors) attached to the polymer hydrogels 32, 32'. ATransposome complexes of groups. These example flow cells may include transposome complexes bound to them, or these transposome complexes may be introduced as part of the method.

[0191] In other examples among these, the flow cell 10 includes complementary recognition primers or target primers capable of hybridizing with a portion of the recognition primer or a portion of the transposon complex, respectively. (See reference...) Figure 3 Figure 5 further describes the recognition primers and complementary recognition primers. (Refer to Figure 5 for further details.) Figure 12 Further description of the target primers.

[0192] In other examples, flow cell 10 includes transposable complexes 38A, 38B, or 38C, 38D (see [reference]). Figure 5A and Figure 5B These transposable complexes are attached to recesses 26 having primers 16, 18 and / or to gap regions 34, or to lanes 36 having primers 16, 18. When transposable complexes 38A, 38B, or 38C, 38D are attached to gap regions 34 or otherwise directly attached to substrates 12, 12', or 14, 14', the attachment may be performed via any of the groups described in U.S. Provisional Application No. 63 / 716,122, the entire contents of which are incorporated herein by reference.

[0193] Embedded Index #1

[0194] One example disclosed in this article uses DNA intercalators for spatial indexing. In this example (such as...) Figure 4 In the depicted configuration, orthogonal recognition primers 30A, 30B, 30C, 30D, 30E, and 30F are conjugated with different DNA samples 54A, 54B, 54C, 54D, 54E, and 54F to form recognition primer-conjugated DNA samples 35A, 35B, 35C, 35D, 35E, and 35F. These recognition primer-conjugated DNA samples 35A, 35B, 35C, 35D, 35E, and 35F hybridize with corresponding complementary recognition primers (not shown) in predetermined regions 37A, 37B, 37C, 37D, 37E, and 37F attached to flow cell 10'. Therefore, each DNA sample 54A, 54B, 54C, 54D, 54E, and 54F will be anchored to the corresponding region 37A, 37B, 37C, 37D, 37E, and 37F of flow cell 10'. This implements spatial indexing.

[0195] Example of primer 30 identification Figure 3As shown in the figure. Each recognition primer 30 comprises a recognition primer sequence 31 and an intercalator 33 attached to the recognition primer sequence 31. As described above, the recognition primers 30 attached to different DNA samples 54A, 54B, etc., are orthogonal to each other. In this respect, "orthogonal" means that the recognition primer sequence 31 of the recognition primer 30 (e.g., 30A) conjugated to a DNA sample (e.g., 54A) is not complementary to the recognition primer sequences 31 of other recognition primers 30 (e.g., 30B, 30C, 30D, 30E, 30F) respectively attached to each other DNA sample (e.g., 54B, 54C, 54D, 54E, 54F). The length of each recognition primer sequence 31 ranges from 5 bases to 50 bases.

[0196] The intercalating agent 33 for recognition primer 30 is a planar aromatic molecule that can slide between DNA base pairs. In other words, the intercalating agent 33 can bind to DNA samples 54A, 54B, etc., through intercalation. Thus, the intercalating agent 33 for recognition primer 30 conjugates DNA samples 54A, 54B, etc., with the unique recognition primer sequence 31. Examples of functionalizable DNA intercalating agents 33 are selected from the group consisting of: CI-921, eletamide, mitoxantrone, aminonaphthylfenoxate, bismuth subcitrate, and cristatol, the structures of which are shown below:

[0197]

[0198] In other examples, the intercalator 33 may be functionalized as follows: i) a series of orthogonal chemical functional groups complementary to functional groups at corresponding regions in the corresponding regions 37A, 37B, 37C, 37D, 37E, 37F of the flow cell 10', respectively, and / or ii) an antibody having a specific recognition site located at the corresponding regions in the corresponding regions 37A, 37B, 37C, 37D, 37E, 37F of the flow cell 10'.

[0199] To form the recognition primer sequence 31, the intercalating agent 33 can be chemically modified to attach the recognition primer sequence 31 to the intercalating agent. Figure 3 In the example shown, the end of the recognition primer sequence 31 is attached to a branch of 5-amino-2-(2-(dimethylamino)ethyl)-1H-benzo[de]isoquinoline-1,3(2H)-dione (i.e., aminonaphthirmeth).

[0200] To form DNA samples 35A, 35B, 35C, 35D, 35E, and 35F that are conjugated to recognition primers, DNA samples 54A, 54B, 54C, 54D, 54E, and 54F were extracted from the source using standard extraction methods. Each sample was then mixed with different / orthogonal recognition primers 30A, 30B, 30C, 30D, 30E, and 30F, for example, in different vials. Each mixture containing the corresponding DNA sample 54A, 54B, etc., and recognition primers 30A, 30B, etc., was incubated to allow the corresponding intercalating agents 33A, 33B, 33C, 33D, 33E, and 33F to intercalate into DNA samples 54A, 54B, 54C, 54D, 54E, and 54F. This uses unique identification primers 30A, 30B, 30C, 30D, 30E, and 30F to label each DNA sample in samples 54A, 54B, 54C, 54D, 54E, and 54F.

[0201] Figure 4 An example of flow cell 10' for use with DNA samples 35A, 35B, 35C, 35D, 35E, 35F for identifying primer conjugation is shown schematically.

[0202] For each DNA sample 35A, 35B, 35C, 35D, 35E, 35F to be introduced into flow cell 10' for each recognition primer conjugation, flow cell 10' has a predetermined region (e.g., recess 26 or gap region 34) located in predetermined regions 37A, 37B, 37C, 37D, 37E, 37F, containing a complementary recognition primer (not shown). The complementary recognition primer in any given predetermined region 37A, 37B, 37C, 37D, 37E, 37F has a sequence complementary to the recognition primer sequence 31 of the recognition primer 30 to be hybridized in that region 37A, 37B, 37C, 37D, 37E, 37F. Therefore, a complementary recognition primer in a region 37 (e.g., 37A) can hybridize with one recognition primer in a recognition primer 30 (e.g., 30A), but not with other recognition primers 30 (e.g., 30B, 30C, 30D, 30E, 30F) in other regions 37 (e.g., 37B, 37C, 37D, 37E, 37F). Thus, each recognition primer 30 and its complementary primer pair can anchor to a DNA sample conjugated to a specific recognition primer 30.

[0203] Therefore, in this example, Figure 2AThe flow cell 10 shown further includes a first plurality of complementary recognition primers attached to a first predetermined region located at a first region 37A of the substrate 12, wherein each of the first plurality of complementary recognition primers has a sequence complementary to the first recognition primer sequence (e.g., 31 of primer 30A); a second plurality of complementary recognition primers attached to a second predetermined region located at a second region 37B of the substrate 12, wherein each of the second plurality of complementary recognition primers has a sequence complementary to the second recognition primer sequence (e.g., 31 of primer 30B); and so on for each of the predetermined regions 37C, 37D, 37E, 37F, etc.

[0204] More specifically, Figure 4 The flow cell 10' shown includes six distinct predetermined regions 37A, 37B, 37C, 37D, 37E, and 37F. Each of these predetermined regions includes a specific type of complementary recognition primer attached to a specific area (e.g., polymer hydrogel 32 or gap region 34) within that region 37A, 37B, 37C, 37D, 37E, and 37F. To introduce different / orthogonal complementary recognition primers into the predetermined regions, the complementary recognition primers can be selectively attached to polymer hydrogel 32 already present in the predetermined regions 37A, 37B, 37C, 37D, 37E, and 37F (e.g., within the recess 26 or lane 36), or to gap region 34 within the predetermined regions 37A, 37B, 37C, 37D, 37E, and 37F. High-precision coating methods can be used to sequentially assign different sets of complementary recognition primers to predetermined regions 37A, 37B, 37C, 37D, 37E, and 37F. In one example, high-precision coating is achieved using a precision bench tool. In other examples, high-precision coating methods are performed using stripe coating or patch coating with a grooved coating tool. Alternatively, high-precision coating methods can be performed using spraying or jetting (e.g., via inkjet). In the example, a first set of complementary recognition primers can be assigned to region 37A and allowed to incubate, such that they graft onto the polymer hydrogel 32 or attach to the gap region 34 in region 37A; then a second set of complementary recognition primers can be assigned to region 37B and allowed to incubate, such that they graft onto the polymer hydrogel 32 or the gap region 34 in region 37B. The complementary recognition primer may contain a 5' terminal group that may be attached directly or via a linker group to a surface group of the polymer hydrogel 32, or to a trapping mechanism or functional group at the interstitial region 34 (e.g., as described in U.S. Provisional Application No. 63 / 716,122).

[0205] In this example flow cell 10', the amplification primer set (i.e., primers 16, 18, or 16', 18') is orthogonal (non-complementary) to the recognition primer sequences 31 of all recognition primers 30 (e.g., 30A, 30B, etc.) attached to flow cell 10'. In this respect, the orthogonality of the sequences prevents the DNA samples 35A, 35B, 35C, 35D, 35E, 35F conjugated to recognition primers from binding to primers 16, 18, or 16', 18'.

[0206] In flow cell 10', the transposon complexes for tag-fragmented DNA samples 54A, 54B, etc., may be present in flow cell 10' before the addition of conjugated samples 35A, 35B, 35C, 35D, 35E, 35F, or may be added after the conjugated samples 35A, 35B, 35C, 35D, 35E, 35F are introduced into the corresponding regions 37A, 37B, 37C, 37D, 37E, 37F and hybridized therein.

[0207] Example transposable complexes that can be used are shown in Figure 5A and Figure 5B middle. Figure 5A and Figure 5B The transposable complexes 38A, 38B and 38C, 38D shown will form dimers in solution and when attached to the surface of a flow cell. Although in Figure 5A and Figure 5B Heterodimers are described herein, but it should be understood that the type of dimer formed can be controlled by controlling the type of transposable complexes 38A and / or 38B or 38C and / or 38D added to the solution. For example, if the solution contains only complex 38A, a homodimer of complex 38A will be formed. Alternatively, if the solution contains both complexes 38A and 38B, homodimers of the respective complexes 38A and 38B will be formed, and a heterodimer containing one of each of the complexes 38A and 38B will be formed. The pre-formed dimer is then used in at least some of the methods disclosed herein. It should be understood that some transposable complexes 38A, 38B, 38C, and / or 38D may not dimerize, and these individual transposable complexes 38A, 38B, 38C, and / or 38D may attach to the surface of the flow cell. Monomeric transposable complexes 38A, 38B, 38C, and / or 38D will not participate in tag fragmentation.

[0208] exist Figure 5A and Figure 5BIn this transposon complex, each of transposon complexes 38A, 38B, 38C, and 38D contains a transposase 46 non-covalently bound to the transposon terminus 40A, 40B, 40C, or 40D. Each transposon terminus 40A, 40B, 40C, or 40D is a double-stranded nucleic acid strand, one strand ME of which is a portion of transfer strands 42A, 42B, 42C, or 42D, and the other strand ME' of which is a non-transfer strand 44A, 44B, 44C, or 44D. In other words, transposon terminus 40 contains a portion of transfer strands 42A, 42B, 42C, or 42D that hybridize with the non-transfer strand 44.

[0209] exist Figure 5A In the example shown, transfer chains 42A and 42B contain 5' terminal functional groups 48A and 48B. In one example, the 5' terminal functional group 48 is biotin (and can be attached to the biotinylated polymer hydrogel 32 via avidin / streptomycin). The 5' terminal functional groups 48A and 48B of the transposon complexes 38A and 38B may alternatively be R-type polymer hydrogels that can be attached to the polymer hydrogels 32 and 32'. A Any functional group on the group. In other examples, the 5' terminal functional groups 48A, 48B of the transposable complexes 38A, 38B can be any functional group that can be attached to the transposable trapping mechanism or substrate surface group located at the gap regions 34, 34', as shown in U.S. Provisional Application No. 63 / 716,122.

[0210] Transfer strand 42A also includes a first amplification domain 45A and a sequencing primer sequence 47A attached to a strand ME at the transposon end 40A. The strand ME at the transposon end 40A is located at the 3' end of transfer strand 42A. Similar to transfer strand 42A, transfer strand 42B includes a 5' terminal functional group 48B capable of attaching to the polymer hydrogel 32 or to a transposon trapping mechanism or substrate surface group located in the interstitial region 34, a second amplification domain 49B, and a sequencing primer sequence 47B attached to a strand (ME) at the transposon end 40B (located at the 3' end of transfer strand 40B).

[0211] The first amplification domain 45A and the second amplification domain 49B of the transposon complexes 38A and 38B have sequences distinct from each other (e.g., P7 and P5), but share the same sequences as the first primer and second primer 16, 18 or 16', 18' attached to the polymer hydrogels 32, 32', respectively. The first amplification domain 45A, transposon complex 38A, and primers 16, 16', together with the second amplification domain 49B, transposon complex 38B, and primers 18, 18', enable the amplification of DNA sample fragments generated during tag fragmentation. Examples of suitable sequences for the first amplification domain 45A and the second amplification domain 49B may include any of the examples described herein for primers 16, 18, or 16', 18', provided they form an amplification primer set. Each domain in 45A and 49B contains cleavage sites 52A, 52B at any point in the strand, such as uracil, 8-oxoguanine, allyl-T, diol, etc.

[0212] Sequencing primer sequences 47A and 47B have sequences distinct from each other, which bind to sequencing primers introduced into flow cells 10 and 10' after tag fragmentation and amplification, respectively. As an example, sequencing primer sequences 47A and 47B can bind to sequencing primers that initiate the synthesis of a new strand complementary to the forward strand fragment / fragment amplicon.

[0213] The transposon ends 40A and 40B of each transposon complex 38A and 38B contain a strand ME that hybridizes with strand ME', respectively. Therefore, strands ME and ME' are complementary. The double-stranded transposon ends 40A and 40B are capable of complexing with transposase 46. As an example, the strands ME and ME' of transposon ends 40A and 40B can be related but distinct 19-base-pair (bp) external (e.g., strand ME) and internal (e.g., strand ME') sequences (which serve as substrates for Tn5 transposase activity), or chimeric ends recognized by wild-type or mutant Tn5 transposases, or R1 ends (e.g., strand ME) and R2 ends (strand ME') recognized by MuA transposases.

[0214] Figure 5B The example transposon complexes 38C and 38D shown are similar to Figure 5A The difference between those shown is that the transposable complexes 38C and 38D are configured for asymmetric attachment to the polymer hydrogel 32 or to transposable trapping mechanisms or substrate surface groups located in the gap region 34.

[0215] like Figure 5BAs shown, each of the first transposon complex 38C and the second transposon complex 38D contains a transposase 46 non-covalently bound to transposon ends 40C, 40D. Each transposon end 40C, 40D is a double-stranded nucleic acid strand, one strand of which (e.g., ME) is part of transfer strand 42C or 42D, and the other strand of which (e.g., ME') is part of non-transfer strand 44C or 44D. Any of the example strands of the example strands of transposon ends 40A, 40B (e.g., ME and ME') described herein may be used.

[0216] In transposon complex 38C, transfer strand 42C includes a first amplification domain 45C and a sequencing primer sequence 47C attached to a single strand ME of the transposon terminal 40C. The ME strand of the transposon terminal 40C is located at the 3' end of transfer strand 42C. Similarly, in transposon complex 38D, transfer strand 42D includes a second amplification domain 49D and a sequencing primer sequence 47D attached to a single strand ME' of the transposon terminal 40D. The ME strand of the transposon terminal 40D is located at the 3' end of transfer strand 42D.

[0217] The first amplification domain 45C and the second amplification domain 49D of the transposon complexes 38C and 38D have sequences distinct from each other (e.g., P7 and P5), but share the same sequences as the first primer and second primer 16, 18 or 16', 18' attached to the polymer hydrogels 32 and 32', respectively. The first amplification domain 45C, transposon complex 38C, and primers 16, 16', together with the second amplification domain 49D, transposon complex 38D, and primers 18, 18', enable the amplification of DNA sample fragments generated during tag fragmentation. Examples of suitable sequences for the first amplification domain 45C and the second amplification domain 49D may include any of the examples described herein for primers 16, 16', 18, 18', provided they form an amplification primer set. Each of the domains 45C and 49D contains cleavage sites 52C, 52D at any point in the strand, such as uracil, 8-oxoguanine, allyl-T, diol, etc.

[0218] Similar to sequencing primer sequences 47A and 47B, sequencing primer sequences 47C and 47D have sequences that are different from each other. These sequences bind to the sequencing primers introduced into flow cells 10 and 10' after tag fragmentation and amplification, respectively.

[0219] As mentioned, transposable complexes 38C and 38D are configured for asymmetric attachment to the polymer hydrogel 32 or to transposable trapping mechanisms or substrate surface groups positioned at the gap region 34. Therefore, one of the complexes (e.g., complex 38D) includes a 3' terminal group 48D for attachment to the polymer hydrogel 32 or to transposable trapping mechanisms or substrate surface groups positioned at the gap region 34, and another complex (e.g., complex 38C) includes a 5' terminal group 48C for attachment to the polymer hydrogel 32 or to transposable trapping mechanisms or substrate surface groups positioned at the gap region 34. Thus, as... Figure 5B As depicted, the non-transfer chain 44D of complex 38D contains a 3' terminal group 48D, and the transfer chain 42C of complex 38C contains a 5' terminal group 48C. In one example, the 3' terminal group 48D and the 5' terminal group 48C can be any functional group capable of being directly or indirectly covalently or non-covalently attached to the surface functional groups of polymer hydrogel 32, and will therefore depend on the surface functional groups of polymer hydrogel 32, 32'. In one example, polymer hydrogel 32 comprises an azide or tetrazine surface group, and the 3' terminal group 48D and the 5' terminal group 48C each comprise a terminal alkyne (e.g., hexynyl) or an internal alkyne, wherein the alkyne is part of a cyclic compound (e.g., bicyclic [6.1.0]nonyne (BCN)). In another example, biotinylated polymer hydrogel 32 is present in the recess 26 of flow cells 10, 10', and each of the 3' terminal group 48D and the 5' terminal group 48C is biotin. In these examples, additional streptavidin or avidin is added to indirectly attach biotin groups to each other. In another example, the 3' terminal group 48D and the 5' terminal group 48C can be any functional group capable of directly or indirectly covalently or non-covalently attaching to the transposable trapping mechanism or substrate surface group located at the gap region 34, as described in U.S. Provisional Application No. 63 / 716,122, the entire contents of which are incorporated herein by reference.

[0220] Although Figure 5B Not shown, but an additional spacer region may be included between the nontransferable strand 44D of the transposon complex 38D and the e3' terminal group 48D. This additional spacer region may be an oligonucleotide sequence or a chemical linker, such as poly(ethylene glycol) (PEG), tri(ethylene glycol) (TEG), or a carbon chain.

[0221] Although Figure 5A or Figure 5BAlthough not shown, it should be understood that transposon complexes 38A and 38B or 38C and 38D used in some of the methods disclosed herein may also contain index sequences in transfer strands 42A, 42B, 42C, and 42D. Index sequences are unique barcode sequences that can be used for the identification and indexing of DNA sample fragments. When included, the index sequence may be located between sequencing primer sequences 47A, 47B, 47C, and 47D and amplification domains 45A, 45B, 45C, and 45D, or 49A, 49B, 49C, and 49D. Therefore, kits and / or methods utilizing indexed transposon complexes are identified herein.

[0222] Return to reference Figure 4 As mentioned, the transposon complexes 38A, 38B or 38C, 38D for tag-fragmented DNA samples 54A, 54B, etc., can be present in flow cell 10' before the addition of conjugated samples 35A, 35B, 35C, 35D, 35E, 35F, or can be added after the conjugated samples 35A, 35B, 35C, 35D, 35E, 35F are introduced into the corresponding regions 37A, 37B, 37C, 37D, 37E, 37F and hybridized therein. When transposon complexes 38A, 38B, or 38C, 38D are included in flow cell 10' before the DNA samples 35A, 35B, 35C, 35D, 35E, and 35F containing recognition primers are introduced, the transposon complexes 38A, 38B, or 38C, 38D can be introduced and grafted onto polymer hydrogel 32 or onto transposon trapping mechanisms or substrate surface groups positioned at interstitial regions 34. Transposon grafting can be performed at a temperature ranging from about 35°C to about 55°C for a time ranging from about 30 minutes to about 120 minutes.

[0223] Following grafting, transposon complexes 38A, 38B, or 38C, 38D can be inactivated by removing transposase 46 (e.g., using sodium dodecyl sulfate (SDS) or a protease, or by heating the flow cell to approximately 60°C). Transposon complexes 38A, 38B, or 38C, 38D can be reactivated upon introduction of the corresponding DNA samples 54A, 54B, 54C, 54D, 54E, 54F. Inactivation helps ensure that DNA samples 54A, 54B, 54C, 54D, 54E, 54F are not prematurely tagged and fragmented. Alternatively, when DNA samples 54A, 54B, 54C, 54D, 54E, 54F are introduced, transposon complexes 38A, 38B, or 38C, 38D can maintain their grafted form, but metal cofactors of the tag fragmentation buffer, such as Mg, should not be introduced / present. 2+ This is to avoid binding to transposable complexes 38A, 38B or 38C, 38D and / or premature tagging fragmentation.

[0224] Because the corresponding DNA samples 54A, 54B, 54C, 54D, 54E, and 54F are conjugated with orthogonal recognition primers 30A, 30B, 30C, 30D, 30E, and 30F, and these orthogonal recognition primers hybridize with complementary recognition primers in the predetermined regions 37A, 37B, 37C, 37D, 37E, and 37F of the flow cell 10', the DNA samples 35A, 35B, 35C, 35D, 35E, and 35F conjugated with recognition primers can be merged before being introduced into the flow cell 10'.

[0225] An example method includes mixing a first DNA sample 54A with a first plurality of recognition primers 30A to conjugate the first DNA sample 54A with the first plurality of recognition primers 30A (to form a conjugated DNA sample 35A); mixing a second DNA sample 54B with a second plurality of recognition primers 30B to conjugate the second DNA sample 54B with the second plurality of recognition primers 30B (to form a conjugated DNA sample 35B); repeating the mixing process for each sample 54C, 54D, 54E, 54F and recognition primers 30C, 30D, 30E, 30F; merging the conjugated DNA samples 35A, 35B, 35C, 35D, 35E, 35F; and introducing the merged samples into a flow cell 10'.

[0226] The merged conjugated samples 35A, 35B, 35C, 35D, 35E, and 35F are incubated in flow cell 10' at the hybridization temperature. Due to the complementarity between the corresponding recognition primers 30A, 30B, 30C, 30D, 30E, and 30F and the complementary recognition primers in regions 37A, 37B, 37C, 37D, 37E, and 37F, the recognition primers 30A, 30B, 30C, 30D, 30E, and 30F will become attached to the corresponding predetermined regions of regions 37A, 37B, 37C, 37D, 37E, and 37F in flow cell 10'. The hybridization temperature can be in the range of approximately 50°C to approximately 60°C.

[0227] The flow cell 10' can then be rinsed with a washing solution. An example washing solution is an aqueous solution containing a buffer (e.g., Tris), a salt (e.g., sodium chloride, sodium citrate, etc.), a surfactant (e.g., TWEEN polysorbate), and / or a chelating agent (e.g., EDTA). In one example, the washing solution contains water, a salt at a concentration ranging from about 25 mM to about 50 mM, a surfactant in an amount ranging from about 0.01 wt% to about 0.1 wt%, and optionally a chelating agent. The washing solution may have a relatively high pH, ​​for example, ranging from about 7 to about 10.

[0228] When transposome complexes 38A, 38B or 38C, 38D are present in flow cell 10', the method further includes introducing a tag fragmentation buffer into flow cell 10' and bringing flow cell 10' to the tag fragmentation temperature. This tag fragmentation buffer may contain water, an optional co-solvent (e.g., dimethylformamide), a metal cofactor of the transposase (e.g., magnesium acetate), and a buffer salt (e.g., Tris acetate, pH 7.6). In the example, the optional co-solvent may be present in an amount of up to about 11%, and the metal cofactor (Mg... 2+ The co-solvent can be present at a concentration ranging from about 3 mM to about 10 mM, and the buffer salt can be present at a concentration ranging from about 7 mM to about 12 mM. In another example, the optional co-solvent can be present in an amount of up to about 10%, the metal cofactor can be present at a concentration ranging from about 3 mM to about 5.5 mM, and the buffer salt can be present at a concentration ranging from about 7 mM to about 10 mM. As described below, tag fragmentation (including fragmentation and attachment) can occur at or above 30°C. In one example, the tag fragmentation temperature can be in the range of 30°C to about 55°C. In another example, the tag fragmentation temperature can be in the range of 35°C to about 45°C.

[0229] By introducing a tag fragmentation buffer and bringing the temperature to the tag fragmentation temperature, DNA samples 54A, 54B, etc., are fragmented, and the 5' ends of both strands of the double-stranded fragments are attached in the corresponding predetermined regions 37A, 37B, 37C, 37D, 37E, 37F to the corresponding 3' ends of the transfer strands 42A, 42B, or 42C, 42D of the transposon complexes 38A, 38B, or 38C, 38D. The 3' ends of the double-stranded fragments are not attached to the 5' ends of the non-transfer strands 44A, 44B, or 44C, 44D. Therefore, there are vacancies between the 3' ends of each DNA fragment strand and the 5' ends of the corresponding non-transfer strands 44A, 44B, or 44C, 44D. In one example, each vacancy is nine (9) base pairs long.

[0230] When transposon complexes 38A, 38B or 38C, 38D are not present in flow cell 10' at the start of the method, the method further includes introducing transposon complex fluid containing transposon complexes 38A, 38B or 38C, 38D into flow cell 10'; introducing the tag fragmentation buffer into flow cell 10'; and bringing flow cell 10' to tag fragmentation temperature.

[0231] The transposon complex fluid contains transposon complexes 38A, 38B, or 38C, 38D at concentrations ranging from about 0.1 μM to about 1 μM in the liquid carrier. The liquid carrier may be water. Buffers and / or salts may be added to the liquid carrier to graft transposon complexes 38A, 38B, or 38C, 38D onto suitable functional groups of the polymer hydrogels 32, 32'. The pH range of the buffer is 5 to 12.

[0232] The transposable complex fluid can be introduced using any suitable technique. Transposable complex grafting can be performed as described herein. In some examples during grafting, transposable complexes 30A, 30B, or 30C, 30D are attached to at least some of the surface groups of the polymeric hydrogel 32 and have no affinity for the gap region 34 or the edge portions of the substrates 12, 14. In other examples during grafting, transposable complexes 30A, 30B, or 30C, 30D are attached to transposable trapping mechanisms or substrate surface groups located at gap regions 34, 34' and have no affinity for the polymeric hydrogels 32, 32'.

[0233] The tag fragmentation buffer can then be introduced into flow cell 10' in any desired manner, and tag fragmentation can be performed as described herein.

[0234] After tag fragmentation, this example method includes generating a fully adapted DNA sample fragment for each of the merged samples; amplifying these fully adapted DNA sample fragments; and performing sequencing operations.

[0235] Generating a fully adapted fragment may include removing transposase 46 from transposon complexes 38A, 38B or 38C, 38D, and initiating an extension reaction.

[0236] The removal of transposase 46 can be accomplished, for example, using sodium dodecyl sulfate (SDS) or a protease, or by heating the flow cell 10' to approximately 60°C. When heat is used, some example methods involve introducing a washing solution into the flow cell 10' and heating the flow cell 10' containing the washing solution to approximately 60°C.

[0237] When SDS or another ionizing detergent has already been used to remove transposases, the washing solution can be flushed through flow channel 20 before initiating the extension reaction. This removes ionizing detergent that may interfere with the activity of downstream enzymes.

[0238] To initiate the extension reaction, the extension amplification mixture is introduced into flow cell 10'. Examples of extension amplification mixtures include nucleotides, recombinases, polymerases, and accessory proteins. Extension amplification mixtures may also include buffers (e.g., Tris), enzymes, stabilizers, metal cofactors, surfactants (e.g., TWEEN polysorbate), and / or cosolvents (e.g., glycerol, dimethylformamide, etc.). ExAMP reagents, available from Inmena, are examples of suitable extension amplification mixtures.

[0239] When the extension amplification mixture is introduced, the flow cell 10' can be at approximately 38°C.

[0240] At the start of the extension reaction, non-transfer strands 44A, 44C, 44C, and 44D are dehybridized. The extension reaction is performed using an extension amplification mixture, adding an additional sequence (adaptor) to the 3' end of a partially adapted fragment (i.e., a fragment attached to transfer strands 42A, 42B, 42C, or 42D). The extension reaction involves adding nucleotides from the 3' end of a DNA fragment in a template-dependent manner using the corresponding transfer strand 42A, 42B, or 42C, 42D as a template. Thus, one DNA fragment is extended along transfer strand 42B or 42D to generate a complementary segment of sequencing primer sequence 47B or 47D and a second amplification domain 49B or 49D attached to that DNA fragment; and another DNA fragment is extended along transfer strand 42A or 42C to generate a complementary segment of sequencing primer sequence 47A or 47C and a first amplification domain 45A or 45C attached to that other DNA fragment. The sequences generated by the extension reaction make partially fitted fragments (i.e., unlinked, extended, etc., tagged fragments) fully fitted and ready for further amplification and cluster generation. At least some of the fully fitted fragments generated along transposon complex 38B or 38D contain a first amplification domain 45A or 45C (e.g., P5) at one end and a complement of a second amplification domain 49B or 49D (e.g., P7') at the other end. At least some of the fully fitted fragments generated along transposon complex 38A or 38C contain a second amplification domain 49B or 49D (e.g., P7) at one end and a complement of a first amplification domain 45A or 45C (e.g., P5') at the other end.

[0241] Using an extension amplification mixture, amplification occurs immediately upon the generation of perfectly matched fragments. The perfectly matched DNA sample strands dehybridize to each other, and the complementary ends of the perfectly matched DNA sample strands hybridize with the corresponding complementary primers 16, 18, or 16', 18'. A high-fidelity DNA polymerase copies the sample fragment from the hybridized primers via 3' extension. The original sample fragment denatures, leaving a copy immobilized around the recesses 26, 26' or in lanes 36, 36'. Isothermal bridging amplification or some other form of amplification can be used to amplify the immobilized copy. For example, the copied template loops back to hybridize with adjacent complementary primers 16, 18, 16', 18', and the polymerase copies the copied template to form double-stranded bridges, denatures these double-stranded bridges to form two single strands. These two strands loop back and hybridize with adjacent complementary primers, and are extended again to form two new double-stranded loops. This process is repeated for each template copy through cycles of isothermal denaturation and amplification, resulting in dense clusters of amplicon clones within recesses 26, 26' or lanes 36, 36'. Each cluster of the double-stranded bridge is denatured. In this example, the antisense strand is removed by specific base cleavage, leaving the forward template strand. This example of clustering is similar to kinetic exclusion amplification and is an example of an executable amplification. It should be understood that other amplification techniques may be used.

[0242] The forward or reverse strand can be cleaved, leaving the remaining strand for sequencing. The cleavage agent used will depend on the cleavage sites 52A, 52B, 52C, 52D of the transposon complex 38A, 38B or 38C, 38D and the required fully adapted DNA fragment to be cleaved. For example, uracil can be cleaved by uracil-DNA glycosylase (UDG), inosine by endonuclease IV (Endo IV) or endonuclease V (Endo V), 8-oxoguanine by 8-oxoguanine DNA glycosylase, and ortho-diol bonds can be cleaved by oxidation (such as treatment with periodate reagent).

[0243] Sequencing can then be performed. In one example, sequencing is performed by introducing sequencing primers, followed by the introduction of an incorporation mixture containing labeled nucleotides. Each instance of nucleotide incorporation can be detected using optical imaging.

[0244] An example kit that can be used with this method includes a first plurality of recognition primers 30A; a second plurality of recognition primers 30B; and a flow cell 10' comprising: a substrate 12 having recesses 26 separated by gap regions 34; a polymer hydrogel 32 positioned within each recess of the recesses 26; and a set of amplification primers 16, 18 attached to the polymer hydrogel 32 within each recess of the recesses 26, the amplification primer sets 16, 18 being respectively associated with a first recognition primer sequence 31 and a second recognition primer sequence 30A of the first plurality of recognition primers 30A and the second plurality of recognition primers 30B. The primer sequences 31 are orthogonal; a first plurality of complementary recognition primers are attached to a first predetermined region located in a first region 37A of the substrate 12, wherein each of the first plurality of complementary recognition primers has a sequence complementary to the sequence of the first recognition primer; and a second plurality of complementary recognition primers are attached to a second predetermined region located in a second region 37B of the substrate 26, wherein each of the second plurality of complementary recognition primers has a sequence complementary to the sequence of the second recognition primer. The predetermined region of each region 37A, 37B may be a recess 26 in the region or a gap region 34 located in the region 37A, 37B.

[0245] The kit may also contain transposon complex fluid, washing solution and / or tag fragmentation buffer.

[0246] In this kit, each type of recognition primer, such as 30A and 30B, is stored separately so that the kit can be used to label specific DNA samples, such as 54A and 54B.

[0247] It should be understood, for reference Figure 4 The described method and kit can be performed using an unpatterned flow cell including lanes 36 but without recesses 26, wherein corresponding complementary recognition primers are attached along lanes 36 to different regions 37A, 37B, etc., so that the DNA samples 35A, 35B, etc., conjugated with recognition primers hybridize in different regions 37A, 37B.

[0248] Embedded Index #2

[0249] Another example disclosed in this paper uses light-triggered DNA intercalators for spatial indexing.

[0250] The flow cell used in this example is Figure 2AAn improved version of flow cell 10 is shown. In one example, the flow cell includes: a substrate 12 having recesses 26 separated by gap regions 34; a polymer hydrogel 32 positioned within each recess of the recesses 26; a set of amplification primers 16, 18 attached to the polymer hydrogel 32 within each recess of the recesses 26; and a light-triggered DNA intercalator 33' (see [link to documentation]). Figure 6 The light-triggered DNA intercalator is attached in its non-intercalated form, NI, to the polymer hydrogel 32 within each recess of the recess 26.

[0251] The phototriggered DNA intercalator 33' is anchored within the recess 26 of the flow cell substrate 12 via any of the attachment mechanisms disclosed herein, or alternatively anchored on the gap region 34 of the flow cell substrate. On the flow cell surface, the phototriggered DNA intercalator 33' is in its non-intercalated form, NI (…). Figure 6 (on the left side), until they are exposed to light of a predetermined wavelength (e.g., ultraviolet light). When exposed to such light, the photochromic portions (i.e., the light-triggered DNA intercalators 33') will undergo a change in properties or behavior that allows them to slide between DNA base pairs of sample 54. Figure 6 (Right side). In embedding form I, the light-triggered DNA intercalator 33' can bind to the DNA sample 54 already introduced into the flow cell 10. The introduced DNA sample 54 will not bind to any unactivated light-triggered DNA intercalator in the light-triggered DNA intercalator 33'.

[0252] The phototriggered DNA intercalator 33' can be selected from the group consisting of: azobenzene-based intercalators, anthracene-based intercalators, metal-polypyridyl complexes, and spiropyran-based intercalators. Examples include:

[0253]

[0254] Azobenzenes undergo reversible cis-trans isomerization upon exposure to light of specific wavelengths. This structural change can modulate their intercalation properties. Photoresponsive anthracene-based compounds can intercalate into DNA. When exposed to UV light, anthracene undergoes photodimerization, which can lead to changes in DNA binding or release. Metal (e.g., ruthenium(II)) polypyridyl complexes can intercalate into DNA, and their photoreactivity is known. These complexes undergo photoinduced ligand dissociation or other reactions upon light exposure, which can affect their DNA-binding properties. Spiropyran molecules can switch between closed, non-intercalating and open intercalating forms upon exposure to light of specific wavelengths. This property can be used to reversibly control the intercalation of these compounds into DNA.

[0255] The light-triggered DNA intercalator 33' can be attached to the polymer hydrogel 32 or the interstitial region 34 via a cleavable adapter. Examples of suitable cleavable adapters include disulfide bonds (cleaved under alkaline or reducing conditions), peptide adapters (cleaved by peptidase, which will also remove the transposon complex 38A, etc.), hydrazine adapters (cleaved under acidic conditions), ester adapters (cleaved under acidic conditions), and thioether adapters (cleaved under reducing conditions).

[0256] A cleavable adapter is desirable, allowing the light-triggered DNA intercalator 33' to be removed after tag fragmentation and before DNA sequencing. This is desirable to remove components (e.g., ruthenium) that could adversely affect downstream processes (e.g., sequencing). The removal of the light-triggered DNA intercalator 33' occurs after tag fragmentation, allowing DNA sample fragments to attach to the flow cell surface via the transfer strands of the corresponding transposon complexes 38A, 38B, or 38C, 38D.

[0257] refer to Figure 5A and Figure 5B Any of the transposon complexes 38A, 38B, or 38C, 38D described can be used in this example flow cell 10 and method. The transposon complexes 38A, 38B, or 38C, 38D for tagging and fragmenting DNA samples can be present in the flow cell 10 before the addition of the corresponding sample, or can be added after the DNA sample 54 is attached to the corresponding region. When the transposon complexes 38A, 38B, or 38C, 38D are included in the flow cell 10 before the introduction of the DNA sample, the transposon complexes 38A, 38B, or 38C, 38D can be introduced and grafted onto the polymer hydrogel 32 or onto the transposon trapping mechanism or substrate surface groups positioned at the interstitial region 34. Transposon grafting can be performed at a temperature ranging from about 35°C to about 55°C for a time ranging from about 30 minutes to about 120 minutes.

[0258] Following grafting, transposon complexes 38A, 38B, or 38C, 38D can be inactivated by removing transposase 46 (e.g., using sodium dodecyl sulfate (SDS) or a protease, or by heating the flow cell to approximately 60°C). Transposon complexes 38A, 38B, or 38C, 38D can be reactivated upon introduction of the corresponding DNA sample. Inactivation helps ensure that the DNA sample is not prematurely tagged and fragmented. Alternatively, transposon complexes 38A, 38B, or 38C, 38D can remain in their grafted form when a DNA sample is introduced, but metal cofactors of the tag fragmentation buffer, such as Mg2+, should not be introduced / present. 2+This is to avoid binding to and / or premature tagging of transposon complexes 38A, 38B, or 38C, 38D. Further, transposon complexes 38A, 38B, or 38C, 38D can be passivated using a hydrophobic polymer of an antifouling agent, which is capable of removable attachment to effectively block transposon complexes 38A, 38B, or 38C, 38D during DNA sample introduction.

[0259] DNA samples to be introduced into flow cell 10 were extracted from the source using standard extraction methods.

[0260] Figure 7 A single flow tank lane 36 is shown at different stages of this example method. The method involves sequentially attaching at least two different DNA samples to corresponding predetermined regions (e.g., recesses 26 or gap regions 34) of different regions 37A, 37B, 37C, 37D, 37E, and 37F of a substrate 12. From top to bottom, Figure 7 The diagram shows lane 36 of the flow cell when no sample is introduced, and then shows the same lane 36 when different regions 37A, 37B, 37C, 37D, 37E, and 37F are exposed to light during the sequential introduction of different DNA samples. The figure essentially depicts the different regions 37A, 37B, 37C, 37D, 37E, and 37F of lane 36 being illuminated at different times to attach different DNA samples. This results in the attachment of six different DNA samples in their respective regions 37A, 37B, 37C, 37D, 37E, and 37F throughout lane 36.

[0261] In this method, each of at least two different DNA samples is attached by introducing a corresponding different DNA sample from the at least two different DNA samples into the flow cell; and while the corresponding different DNA sample is present in the flow cell, exposing a corresponding predetermined region (e.g., at region 37A) of a corresponding predetermined region to light of a corresponding predetermined wavelength, thereby activating a light-triggered DNA intercalator 33' located within a recess 26 in the corresponding predetermined region (e.g., at region 37A), and binding one of the at least two different DNA samples in the corresponding predetermined region (e.g., at region 37A). Thus, during this method, one DNA sample is introduced at a time, and the binding of the DNA sample to the predetermined region is initiated by exposing the light-triggered DNA intercalator 33' to light that activates the intercalation properties of the light-triggered DNA intercalator. To prevent subsequently introduced samples from attaching to predetermined regions that have already been activated and have bound DNA, the light-triggered DNA intercalator 33' and the DNA sample at each region should be titrated to ensure that all light-triggered DNA intercalators 33' are occupied.

[0262] The method then involves initiating tag fragmentation of at least two different DNA samples to generate partially adapted fragments from at least two different DNA samples.

[0263] If transposon complexes 38A, 38B, or 38C, 38D are grafted onto flow cell 10 during DNA sample addition, transposon complexes 38A, 38B, or 38C, 38D can be inactivated after grafting and before DNA sample introduction, and then reactivated after DNA sample introduction, as described herein. Alternatively, transposon complexes 38A, 38B, or 38C, 38D can remain in the grafted state and can be introduced into the DNA sample in the absence of tag fragmentation buffer (and metal cofactor). In other words, complexes 38A, 38B, or 38C, 38D attached to the flow cell surface do not contain transposase 46. Transposome complexes 38A, 38B or 38C, 38D can be initially attached to substrate 12 with transposase 46 (e.g., at polymer hydrogel 32 or interstitial region 34), and then transposase 46 can be removed using one of the methods disclosed herein to inactivate transposome complexes 38A, 38B or 38C, 38D. This will prevent premature tag fragmentation in undesirable regions 37A, 37B, etc., of substrate 12.

[0264] Once all DNA samples have been added and bound to the desired regions 37A, 37B, etc., transposase 46 can be reintroduced. Transposase 46 binds to the transposon ends 40E, 40F to reform transposon complexes 38E, 38F. This reactivates transposon complexes 38A, 38B or 38C, 38D. Tag fragmentation buffer can then be added, and the temperature adjusted to the tag fragmentation temperature to initiate tag fragmentation, as per reference. Figure 4 As stated above.

[0265] If transposon complexes 38A, 38B or 38C, 38D are not present in flow cell 10 when the DNA sample is introduced and bound, the method further includes introducing a transposon complex fluid containing transposon complexes 38A, 38B or 38C, 38D into flow cell 10; introducing a tag fragmentation buffer into flow cell 10'; and bringing flow cell 10 to the tag fragmentation temperature.

[0266] Any example of a transposon complex fluid can be used, and attachment of transposon complexes 38A, 38B, or 38C, 38D can be performed as described herein. Tag fragmentation buffer can be added after attachment of transposon complexes 38A, 38B, or 38C, 38D, and the temperature is adjusted to the tag fragmentation temperature to initiate tag fragmentation, as referenced. Figure 4 As stated above.

[0267] After tag fragmentation, the method may further include introducing a cutting agent into a flow cell to cut the cuttable adapter; and removing the light-triggered DNA intercalator from the flow cell 10.

[0268] Following tag fragmentation, this example method involves generating a fully adapted DNA sample fragment for each of the merged samples; amplifying these fully adapted DNA sample fragments; and performing sequencing. These can also be referenced. Figure 4 To be executed as described.

[0269] It should be understood, for reference Figure 6 and Figure 7 The described methods and kits can be performed using an unpatterned flow cell, in which a light-triggered DNA intercalator 33' is attached along lane 36.

[0270] Solution-based tag fragmentation for indexing

[0271] Other examples disclosed in this article utilize solution-based label fragmentation to achieve indexing.

[0272] In the first example utilizing solution-based tagging and fragmentation, different transposon complex fluids are used to tag and fragment different DNA samples outside flow cell 10. Therefore, transposon complexes 38A, 38B or 38C, 38D are not initially attached to flow cell 10, but are added along with the tagged and fragmented DNA samples. Figure 2A and Figure 2B Any of the example flow cell architectures shown can be used in this method and kit.

[0273] In this first example, the kit may comprise i) a first fluid comprising a first liquid carrier, a first transposon complex 38A or 38C comprising a first amplification domain 45A or 45C and a first index sequence, and a second transposon complex 38B or 38D comprising second amplification domains 49B, 49D and a first index sequence, wherein at least one of the first transposon complex 38A or 38C or the second transposon complex 38B or 38D comprises a terminal linker group 48A or 48C, or 48B or 48D; ii) a second fluid, wherein the first liquid carrier comprises a first transposon complex 38A or 38C and a first index sequence 45A or 45C, and a second transposon complex 38B or 38D comprises a first liquid carrier, a first transposon complex 38A or 38C comprising a first amplification domain 45A or 45C and a first index sequence 45C, and a second transposon complex 38B or 38D; The two fluids comprise a second liquid carrier, a third transposon complex 38A or 38C comprising a first amplification domain 45A or 45C and a second index sequence different from the first index sequence, and a fourth transposon complex 38B or 38D comprising a second amplification domain 49B or 49D and a second index sequence, wherein at least one of the third transposon complex 38A or 38C or the fourth transposon complex 38B or 38D comprises a terminal linker group 48A or 48C, or 48B or 48D; and iii) any example of the tag fragmentation buffer disclosed herein. It should be understood that the kit may contain any number of fluids (transposon complex fluids), and each fluid contains fresh transposon complexes, such as 38A and 38B, 38A' and 38B', which have an index sequence unique to that specific fluid. Therefore, each DNA sample tagged and fragmented within an individual fluid is uniquely indexed. See reference... Figure 5A and Figure 5B The index sequence is included in transfer chains 42A, 42B, 42C, and 42D.

[0274] Index sequences are short, unique identifier sequences. They barcode DNA samples fragmented using transposon complex tags 38A and 38B, 38A' and 38B'. The length of index sequences can range from 7 to 15 bases.

[0275] In addition to containing the index sequence, at least one of the transposon complexes 38A and / or 38B or 38C and / or 38D used in this example contains a terminal linking group / functional group 48A or 48C, or 48B or 48D. Therefore, unlike transposon complexes 38A, 38B and 38C, 38D (each of which contains a terminal linking / functional group 48A or 48C, or 48B or 48D), one or more transposon complexes 38A and / or 38B or 38C and / or 38D may not have a linking group 48A or 48C, or 48B or 48D.

[0276] Different examples of such transposable complexes are shown in Figures 8A to 8F In the diagram, the terminal linker / functional group is shown as B (for biotin, although these groups are not intended to be limited to biotin). These examples illustrate homodimers of transposable complexes. Figure 8A Homodimers of transposable complexes 38C and 38D are shown. Figure 8B Homodimers of transposable complex 38A paired with transposable complexes without any 5' or 3' end linking groups are shown. Figure 8C Homodimers of transposable complex 38D paired with transposable complexes that do not have any 5' or 3' end linking groups are shown. Figure 8D The homodimers of transposable complexes 38A and 38B are shown. Figure 8E Similar to Figure 8C The difference lies in that the 3' end linking group is on the opposite transposable complex (i.e., complex 38D does not contain a 3' end linking group, and the other complex does contain a 3' end linking group). Figure 8F A homodimer of transposable complex 38D paired with another transposable complex having a 3' terminal linking group is shown (similar to complex 38C, except that the 5' terminal functional group 48C is on the 3' end of the non-transfer chain).

[0277] The kit may also contain Figure 2A and Figure 2B The flow cell 10 shown is any one of the flow cells without further modification. Because the transposon complexes 38A, 38B or 38C, 38D (or any pair of pairs shown in FIG8) are used for solution-based tag fragmentation, the flow cell 10 does not contain the transposon complexes 38A, 38B or 38C, 38D to which they are attached.

[0278] The first example is Figure 9As shown in Figure 8. Although transposon complexes 38A, 38B, or 38C, 38D are mentioned, any of the transposon complexes shown in Figure 8 can be used. In this first example, the method may include performing solution-based tagging of a first DNA sample 54A with a first transposon complex and a second transposon complex 38A, 38B, or 38C, 38D (all containing a first index sequence) to generate a first binding complex 58A; performing solution-based tagging of a second DNA sample 54B with a third transposon complex and a fourth transposon complex 38A', 38B', or 38C', 38D', all containing a second index sequence different from the first index sequence, to generate a second binding complex 58B; merging the first binding complex 58A and the second binding complex 58B; and introducing the merged first binding complex 58A and the second binding complex 58B into a flow cell 10, whereby the first binding complex 58A and the second binding complex 58B are attached to the surface of the flow cell 10.

[0279] Solution-based tag fragmentation is performed by mixing the respective DNA samples 54A and 54B with a transposon complex solution containing indexed transposon complexes 38A, 38B, 38A', 38B' or 38C, 38D, 38C', 38D', respectively. The transposon complex solution can be any of the examples described herein. Tag fragmentation buffer is added to the mixture, and the solution is heated to the tag fragmentation temperature (e.g., from about 37°C to about 55°C). In this example, the tag fragmentation time can range from about 2 minutes to about 15 minutes.

[0280] After tag fragmentation, transposase 46 is not removed, and therefore the DNA sample fragments remain linked together by transposon complexes 38A, 38B, 38A', 38B' or 38C, 38D, 38C', 38D' still in place along the double-stranded DNA sample strand. This in Figure 9 The right side and Figure 10 It is shown schematically in the diagram.

[0281] Once all binding complexes 58A and 58B have been formed, these binding complexes can be combined together and simultaneously introduced into flow cell 10. Binding complexes 58A and 58B are allowed to incubate within flow cell 10, allowing attachment to occur between the 5' terminal functional groups and / or the 3' terminal functional groups and i) the surface groups of the polymer hydrogel 32, or ii) the transposable trapping mechanism at the gap region 34, or iii) the substrate surface groups at the gap region 34.

[0282] Figure 10A binding complex 58A is depicted attached to some of the recesses 26 in the flow cell 10. As shown, 5' and / or 3' functional groups attach the binding complex 58A within the recesses 26 (e.g., to surface groups of the polymer hydrogel 32 or to the polymer hydrogel). When biotin is used for attachment, streptavidin can be introduced together with or before the binding complexes 58A and 58B to create a biotin-streptavidin-biotin bond. Because DNA samples 54A and 54B remain together after tagging and the binding complexes 58A and 58B are attached to adjacent recesses 26, spatial connections between fragments from the same DNA samples 54A and 54B are maintained on the flow cell surface.

[0283] Once the binding complexes 58A and 58B are attached, washing can be performed using an example of the washing solution described herein to remove any unbound material. Transposase 46 can then be removed using one of the methods disclosed herein. Tag-fragmented (partially adapted) DNA sample fragments (from different samples) are held attached to flow cell 10 by 5' and / or 3' end functional groups.

[0284] The generation of fully adapted DNA sample fragments (for each DNA sample fragment in the DNA sample fragments generated via an extension reaction), the amplification of these fragments, and the sequencing of the amplified fragments can be performed as described herein. Index sequence data can be used to identify specific DNA samples.

[0285] In a second example utilizing solution-based tagging fragmentation, solution-based tagging fragmentation of each DNA sample (e.g., 54A, 54B, etc.) is performed in solution using one transposon complex (e.g., 38A or 38C containing the first amplification domain 45A or 45C), and second tagging fragmentation is performed on the flow cell surface using another surface-bound transposon complex (e.g., 38B or 38D containing the second amplification domain 49B or 49D). Transposon complexes 38A or 38C in each solution are uniquely indexed, while surface-bound transposon complexes 38B or 38D may or may not be indexed. For example, when the same transposon complexes 38B or 38D are grafted across the flow cell surface, the surface-bound transposon complexes 38B or 38D may not be indexed. For another example, when different transposable complexes 38B or 38D are selectively grafted across the surface of a flow cell (e.g., using a high-precision coating method), the surface-bonded transposable complexes 38B or 38D can be indexed.

[0286] In this second example, the kit may contain i) a first fluid comprising a first liquid carrier and a first transposon complex 38A or 38C, the first transposon complex comprising a first amplification domain 45A or 45C and a first index sequence; ii) a second fluid comprising a second liquid carrier, a second transposon complex 38A' or 38C', the second transposon complex comprising the first amplification domain 45A or 45C and a second index sequence different from the first index sequence; and iii) a tag fragmentation buffer. (iv) Flow cell 10, which includes a substrate 12 having recesses 26 separated by gap regions 34, a polymeric hydrogel 32 positioned within each recess of the recesses 26, a set of amplification primers 16, 18 attached to the polymeric hydrogel 32 within each recess of the recesses 26; and a third transposon complex 38B or 38C, which includes a second amplification domain 49B or 49D and an optional third index sequence different from the first and second index sequences. It should be understood that the kit may contain any number of fluids (transposon complex fluids), and each fluid contains fresh transposon complexes, such as 38A, 38A', or 38C, 38C', which have index sequences unique to that specific fluid. Therefore, DNA samples fragmented with individual fluid tags are uniquely indexed. (See reference...) Figure 5A and Figure 5B The index sequence is included in transfer chains 42A, 42B, 42C, and 42D.

[0287] In this second example, the transposon complex 38A or 38C in solution may not contain the terminal linker group / functional group 48A or 48C. This is because the second tag fragmentation is performed on the flow cell surface, and the surface-bound transposon complex 38B or 38D will be used to attach the DNA sample that was tagged and fragmented in the first step to the flow cell surface.

[0288] Figure 2A and Figure 2B Any of the example flow cell architectures shown can be used in this method and kit, the difference being that one of the transposon complexes 38B or 38D is attached to the polymer hydrogel 32 as described herein.

[0289] In this second example, the method for using the kit may include performing solution-based tag fragmentation of the first DNA sample 54A with a first fluid (containing a uniquely indexed transposon 38A or 38C of a certain type) and a tag fragmentation buffer to generate a first binding complex 58A' (see [link to kit]). Figure 11Solution-based tagging of the second DNA sample 54B was performed using a second fluid (containing a uniquely indexed transposon 38A' or 38C' of one type) and some of the tag fragmentation buffer in the tag fragmentation buffer to generate the second binding complex 58B'. Figure 11 ); generate an inactive first binding complex and an inactive second binding complex; and combine the inactive first binding complex and the inactive second binding complex; and introduce the combined inactive first binding complex and the inactive second binding complex into the flow cell 10, whereby the inactive first binding complex and the inactive second binding complex are respectively fragmented by a third (surface-bound) transposable complex 38B or 38D tag.

[0290] Although transposon complexes 38A, 38B, or 38C, 38D are mentioned, any of the transposon complexes shown in Figure 8 can be used, as long as the amplification domains 45 and 49 are present and one of the transposon complexes can be attached to the flow cell surface.

[0291] Solution-based tagging is performed by mixing the corresponding DNA samples 54A and 54B with a transposon complex solution containing one type of transposon complex 38A, 38A', or 38C, 38C', which is uniquely indexed. The transposon complex solution can be any of the examples described herein. Tag fragmentation buffer is added to the mixture, and the solution is heated to the tag fragmentation temperature (e.g., from about 37°C to about 55°C). In this example, the tag fragmentation time can range from about 2 minutes to about 15 minutes. In this example, solution-based tagging generates fragments with insert sizes ranging from 200 bp to 1000 bp.

[0292] After tag fragmentation and before merging the binding complexes 58A' and 58B', the metal cofactor (Mg) can be chelated. 2+ The binding complexes 58A' and 58B' can be deactivated by introducing a transposon deactivation solution. Examples of transposon deactivation solutions are aqueous solutions containing buffers (e.g., Tris), salts (e.g., sodium chloride, sodium citrate, etc.), surfactants (e.g., TWEEN polysorbate), and / or chelating agents (e.g., EDTA).

[0293] The binding complexes 58A' and 58B' can then be combined and (simultaneously) introduced into flow cell 10 containing the surface-bound transposon complexes 38B or 38D. Tag fragmentation buffer is added along with or after the binding complexes 58A' and 58B', and the flow cell 10 is heated to the tag fragmentation temperature (e.g., approximately 37°C to approximately 55°C). This initiates tag fragmentation of the (already tagged fragments) of the binding complexes 58A' and 58B'.

[0294] Transposase 46 is then removed from transposome complexes 38A or 38C bound to complexes 58A' and 58B', and from surface-bound transposome complexes 38B or 38D. The twice-tagged fragments are now attached to the flow cell surface via transfer strands 42B or 42D.

[0295] The generation of fully adapted DNA sample fragments (for each DNA sample fragment in the DNA sample fragments generated via an extension reaction), the amplification of these fragments, and the sequencing of the amplified fragments can be performed as described herein. Index sequence data can be used to identify specific DNA samples.

[0296] In the third example utilizing solution-based tag fragmentation, solution-based tag fragmentation is performed twice for each DNA sample (e.g., 54A, 54B, etc.). The first tag fragmentation for each DNA sample 54A, 54B is performed individually and outside the flow cell 10, and the second tag fragmentation for all samples 54A, 54B is performed on the flow cell. Transposon complexes 38A or 38C used for the first tag fragmentation are uniquely indexed, while transposon complexes 38B or 38D used for the second tag fragmentation are unindexed.

[0297] In this example, the transposable complexes 38A, 38B or 38C, 38D were not initially attached to flow cell 10. Figure 2A and Figure 2B Any of the example flow cell architectures shown can be used in the method and kit, provided that i) the surface groups of the polymer hydrogel 32 or ii) the transposon trapping mechanism at the gap region 34 or iii) the surface groups at the gap region 34 are present to attach to the transposon complex 38A, 38A' or 38C, 38C' used in the first tag fragmentation.

[0298] In this third example, the kit may comprise i) a first fluid comprising a first liquid carrier and a first transposon complex 38A or 38C, the first transposon complex comprising a first amplification domain 45A or 45C and a first index sequence; a second fluid comprising a second liquid carrier and a second transposon complex 38A' or 38C', the second transposon complex comprising the first amplification domain 45A or 45C and a second index sequence different from the first index sequence; a third fluid comprising a third liquid carrier and a third transposon complex, the third transposon complex comprising a second amplification domain 49B or 49D; and a tag fragmentation buffer; wherein each of the first transposon complex 38A or 38C and the second transposon complex 38A' or 38C' comprises a terminal linker group 48A or 49C.

[0299] It should be understood that the kit may contain any number of fluids (transposon complex fluids, such as the first and second fluids), and each fluid contains fresh transposon complexes, such as 38A or 38C, 38A' or 38C', which have index sequences unique to that specific fluid. Therefore, each DNA sample initially fragmented with individual fluid tags is uniquely indexed. (See reference...) Figure 5A and Figure 5B The index sequence is included in transfer chains 42A, 42B, 42C, and 42D.

[0300] The kit may also contain Figure 2A and Figure 2B Any one of the flow cells 10 shown is used without further modification. Because all transposon complexes 38A, 38A', 38B or 38C, 38C', 38D are used for solution-based tag fragmentation, flow cell 10 does not contain transposon complexes 38A, 38B or 38C, 38D to which they are attached.

[0301] In this third example, the method for using the kit may include generating a first binding complex 58A' by performing solution-based tag fragmentation of a first DNA sample 54A using a first fluid (containing a uniquely indexed transposon 38A or 38C of one type) and a tag fragmentation buffer; generating a second binding complex 58B' by performing solution-based tag fragmentation of a second DNA sample 54B using a second fluid (containing a uniquely indexed transposon 38A' or 38C' of one type) and a tag fragmentation buffer; merging the first binding complex 58A' and the second binding complex 58B'; introducing the merged first binding complex 58A' and the second binding complex 58B' into flow cell 10, whereby the first binding complex 58A' and the second binding complex 58B' are attached to the surface of flow cell 10; and performing a second solution-based tag fragmentation of the DNA fragments of the first binding complex 58A' and the second binding complex 58B' in flow cell 10 using a third fluid and a tag fragmentation buffer.

[0302] Although transposon complexes 38A, 38B, or 38C, 38D are mentioned, any of the transposon complexes shown in Figure 8 may be used, provided that the amplified domains 45, 49 are present and the transposon complex used in the first tag fragmentation can be attached to the flow cell surface (e.g., polymer hydrogel 32).

[0303] Solution-based tagging is performed by mixing the corresponding DNA samples 54A and 54B with transposon complex solutions (first solution, second solution) containing one type of transposon complex 38A, 38A' or 38C, 38C', which are uniquely indexed. The transposon complex solution can be any of the examples described herein. Tag fragmentation buffer is added to the mixture, and the solution is heated to the tag fragmentation temperature (e.g., from about 37°C to about 55°C). In this example, the tag fragmentation time can range from about 2 minutes to about 15 minutes. In this example, solution-based tag fragmentation produces fragments with insert sizes ranging from 200 bp to 1000 bp. The corresponding binding complexes 58A' and 58B' are similar to the reference... Figure 11 Those described.

[0304] After tag fragmentation and before merging the binding complexes 58A' and 58B', the metal cofactor (Mg) can be chelated. 2+ Alternatively, the binding complexes 58A' and 58B' can be deactivated by introducing a transposable deactivation solution.

[0305] The binding complexes 58A' and 58B' can then be combined together and (simultaneously) introduced into the flow cell 10. Because at least some of the transposon complexes 38A, 38A' or 38C, 38C' used to generate the binding complexes 58A' and 58B' contain 5' or 3' terminal linking groups / functional groups 48A, 48C, the binding complexes 58A' and 58B' can be attached to the polymer hydrogel 32 within the flow cell 10.

[0306] After the binding complexes 58A' and 58B' are attached to the polymer hydrogel 32, the transposase 46 binding complexes 58A' and 58B' can be removed.

[0307] A third solution containing other transposon complexes 38B or 38D is then added to flow cell 10 containing the attached binding complexes 58A' and 58B'. Tagging fragmentation buffer is also added, and the solution is brought to the tagging fragmentation temperature. Flow cell 10 is then brought to the tagging fragmentation temperature (e.g., from about 37°C to about 55°C). This initiates tagging fragmentation of the (already tagged fragments) of binding complexes 58A' and 58B'. Transposase 46 is then removed from the other transposon complexes 38B or 38D using any of the methods disclosed herein. The twice-tagged fragments are now attached to the flow cell surface via 5' or 3' end linker groups / functional groups 48A and 48C.

[0308] The generation of fully adapted DNA sample fragments (for each DNA sample fragment in the DNA sample fragments generated via an extension reaction), the amplification of these fragments, and the sequencing of the amplified fragments can be performed as described herein. Index sequence data can be used to identify specific DNA samples.

[0309] The fourth example of using solution-based tag fragmentation is similar to that in Figure 8 and Figure 9 The example described is modified as follows: i) the spatial tag is attached to the transposable complex 38A, 38B or 38C, 38D instead of the 3' or 5' end linking groups / functional groups 48A, 48B, 48C, 48D, and ii) the target primers (which are complementary to the spatial tag) used to attach the binding complex 58A, 58B are attached to the surface of the flow cell.

[0310] In this example, transposon complexes 38A, 38B or 38C, 38D are referenced in this paper. Figure 5A and Figure 5B Or any of the examples shown in Figure 8, except that the 3' or 5' end linking groups / functional groups 48A, 48B, 48C, 48D are spatially labeled (see Figure 8). Figure 12Replace 60A, 60B in the original text. The spatial tag attached to a specific set of transposon complexes 38A, 38B or 38C, 38D is an oligonucleotide primer i) that is aligned with a predetermined region of flow cell 10" (see [link to flow cell 10]). Figure 12 The target primers (not shown) contained in regions 37A, 37B, 37C, 37D, 37E, and 37F are complementary, and (ii) they are attached to binding complexes 58A" and 58B" formed by this set of transposable complexes 38A, 38B, or 38C, 38D. Therefore, the spatial tag used in each fluid will depend on the corresponding region 37A, 37B, etc., and the target primer in that region 37A, 37B, etc. In the example, one spatial tag 60A is TACGTACG, and another spatial tag 60B is GGTTCCAT.

[0311] Therefore, the flow cell lane 36 is divided into at least two zones 37A, 37B, etc. The number of zones 37A, 37B, etc. depends on the number of different samples 54A, 54B, etc. to be introduced into the flow cell lane 36. The number of zones 37A, 37B is also limited by the size of the lane 36.

[0312] Regions 37A, 37B, etc., are defined by specific types of target primers attached to polymer hydrogel 32 or interstitial regions 34 within regions 37A, 37B, etc. Each target primer in a given region 37A, 37B, etc., has the same sequence as each other target primer in that region 37A, 37B, etc., and this sequence is complementary to the sequence of the spatial tag to which it is to hybridize. Target primers in one region (e.g., 37A) are orthogonal to target primers in each of the other regions (e.g., 37B, 37C, 37D, 37E, 37F). The term "orthogonal," when used to describe target primers, means that a target primer in one region has a different oligonucleotide sequence than the target primers in each of the other regions, and therefore the target primers in the corresponding regions 37A, 37B, 37C, 37D, 37E, 37F are able to hybridize with the corresponding complementary spatial tag.

[0313] The 5' end of each target primer contains a functional group that attaches it to the polymer hydrogel 32 or the gap region 34. For example, when using a biotinylated polymer hydrogel 32, the 5' end of each target primer is biotin, and avidin or streptoavidin can be used to attach the target primer to the desired region. In other examples, the 5' end of each target primer may be an R group that can be covalently attached to the polymer hydrogel 32. A Any suitable functional group of the group. In other examples, the 5' end of each target primer in the target primer can be any suitable functional group that can be attached to the transposable trapping mechanism or substrate surface group located at the gap region 34.

[0314] Different groups of target primers can be sequentially assigned to the corresponding regions 37A, 37B, etc., using any of the high-precision coating methods described herein.

[0315] The fourth example kit may include a flow cell 10", which contains Figure 2A The same components as the flow cell 10 shown, and further comprising: target primers attached to polymer hydrogels 32 in each recess 26, wherein the target primers attached to the recess 26 in the first region 37A of the flow cell 10" are orthogonal to the target primers attached to the recess 26 in the second region 37B of the flow cell 10"; a first fluid comprising a first liquid carrier, a first transposon complex 38A or 38C comprising a first amplification domain 45A or 45C and a first index sequence, and a second transposon complex 38B or 38D comprising a second amplification domain 49B or 49D and a second index sequence, wherein at least one of the first transposon complex 38A or 38C or the second transposon complex 38B or 38D comprises a first spatial tag 60A, the first spatial tag being perpendicular to the polymer hydrogel 32 in each recess 26 of the flow cell 10". The first region contains a target primer attached within the recess 26 of the flow cell 10, which is complementary to the target primer attached within the recess 26 of the first region; a second fluid comprising a second liquid carrier, a third transposon complex 38A' or 38C' comprising a first amplification domain 45A or 45C and a third index sequence different from the first and second index sequences, and a fourth transposon complex 38B' or 38D' comprising second amplification domains 49B and 49D and a fourth index sequence different from the first, second, and third index sequences; wherein at least one of the third transposon complex 38A' or 38C' or the fourth transposon complex 38B' or 38D' comprises a second spatial tag 60B, which is complementary to the target primer attached within the recess 26 of the second region of the flow cell 10; and a tag fragmentation buffer. In an alternative kit, the flow cell 10 contains Figure 2A The flow cell 10 shown has the same components and further includes target primers attached to the polymer hydrogel 32 along the lane 36, wherein the target primers attached in the first region of the flow cell 10" are orthogonal to the target primers attached in the second region of the flow cell 10". In another alternative kit, the flow cell 10" contains Figure 2A The same components as the flow cell 10 shown, and further include target primers attached to the gap region 34, wherein the target primers attached to the gap region 34 located in the first region of the flow cell 10” are orthogonal to the target primers attached to the gap region 34 located in the second region of the flow cell 10”.

[0316] Methods for using the kit include performing solution-based tag fragmentation of a first DNA sample 54A with a first transposon complex and a second transposon complex 38A, 38B or 38C, 38D to generate a first binding complex 58A"; performing solution-based tag fragmentation of a second DNA sample 54B with a third transposon complex and a fourth transposon complex 38A', 38B' or 38C', 38D', each containing a second index sequence different from the first index sequence, to generate a second binding complex 58B"; merging the first binding complex 58A" and the second binding complex 58B"; and using... The first binding complex 58A" and the second binding complex 58B" are introduced into the flow cell 10", whereby the first binding complex 58A" and the second binding complex 58B" are attached to the target primers in the first region 37A and the second region 37B, respectively; transposase 46 is removed from the first transposon complex, the second transposon complex, the third transposon complex and the fourth transposon complex 38A, 38B or 38C, 38D and 38A', 38B' or 38C', 38D'; and a fully adapted first DNA sample fragment and a fully adapted second DNA sample fragment are generated on the surface of the flow cell.

[0317] Solution-based tag fragmentation is performed by mixing the respective DNA samples 54A and 54B with a transposon complex solution containing indexed transposon complexes 38A, 38B, 38A', 38B' or 38C, 38D, 38C', 38D', respectively, in this example, the indexed transposon complexes containing spatial tags 60A and 60B. Tag fragmentation buffer is added to the mixture, and the solution is heated to the tag fragmentation temperature (e.g., from about 37°C to about 55°C).

[0318] Once all binding complexes 58A" and 58B" have been formed, these binding complexes can be combined and simultaneously introduced into flow cell 10". Binding complexes 58A" and 58B" are allowed to incubate in flow cell 10" so that spatial tags 60A and 60B hybridize with target primers in corresponding regions 37A, 37B, etc.

[0319] Once the binding complexes 58A" and 58B" are attached, washing can be performed using an example of the washing solution described herein to remove any unbound material. Transposase 46 can then be removed using one of the methods disclosed herein. Tag-fragmented (partially adapted) DNA sample fragments (from different samples) are held attached to flow cell 10 by a hybridization spatial tag.

[0320] The generation of fully adapted DNA sample fragments (for each DNA sample fragment in the DNA sample fragments generated via an extension reaction), the amplification of these fragments, and the sequencing of the amplified fragments can be performed as described herein. Index sequence data can be used to identify specific DNA samples.

[0321] In the fifth example utilizing solution-based tag fragmentation, photoactivation of the attachment mechanism on the flow cell surface is used to attach the binding complex (e.g., 58A, 58B) to the desired region of the flow cell. This is in Figure 13 The image is depicted schematically.

[0322] Examples of this method include performing solution-based tagging of a first DNA sample 54A with a first transposon complex and a second transposon complex 38A, 38B or 38C, 38D, all containing a first index sequence, to generate a first binding complex 58A; introducing the first binding complex into a flow cell 10; exposing a predetermined region to light of a specific wavelength while the first binding complex 58A is in the flow cell 10, thereby activating a light-triggered attachment mechanism located in a recess 26 within the predetermined region and binding the first binding complex 58A to the predetermined region; and performing a second DNA sample 54A with a third transposon complex and a fourth transposon complex 38A', 38B' or 38C', 38D', all containing a second index sequence different from the first index sequence. Solution-based tag fragmentation of B to generate a second binding complex 58B; the second binding complex 58B is introduced into flow cell 10; while the second binding complex 58B is in flow cell 10, a second predetermined region is exposed to light of a certain wavelength, thereby activating a light-triggered attachment mechanism located in the recess 26 in the second predetermined region and binding the second binding complex 58B to the second predetermined region; transposase 46 is removed from the first transposon complex, the second transposon complex, the third transposon complex, and the fourth transposon complex 38A, 38B or 38C, 38D and 38A', 38B' or 38C', 38D'; and a fully adapted first DNA sample fragment and a fully adapted second DNA sample fragment are generated on the surface of the flow cell.

[0323] For reference Figure 9 The first binding complex 58A and the second binding complex 58B can be formed separately.

[0324] In this example, the flow cell 10 includes a light-triggered attachment mechanism attached within the recess 26, along the lane 36, or on the gap region 34. In this example, the light-triggered attachment mechanism is a light-triggered DNA intercalator 33'. As an alternative to the light-triggered DNA intercalator 33', a reversible light-responsive component can be used. A light-responsive pair may include one component attached to a DNA sample complex and another component attached to the surface of the flow cell. The DNA binding capability of the reversible light-responsive component can be turned off, so that subsequently introduced DNA sample complexes do not attach to the previously activated region. A "visible light-responsive pair" refers to two or three reagents that undergo a coupling reaction when exposed to visible light. When the pair contains two reagents, one reagent is attached to the polymer hydrogel 32 or the gap region 34, and the other reagent is attached to the DNA sample complex to be introduced onto the surface of the flow cell. When the pair contains three reagents, one reagent is attached to the polymer hydrogel 32 or the gap region 34, another reagent is attached to the DNA sample complex, and a third reagent is present in the formulation introduced when the coupling reagent is to be performed.

[0325] In this method, a first binding complex 58A is introduced into a flow cell 10, and a desired region 37A is exposed to light, which activates a light-triggered attachment mechanism. This allows the first binding complex 58A to bind in the predetermined region 37A. This process is repeated sequentially for each binding complex, such as binding complex 58B, to be attached within the flow cell.

[0326] Once the binding complexes 58A and 58B are introduced and attached, washing can be performed using an example of the washing solution described herein to remove any unbound material. Transposase 46 can then be removed using one of the methods disclosed herein. Tag-fragmented (partially adapted) DNA sample fragments (from different samples) remain attached.

[0327] The generation of fully adapted DNA sample fragments (for each DNA sample fragment in the DNA sample fragments generated via an extension reaction), the amplification of these fragments, and the sequencing of the amplified fragments can be performed as described herein. Index sequence data can be used to identify specific DNA samples.

[0328] The sixth example of using solution-based tag fragmentation is depicted in Figure 33A and Figure 33B In the example method, i) the universal transposon complexes 38E and 38F (see Figure 31A and Figure 31B This universal transposon complex enables the tagging and fragmentation of several DNA samples, such as 54A, and ii) corresponding unique double-indexed strands 102A and 102B (see ii). Figure 32AThis corresponding unique double-addition index chain enables the addition of unique markers to each DNA sample in DNA samples 54A, 54B, etc.

[0329] Examples of universal transposable complexes 38E and 38F are respectively in Figure 31A and Figure 31B The diagram shows a homodimer. Universal transposon complexes 38E and 38F do not contain amplification domains 45 and 49 or index sequence 50, and are therefore usable for tagging and fragmenting any DNA sample to be subsequently merged into DNA samples 54A, 54B, etc. Each transposon complex in 38E and 38F contains a transposase 46 non-covalently bound to the transposon ends 40E and 40F. Each transposon end 40E and 40F is a double-stranded nucleic acid strand, one strand ME of which is the transfer strand 42E and 42F, and the other strand ME' of which is the non-transfer strand 44E and 44F. In other words, transposon ends 40E and 40F each contain transfer strands 42E and 42F that hybridize with a portion of the non-transfer strands 44E and 44F.

[0330] In this example, each transfer strand 42E, 42F has a 5' phosphate group (5'P), which acts as a substrate for the ligase and thus enables the unique double-indexed strands 102A, 102B (each strand of which has a unique double-indexed structure in...). Figure 32A The corresponding connections are shown in the figure. Also in this example, each of the non-transfer strands 44E and 44F contains complements 47'E and 47'F to the sequencing primer sequences 47E and 47F.

[0331] Unique double-addition index chains 102A and 102B in Figure 32A As shown in the diagram. During this method, strand 102A is ligated to transfer strand 42E, and strand 102B is ligated to transfer strand 42F. These strands 102A and 102B add two unrelated, non-redundant index sequences 50A and 50B to each fully fitted DNA fragment in the fully fitted DNA fragments of individual DNA samples 54A, 54B, etc. The index sequences 50A and 50B together uniquely identify specific DNA samples 54A, 54B, etc.

[0332] Chain 102A contains sequencing primer sequence 47E, a first index sequence 50A, and a first amplification domain 45E from its 3' end to its 5' end. Similarly, chain 102B contains sequencing primer sequence 47F, a second index sequence 50B, and a second amplification domain 49F from its 3' end to its 5' end. Similar to other sequencing primer sequences described herein, such as 47A and 47B, sequences 47E and 47F in this example have sequences distinct from each other, which bind to sequencing primers introduced, for example, onto the surface of a flow cell after amplification has been performed. Also in this example, the first index sequence 50A and the second index sequence 50B form a unique dual index (UDI) for DNA samples 54A, 54B, etc., linked to chains 102A and 102B. Furthermore, in this example, the first amplification domain 45E and the second amplification domain 49F each have the same sequence as primers 16, 18 or 16', 18' present on the surface of flow cell 10, which are used to amplify binding. Figure 33A and Figure 33B The method shown generates a perfectly matched DNA fragment.

[0333] One or both chains 102A and 102B further comprise a 5' terminal functional group that can attach the resulting binding complex to the surface of the flow cell. In the example shown, chain 102A comprises a 5' terminal functional group 48E. Alternatively, chain 102B may comprise a 5' terminal functional group. The 5' terminal functional group can be any of the examples described herein that can attach the binding complex to the polymer hydrogel 32 or the interstitial region 34. In one example, the 5' terminal group is biotin.

[0334] Other examples of transposable complexes 38E, 38F and corresponding chains 102A, 102B are shown in Figure 32B and Figure 32C middle.

[0335] exist Figure 32B In the example shown, the sequencing primer sequences 47E and 47F for chains 102A and 102B are separated between transposon complexes 38E' and 38F' and the corresponding chains 102A' and 102B'.

[0336] Each of the transposon complexes 38E' and 38F' contains a transposase 46 non-covalently bound to the transposon terminus 40E' or 40F'. Each transposon terminus 40E' or 40F' is a double-stranded nucleic acid strand, one strand ME of which is the transfer strand 42E' or 42F', and the other strand ME' is a portion of the non-transfer strand 44E' or 44F'. In other words, the transposon terminus 40E' or 40F' contains transfer strands 42E' and 42F' that hybridize with a portion of the non-transfer strands 44E' and 44F', respectively.

[0337] In this example, each transfer strand 42E', 42F' contains the corresponding first portions 47E-1 and 47F-1 of the desired sequencing primer sequences 47E, 47F. The second portions 47E-2 and 47F-2 of the desired sequencing primer sequences 47E, 47F are portions of the double-indexed strands 102A' and 102B', respectively. When strands 102A' and 102B' are ligated to transfer strands 42E' and 42F', the two portions 47E-1 plus 47E-2 and 47F-1 plus 47F-2 form the sequencing primer sequences 47E, 47F.

[0338] Each transfer strand 42E' and 42F' also contains a 5' phosphate group (5'P), which acts as a substrate for the ligase and thus enables the corresponding ligation of the unique double-indexed strands 102A' and 102B' (also in... Figure 32B (As shown in the image).

[0339] Similar to non-transfer strands 44E and 44F, each non-transfer strand in non-transfer strands 44E' and 44F' contains complements 47'E and 47'F of the total sequencing primer sequence, as mentioned, which is 47E-1 plus 47E-2 and 47F-1 plus 47F-2.

[0340] Unique double-addition index chains 102A' and 102B' are also present. Figure 32B As shown in the diagram. During this method, strand 102A' is ligated to transfer strand 42E', and strand 102B' is ligated to transfer strand 42F'. These strands 102A' and 102B' add two unrelated, non-redundant index sequences 50A and 50B to each fully fitted DNA fragment in the fully fitted DNA fragments of individual DNA samples 54A, 54B, etc. The index sequences 50A and 50B together uniquely identify specific DNA samples 54A, 54B, etc.

[0341] Chain 102A' contains the second part of the sequencing primer sequence 47E-2, the first index sequence 50A, and the first amplification domain 45E from the 3' end to the 5' end. Similarly, chain 102B' contains the second part of the sequencing primer sequence 47F-2, the second index sequence 50B, and the second amplification domain 49F from the 3' end to the 5' end.

[0342] exist Figure 32C In the example shown, alternative sequences 122 and 124 are included in the corresponding transfer strands 42E" and 42F", and splice oligonucleotides 126 and 128 are attached to unique double-indexed strands 102A" and 102B".

[0343] Each of the transposon complexes 38E" and 38F" contains a transposase 46 non-covalently bound to the transposon terminus 40E" and 40F". Each transposon terminus 40E" and 40F" is a double-stranded nucleic acid strand, one strand ME of which is the transfer strand 42E" and 42F" and the other strand ME' of which is a portion of the non-transfer strand 44E" and 44F". In other words, the transposon terminus 40E" and 40F" each contain a transfer strand 42E" and 42F" that hybridizes with a portion of the non-transfer strand 44E" and 44F".

[0344] In this example, each transfer strand 42E" and 42F" contains corresponding additional sequences 122 and 124. These sequences 122 and 124 are different from each other, such that their corresponding complementary sequences 122' and 124' (part of the corresponding splice oligonucleotides 126 and 128) can bind to sequences 122 and 124, but not to the other sequence in sequences 124 and 122.

[0345] Each transfer strand 42E' and 42F' also contains a 5' phosphate group (5'P), which acts as a substrate for the ligase and thus enables the corresponding ligation of the unique double-indexed strands 102A' and 102B' (also in... Figure 32C (As shown in the image).

[0346] Unlike the non-transferable strands 44E and 44F, each strand in the non-transferable strands 44E" and 44F" consists of strand ME' and does not contain the complementary sequences 47'E and 47'F of the sequencing primer sequences.

[0347] Unique double-addition index chains 102A" and 102B are also present. Figure 32CAs shown in the diagram. During this method, strand 102A" hybridizes with sequence 122 via a portion 122' of the splice oligonucleotide 126 and is ligated to transfer strand 42E". Similarly, strand 102B" hybridizes with sequence 124 via a portion 124' of the splice oligonucleotide 128 and is ligated to transfer strand 42F". These strands 102A" and 102B" add two unrelated, non-redundant index sequences 50A and 50B to each fully fitted DNA fragment in the fully fitted DNA fragments of individual DNA samples 54A, 54B, etc. The index sequences 50A and 50B together uniquely identify specific DNA samples 54A, 54B, etc.

[0348] Chain 102A" contains, from its 3' end to its 5' end, sequencing primer sequence 47E, a first index sequence 50A, and a first amplification domain 45E, and also contains a splice oligonucleotide 126 that hybridizes with sequencing primer complement 47'E. Similarly, chain 102B" contains, from its 3' end to its 5' end, sequencing primer sequence 47F, a second index sequence 50B, and a second amplification domain 49F, and also contains a splice oligonucleotide 128 that hybridizes with sequencing primer complement 47'F.

[0349] Figure 32B and Figure 32C The example shown extends the transfer strands 42E', 42E", 42F', and 42F" beyond the ME strand to provide more access for the ligase.

[0350] The method using universal transposon complexes 38E, 38F and unique dual-indexed strands 102A, 102B includes generating a first indexed binding complex by tagging a first DNA sample (e.g., 54A) with a plurality of first transposon complexes 38E and second transposon complexes 38F to generate a sample fragment with a first transfer strand 42E or a second transfer strand 42F attached thereto (see [link to original text]). Figure 33A ), and respectively link the first unique double-indexed strands 102A and 102B to the first transfer strand 42E and the second transfer strand 42F attached to the first DNA sample fragment ( ), and respectively. Figure 33B The second indexed binding complex is generated by: tagging and fragmenting the second DNA sample (e.g., 54B) with a second plurality of first transposon complexes 38E and a second transposon complex 38F to generate a second DNA sample fragment having a first transfer strand or a second transfer strand attached thereto, and binding a second unique double-indexed strand to the first transfer strand and the second transfer strand attached to the second DNA sample fragment, respectively; merging the first indexed binding complex and the second indexed binding complex; and introducing the merged first indexed binding complex and the second indexed binding complex into flow cell 10.

[0351] Figure 33A and Figure 33B Together, they depicted the tag fragmentation and ligation of a DNA sample 54A to form a binding complex 58C. (As shown) Figure 33A As shown, solution-based tagging of a DNA sample 54A is performed by mixing the DNA sample 54A with a transposon complex solution containing any universal transposon complexes 38E, 38F. This transposon complex solution may contain any liquid carrier described herein and can be used for each of the respective samples 54A, 54B, etc. Tag fragmentation buffer is added to the mixture, and the solution is heated to the tag fragmentation temperature (e.g., from about 37°C to about 55°C). In this example, the tag fragmentation time may range from about 2 minutes to about 15 minutes. As described, tag fragmentation results in the fragmentation of the DNA sample 54A into double-stranded fragments 100A, 100B and 100C, 100D and 100E, 100F, and the 5' ends of both fragments 100A, 100B and 100C, 100D and 100E, 100F are attached to the corresponding 3' ends of the transfer strands 42E, 42F. The 3' ends of the double-stranded segments 100A, 100B and 100C, 100D and 100E, and 100F are not attached to the 5' ends of the non-transfer chains 44E and 44F.

[0352] exist Figure 33A and Figure 33B In the example shown, multiple first unique double-indexed strands 102A and 102B are added to tagged fragments 100A, 100B, 100C, 100D, 100E, and 100F (in tag fragmentation buffer) using ligase and nicotinamide adenine dinucleotide (NAD+). A suitable ligase is E. coli DNA ligase. In one example, the ligase is present in amounts ranging from about 10 units to about 25 units, and NAD+ is present in amounts ranging from about 0.25 mM to about 1 mM.

[0353] When the first unique double-indexed strands 102A and 102B, ligase, and NAD+ are added, the conditions of the maintenance solution, or conditions that bring the solution to a state where hybridization of sequences 47E and 47'E, and 47F and 47'F, will be initiated. The 5' phosphorylated 5'P of the transfer strands 42E and 42F acts as a substrate for the ligase, thereby enabling the unique double-indexed strands 102A and 102B to be ligated to the 5' ends of the transfer strands 42E and 42F respectively. This is in Figure 33B As shown in the image.

[0354] After tag fragmentation and ligation, transposase 46 is not removed, and therefore (now partially adapted) DNA sample fragments 100A, 100B and 100C, 100D and 100E, 100F remain linked together via transposon complexes 38E and 38F. This binding complex 58C is schematically shown in... Figure 33B middle.

[0355] Although reference Figure 33A and Figure 33B Sequential tag fragmentation and ligation are shown and described, but it should be understood that these processes can be performed simultaneously by mixing DNA sample 43, complexes 38E and 38F, tag fragmentation buffer, strands 102A and 102B, ligase, and NAD+ together and bringing the solution to the appropriate tag fragmentation / ligation temperature.

[0356] For any desired number of DNA samples to be processed in flow cell 10, repeat in separate batches. Figure 33A and Figure 33B The process is illustrated below. Once all binding complexes, i.e., similar complexes of 58C and other DNA samples, have been formed, these binding complexes can be pooled together and simultaneously introduced into flow cell 10. Flow cell 10 can be... Figure 2A or Figure 2B The example described herein is used without further modification. Because all transposon complexes 38E and 38F are used for solution-based tag fragmentation, flow cell 10 does not contain transposon complexes 38E and 38F to which they are attached.

[0357] The complex 58C is allowed to be incubated in the flow cell 10, so that the 5' terminal functional group 48E is attached to i) the surface groups of the polymer hydrogel 32 (in the recess 26 or in the lane 36) or ii) the transposable trapping mechanism in the gap region 34 or iii) the substrate surface groups in the gap region 34.

[0358] When the flow cell 10 includes the recess 26, the attachment of the bonding compound can be similar to... Figure 10 The attachment is shown. Alternatively, the binding complex can be attached along lane 36. Because the binding complex 58C, etc., is attached to the flow cell surface, spatial connections between fragments 100A, 100B, etc., from the same DNA sample 54A, etc., are maintained on the flow cell surface.

[0359] Once the binding complex 58C, etc., is attached, washing can be performed using an example of the washing solution described herein to remove any unbound material. Transposase 46 can then be removed using one of the methods disclosed herein. At least some of the tagged fragmented (partially adapted) DNA sample fragments (from different samples) are held attached to flow cell 10 by the 5' terminal functional group 38E. Any unbound, partially adapted DNA sample fragments can be washed away.

[0360] Then, primers 16 and 18 bound to the flow cell and the extension amplification mixture can be used to generate and amplify a fully fitted fragment. Sequencing of the amplified fragment can then be performed as described herein. The dual-indexed sequence data (from sequences 50A and 50B) can be used to identify a specific DNA sample 54A.

[0361] In some examples, Figure 33A and Figure 33B The method shown includes additional processing prior to merging various samples. After tag fragmentation and joining, some of the unique double-addition index chains 102A, 102B can remain unattached. These unattached unique double-addition index chains 102A, 102B can potentially provide a means of index skipping and can be removed before merging the samples together.

[0362] A corresponding binding complex is formed in the corresponding sample fluid. Before merging the first-indexed binding complex and the second-indexed binding complex, the method further includes removing unattached first unique double-indexed chains from the first sample fluid containing the first-indexed binding complex; and removing unattached second unique double-indexed chains (not shown) from the second sample fluid containing the second-indexed binding complex. The removal of unattached first unique double-indexed chains 102A' and 102B' from the first sample fluid containing the first-indexed binding complex 58C... Figure 33C As shown in the image.

[0363] Removal of unattached, unique double-indexed strands 102A' and 102B' from the respective sample fluids involves exposing a first and a second sample fluid to a 3' → 5' exonuclease 120. The 3' → 5' exonuclease 120 acts on single-stranded DNA to digest strands 102A' and 102B' after the ligation reaction is complete. An example of a 3' → 5' exonuclease 120 is PyroExo.

[0364] The other 3' ends of strands 102A and 102B are protected by transposase 46 and therefore should not be chewed back. The 3' ends of sequencing primer sequence complements 47'E and 47'F are exposed. Therefore, when synthesizing transposon complexes 38E and 38F, blocking groups (not shown) can be incorporated at the 3' ends of these strands. Examples of such blocking groups (not shown) could be dideoxycytidine (ddC) or deoxythymidine (dT). These groups can be removed prior to extension and amplification.

[0365] Once the unattached, unique double-indexed chains 102A' and 102B' have been removed from each fluid sample, the samples can be combined and introduced into the flow cell 10. This method can be performed as described herein.

[0366] In another example, the connection of the unique double-addition index chains 102A and 102B ( Figure 33B The removal of the unique double-addition index chains 102A' and 102B' that were not attached. Figure 33C The reactions occur sequentially within a single mixture, and the corresponding reactions are temperature-controlled. In this example method, the ligation of the first unique double-indexed strands 102A and 102B with the first transfer strand 42E and the second transfer strand 42F attached to the first DNA sample fragments 100A and 100B involves adding a ligation mixture to a tagged fragmented first DNA sample 54A to form a mixture containing a DNA ligase and a 3' → 5' exonuclease; and exposing the mixture to a ligation temperature for a first predetermined time. After the predetermined time, the method further includes removing unattached first unique double-indexed strands 102A' and 102B' from the mixture by activating the 3' → 5' exonuclease by exposing the mixture to an exonuclease activation temperature; and adding ethylenediaminetetraacetic acid to terminate the 3' → 5' exonuclease activity.

[0367] In this example method, the ligation mixture contains a ligase, a 3' → 5' exonuclease, and NAD+.

[0368] Depending on the DNA ligase used, the ligation temperature can range from approximately 12°C to approximately 37°C. A predetermined time is sufficient for ligation to occur. In this example, the time ranges from approximately 10 minutes to approximately 30 minutes.

[0369] After a predetermined time, the temperature is increased to activate the 3' → 5' exonuclease. Following activation, 3' → 5' exonuclease 120 acts on single-stranded DNA to digest strands 102A' and 102B' after the ligation reaction is complete. EDTA is added to stop the 3' → 5' exonuclease activity.

[0370] Once the unattached, unique double-indexed chains 102A' and 102B' have been removed from each fluid sample, the samples can be combined and introduced into the flow cell 10. This method can be performed as described herein.

[0371] The sample kit may include: a first fluid comprising multiple first transposon complexes 38E and second transposon complexes 38F; a second fluid comprising first unique double-indexed chains 102A and 102B; and a third fluid comprising a second unique double-indexed chain (having an index sequence different from the index sequences of chains 102A and 102B). The kit may also include... Figure 2A or Figure 2B Any example of the flow cell 10 shown. The fluid can be any of the example carrier fluids described herein.

[0372] Semi-active transposon dimers for indexing

[0373] Some examples disclosed herein enable the indexing of DNA samples using semi-active transposon dimers, where only one of the two entities is capable of tagging and fragmenting the DNA strand. Some semi-active transposon dimers for unilateral transposition are described in WO 2016 / 003814 A1, the entire contents of which are incorporated herein by reference. Any of these transposon dimers can be used... Figures 14 to 23 The example shown. In addition to the example described in WO 2016 / 003814 A1, other methods may be used to prepare semi-active dimers.

[0374] As an example, semi-active transposon dimers can be prepared using protein engineering techniques. Protein engineering can be used to link two transposase proteins together via a linker peptide to form a chimeric dimer. This ensures that one copy of transposase 46 is mutated, preventing the transposase from tagging and fragmenting DNA strands.

[0375] As another example, active transposon adaptor 62, inactive transposon adaptor 64, and transposase 46 can be used to generate semi-active transposon dimers. These are in... Figure 14The following is shown as part of kit 66. Kit 66 comprises an active transposon adaptor 62 having an active transposon terminus 40', which includes a portion (e.g., ME) of an active transfer strand 42' hybridizing with a first non-transfer strand 44', ME'. The active transfer strand 42' includes a portion of ME, an index sequence 50, and a first amplification domain 45' without a 5' end linker. The active transposon adaptor 62 also includes a first non-transfer strand 44', ME' without a 3' end linker. Kit 66 further includes an inactive transposon adaptor 64 having an inactive transposon terminus 40" which includes an inactive transfer strand 42", ME with an inactive 3' terminus 68 and a 5' end linker 48" and a second non-transfer strand 44", ME' hybridizing with the inactive transfer strand 42", ME, wherein the second non-transfer strand 44", ME' does not have a 3' end linker. Kit 66 also contains transposase 46. Any of the examples of transposon ends (e.g., 40A), amplified domains (e.g., 45A, 49B), and index sequences (e.g., 50) can be used.

[0376] Figure 14 The assembly of the active transposon adaptor 62 and the inactive transposon adaptor 64 with transposase 46 is also described. As depicted, three types of transposon dimers are formed—active transposon homodimer 70A (homodimer), inactive transposon dimer 70B (homodimer), and hemiactive transposon dimer 70C (heterodimer). Active transposon dimer 70A contains two active transposon adaptors from active transposon adaptor 62, inactive transposon dimer 70B contains two inactive transposon adaptors from inactive transposon adaptor 64, and hemiactive transposon dimer 70C contains one active transposon adaptor from active transposon adaptor 62 and one inactive transposon adaptor from inactive transposon adaptor 64.

[0377] The kit 66 may further include a solid carrier 72 containing surface groups for attachment to the 5' end linker 48". Figure 15The use of a solid support 72 to capture inactive transposon dimers 70B and semi-active transposon dimers 70C is illustrated. When the three types of transposon dimers 70A, 70B, and 70C are mixed with a solid support 72 capable of binding 5'-terminal linker molecules 48", only those dimers 70B and 70C containing 5'-terminal linker molecules 48" will bind. Active transposon dimer 70A does not contain any linker molecules and therefore does not bind to the solid support 72. In one example, the 5'-terminal linker 48" is biotin, and the solid support 72 is a streptavidin-coated magnetic bead. After the dimers 70B and 70C bind, the unbound active transposon dimer 70A can be removed. Figure 15 As shown, this essentially forms a solid carrier 72 bound to a semi-active transposon dimer 70C, since the bound inactive transposon dimer 70B is inactive.

[0378] An example method combination Figure 14 and Figure 15 The process shown includes forming a carrier-bound dimer solution by combining multiple of the following in a liquid carrier: an active transposon adaptor 62 containing an index sequence and without a 5' end linker molecule; an inactive transposon adaptor 64 containing a 5' end linker molecule 48"; and a transposase 46, thereby forming multiple of the following: an active transposon dimer 70A containing two active transposon adaptors from the active transposon adaptor 62; a semi-active transposon dimer 70C containing one active transposon adaptor from the active transposon adaptor 62 and one inactive transposon adaptor from the inactive transposon adaptor 64; and an inactive transposon dimer 70C containing an active transposon adaptor from the active transposon adaptor 62 and an inactive transposon adaptor from the inactive transposon adaptor 64. The two inactive transposon dimers 70B of the transposon integrator 64; the formation of carrier-bound dimers in the liquid carrier by adding a plurality of solid carriers 72, whereby at least some of the following are attached to at least some of the solid carriers 72: semi-active transposon dimer 70C and inactive transposon dimer 70B, and whereby the plurality of active transposon dimers 70A remain unattached; and the removal of the plurality of active transposon dimers 70A from the liquid carrier. The liquid carrier used to form dimers 70A, 70B, 70C and for attachment to solid carriers 72 may be water alone or water in combination with buffer and / or salt.

[0379] To utilize the vector-bound dimer for tag fragmentation, DNA sample 54 is added to a solution of the vector-bound dimer; a tag fragmentation buffer is introduced into the solution of the vector-bound dimer containing DNA sample 54; and the temperature of the solution of the vector-bound dimer containing the tag fragmentation buffer and DNA sample 54 is brought to the tag fragmentation temperature disclosed herein. When DNA sample 54 is added to a semi-active transposon dimer 70C (which can bind to a solid vector 72), multiple tag fragmentation events can occur on individual fragments of DNA sample 54. Examples of tag fragmentation events are shown in... Figure 17 As illustrated, the two tag fragmentation events can occur on the same strand in the cis configuration or on opposite strands in the trans configuration. After removal of transposase 46 from the product dimer 70C (which is optional), for example by washing with SDS or using another suitable removal technique disclosed herein, the original fragment remains intact unless the two tag fragmentation events occur trans-closely together. When the two tag fragmentation events occur trans-closely together, the fragment strand can split into two after removal of transposase 46. This can be minimized by utilizing a solid carrier 72 with a low density of coupled semi-active transposome dimer 70C.

[0380] Figure 14 The kit 66 shown may also include a flow cell 10. The semi-active transposon dimer 70C can be used with two different flow cells containing two different surface-bound transposon complexes 38' or 38". Figure 16 The image shows a recess 26 containing a surface-bonded transposable composite 38', 38"

[0381] An example flow cell of kit 66 includes: a substrate 12 having recesses 26 separated by gap regions 34; a polymer hydrogel 32 positioned within each recess of the recesses 26; a set of amplification primers 16, 18 attached to the polymer hydrogel 32 within each recess of the recesses 26; and a transposon complex 38' attached to the polymer hydrogel 32 within each recess of the recesses 26 via the 3' end of a non-transfer strand 44''', the transposon complex 38' comprising: a transposon end 40''' containing a transfer strand 42''' that hybridizes with a portion of the non-transfer strand 44'''; a transfer strand 42''' containing a 5'-terminal blocking group (e.g., 5'P); and a non-transfer strand 44''' containing a portion of ME', a sequence of sequencing primers, and a complement to a second amplification domain (e.g., a complement to 49B).

[0382] Another example of flow cell 10 includes: a substrate 12 having recesses 26 separated by gap regions 34; a polymer hydrogel 32 positioned within each recess of the recesses 26; and a set of amplification primers 16, 18 attached to the polymer hydrogel 32 within each recess of the recesses 26, wherein each primer 16, 18 of the amplification primer set contains a 3' end blocking group ( Figure 16 The right amplification portion contains the X at the ends of primers 16 and 18; and the transposon complex 38" is attached to the polymer hydrogel 32 in each recess of the recess 26 via the 5' end of the transfer strand 42"". The transposon complex 38" contains a transposon end 40"" which contains a portion of the transfer strand 42"" that hybridizes with the non-transfer strand 44"". The transfer strand 42"" contains a portion of ME, the sequencing primer sequence, and a second amplification domain (e.g., similar to 49B); and the non-transfer strand 44"" contains a 3' end blocking group 104.

[0383] In the method utilizing the semi-active carrier-bound dimer 70C, it should be understood that multiple DNA samples can be tagged, fragmented, combined, and introduced into one example of the flow cell described in this section. Therefore, the processes for forming the carrier-bound dimer solution and tagging DNA sample 54 can be repeated multiple times as needed for different DNA samples (e.g., 54A, 54B, etc.). It should be understood that the index sequence of the semi-active transposome dimer 70C used in the active transposome adaptor 62 to form any kind of carrier-bound dimer solution is different from the index sequence of the semi-active transposome dimer 70C used in the active transposome adaptor 62 to form each other carrier-bound dimer solution. Therefore, each DNA sample 54A, 54B, 54C is uniquely indexed. This is in Figure 18 As shown in the figure, the unique indices are represented by i1, i2, and i3.

[0384] refer to Figures 19A to 21 Several example methods utilizing semi-active transposon dimer 70C and transposon complex 38' are described. As mentioned, the transposon complex 38' bound to the flow cell surface contains a transfer strand 42'''. In this example, the transfer strand 42''' contains the sequence ME of the transposon terminus 40''', and this sequence is closed at its 5' end for ligation. In this example, the non-transfer strand 44''' contains a portion of the ME' of the transposon terminus 40''' from its 5' end to its 3' end, a sequencing primer sequence, and a complement to the second amplification domain (e.g., a complement to 49B). The 5' end of the non-transfer strand 44''' is phosphorylated ( Figure 16The 3' end has a functional group 48' (e.g., a 3' biotin group), which enables the transposable complex 38' to attach to the surface.

[0385] When DNA molecules previously treated with semi-active transposon dimer 70C are added from a flow cell (e.g., on a solid support 72) to a flow cell containing surface-bound transposons 38', several results can occur depending on the location of the surface tag fragmentation event associated with the semi-tag fragmentation site on the DNA sample 54. These examples are in... Figures 19A to 19D As shown in the figure. In the case where a single surface tag fragmentation event occurs between two half-tag fragmentation sites on DNA sample 54, there are four possible outcomes: 1) Tag fragmentation occurs between two cis-half-tag fragmentation sites on the untagged strand ( Figure 19A ); 2) Tag fragmentation occurs between two cis-half-tag fragmentation sites on a chain that has already been tagged fragmented ( Figure 19B ); 3) Tag fragmentation occurs between two trans-tagged fragmentation sites, where the surface-bound transfer strand 42''' is transferred to the strand position on the 5' side of the semi-tagged fragmentation strand ( Figure 19C ); or 4) Tag fragmentation occurs between two trans-tagged fragmentation sites, where the surface-bound transfer strand 42''' is transferred to the strand position on the 3' side of the semi-tagged fragmentation strand ( Figure 19D );

[0386] Several options are possible for how to subsequently transform the tagged fragmented molecules in preparation for clustering.

[0387] In one example method, transposonase 46 is removed (e.g., using SDS washing), followed by an extension / ligation reaction performed with a reagent containing a non-displacement polymerase and a ligase. This reaction results in the transfer strand 42' from the semi-active tagged fragmented DNA joining the non-transfer strand 44''' of the surface-bound transposon complex 38'. This reaction forms a clusterable template (i.e., a fully fitted DNA fragment). Further denaturation steps leave only those strands attached to the surface (e.g., via biotinylation) within the given indentation 26. In cases where a single surface tag fragmentation event occurs within a given indentation 26 between two semi-tagged fragmentation sites on the DNA sample 54, refer to... Figures 19A to 19D The four described results produce four distinct clustering templates within a given indentation 26. These... Figures 20A to 20D As shown in the image.

[0388] Figure 20A It shows Figure 19AThe result of surface-based tag fragmentation is shown. Specifically, the recess 26 contains a single fully clusterable template 106A (i.e., a fully adapted DNA fragment) originating from the 3' side of the half-tag fragmentation event. Furthermore, a non-clusterable template 108A is formed, which terminates in a closed transfer strand 42'''. Subsequent clustering will produce pure clusters of an indexed insert. In other words, an amplicon cluster of template 106A will be generated.

[0389] Figure 20B It shows Figure 19B The result of surface-based tag fragmentation is shown. Specifically, the recess 26 contains a single fully clusterable template 106B originating from the 5' side of the semi-tag fragmentation event. Furthermore, a non-clusterable template 108B is formed, terminating in a closed transfer chain 42'''. Subsequent clustering will produce a pure cluster of an indexed insert. In other words, an amplicon cluster of template 106B will be generated.

[0390] Figure 20C It shows Figure 19C The result of surface-based label fragmentation is shown. In this example, the recess 26 does not contain a clusterable template 108C due to the closed transfer chain 42''' at the end of 5'.

[0391] Figure 20D It shows Figure 19D The result of surface-based tag fragmentation is shown. In this example, the recess 26 contains two clustering templates 106C and 106D because the DNA fragments are partially different. After cluster amplification, this can generate polyclonal clusters within the recess 26. It is believed that only one of the two templates 106C and 106D (most likely the shorter one) will amplify at a faster rate than the other template 106C and 106D, producing clusters that pass through the chastity filter.

[0392] It should be understood that Figures 20A to 20D The example shown illustrates the case of a single surface tag fragmentation event occurring between two half-tag fragmentation sites on a DNA sample fragment. It is possible that two or more surface tag fragmentation events can occur between two half-tag fragmentation sites on the DNA. However, in this case, regardless of the trans or cis orientation of the two half-tag fragmentation sites, any resulting templates generated between the two surface-bound transposons will be non-clusterable because they lack the first amplification domain sequence. This is in Figure 21 Described in the text.

[0393] refer to Figure 22 and Figure 23Other example methods utilizing semi-active transposon dimer 70C and transposon complex 38'' are described.

[0394] As mentioned, the transposon complex 38" bound to the flow cell surface comprises a transfer strand 42"" bound to the flow cell surface via its 5' end. In this example, the transfer strand 42"" comprises the sequence ME of the transposon terminus 40"" and the sequencing primer sequence, and a second amplification domain (e.g., 49B) at the 5' end. In this example, the non-transfer strand 44"" comprises the sequence ME' of the transposon terminus 40"" which is blocked at its 3' end (e.g., with a 3' phosphate group, as indicated by reference numeral 104) and cannot be further extended, for example, via a polymerase extension reaction. Also as referenced Figure 16 The primers 16 and 18 are blocked at their 3' ends (e.g., via 3' phosphate).

[0395] For surface-bound transposon complex 38", single surface tag fragmentation of semi-tagged DNA ( Figures 19A to 19C Following this is a treatment to remove transposase 46 (e.g., washing with SDS). Then, an extension-ligation reaction (using non-strand displacement polymerase and ligase) is performed to join the transfer strand 42' from the semi-active tagged fragmented DNA to the non-transfer strand 44''' of the surface-bound transposon complex 38''. 3'-5' exonucleases are added to digest the non-transfer strand 44" of the semi-tagged fragmented dimer via the unclosed 3' end of the semi-tagged fragmented dimer 70C and any strand 5' of the semi-tagged fragmented dimer 70C adjacent to the surface transposon transfer strand 42''''. Finally, the 3' phosphate block (X, 104) is removed by a phosphatase reaction that allows all 3' ends of amplification primers 16, 18 and the tagged fragmented strand ending in ME' (due to the extension / ligation of the non-transfer strand 44"') to extend. This reaction completes the formation of fully adapted fragments that can be amplified into clusters. This method in Figure 22 The image shows a half-tagged fragmented DNA sample with a cis-half-tagged fragmentation site.

[0396] Figure 22 In the workflow generally shown, the result of each recess 26 depends on the orientation (i.e., cis or trans) of the semi-tagged DNA fragmented by the surface transposable 38". Figure 23All outcomes of a single surface tag fragmentation event are shown. Two outcomes (A and C) result in an indentation 26 with a single clusterable template 106E (cis-half-tag fragmentation site); one outcome (B) results in an empty indentation 26; and one outcome (D) results in an indentation 26 with two clusterable, fully fitted DNA fragments 106F and 106G. Similar to... Figure 20D In the results of D, it is expected that only the template (most likely the shorter of the two templates) will dominate during cluster amplification and result in the pores passing through the purity filter.

[0397] In other examples, specific arrangements of individual biochemical steps are possible and are understood to be included because they are variations of the concept of first tagging and fragmenting the DNA with semi-active transposons (indexed or unindexed), then merging (or not merging), and then adding it to a flow cell containing surface-bound transposons.

[0398] Finally, the examples described in this chapter can generate larger template inserts (fully fitted DNA fragments) because the template is not generated entirely within the recess 26.

[0399] Error-proofing flow pool for indexing

[0400] Some examples disclosed herein utilize error-proofing mechanisms to implement spatial indexing. Typically, error-proofing is any mechanism that helps, for example, an equipment operator avoid errors in a specific process. In the examples disclosed herein, error-proofing mechanisms are used to help guide different DNA samples 54A, 54Bb, etc., to different regions of flow cell 10.

[0401] Examples of some of the error-proofing mechanisms disclosed in this article 74 are in Figure 24A The diagram shows it in the operable position. The "operable position" of the error-proofing mechanism 74 is when it covers the flow cell 10, such that a desired subset of the recess 26 of the flow cell 10 is exposed through the desired uniquely shaped vias 76A, 76B, 76C of the error-proofing mechanism 74. In this example, the flow cell 10 is an open wafer flow cell.

[0402] The flow pool 10 and the error-proofing mechanism 74 together constitute a spatial indexing device 80, a part of which is in Figure 24A As shown in the figure. The space indexing device 80 includes: Figure 2AThe flow cell 10, wherein primers 16, 18 and a first transposable complex and a second transposable complex 38A, 38B or 38C, 38D are attached to a polymer hydrogel 32 within each recess of the recess 26; and a mistake-proofing mechanism 74 comprising at least two spatially separated regions 78A, 78B, 78C, each of the spatially separated regions 78A, 78B, 78C having a plurality of uniquely shaped through-holes 76A, 76B, 76C defined therein, each of the plurality of uniquely shaped through-holes 76A, 76B, 76C being exposed when the mistake-proofing mechanism 74 is in an operable position. Figure 2A The corresponding subset of the recessed portion 26 of the flow cell 10.

[0403] It should be understood that the first transposable complex or the second transposable complex 38A, 38B or 38C, 38D across the entire flow cell 10 may be the same (without any index sequence), or may contain a unique index sequence 50 in each of the corresponding regions 78A, 78B, 78C.

[0404] In one example, the error-proofing mechanism 74 is permanently attached to the substrate 12. In this example, the error-proofing mechanism 74 is a laminated mask fastened to the substrate 12 in an operable position. An optical adhesive (e.g., NORLAND, available from Norland Products) can be used. ™ Attachment can be achieved using optical adhesives or double-sided tape.

[0405] In another example, the error-proofing mechanism 74 is detached from the substrate 12 and can be temporarily (removably) secured to the substrate 12 when different DNA samples are desired to be introduced into the flow cell 10. In this example, the error-proofing mechanism 74 can be positioned above the substrate 12 in an operable position and then removed from the substrate 12 after the DNA sample (e.g., 54A, 54B, etc.) has been introduced.

[0406] In another example, the error-proofing mechanism 74 is temporarily attached to the substrate 12. In this example, the error-proofing mechanism 74 is defined by a removable material having removable properties orthogonal to the removable properties of the substrate 12. In this example, "orthogonal" means that the mechanism used to remove the error-proofing mechanism 74 will not react with the substrate 12, primers 16, 18, transposon complexes 38A, 38B or 38C, 38D, or introduced DNA samples 54A, 54B, etc. In one example, the removable material may be the same cured polymer 84 as the encapsulation complexes 82A, 82B, 82C (see [link to relevant documentation]). Figure 24BThese encapsulation compounds will melt when exposed to heat. Alternatively, the crosslinking level of the removable material can be tuned so that it requires more heat than encapsulation compounds 82A, 82B, and 82C, thereby ensuring that encapsulation compounds 82A, 82B, and 82C are removed before the temporary bonding error-proofing mechanism 74.

[0407] In yet another example, the error-proofing mechanism 74 and the flow cell 10 can be integrally formed (i.e., they are a single piece). The space indexing device 80 can be formed using an additional photolithography step on top of layer 24 of the flow cell substrate 12.

[0408] In one example, the spatial indexing device 80 may be included in the kit along with a photocurable polymer. The photocurable polymer can be used to encapsulate DNA samples to be introduced into the recess 26 of the flow cell 10. Examples of suitable photocurable polymers are formed using poly(ethylene glycol) diacrylate (PEGDA, Mn approximately 575, 40% DPBS solution) and 2,2-dimethoxy-2-phenylacetophenone as monomers and a photoinitiator. The kit may contain other encapsulation materials instead of the photocurable polymer, such as micelles, lipid nanoparticles, polymer nanoparticles, dendritic polymers, liposomes, carbon nanotubes, protein nanocages, metal nanocages, exosomes, and extracellular vesicles.

[0409] Before performing the method using the spatial indexing device 80, the corresponding DNA samples 54A, 54B, etc., can be encapsulated in a photocurable polymer to form encapsulation complexes 82A, 82B, 82C, such as... Figure 24B As shown. In Figure 24B In this example, different DNA samples 54A, 54B, and 54C are encapsulated in a cured polymer 84. In this example, the cured polymer 84 is the same for each of the encapsulation complexes 82A, 82B, and 82C. In other examples, the cured polymer may be different for each of the encapsulation complexes 82A, 82B, and 82C.

[0410] An example method for preparing encapsulation complexes 82A, 82B, and 82C is optical transient liquid molding, which generates microstructures by irradiating a target flow containing a polymer precursor of the desired DNA sample 54A, 54B, etc., with patterned ultraviolet (UV) light. Figure 24B As shown, the shapes of encapsulation complexes 82A, 82B, and 82C correspond to the shapes of through holes 76A, 76B, and 76C, respectively.

[0411] The method using the spatial indexing device 80 involves i) simultaneously introducing at least two encapsulation complexes 82A, 82B, and 82C into the flow cell 10 when the error-proofing mechanism 74 is in an operable position, wherein the first encapsulation complex 82A of the at least two encapsulation complexes 82A, 82B, and 82C comprises a first DNA sample 54A embedded in a first polymer 84 and has a first shape corresponding to a plurality of uniquely shaped through-holes 76A in the first spatially separated region 78A, 78B, and 78C, and the second encapsulation complex 82B of the at least two encapsulation complexes 82A, 82B, and 82C comprises a first DNA sample 54A embedded in a second ... first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to a first shape corresponding to Figure 24B The second DNA sample 54B, shown as 84), has a second shape corresponding to a plurality of uniquely shaped through-holes 76B in region 78B, which is separated in at least two spaces, and thus: at least some of the first encapsulation complexes 82A, 82B, 82C of the first encapsulation complex 82A occupy at least some of the uniquely shaped through-holes 76A in region 78A, 78B, 78C, which is separated in at least two spaces; and the at least two encapsulation complexes 82A, 82B, 82C ... ii) At least some of the second encapsulation complexes in the second encapsulation complex 82B of the encapsulation complexes 82A, 82B, 82C occupy at least some of the uniquely shaped vias 76B in the region 78B separated in the second space of the regions 78A, 78B, 78C that are separated in the at least two spaces; ii) Remove the at least two encapsulation complexes 82A, 82B, 82C that do not occupy the multiple uniquely shaped vias 76A, 76B, 76C; and iii) Release the first DNA sample 54A and the second DNA sample 54B from the at least two encapsulation complexes 82A, 82B.

[0412] Encapsulation compounds 82A, 82B, and 82C can be added to a liquid carrier (e.g., water) and introduced into a mistake-proofing mechanism 74 (in an operable position). The mistake-proofing mechanism 74 can be open to the surrounding environment or have a dedicated inlet large enough to accommodate the encapsulation compounds 82A, 82B, and 82C.

[0413] Once in the error-proofing mechanism 74, encapsulation compounds 82A, 82B, and 82C are allowed to incubate within it. Under sufficiently slow flow, encapsulation compounds 82A, 82B, and 82C will roll on the surface and be trapped in the corresponding uniquely shaped vias 76A, 76B, and 76C. Therefore, encapsulation compounds 82A, 82B, and 82C will settle into the corresponding uniquely shaped vias 76A, 76B, and 76C, respectively. The flow direction can be switched multiple times to allow the encapsulation compounds 82A, 82B, and 82C to flow / move gently back and forth in an attempt to position them in the corresponding zones 78A, 78B, and 78C.

[0414] After at least some of the encapsulation compounds 82A, 82B, 82C occupy the corresponding uniquely shaped vias 76A, 76B, 76C, the encapsulation compounds 82A, 82B, 82C that have not settled and do not occupy the uniquely shaped vias 76A, 76B, 76C can be removed, for example, by washing.

[0415] The polymer 84 of the encapsulation complex 82A, 82B, 82C within the uniquely shaped through-holes 76A, 76B, 76C can then be removed (e.g., by dissolution) to release the corresponding DNA samples 54A, 54B, 54C into subsets of the recesses 26 in regions 78A, 78B, 78C.

[0416] After the release of DNA samples 54A, 54B, and 54C, polymer 84 can be washed away. Tag fragmentation buffer can then be added, and the temperature adjusted to the tag fragmentation temperature to initiate tag fragmentation, as per reference. Figure 4 As described herein, transposase 46 is removed from the surface-bound transposon complexes 38A, 38B, or 38C, 38D. The generation of fully adapted DNA sample fragments (for each DNA sample fragment in the DNA sample fragments obtained via an extension reaction), the amplification of these fragments, and the sequencing of the amplified fragments can be performed as described herein.

[0417] In some cases, the error-proofing mechanism 72 is removed after tag fragmentation or amplification. This removal will depend on how the error-proofing mechanism 72 is attached or whether it is soluble.

[0418] Indexing using a droplet array plate

[0419] Some examples disclosed herein utilize pendant drop arrays for spatial indexing. In the examples disclosed herein, pendant drop arrays facilitate the guidance of different DNA samples to different regions of flow cell 10. Flow cell 10 may be... Figure 2AThe example described herein could also be a complementary metal-oxide (CMOS) chip that includes patterned recesses 26 covering optical and electronic components (e.g., waveguides, sensors, etc.) of the chip. In either example, the flow cell portion is an open wafer flow cell.

[0420] Examples of a portion of the pendant drop array plate 86 disclosed herein are shown in Figure 25A The diagram shows the movement toward an operable position. The "operable position" of the pendant drop array plate 86 is the desired subset (e.g., of the recess 26 of the flow cell 10) when it covers the flow cell 10. Figure 25B The 88A and 88B shown are aligned with individual openings 90 of the droplet array plate 86.

[0421] In the example, the kit includes a reference. Figure 2A The described flow cell 10 (with primers 16, 18 in each of the recesses 26) and the pendant drop array plate 86 temporarily attached to the flow cell 10, the pendant drop array plate 86 including individual openings 90 to be aligned with corresponding subsets 88A, 88B of the recesses 26 of the flow cell 10 when the pendant drop array plate 86 is in an operable position.

[0422] In these cases, the flow cell 10 also includes a first transposon complex and a second transposon complex 38A, 38B or 38C, 38D of the polymer hydrogel 32 attached to each recess in the recess 26. In these cases, the first transposon complex and the second transposon complex 38A, 38B or 38C, 38D are unindexed and identical across the flow cell surface. If desired, the first transposon complex and the second transposon complex 38A, 38B or 38C, 38D can be dried to improve stability until the DNA sample 54A, 54B is introduced.

[0423] The kit may further include a tag fragmentation buffer, which can be introduced using a hanging drop array plate 86.

[0424] One method involves: adding at least two different DNA samples 54A and 54B to at least two individual openings in individual openings 90 of a hanging drop array plate 86; positioning the hanging drop array plate 86 in contact with a flow cell 10 such that the hanging drop array plate 86 is in an operable position, thereby transferring the at least two different DNA samples 54A and 54B to at least two different subsets 88A and 88B of a recess in the flow cell 10; and removing the hanging drop array plate 86 from the flow cell 10.

[0425] DNA samples 54A, 54B, etc., are added to the hanging drop array plate 86 using a manual or automated system. DNA samples 54A, 54B precipitate and form droplets within the opening 90. The user compresses the hanging drop plate 86 with an open-form flow cell 10 to transfer DNA samples 54A, 54B to the corresponding subsets 88A, 88B of the recesses 26. In this example (e.g.) Figure 25B As shown), subsets 88A and 88B of the recess 26 can be confined in areas separated from the space aligned with the opening 90.

[0426] The hanging drop array plate 86 can also be used to introduce washing solution after the introduction of DNA samples 54A and 54B. Alternatively, the washing solution can be introduced into the flow cell 10 after the removal of the hanging drop array plate 86, provided that the flow rate is not high enough to disrupt the binding of DNA samples 54A and 54B.

[0427] The method further includes removing the pendant array plate 86 from the flow cell 10 after all desired fluid has been introduced.

[0428] The method may also include attaching an optically clear cap to the substrate 12 after removing the hanging drop array plate 86. In the example, the optically clear cap (e.g., a glass slide) may be positioned and attached to the substrate 12 to create a flow channel 20 that will receive attachment fluid for tag fragmentation, amplification, etc. A laminated spacer may be used between the glass slide and the substrate 12 to create a fluid architecture. As an alternative to the optically clear cap, a second patterned substrate (e.g., 12' in FIG. 2) may be attached to the substrate 12 using a laminated spacer (e.g., interposer 28). Prior to attaching the second patterned substrate to the substrate 12, an additional DNA sample may have already been added to the second patterned substrate in the manner described in this example.

[0429] Then any example of tag fragmentation buffer can be added (e.g., via the flow channel inlet), and the temperature can be adjusted to the tag fragmentation temperature to initiate tag fragmentation, as referenced. Figure 4 Alternatively, using the hanging drop array plate 86 as described, at least two different DNA samples 54A and 54B are introduced together with a tag fragmentation buffer, and the method further includes raising the temperature of the flow cell to the tag fragmentation temperature. In this example, the hanging drop array plate 86 can be removed from the flow cell 10 before or after the temperature rise.

[0430] After tagging and fragmentation, this example method includes generating a fully adapted DNA sample fragment for each type of sample; amplifying these fully adapted DNA sample fragments; and performing sequencing. These can also be referenced. Figure 4 To be executed as described.

[0431] Open Die Workflow for Indexing

[0432] Some examples disclosed herein utilize devices including binder clamps to achieve spatial indexing. In these examples, DNA samples 54A, 54B, etc., or binding complexes 58A, 58B, are incorporated into target points within lane 36 of the flow cell precursor held in the binder cantilever before the optically clear cap or second flow cell precursor is bound. The positioning of each sample 54A, 54B, or binding complex 58A, 58B on the flow cell precursor provides spatial indexing.

[0433] As used herein, a second flow cell precursor refers to another substrate, such as 12' or 14', that has been functionalized with DNA sample 54A, 54B according to one of the methods described herein.

[0434] These examples utilize, including Figure 26A The connector clamp 92 shown is a device 91. The connector clamp 92 may be formed of a plastic material, which includes a concave flow pool region 94 defined therein (e.g., using...). Figure 26A As shown in Figure A). The dimensions (e.g., length, width, and depth) of the concave flow cell region 94 are the same as those of the flow cell substrate 12. Figure 2A ) or 14 ( Figure 2B The corresponding dimensions (e.g., length, width, and thickness) of the flow cell substrates 12, 14 correspond to the flow cell substrates 94. In this example, "corresponds to" means that the flow cell substrates 12, 14 can be fitted into the concave flow cell region 94 such that the surface of the interposer layer 98 (applied to or a portion of the flow cell precursor) is substantially flush with the surface of the connector jig 92.

[0435] like Figure 26B As shown, the device 91 also includes a flow cell precursor positioned in the concave flow cell region 94. The flow cell precursor is Figure 2A substrate 12 or Figure 2B Substrate 14. Figure 26B Examples include a substrate 12 serving as a flow cell precursor. Substrates 12, 14 comprise a polymer hydrogel 32, primers 16, 18, and, in some cases, transposable complexes 38A and 38B or 38C and 38D applied to the substrate in a manner described herein. In some examples, the flow cell precursor also includes an interposer 98 fastened to the substrates 12, 14. Interposer 98 in… Figure 26A and Figure 26B Point B in the diagram is shown.

[0436] like Figure 26BAs shown, the device 91 also includes a protective layer 110, which is fastened to the connector clamp 92 and positioned above the flow cell precursor present in the concave flow cell region 94. The protective film 110 can be fastened to a convex portion surrounding the concave flow cell region 94, such that removal of the protective film 110 exposes the flow cell precursor in the concave flow cell region 94. Alternatively, several protective films can be individually fastened to the convex portion, such that removal of one protective film exposes a lane 36 of the flow cell precursor (which may or may not have a recess 26 defined therein). In the latter example, a pre-cut intermediate layer 98 is pre-positioned on the flow cell precursor such that when an individual protective film is removed, a lane 36 is exposed.

[0437] In some methods of using apparatus 91, transposable complexes 38A, 38B, or 38C, 38D are grafted onto the polymeric hydrogel 32 of the flow cell precursor present within the concave flow cell region 94. In these examples, transposable complexes 38A, 38B, or 38C, 38D are not indexed and are grafted across the polymeric hydrogel 32 (in the recess 26 or in the lane 36) and / or across the gap region 34 separating the recess 26.

[0438] In some other methods using apparatus 91, transposome complexes 38A, 38B, or 38C, 38D are used in solution-based tagging and fragmentation methods performed outside a flow cell. Depending on the method used, these transposome complexes 38A, 38B, or 38C, 38D may contain index sequences. In these examples, the flow cell precursor does not contain transposome complexes 38A, 38B, or 38C, 38D.

[0439] An example method includes removing the protective membrane 110 from device 91; placing a pre-cut intercalator 98 into a flow cell precursor; selectively introducing at least two different DNA samples 54A, 54B into at least two different regions of the flow cell precursor defined by the pre-cut intercalator 98; and placing an optically clear coverslip 96 (see [link to documentation]). Figure 26A C) or the second flow cell precursor is bonded to the pre-cut intermediate layer 98.

[0440] The pre-cut intermediate layer 98 can be formed by a double-sided adhesive, which can be bonded to the flow cell precursor and the subsequently applied optically clear cover glass 96 or second flow cell precursor. Figure 26AAs shown at point B, the pre-cut interlayer 98 can be placed over the flow cell precursor (not depicted) in the concave flow cell region 94 to form / define the lane 36. Tweezers or another suitable tool (automated or non-automated) can be used to apply the pre-cut interlayer 98. The substrate 12 or 14 may have areas designated for receiving the pre-cut interlayer 98 (i.e., unpatterned, not containing the polymerized hydrogel 32, etc.).

[0441] Figure 27 The diagram schematically illustrates the selective introduction of at least two different DNA samples, 54A and 54B. Figure 27 The text depicts different DNA samples 54A, 54B, 54C, etc., and their selective allocation to different regions 37A, 37B, 37C, etc., within a lane 36-1. Samples 54A, 54B, etc., can be allocated manually or using a high-precision coating method as described herein.

[0442] In one example, a pre-cut intermediate layer 98 is placed onto a flow cell precursor to form at least two lanes 36 of the flow cell precursor; at least two distinct regions 37A, 37B, etc. of the flow cell precursor are located in the first lane of the at least two lanes 36 (e.g., Figure 27 Within lane 36-1); and the method further includes selectively introducing at least two additional, different DNA samples into a second lane of at least two lanes 36 (e.g., Figure 27 At least two distinct regions of lane 36-2). After applying a pre-cut intermediary layer 98 to define the actual lane 36, the selective introduction of multiple samples 54A, 54B can be repeated for each lane 36-1, 36-2.

[0443] When the pre-cut intermediate layer 98 is in place and DNA samples 54A and 54B have been selectively applied, an optically transparent coverslip 96 or a second flow cell precursor can be positioned on and attached to the pre-cut intermediate layer 98, such as... Figure 26A As shown at point C. Because the pre-cut interlayer 98 is a double-sided adhesive, it can be bonded to the optically clear coverslip 96 or the second flow cell precursor. Pressure can be applied to the optically clear coverslip or the second flow cell precursor when it is bonded to the pre-cut interlayer 98.

[0444] It should be understood that the resulting structure is a closed flow cell containing the bound flow cell precursor. The flow cell may include fluid lines (e.g., inlet and outlet, not shown) such that tagged fragmentation reagents, extension reaction reagents, amplification reagents, etc., can be introduced into each of the formed lanes 36.

[0445] When the first transposon complex and the second transposon complex 38A, 38B or 38C, 38D are initially attached to the polymer hydrogel 32 and / or the interstitial region 34, the corresponding DNA samples 54A, 54B, 54C, etc., can be introduced into the desired region using a tagging fragmentation fluid. Tagging fragmentation of each sample 54A, 54B, 54C, etc., can be initiated by raising the temperature to the tagging fragmentation temperature and will be performed as described herein. The method then includes removing transposase 46 from each of the first transposon complex and the second transposon complex 38A, 38B or 38C, 38D; and generating fully adapted first DNA sample fragments and fully adapted second DNA sample fragments in at least two distinct regions 37A, 37B. Alternatively, as referenced herein... Figure 4 The process involves transposase 46 removal and the generation of fully adapted fragments. Once fully adapted fragments have been generated for each DNA sample in each of the regions 37A, 37B, etc., for each of the DNA samples 54A, 54B, 54C, etc., fragment amplification and sequencing of the amplified fragments can be performed as described herein.

[0446] Another method using device 91 involves performing solution-based tag fragmentation to generate at least two different binding complexes 58A, 58B, each containing two different DNA samples 54A, 54B and a 5' end linker; placing a pre-cut intermediate layer 98 onto a flow cell precursor of device 91; selectively introducing the at least two different binding complexes 58A, 58B, etc., into at least two different regions 37A, 37B, etc., whereby the at least two different binding complexes 58A, 58B, etc., are respectively attached to the at least two different regions 37A, 37B, etc. via the 5' end linker; and binding an optically clear coverslip 96 or a second flow cell precursor to the pre-cut intermediate layer 98.

[0447] This method is referenced Figure 9 and Figure 10 The description of solution-based tag fragmentation and Figure 26A The method shown is a combination. In this example, different binding complexes 58A and 58B are prepared outside the device, and then these binding complexes are introduced into lanes 36-1 and 36-2 defined after the application of a pre-cut interlayer 98. The different binding complexes 58A and 58B are attached via 5' terminal functional groups, as shown in the reference. Figure 9 and Figure 10 As described above. (See reference) Figure 9 As mentioned above, indexing was performed on individual samples 54A and 54B.

[0448] This example may include a protective membrane 110 covering the entire flow cell precursor present in the concave flow cell region 94. Once the protective membrane 110 is removed, a pre-cut intermediate layer 98 may be applied to form lanes 36-1, 36-2, etc., and binding complexes 58A, 58B may be selectively introduced and bound to the polymer hydrogel 32 and / or gap regions 34 in the corresponding regions within lanes 36-1, 36-2, etc. Alternatively, binding complexes 58A, 58B may be combined and then introduced into specific lanes 36-1, 36-2, etc.

[0449] Once all binding complexes 58A and 58B are introduced and incorporated, the optically transparent coverslip 96 or the second flow cell precursor can be positioned on and attached to the pre-cut interlayer 98, such as... Figure 26A As shown at point C in the diagram.

[0450] Washing can be performed using an example of the washing solution described herein to remove any unbound material. Transposase 46 can then be removed using one of the methods disclosed herein. Tag-fragmented (partially adapted) DNA sample fragments (from different samples) are held attached to flow cell 10 by 5' and / or 3' end functional groups.

[0451] The generation of fully adapted DNA sample fragments (for each DNA sample fragment in the DNA sample fragments generated via an extension reaction), the amplification of these fragments, and the sequencing of the amplified fragments can be performed as described herein. Index sequence data can be used to identify specific DNA samples.

[0452] The device 91, or other methods, has a pre-cut intermediate layer 98 positioned at an appropriate location above the flow tank precursor in the concave flow tank area 94 at the beginning. The pre-cut intermediate layer 98 at the appropriate location defines the lane 36 of the flow tank precursor.

[0453] One example method includes removing a protective membrane 110 from device 91 to expose lanes 36 of a flow cell precursor; selectively introducing at least two different DNA samples 54A, 54B, 54C, etc., into at least two different regions 37A, 37B, 37C, etc., of the exposed lanes 36; and attaching an optically clear coverslip 86 or a second flow cell precursor to a pre-cut interlayer 98. Tagging fragmentation of each sample 54A, 54B, 54C, etc., will be initiated and performed as described herein. In this example, if one lane 36-1 is exposed at a time, the process can be repeated for each lane 36-2, etc. Alternatively, all lanes 36-1, 36-2, etc., can be exposed when the protective membrane 110 is removed.

[0454] Another example method includes performing solution-based tag fragmentation to generate at least two different binding complexes 58A, 58B, etc., including two different DNA samples 54A, 54B and a 5' end linker; removing a protective membrane from device 91 to expose lanes 36 of the flow cell precursor; selectively introducing at least two different regions 37A, 37B, etc. of the exposed lanes 36, whereby the at least two different binding complexes 58A, 58B, etc. are respectively attached to at least two different regions 37A, 37B, etc. via the 5' end linker; and binding an optically clear coverslip 96 or a second flow cell precursor to a pre-cut interlayer 98.

[0455] The method then includes removing transposase 46 from each of the first transposon complex and the second transposon complex 38A, 38B or 38C, 38D; and generating a fully adapted first DNA sample fragment and a fully adapted second DNA sample fragment in at least two distinct regions 37A, 37B, etc. Alternatively, as referenced herein... Figure 4 The removal of transposase 46 and the generation of fully adapted fragments are performed. Once fully adapted fragments have been generated for each of the DNA samples 54A, 54B, 54C or sample complexes 58A, 58B, etc., in each of the regions 37A, 37B, etc., fragment amplification and sequencing of the amplified fragments can be performed as described herein.

[0456] In any of these examples, the protective coating (different from protective membrane 110) may be positioned over primers 16, 18, and in some cases, on transposon complexes 38A, 38B, or 38C, 38D. The protective coating may be a sugar-based coating or a polymer, such as KOLLICOAT. ™ (BASF Corp.). In these examples, the protective coating can be removed before introducing DNA samples 54A and 54B. This type of coating can be water-soluble and therefore can be removed by washing with water.

[0457] Encapsulation of DNA templates for indexing

[0458] Another example disclosed in this article uses a wrapper container for space indexing. In this example (such as...) Figure 28A and Figure 28BAs depicted, orthogonally functionalized encapsulation containers 112A, 112B contain corresponding DNA samples 54A, 54B attached to corresponding attachment members 114A, 114B, which are attached to predetermined regions / areas 37A, 37B on the flow cell 10. Therefore, each encapsulation container 112A, 112B is anchored to a corresponding region of the flow cell 10, where each individual encapsulated DNA sample 54A, 54B is locally released. This achieves spatial indexing.

[0459] Flow cell 10 is similar to Figure 2A The example shown includes: a substrate 12 having recesses 26 separated by gap regions 34; a polymer hydrogel 32 positioned within each recess of the recesses 26; and amplification primer sets 16, 18 attached to the polymer hydrogel 32 within each recess of the recesses 26. The example flow cell 10 also includes: transposon complexes 38A, 38B or 38C, 38D attached to the polymer hydrogel 32 within each recess of the recesses 26; and attachment members 114A, 114B attached to the polymer hydrogel 32 within each recess of the recesses 26 (see [link to relevant documentation]). Figure 28B ) or ii) attached to gap region 34 (see Figure 28A The attachment member 114A located in the first zone 37A of the flow tank 10 is orthogonal to the attachment member located in the second zone 37B of the flow tank 10, thereby selectively attaching the first encapsulation container 112A to the attachment member 114A in the first zone 37A, and selectively attaching the second encapsulation container 112B to the attachment member 114B in the second zone 37B. In this example, "orthogonal" means that the attachment member 114A present in one zone 37A of the flow tank 10 can be coupled to its corresponding member 116A (which is attached to one of the encapsulation containers 112A), but cannot be coupled to the member 116B of any other encapsulation container in the other encapsulation containers 112B introduced into the flow tank 10.

[0460] Each encapsulation container 112A, 112B contains different DNA samples 54A, 54B encapsulated in encapsulation matrices 118A, 118B. To form the encapsulation containers 112A, 112B, each DNA sample 54A, 54B is extracted from the source using standard extraction methods and then mixed with the desired encapsulation matrices 118A, 118B, for example, in different reaction containers (e.g., vials). Although the DNA samples 54A, 54B are different in the different containers 112A, 112B, the encapsulation matrices 118A, 118B of the corresponding containers 112A, 112B can be the same material or different materials. The same material can be used when it is desired to remove matrices 118A, 118B simultaneously with a single remover. Different materials can be used when it is desired to remove matrices 118A, 118B sequentially with different removers. Therefore, the encapsulation matrices 118A and 118B are independently selected from the group consisting of micelles, lipid nanoparticles, polymer nanoparticles, dendritic aggregates, liposomes, carbon nanotubes, protein nanocages, metal nanocages, efflux bodies, and extracellular vesicles.

[0461] In some examples, encapsulation containers 112A and 112B may also contain tag fragmentation buffer encapsulated with DNA samples 54A and 54B. This allows for the local release of DNA samples 54A and 54B and metal cofactors (e.g., Mg) used for tag fragmentation. 2+ Both.

[0462] The chemicals involved in the encapsulation process can vary depending on the materials chosen for matrices 118A and 118B. The strands of DNA samples 54A and 54B become trapped within matrices 118A and 118B, which can be covalently or non-covalently linked depending on the matrix materials 118A and 118B. Figure 28A An example is described in the text.

[0463] Then, each matrix material 118A, 118B is functionalized with its corresponding component 116A, 116B. Each component 116A, 116B forms a corresponding binding pair with its corresponding attachment component 114A, 114B, which i) is attached within the recess 26 or ii) is attached to the gap region 34 at different regions of the flow cell 10. Example binding pairs (i.e., attachment component 114A or 114B and its corresponding component 116A or 116B) include azide-alkyne, trans-cyclooctyne (TCO)-tetraazine, streptavidin-biotin, aptamer-protein, aptamer-aptamer, antibody-antigen, antibody-antibody, nickel-histidine tag, amine-NHS ester, metal-ligand, protein-ligand, complementary DNA oligomer (similar to the spatial tags and target primers disclosed herein), lectin-carbohydrate, affinity tag (e.g., His tag, FLAG tag), or molecularly imprinted polymer (MIP). It should be understood that the adaptor may alternatively be a pair of parts with another part.

[0464] As mentioned, components 116A and 116B are attached to the surfaces of the corresponding substrates 118A and 118B, and attachment components 114A and 114B are respectively attached to the polymer hydrogel 32 or the interstitial region 34 at different regions 37A and 37B of the flow cell 10. In one example, the R of the polymer hydrogel 32 in one region 37A of the flow cell is... A The group serves as an attachment member 114A for the alkyne 116A attached to the encapsulation container 112A. In this example, the polymer hydrogel 32 in different regions of the flow cell 10 may have different R groups than the attachment members 114A, 114B. A In another example, interstitial region 34 contains a carboxyl group as an attachment member 114A for coupling peptide 116A.

[0465] Polymer hydrogels 32 with different attachment members 114A, 114B or different attachment members 114A, 114B to be introduced into gap regions 34 can be sequentially distributed in predetermined areas using any of the high-precision coating methods described herein. The attachment members 114A, 114B at the surface of flow cell 10 should be spatially isolated and confined to different areas 37A, 37B of lane 36, each area accommodating different types of chemicals (i.e., different corresponding members 116A, 16B).

[0466] Because DNA samples 54A and 54B are encapsulated within matrices 118A and 118B, encapsulation containers 112A and 112B can be combined and simultaneously introduced into flow cell 10. The combined encapsulation containers 112A and 112B are incubated in flow cell 10, allowing corresponding components 116A and 116B to attach to attachment components 114A and 114B. Since components 114A and 116A and 114B and 116B are binding pairs, encapsulation containers 112A and 112B will become attached to the corresponding predetermined regions 37A and 37B of flow cell 10.

[0467] The flow cell 10 can then be rinsed with an example of the washing solution.

[0468] If the tag fragmentation buffer is not encapsulated in encapsulation containers 112A and 112B, the method further includes introducing the tag fragmentation buffer into flow cell 10 before releasing DNA samples 54A and 54B. If DNA samples 54A and 54B are not bound to their respective predetermined regions, introducing the tag fragmentation buffer after the release of these DNA samples can move DNA samples 54A and 54B from their respective predetermined regions.

[0469] Then, DNA samples 54A and 54B are locally released from encapsulation containers 112A and 112B into predetermined regions 37A and 37B, respectively. Release can be achieved by dissolving encapsulation matrices 118A and 118B. When matrices 118A and 118B are identical, a stripping agent can be introduced, and then the matrices can be allowed to stand without flow and with minimal diffusion. When matrices 118A and 118B are different, multiple stripping agents can be introduced sequentially, and each stripping agent can be allowed to stand without flow and with minimal diffusion. In these examples, the release is chemically induced because the stripping agent is a degrader of matrices 118A and 118B. In other examples, the release can be induced by an external source, i.e., by heat or light. Heat or light can be used when matrices 118A and 118B degrade, dissolve, etc., upon exposure to such conditions.

[0470] In some cases, the release of DNA samples 54A and 54B also releases the tag fragmentation buffer.

[0471] Once DNA samples 54A and 54B are released and the tag fragmentation buffer is released or introduced, and because transposon complexes 38A, 38B or 38C, 38D are present in flow cell 10, the method further includes bringing flow cell 10 to the tag fragmentation temperature. In the presence of the tag fragmentation buffer and at the tag fragmentation temperature, DNA samples 54A, 54B, etc., are fragmented, and the 5' ends of the two strands of the double-stranded fragment are attached in the corresponding predetermined regions 37A, 37B to the corresponding 3' ends of the transfer strands 42A, 42B or 42C, 42D of transposon complexes 38A, 38B or 38C, 38D.

[0472] If the released DNA samples 54A and 54B can bind to the corresponding predetermined regions 37A and 37B (e.g., via complementary oligonucleotides, etc.), the method may further include introducing a tag fragmentation buffer into the flow cell 10 after the DNA samples 54A and 54B are released and bound; and bringing the flow cell 10 to the tag fragmentation temperature.

[0473] After tag fragmentation, this example method includes generating a fully adapted DNA sample fragment for each of the merged samples; amplifying these fully adapted DNA sample fragments; and performing sequencing operations.

[0474] Generating a fully fitted fragment may include removing transposase 46 from transposon complexes 38A, 38B, or 38C, 38D, and initiating the extension reaction described herein. The sequence produced by the extension reaction makes partially fitted fragments (i.e., unligated, extended, etc., tagged fragments) fully fitted and ready for amplification and cluster generation. These processes can be performed as described herein.

[0475] Sequencing can then be performed. In one example, sequencing is performed by introducing sequencing primers, followed by the introduction of an incorporation mixture containing labeled nucleotides. Each instance of nucleotide incorporation can be detected using optical imaging.

[0476] Figure 28A and Figure 28B The example shown advantageously allows multiple DNA samples 54A, 54B to be simultaneously loaded into flow cell 10. Once loaded into flow cell 10, the different DNA samples 54A, 54B are spatially isolated according to regions 37A, 37B, in which specific binding occurs between encapsulation containers 112A, 112B and attachment members 114A, 114B. Following local release and tag fragmentation, amplification and clustering of surface-bound libraries can be performed simultaneously. Furthermore, long reads of nucleic acids can be achieved via spatially controlled tag fragmentation of DNA samples 54A, 54B on flow cell 10.

[0477] Parallel processing for indexing

[0478] Another example disclosed herein uses two different processes performed in parallel on the same merged DNA sample. Data from these processes enables haplotype matching with a specific DNA sample in the pool. In this example method, transposon complexes 38A, 38B or 38C, 38D do not contain index sequences.

[0479] The method includes generating a first haplotype block by: merging at least two different DNA samples together; generating fully fitted DNA fragments from the merged DNA samples using a flow cell and tag fragmentation scheme without indexing; sequencing the fully fitted DNA fragments to generate sequencing data; and performing haplotype phasing based on the sequencing data; generating individual sample haplotype blocks by: generating individual libraries for each of the at least two different DNA samples; exposing these individual libraries to i) a single nucleotide polymorphism (SNP) array or ii) whole-genome sequencing, respectively; and performing haplotype phasing based on the i) SNP array data or ii) sequencing data of each of these individual libraries; and based on these individual sample haplotype blocks, associating single nucleotide polymorphisms observed in the haplotype phasing data with one of the at least two different DNA samples.

[0480] Throughout the discussion of this method, reference will be made to Figure 30 The first haplotype block is in Figure 30 The samples are labeled A through H, and individual samples from the haplotype module are... Figure 30 The samples are marked as Sample 1 to Sample 4.

[0481] In this example method, several different DNA samples are used, such as 54A, 54B, etc. The DNA samples should come from unrelated individuals or from populations without significant inbreeding. In this method, two DNA samples of each DNA sample type are used. Therefore, if ten different DNA samples are to be analyzed, a total of twenty DNA samples will be used—two DNA samples of each of the ten different DNA samples. For each DNA sample type, one DNA sample is pooled with all other DNA sample types in a mixed DNA sample, and then exposed to tag fragmentation and sequencing; and the other DNA sample is individually exposed to either i) a single nucleotide polymorphism (SNP) array or ii) whole-genome sequencing. Individual exposure means that the DNA samples are not pooled together, but are individually exposed to the SNP array or whole-genome sequencing.

[0482] Once the different DNA samples have been collected, one DNA sample from each of the various DNA samples is mixed together. This forms a mixed DNA sample. The mixed DNA sample is then exposed to solution-based tag fragmentation or tag fragmentation built into a flow cell.

[0483] Solution-based tagging is performed by mixing a mixed DNA sample with a transposon complex solution containing non-indexed transposon complexes 38A, 38B, or 38C, 38D. The transposon complex solution can be any of the examples described herein. Tag fragmentation buffer is added to the mixture, and the solution is heated to the tagging temperature (e.g., from about 37°C to about 55°C). In this example, the tagging time can range from about 2 minutes to about 15 minutes. Within the mixed DNA sample, copies of the DNA sample are tagged and fragmented as described herein.

[0484] After tag fragmentation, transposase 46 is not removed, and thus the DNA sample fragments remain linked together by transposon complexes 38A, 38B or 38C, 38D, which are still in place along the double-stranded DNA sample strand. This process forms a binding complex, similar to the reference... Figure 9 and Figure 10 The described binding complexes 58A and 58B.

[0485] The binding complex is introduced into flow cell 10, which includes lanes 36 or recesses 26 containing polymer hydrogel 32 and primers 16, 18. This allows the binding complex to incubate within flow cell 10, enabling it to attach to polymer hydrogel 32 and / or interstitial regions 34 via 5' and / or 3' terminal functional groups.

[0486] Once the binding complex is attached within flow cell 10, transposase 46 is subsequently removed from transposon complexes 38A, 38B, or 38C, 38D of the binding complex, as well as from any other surface-bound transposon complexes. Now, tagged fragments of each different DNA sample from the different DNA samples are attached to the flow cell surface via transfer strand 42B or 42D. Fully adapted DNA sample fragments are generated and amplified for each DNA sample fragment via the extension reaction described herein, and these amplified fragments are sequenced as described herein.

[0487] In another example, tag fragmentation occurs within flow cell 10. In this example, unindexed transposon complexes 38A, 38B or 38C, 38D are pre-attached to lane 36 or recess 26, or introduced and attached to flow cell 10 before the introduction of the mixed DNA sample. Once the unindexed transposon complexes 38A, 38B or 38C, 38D are immobilized in flow cell 10, the mixed DNA sample is introduced along with tag fragmentation buffer, and tag fragmentation is performed as described herein. A fully adapted DNA sample fragment is generated and amplified for each DNA sample fragment via the extension reaction described herein, and these amplified fragments are sequenced as described herein.

[0488] The sequencing data from the mixed DNA samples are then exposed to haplotype phasing. This generates haplotype blocks, for example... Figure 30 A through H are shown in the diagram. It should be understood that any haplotype phasing method can be used. In this example, haplotype phasing involves alignment-based haplotype phasing or assembly-based haplotype phasing. With alignment-based haplotype phasing, reads are sequenced and mapped to a reference genome for variant detection. The linked variants are then extended into phasing blocks, each containing multiple adjacent SNPs belonging to the same haplotype. With assembly-based haplotype phasing, reads are sequenced and allele-aware de novo assembly is performed, for example, using Falcon-unzip or Canu triplet binning methods. When multiple haplotypes are present, the main contiguous group can be chosen as an arbitrary haplotype representation, for example, using purgehaplotig, for downstream analysis. Alternatively, the complete set of haplotypes can be resolved using Hi-C techniques, such as ALLHiC.

[0489] Each DNA sample within a DNA sample species is individually exposed to either an SNP array or whole-genome sequencing assay. When using an SNP array, each DNA sample within the DNA sample is tested with the SNP array, making the resulting data unique for each individual sample tested. When using whole-genome sequencing, each DNA sample within the DNA sample is exposed to the corresponding whole-genome sequencing assay, making the resulting data unique for each individual sample tested. While two examples are provided, it is believed that any sequencing technology can be used for individual DNA samples.

[0490] Prior to SNP array or whole-genome sequencing, DNA samples are exposed to a library preparation technique that introduces adaptors complementary to primers 16 and 18 used in SNP array probes or whole-genome sequencing. Additionally, for SNP arrays, the DNA library fragments are labeled with fluorescent tags. For whole-genome sequencing, commercially available library preparation kits, such as TRUSEQ, can be used. ® DNA PCR-Free Preparation Kit or ILLUMINA ® DNA PCR-Free Preparation Kits: Both kits are available from Inmena.

[0491] When SNP arrays are used for individual DNA sample analysis, the SNP array slides are spotted with allele-specific DNA probes targeting regions where SNP variations exist between individuals. A different slide is used for each type of DNA sample. Each DNA sample is hybridized to the corresponding array slide, where the library fragment binds to a complementary probe. The array slides are scanned, and fluorescence emission at each probe location is measured.

[0492] When SNP arrays are used for individual DNA sample analysis, the SNP array slides are spotted with allele-specific DNA probes targeting regions where SNP variations exist between individuals. A different slide is used for each type of DNA sample. Each DNA sample is hybridized to the corresponding array slide, where the library fragment binds to a complementary probe. The array slides are scanned, and fluorescence emission at each probe location is measured.

[0493] When whole-genome sequencing is used for the analysis of individual DNA samples, a commercially available sequencing system, such as NOVASEQ from Imena, is used. ™ The 6000 system or NOVASEQ X series is used to amplify and sequence library fragments.

[0494] Data from SNP arrays or sequencing data from whole-genome sequencing are exposed to haplotype phasing. Haplotype phasing can be performed using alignment-based haplotype phasing or assembly-based haplotype phasing. Figure 30 The alignment-based phasing results for each individual DNA sample (e.g., sample 1 to sample 4) are illustrated schematically.

[0495] Then, based on individual sample haplotype blocks (e.g., samples 1 to 4), the single nucleotide polymorphisms observed in the haplotype phasing data (i.e., in phasing blocks A to H of mixed DNA samples) are associated with one of the at least two different DNA samples.

[0496] In any of the examples described herein, it should be understood that transposon concentration, DNA sample input, and reaction volume can vary depending on the application.

[0497] Examples are provided herein to further illustrate this disclosure. It should be understood that these examples are provided for illustrative purposes and should not be construed as limiting the scope of this disclosure.

[0498] Non-limiting working examples

[0499] Example 1

[0500] Use indexed P5 transposons and indexed P7 transposons (similar to reference). Figure 5A and Figure 9 The following preparations were made using dual-indexed transposons. Two sets of indexed P5 and P7 transposons were assembled. In a 50 μL tag fragmentation reaction, one set of indexed transposons (each with a total concentration of 0.05 μM) was added to either 500 ng of NA12878 human gDNA sample or 500 ng of λgDNA sample. P7:P5 TsM at a 50:50 ratio and P7:P5 TsM at an 80:20 ratio were tested on different samples. Each sample was then heated to 41 °C for 5 minutes and then cooled to room temperature. For the corresponding control samples, NA12878 and λgDNA samples were used separately. For the four example samples, NA12878 and λgDNA samples were mixed together. For two of the mixed example samples, 100 mM of additional NaCl was added before mixing. NaCl or EDTA should reduce the activity of the transposons and thus reduce the likelihood of additional transposon activity in mixed samples from incorrectly indexed transposons. In the mixed sample, the DNA sample has been tagged and fragmented, but the transposase (Tn5) has not been removed, so the DNA sample remains together in the original gDNA fragment.

[0501] Flow all control and example samples into HISEQ ™ In individual lanes on a 4K (Inmena) flow cell, each lane was pre-prepared with a biotin / streptavidin surface at room temperature and incubated for 30 minutes. After the gDNA / biotinylated transposon complex bound to the streptavidin surface, any unbound material was washed away with a washing solution, followed by washing with 1% SDS and incubation for 2 minutes to remove Tn5. The SDS solution was washed away, and then ExAmp was used. ™ The reagents (Inmena) amplified the fragment onto the surface primers for 1 hour. The remainder of the clustering and sequencing workflow is for HISEQ. ™ The standard for 4K instruments.

[0502] The pass-through rate (PF) is a metric used to describe clusters that have passed a purity threshold. In this embodiment, the %PF for all 50:50 ratio lanes is between 33% and 36%, but lower for 80:20 ratio lanes, ranging from 8% to 21%.

[0503] The percentages of correct and incorrect mapped readings for control samples (NA12878 L1 and λL3), one of the mixed samples (L5), and one of the mixed samples with NaCl (L7) are shown in [the table / image]. Figure 29 In Chinese, the percentage of mapped reads (or alignments) or mapping quality score refers to a measure or other measurement of the quality or certainty of a nucleotide read (or other nucleotide sequence or subsequence) aligned to a reference genome. For example, the mapping quality score includes the mapping quality (MAPQ) score for nucleobase detection at genomic coordinates, where the MAPQ score represents -10 log10 Pr{mapping location error}, rounded to the nearest integer. As an alternative to mean or median mapping quality, the mapping quality score includes the overall distribution of mapping quality for all nucleotide reads aligned to a reference genome at genomic coordinates. A higher percentage of mapped reads (or alignments) indicates sequencing accuracy. A mixed sample performs as well as a control sample.

[0504] Example 2

[0505] NovaSeq ™ A standard flow cell of 6000 was overgrafted with bicyclic nonyne (BCN)-10T-biotin / streptoavidin at 60°C for 2 hours.

[0506] A solution-tagged fragmentation reaction was established using 25 μl of 0.1 μM of each type of indexed transposon complex (i.e., biotinylated P5-indexed transposon complex and biotinylated P7-indexed transposon complex), 250 ng of NA12878 DNA, and tag fragmentation buffer. The solution-tagged fragmentation reaction was incubated at 41 °C for 5 min and then cooled on ice. The samples were pooled in working buffer and loaded onto a flow cell containing BCN-biotin / streptavidin, and incubated at room temperature for 30 min to allow the tagged fragmented DNA to bind to the flow cell surface.

[0507] The flow cell is then assembled in the flow cell box (plastic frame and gaskets) and then loaded into the NovaSeq. ™6000. Sequencing was performed using the following protocol: a washing step to remove unbound material, followed by an SDS step to remove Tn5 transposase, then rinsing to remove the amplification mixture to allow for the formation of fully fitted capture strands and amplification of those strands, followed by standard 2×151+ dual-index sequencing.

[0508] Figure 34 The demultiplexing results for a 6-lane pool are shown. The graph shows the percentage of reads identified per index. These results demonstrate that, even with pooled samples, unwanted markers between samples are few or nonexistent.

[0509] Although not reproduced in this paper, the sequencing performance (e.g., %PF and %base detection) was also good.

[0510] Then Figure 34 The results are used to a) change the volume of the transposon complex contained in the solution-labeled fragmentation reaction, or b) use with [a specific method / approach] to [a specific reaction]. Figure 34 The same solution tag fragmentation conditions are used to change the merged volume after tag fragmentation. The resulting demultiplexing results are... Figure 35 As shown in a), and in Figure 36 The results show that both methods are ways to reduce index representation bias, with the change made by merging volumes being more successful in this particular embodiment.

[0511] Example 3

[0512] Solution-based tagging and fragmentation were performed as described in Example 2, using either NA12878 standard extraction or HMW DNA extraction from human blood samples. After tagging and fragmentation at 41°C for 5 minutes, the 8-cell pool was diluted in working buffer. The eight samples from the respective extractions were pooled together to generate four pooled (mixed) samples from each extraction.

[0513] Load the pool into the library for use in NovaSeqX ™ Run on NovaSeqX. ™ The above protocol begins with 2 hours of overgrafting of BCN-10T-biotin / streptavidin at 60°C, followed by loading of the pooled samples from the library tubes. The corresponding pooled samples prepared from tagged fragmented DNA extracted using the NA12878 standard were introduced into lanes 1, 3, 5, and 7 of the flow cell. The corresponding pooled samples prepared from tagged fragmented DNA extracted using HMW DNA extraction were introduced into lanes 2, 4, 6, and 8 of the flow cell.

[0514] Figure 37Linkage metrics for all 64 samples (8 pairs per lane × 8 lanes) from the acquired sequencing data are shown. The depicted linkage metrics include Q25 linking rate, phasing block N50, and linking coverage.

[0515] Q25 is equivalent to the probability of an incorrect link of two reads occurring once out of 316 reads. The Q25 link rate measures the percentage of reads linked together by a link quality score of Q25 or higher. Figure 37 As shown, this varies depending on the type of sample extraction, but it is typical for this type of sequencing.

[0516] N50 defines the assembly quality with respect to adjacency. Given a set of contigs, N50 is defined as the sequence length of the shortest contig or phase block at 50% of the total assembly length. NG50 is the same as N50, except that it is 50% of the known or estimated genome size, which must be NG50 length or longer. Phase block NG50 results are typical for this type of sequencing.

[0517] Linkage coverage refers to the average number of reads aligned to or covering a known reference region. These results show a linkage coverage of 7-20x per sample per lane, which is typical for this type of sequencing.

[0518] The run had repetitions of 4% to 5% per sample, insert lengths of approximately 200 bp, and normalized coverage of approximately 1 at 80% to 100% GC and 0.8 to 0.9 at 20% to 40% GC. These attachment results show that the primary sequencing metrics are as expected for this type of sequencing.

[0519] Additional notes

[0520] It should be understood that all combinations of the foregoing concepts and the additional concepts discussed in more detail below (assuming such concepts do not contradict each other) are contemplated as part of the inventive subject matter disclosed herein. Specifically, all combinations of the claimed subject matter appearing at the end of this disclosure are contemplated as part of the inventive subject matter disclosed herein. It should also be understood that terms expressly adopted herein that may also appear in any disclosure incorporated by reference should be given the meaning most consistent with the specific concepts disclosed herein.

[0521] Throughout this specification, references to “an example,” “another example,” “a kind of example,” etc., mean that a particular element (e.g., a feature, structure, and / or characteristic) described in connection with that example is included in at least one example described herein and may or may not be present in other examples. Furthermore, it should be understood that the elements used in any example may be combined in any suitable manner in various examples, unless the context clearly indicates otherwise.

[0522] Although several examples have been described in detail, it should be understood that modifications can be made to the disclosed examples. Therefore, the above description should be considered non-limiting.

Claims

1. A reagent kit, the reagent kit comprising: The first plurality of recognition primers, each of the first plurality of recognition primers comprising: First recognition primer sequence; and A first intercalating agent, wherein the first intercalating agent is attached to the first recognition primer sequence; The second plurality of recognition primers, each of the second plurality of recognition primers comprising: The second identification primer sequence is orthogonal to the first identification primer sequence; and A second intercalating agent is attached to the second recognition primer sequence; and Flow cell, the flow cell comprising: A substrate having recesses separated by gap regions; A polymer hydrogel, wherein the polymer hydrogel is positioned within each of the recesses; An amplification primer set is attached to the polymer hydrogel within each of the recesses, the amplification primer set being orthogonal to the first recognition primer sequence and the second recognition primer sequence; A plurality of complementary recognition primers are attached to a first predetermined region located in a first region of the substrate, wherein each of the plurality of complementary recognition primers has a sequence complementary to the sequence of the first recognition primer; and The second plurality of complementary recognition primers are attached to a second predetermined region located in a second region of the substrate, wherein each of the second plurality of complementary recognition primers has a sequence complementary to the sequence of the second recognition primer.

2. The kit according to claim 1, wherein: The first predetermined region includes i) a recess located within the first region or ii) the gap region located within the first region; and The second predetermined region includes i) a recess located within the second region or ii) the gap region located within the second region.

3. The kit according to claim 1 or claim 2, wherein the flow cell further comprises a transposable complex attached to each of the recesses, attached above the gap region, or attached to both the recesses and the gap region.

4. The kit according to claim 1 or claim 2, wherein the kit further comprises: A transposable complex fluid, the transposable complex fluid comprising a transposable complex; and Tag fragmentation buffer.

5. The kit according to any one of claims 1 to 4, wherein the intercalating agent is selected from the group consisting of: CI-921, eletamide, mitoxantrone, aminonaphthylfenoxate, bismuth subcitrate, and cristatol.

6. A method for using the kit according to claim 1, the method comprising: The first DNA sample is mixed with the first plurality of recognition primers, thereby conjugating the first DNA sample with the first plurality of recognition primers; The second DNA sample is mixed with the second plurality of recognition primers, thereby conjugating the second DNA sample with the second plurality of recognition primers; Combine the conjugated DNA samples; as well as The combined sample is introduced into the flow cell.

7. The method of claim 6, wherein the flow cell comprises a transposable composite attached to each of the recesses, attached above the gap region, or attached to both the recesses and the gap region, and the method further comprises: The merged samples are allowed to be incubated in the flow cell at the hybridization temperature; The tag fragmentation buffer is introduced into the flow cell; as well as The flow cell is brought to the label fragmentation temperature.

8. The method according to claim 6, wherein the method further comprises: The merged samples are allowed to be incubated in the flow cell at the hybridization temperature; A fluid containing the transposable complex is introduced into the flow cell; The tag fragmentation buffer is introduced into the flow cell; as well as The flow cell is brought to the label fragmentation temperature.

9. The method according to claim 7 or claim 8, wherein after tag fragmentation, the method further comprises: Generate a fully adapted DNA sample fragment for each of the merged samples; Amplify the fully adapted DNA sample fragment; as well as Perform sequencing operations.

10. A method for fabricating a flow cell, the method comprising: A polymer hydrogel is applied to a recess defined in a substrate and separated by gap regions, wherein the gap regions do not contain the polymer hydrogel. The amplification primer set was attached to the polymer hydrogel; A first plurality of complementary recognition primers are selectively attached to a first predetermined region located in a first region of the substrate, wherein each of the first plurality of complementary recognition primers has a first primer complementary sequence; and A second plurality of complementary recognition primers are selectively attached to a second predetermined region located in a second region of the substrate, wherein each of the second plurality of complementary recognition primers has a second recognition primer complementary sequence; The amplification primer set, the first plurality of complementary recognition primers, and the second plurality of complementary recognition primers have orthogonal sequences.

11. The method of claim 10, the method further comprising attaching the transposable complex to the polymer hydrogel.

12. A flow cell, the flow cell comprising: A substrate having recesses separated by gap regions; A polymer hydrogel, wherein the polymer hydrogel is positioned within each of the recesses; An amplification primer set, the amplification primer set being attached to the polymer hydrogel within each of the recesses; and A light-triggered DNA intercalator, wherein the light-triggered DNA intercalator is attached in its non-intercalated form to the polymer hydrogel within each of the recesses.

13. The flow cell of claim 12, wherein the phototriggered intercalator is selected from the group consisting of: azobenzene-based intercalators, anthracene-based intercalators, metal-polypyridyl complexes, and spiropyran-based intercalators.

14. The flow cell of claim 12 or 13, wherein the light-triggered DNA intercalator is attached to the polymer hydrogel via a cleavable connector.

15. The flow cell according to any one of claims 12 to 14, the flow cell further comprising a transposable composite attached to each of the recesses, attached above the gap region, or attached to both the recesses and the gap region.

16. A method, the method comprising: At least two different DNA samples are sequentially attached to corresponding predetermined regions of a substrate in a flow cell, wherein each of the at least two different DNA samples is attached in the following manner: One of the at least two different DNA samples is introduced into the flow cell; as well as When a corresponding DNA sample from the at least two different DNA samples is present in the flow cell, a corresponding predetermined region in the corresponding predetermined region is exposed to light of a corresponding predetermined wavelength, thereby activating a light-triggered DNA intercalator located in a recess within the corresponding predetermined region, and binding the corresponding DNA sample from the at least two different DNA samples in the corresponding predetermined region. as well as Initiate tag fragmentation of the at least two different DNA samples to generate partially adapted fragments of the at least two different DNA samples.

17. The method of claim 16, wherein the transposable complex is attached within each of the recesses, above the gap region, or within each of the recesses and above the gap region, and wherein initiating tag fragmentation involves: The tag fragmentation buffer is introduced into the flow cell; and The flow cell is brought to the label fragmentation temperature.

18. The method of claim 16, wherein: Prior to initiating tag fragmentation, the method further includes introducing a transposon complex fluid containing the transposon complex; and Startup tag fragmentation involves: The tag fragmentation buffer is introduced into the flow cell; and The flow cell is brought to the label fragmentation temperature.

19. The method of claim 17 or claim 18, wherein the light-triggered DNA intercalator is attached to the polymer hydrogel via a cleavable adapter, and wherein, after tag fragmentation, the method further comprises: The cutting agent is introduced into the flow pool to cut the cutable joint; as well as Remove the light-triggered DNA intercalator from the flow cell.

20. The method according to any one of claims 17 to 19, wherein after tag fragmentation, the method further comprises: Generate a fully adapted DNA sample fragment from the partially adapted fragment; Amplify the fully adapted DNA sample fragment; as well as Perform sequencing operations.

21. A kit comprising: Active transposon connector, the active transposon connector comprising: An active transposon terminus, wherein the active transposon terminus comprises a portion of an active transfer strand that hybridizes with a first nontransfer strand; The active transfer strand includes the portion of the active transfer strand, an index sequence, and a first amplification domain that does not have a 5' end linker molecule; and A first non-transferable chain, wherein the first non-transferable chain does not have a 3' end linker molecule; An inactive transposon connector, the inactive transposon connector comprising an inactive transposon end, the inactive transposon end comprising: An inactive transfer chain having an inactive 3' end and containing a 5' end linker molecule; and A second non-transfer strand, which hybridizes with the inactive transfer strand, wherein the second non-transfer strand does not have a 3' end linker molecule; and Transposase.

22. The kit of claim 21, further comprising a solid carrier having surface groups for attachment to the 5' end linker molecule.

23. The kit of claim 21, further comprising a flow cell, the flow cell comprising: A substrate having recesses separated by gap regions; A polymer hydrogel, wherein the polymer hydrogel is positioned within each of the recesses; An amplification primer set, the amplification primer set being attached to the polymer hydrogel within each of the recesses; and A transposon complex, the transposon complex being attached to the polymer hydrogel within each of the recesses via the 3' end of a third non-transferable chain, the transposon complex comprising: The transposon end includes a transfer strand that hybridizes with a portion of the third non-transfer strand; The transfer chain includes a 5' terminal blocking group; and The third non-transfer strand comprises the portion of the third non-transfer strand, the sequencing primer sequence, and a complement to the second amplification domain.

24. The kit of claim 21, further comprising a flow cell, the flow cell comprising: A substrate having recesses separated by gap regions; A polymer hydrogel, wherein the polymer hydrogel is positioned within each of the recesses; An amplification primer set, the amplification primer set being attached to the polymer hydrogel within each of the recesses, wherein each primer in the amplification primer set contains a 3' end blocking group; and A transposable complex, the transposable complex being attached to the polymer hydrogel within each of the recesses via the 5' end of a transfer chain, the transposable complex comprising: The transposon end includes a portion of the transfer strand that hybridizes with the third non-transfer strand; The transfer strand, comprising the portion thereof, the sequencing primer sequence, and the second amplification domain; and The third non-transfer chain includes the 3' terminal blocking group.

25. A method, the method comprising: The carrier-bound dimer solution is formed in the following manner: Combining multiple of the following in a liquid carrier: an active transposon incorporating an index sequence and having no 5' end linker; an inactive transposon incorporating a 5' end linker; and a transposase, thereby forming multiple of the following: an active transposon dimer comprising two active transposon incorporating the active transposon, a semi-active transposon dimer comprising one active transposon incorporating the active transposon and one inactive transposon incorporating the inactive transposon, and an inactive transposon dimer comprising two inactive transposon incorporating the inactive transposon; By adding a plurality of solid carriers to the liquid carrier, a carrier-bound dimer is formed in the liquid carrier, whereby at least some of the following are attached to at least some of the plurality of solid carriers in the solid carrier: the semi-active transposon dimer and the inactive transposon dimer, and whereby the plurality of active transposon dimers remain unattached; and Remove the plurality of active transposable dimers from the liquid carrier.

26. The method of claim 25, further comprising forming a tag-fragmented DNA fragment in a solution of the carrier-bound dimer by: The DNA sample is added to the dimer solution bound to the vector; The tag fragmentation buffer is introduced into a vector-bound dimer solution containing the DNA sample; and The temperature of the vector-bound dimer solution containing the tag fragmentation buffer and the DNA sample is increased to the tag fragmentation temperature.

27. The method of claim 26, further comprising: A second carrier-bound dimer solution is formed through the following steps: In a second liquid carrier, multiple of the following are combined: a second active transposon incorporating a second index sequence different from the index sequence and without the 5' end linker molecule; a second inactive transposon incorporating the 5' end linker molecule; and the transposase, thereby forming multiple of the following: a second active transposon dimer comprising two of the second active transposon incorporating the second active transposon incorporating the second active transposon incorporating the second active transposon incorporating the second active transposon incorporating the second active transposon incorporating the second active transposon incorporating the second inactive ... By adding a plurality of second solid carriers to the second liquid carrier, a second carrier-bound dimer is formed in the second liquid carrier, whereby at least some of the following are attached to at least some of the plurality of second solid carriers in the second solid carrier: a second semi-active transposon dimer and a second inactive transposon dimer, and whereby the plurality of second active transposon dimers remain unattached; and Remove the plurality of second active transposable dimers from the second liquid carrier; as well as The second tag-fragmented DNA fragment is formed in the dimer solution bound to the second vector in the following manner: The second DNA sample was added to the dimer solution bound to the second vector; The second tag fragmentation buffer is introduced into the second vector-bound dimer solution containing the second DNA sample; as well as The temperature of the dimer solution containing the second tag fragmentation buffer and the second DNA sample, which is bound to the second vector, is increased to the tag fragmentation temperature.

28. The method of claim 27, further comprising: Merge the tagged fragmented DNA fragment and the second tagged fragmented DNA fragment; as well as The merged DNA fragments are introduced into the flow cell.

29. The method of claim 28, wherein the flow cell comprises: A substrate having recesses separated by gap regions; A polymer hydrogel, wherein the polymer hydrogel is positioned within each of the recesses; An amplification primer set, the amplification primer set being attached to the polymer hydrogel within each of the recesses; and A transposon complex, the transposon complex being attached to the polymer hydrogel within each of the recesses via the 5' end of a third non-transferable chain, the transposon complex comprising: The transposon end includes a transfer strand that hybridizes with a portion of the third non-transfer strand; The transfer chain includes a 5' terminal blocking group; and The third non-transfer strand comprises the portion of the third non-transfer strand, the sequencing primer sequence, and a complement to the second amplification domain.

30. The method of claim 28, wherein the flow cell comprises: A substrate having recesses separated by gap regions; A polymer hydrogel, wherein the polymer hydrogel is positioned within each of the recesses; An amplification primer set, the amplification primer set being attached to the polymer hydrogel within each of the recesses, wherein each primer in the amplification primer set contains a 3' end blocking group; and A transposable complex, the transposable complex being attached to the polymer hydrogel within each of the recesses via the 5' end of a transfer chain, the transposable complex comprising: The transposon end includes a portion of the transfer strand that hybridizes with the third non-transfer strand; The transfer strand, comprising the portion thereof, the sequencing primer sequence, and the second amplification domain; and The third non-transfer chain includes the 3' terminal blocking group.

31. A reagent kit, the reagent kit comprising: A first fluid, the first fluid comprising: First liquid carrier; A first transposon complex, the first transposon complex comprising a first amplified domain and a first index sequence; and The second transposon complex comprises a second amplified domain and the first index sequence; At least one of the first transposon complex or the second transposon complex contains a terminal linker group; The second fluid, the second fluid comprising: Second liquid carrier; A third transposon complex, the third transposon complex comprising the first amplified domain and a second index sequence different from the first index sequence; and A fourth transposon complex, the fourth transposon complex comprising the second amplified domain and the second index sequence; At least one of the third transposon complex or the fourth transposon complex contains the terminal linker group; Tag fragmentation buffer.

32. The kit of claim 31, further comprising a flow cell, the flow cell comprising: A substrate having recesses separated by gap regions; A polymeric hydrogel, wherein the polymeric hydrogel is positioned within each of the recesses, the polymeric hydrogel comprising surface groups for attachment to the end-connecting groups; and An amplification primer set is attached to the polymer hydrogel within each of the recesses.

33. A method, the method comprising: Solution-based tagging of the first DNA sample was performed using a first transposon complex and a second transposon complex, both containing the first index sequence, to generate a first binding complex. Solution-based tagging of the second DNA sample was performed using a third transposon complex and a fourth transposon complex, both containing a second index sequence different from the first index sequence, to generate a second binding complex. Combine the first binding complex and the second binding complex; as well as The combined first and second binding complexes are introduced into a flow cell, whereby the first and second binding complexes are attached to the surface of the flow cell.

34. The method of claim 33, further comprising: Remove transposases from the first transposon complex, the second transposon complex, the third transposon complex, and the fourth transposon complex; as well as A fully adapted first DNA sample fragment and a fully adapted second DNA sample fragment are generated on the surface of the flow cell.

35. A kit comprising: A first fluid, the first fluid comprising: First liquid carrier; and A first transposon complex, the first transposon complex comprising a first amplification domain and a first index sequence; The second fluid, the second fluid comprising: Second liquid carrier; The second transposon complex includes the first amplified domain and a second index sequence different from the first index sequence; Tag fragmentation buffer; and Flow cell, the flow cell comprising: A substrate having recesses separated by gap regions; A polymer hydrogel, wherein the polymer hydrogel is positioned within each of the recesses; An amplification primer set, said amplification primer set being attached to the polymer hydrogel within each of the recesses; and A third transposon complex, the third transposon complex comprising a second amplification domain.

36. A method for using the kit according to claim 35, the method comprising: Solution-based tagging of the first DNA sample was performed using the first fluid and some of the tagging fragmentation buffer in the tagging fragmentation buffer to generate a first binding complex; Solution-based tagging of the second DNA sample was performed using the second fluid and some of the tagging fragmentation buffer in the tagging fragmentation buffer to generate a second binding complex; An inactive first binding complex and an inactive second binding complex are generated; Combine the inactive first binding complex and the inactive second binding complex; as well as The combined inactive first binding complex and the inactive second binding complex are introduced into a flow cell, whereby the inactive first binding complex and the inactive second binding complex are respectively fragmented by the third transposable complex tag.

37. The method of claim 36, further comprising generating a fully adapted first DNA sample fragment and a fully adapted second DNA sample fragment on the surface of the flow cell.

38. A reagent kit, the reagent kit comprising: A first fluid, the first fluid comprising: First liquid carrier; and A first transposon complex, the first transposon complex comprising a first amplification domain and a first index sequence; The second fluid, the second fluid comprising: Second liquid carrier; and The second transposon complex includes the first amplified domain and a second index sequence different from the first index sequence; A third fluid, the third fluid comprising: Third liquid carrier; and A third transposon complex, the third transposon complex comprising a second amplified domain; and Tag fragmentation buffer; Each of the first transposon complex and the second transposon complex contains a terminal linker group.

39. The kit of claim 38, further comprising a flow cell, the flow cell comprising: A substrate having recesses separated by gap regions; A polymeric hydrogel, wherein the polymeric hydrogel is positioned within each of the recesses, the polymeric hydrogel comprising surface groups for attachment to the end-connecting groups; and An amplification primer set is attached to the polymer hydrogel within each of the recesses.

40. A method for using the kit according to claim 38, the method comprising: A first binding complex is generated by performing solution-based tag fragmentation of the first DNA sample using the first fluid and some of the tag fragmentation buffer in the tag fragmentation buffer. A second binding complex is generated by performing solution-based tagging of the second DNA sample using the second fluid and some of the tagging fragmentation buffer; the first binding complex and the second binding complex are then combined. The combined first and second binding complexes are introduced into a flow cell, whereby the first and second binding complexes are attached to the surface of the flow cell. as well as In the flow cell, a second solution-based tagging of DNA fragments of the first binding complex and the second binding complex is performed using the third fluid and some of the tagging fragmentation buffer from the tagging fragmentation buffer.

41. The method of claim 40, further comprising: Remove transposases from the third transposon complex and the fourth transposon complex; as well as A fully adapted first DNA sample fragment and a fully adapted second DNA sample fragment are generated on the surface of the flow cell.

42. A kit comprising: Flow cell, the flow cell comprising: A substrate having recesses separated by gap regions; A polymer hydrogel, wherein the polymer hydrogel is positioned within each of the recesses; An amplification primer set, said amplification primer set being attached to the polymer hydrogel within each of the recesses; and Target primers are attached to the polymer hydrogel in each of the recesses, wherein the target primers attached to the recesses in the first region of the flow cell are orthogonal to the target primers attached to the recesses in the second region of the flow cell. A first fluid, the first fluid comprising: First liquid carrier; A first transposon complex, the first transposon complex comprising a first amplified domain and a first index sequence; and The second transposon complex includes a second amplification domain and a second index sequence; At least one of the first transposon complex or the second transposon complex includes a first spatial tag, the first spatial tag being complementary to the target primer attached to the recess located in the first region of the flow cell. The second fluid, the second fluid comprising: Second liquid carrier; A third transposon complex, the third transposon complex comprising the first amplified domain and a third index sequence different from the first index sequence and the second index sequence; and A fourth transposon complex, the fourth transposon complex comprising the second amplified domain and a fourth index sequence different from the first index sequence, the second index sequence and the third index sequence; At least one of the third transposon complex or the fourth transposon complex includes a second spatial tag, the second spatial tag being complementary to the target primer attached to the recess located in the second region of the flow cell; and Tag fragmentation buffer.

43. A method for using the kit according to claim 42, the method comprising: Solution-based tagging of the first DNA sample was performed using the first transposon complex and the second transposon complex to generate a first binding complex; Solution-based tagging of the second DNA sample is performed using the third transposon complex and the fourth transposon complex, both of which contain a second index sequence different from the first index sequence, to generate a second binding complex; Combine the first binding complex and the second binding complex; as well as The combined first and second binding complexes are introduced into the flow cell, whereby the first and second binding complexes are respectively attached to the target primers in the first and second regions.

44. The method of claim 43, further comprising: Remove transposases from the first transposon complex, the second transposon complex, the third transposon complex, and the fourth transposon complex; as well as A fully adapted first DNA sample fragment and a fully adapted second DNA sample fragment are generated on the surface of the flow cell.

45. A method comprising: Solution-based tagging of the first DNA sample was performed using a first transposon complex and a second transposon complex, both containing the first index sequence, to generate a first binding complex. The first binding complex is introduced into the flow cell; When the first binding complex is in the flow cell, a predetermined region is exposed to light of a certain wavelength, thereby activating a light-triggered attachment mechanism located in a recess in the predetermined region and binding the first binding complex to the predetermined region. Solution-based tagging of the second DNA sample was performed using a third transposon complex and a fourth transposon complex, both containing a second index sequence different from the first index sequence, to generate a second binding complex. The second binding complex is introduced into the flow cell; When the second binding compound is in the flow cell, the second predetermined region is exposed to light of a certain wavelength, thereby activating the light-triggered attachment mechanism located in the recess in the second predetermined region and binding the second binding compound to the second predetermined region. Remove transposases from the first transposon complex, the second transposon complex, the third transposon complex, and the fourth transposon complex; as well as A fully adapted first DNA sample fragment and a fully adapted second DNA sample fragment are generated on the surface of the flow cell.

46. ​​The method of claim 45, wherein the light-triggered attachment mechanism is a light-triggered DNA intercalator.

47. A spatial indexing device, the spatial indexing device comprising: Flow cell, the flow cell comprising: A substrate having recesses separated by gap regions; A polymer hydrogel, wherein the polymer hydrogel is positioned within each of the recesses; An amplification primer set, said amplification primer set being attached to the polymer hydrogel within each of the recesses; and A first transposable complex and a second transposable complex, the first transposable complex and the second transposable complex being attached to the polymer hydrogel within each of the recesses; and A fault-proofing mechanism comprising at least two spatially separated zones, each of the spatially separated zones having a plurality of uniquely shaped through-holes defined within the spatially separated zone, wherein when the fault-proofing mechanism is in an operable position, each of the plurality of uniquely shaped through-holes exposes a corresponding subset of the recess of the flow cell.

48. The spatial indexing device of claim 47, wherein the error-proofing mechanism is permanently attached to the substrate.

49. The spatial indexing device according to claim 47, wherein the error prevention mechanism is separate from the flow pool.

50. The spatial indexing device of claim 47, wherein the error-proofing mechanism is temporarily attached to the substrate and is defined by a soluble material having a solubility property orthogonal to the solubility property of the substrate.

51. A reagent kit, the reagent kit comprising: The spatial indexing device according to claim 47; and Photocurable polymers.

52. A method for using the spatial indexing apparatus according to claim 47, the method comprising: When the error-proofing mechanism is in the operable position, at least two encapsulation compounds are simultaneously introduced into the flow cell, wherein: The first encapsulation complex of the at least two encapsulation complexes comprises a first DNA sample embedded in a first polymer and has a first shape corresponding to the vias of the plurality of uniquely shaped regions defined in the first spatially separated region of the at least two spatially separated regions; and The second encapsulation complex of the at least two encapsulation complexes comprises a second DNA sample embedded in a second polymer and has a second shape corresponding to the vias of the plurality of unique shapes defined in the second spatially separated region of the at least two spatially separated regions, and thereby: At least some of the first encapsulation compounds in the at least two encapsulation compounds occupy at least some of the uniquely shaped vias in the plurality of uniquely shaped vias in the at least two spatially separated regions; and At least some of the encapsulation compounds of the second encapsulation compound in the at least two encapsulation compounds occupy at least some of the uniquely shaped vias in the region defined in the second space of the at least two spatially separated regions. The removal of the at least two encapsulation compounds that do not occupy the vias of the plurality of unique shapes; and Release the first DNA sample and the second DNA sample from the at least two encapsulation complexes.

53. A kit comprising: Flow cell, the flow cell comprising: A substrate having recesses separated by gap regions; Polymer hydrogel, wherein the polymer hydrogel is positioned within each of the recesses; and An amplification primer set, said amplification primer set being attached to the polymer hydrogel within each of the recesses; and A pendant drop array plate, temporarily attached to the flow cell, the pendant drop array plate including individual openings to align with a corresponding subset of the recesses of the flow cell when the pendant drop array plate is in an operable position.

54. The kit of claim 53, wherein the flow cell further comprises a first transposable complex and a second transposable complex, the first transposable complex and the second transposable complex being attached to the polymer hydrogel within each of the recesses.

55. The kit according to claim 53 or claim 54, wherein the kit further comprises a tag fragmentation buffer.

56. A method for using the kit according to claim 54, the method comprising: At least two different DNA samples are added to at least two individual openings in the individual openings of the hanging drop array plate, respectively; The pendant drop array plate is placed in contact with the flow cell, such that the pendant drop array plate is in the operable position, thereby transferring the at least two different DNA samples to at least two different subsets of the recess of the flow cell; as well as Remove the pendant array plate from the flow cell.

57. The method of claim 56, further comprising introducing a washing solution into at least two of the individual openings before removing the pendant array plate from the flow cell.

58. The method of claim 56, wherein the at least two different DNA samples are introduced with a tag fragmentation buffer, and the method further comprises raising the temperature of the flow cell to the tag fragmentation temperature before removing the hanging drop array plate from the flow cell.

59. The method according to any one of claims 56 to 58, the method further comprising attaching an optically transparent cap to the substrate after removing the droplet array plate.

60. A method comprising: The device for removing the protective film includes: A connector fixture having a concave flow pool region defined within the connector fixture; A flow cell precursor, positioned within the concave flow cell region, the flow cell precursor comprising: A substrate having a recess defined therein and separated by a gap region; A polymer hydrogel, wherein the polymer hydrogel is located within the recess; Amplification primer set, said amplification primer set being attached to said polymer hydrogel; and The first transposon complex and the second transposon complex respectively include a first amplification domain and a second amplification domain attached to the polymer hydrogel. The pre-cut intermediate layer is placed into the flow cell precursor; At least two different DNA samples are selectively introduced into at least two different regions of the flow cell precursor defined by the pre-cut intermediate layer; and An optically transparent cover glass or a second flow cell precursor is bonded to the pre-cut interlayer.

61. The method of claim 60, wherein: The pre-cut intermediate layer is placed into the flow cell precursor to form at least two lanes of the flow cell precursor; The at least two distinct regions of the flow pool forebody are located within the first lane of the at least two lanes; and The method further includes selectively introducing at least two additional, different DNA samples into at least two different regions of the second lane of the at least two lanes.

62. The method according to claim 60, wherein: The flow cell precursor further includes a protective coating over the amplification primer set and the first transposon complex and the second transposon complex; and The method further includes removing the protective coating before selectively introducing the at least two different DNA samples.

63. The method according to any one of claims 60 to 62, the method further comprising: Remove the transposase from each of the first transposon complex and the second transposon complex; as well as A fully adapted first DNA sample fragment and a fully adapted second DNA sample fragment are generated in the at least two different regions.

64. A method, the method comprising: Solution-based tag fragmentation is performed to generate at least two different binding complexes, the at least two different binding complexes comprising two different DNA samples and 5' end linker groups; A pre-cut intermediate layer is placed onto the flow cell precursor of the device, the device comprising: A connector fixture having a concave flow pool region defined within the connector fixture; The flow cell precursor is positioned in the concave flow cell region, and the flow cell precursor includes: A substrate having a recess defined therein and separated by a gap region; Polymer hydrogel, the polymer hydrogel being located within the recess; and An amplification primer set is attached to the polymer hydrogel; The at least two different binding complexes are selectively introduced into at least two different regions, whereby the at least two different binding complexes are respectively attached to at least two different regions defined by the pre-cut intermediate layer via the 5' end linking group; and An optically transparent cover glass or a second flow cell precursor is bonded to the pre-cut interlayer.

65. The method according to claim 64, wherein: The pre-cut intermediate layer is placed on the flow tank precursor to form at least two lanes of the flow tank precursor; The at least two distinct regions of the flow pool forebody are located within the first lane of the at least two lanes; and The method further includes selectively introducing the at least two additional different binding complexes into at least two different regions of the second lane of the at least two lanes.

66. The method of claim 64, wherein: The flow cell precursor further includes a protective coating over the amplification primer set; and The method further includes removing the protective coating before selectively introducing the at least two different binding complexes.

67. A method, the method comprising: The apparatus includes a device for removing a protective film to expose the lanes of a flow tank precursor. A connector fixture having a concave flow pool region defined within the connector fixture; The flow cell precursor is positioned in the concave flow cell region, and the flow cell precursor includes: A substrate having a recess defined therein and separated by a gap region; A pre-cut interposer layer is attached to the substrate and defines a plurality of lanes in the lanes on the substrate. A polymer hydrogel, wherein the polymer hydrogel is located within the recess; Amplification primer set, said amplification primer set being attached to said polymer hydrogel; and The first transposon complex and the second transposon complex respectively include a first amplification domain and a second amplification domain attached to the polymer hydrogel. At least two different DNA samples are selectively introduced into at least two different regions of the exposed swimming lane; and An optically transparent cover glass or a second flow cell precursor is bonded to the pre-cut interlayer.

68. A method comprising: Solution-based tag fragmentation is performed to generate at least two different binding complexes, the at least two different binding complexes comprising two different DNA samples and 5' end linker groups; The apparatus includes a device for removing a protective film to expose the lanes of a flow tank precursor. A connector fixture having a concave flow pool region defined within the connector fixture; The flow cell precursor is positioned in the concave flow cell region, and the flow cell precursor includes: A substrate having a recess defined therein and separated by a gap region; A pre-cut interposer layer is attached to the substrate and defines a plurality of lanes in the lanes on the substrate. Polymer hydrogel, the polymer hydrogel being located within the recess; and An amplification primer set is attached to the polymer hydrogel; The at least two different binding complexes are selectively introduced into at least two different regions of the exposed swimming lane, whereby the at least two different binding complexes are respectively attached to the at least two different regions via the 5' terminal linker group; and An optically transparent cover glass or a second flow cell precursor is bonded to the pre-cut interlayer.

69. A method comprising: The first and second packaging containers are simultaneously introduced into a flow cell, the flow cell comprising: A substrate having recesses separated by gap regions; A polymer hydrogel, wherein the polymer hydrogel is positioned within each of the recesses; An amplification primer set, the amplification primer set being attached to the polymer hydrogel within each of the recesses; Transposable complex, the transposable complex being attached to the polymer hydrogel within each of the recesses; and An attachment member is attached to a polymer hydrogel or the gap region within each of the recesses, wherein the attachment member located in a first region of the flow cell is orthogonal to the attachment member located in a second region of the flow cell. Thus, the first packaging container is selectively attached to the attachment member in the first region, and the second packaging container is selectively attached to the attachment member in the second region; and Simultaneously or sequentially, a first DNA sample is released from the first encapsulation container and a second DNA sample is released from the second encapsulation container.

70. The method of claim 69, wherein, prior to its introduction, the method further comprises forming the first encapsulation container by: The first DNA sample was encapsulated in an encapsulation matrix; and In the first region, the encapsulation matrix is ​​functionalized using corresponding components for the attachment components.

71. The method of claim 70, further comprising forming the second packaging container by: The second DNA sample is encapsulated in the encapsulation matrix; and In the second region, the encapsulation matrix is ​​functionalized using corresponding components for the attachment components; The formation of the first and second encapsulation containers occurs in separate reaction containers.

72. The method of claim 70, further comprising forming the second packaging container by: The second DNA sample is encapsulated in a second encapsulation matrix that is different from the encapsulation matrix described above; as well as In the second region, the second encapsulation substrate is functionalized with corresponding components for the attachment components; The formation of the first and second encapsulation containers occurs in separate reaction containers.

73. The method of claim 71 or claim 72, wherein the encapsulation matrix and the second encapsulation matrix are independently selected from the group consisting of micelles, lipid nanoparticles, polymer nanoparticles, dendritic aggregates, liposomes, carbon nanotubes, protein nanocages, metal nanocages, efflux bodies, and extracellular vesicles.

74. The method according to any one of claims 69 to 73, the method further comprising: The tag fragmentation buffer is introduced into the flow cell; as well as The flow cell is brought to the label fragmentation temperature.

75. A method, the method comprising: The first haplotype block is generated in the following manner: Combine at least two different DNA samples; Fully adapted DNA fragments were generated from the merged DNA sample using a flow cell and tag fragmentation scheme without indexing. The fully adapted DNA fragment is sequenced to generate sequencing data; and Haplotype phasing is performed based on the sequencing data; Individual sample haplotype blocks were generated using the following method: Generate an individual library for each of the at least two different DNA samples; The individual libraries were exposed to either i) single nucleotide polymorphism (SNP) arrays or ii) whole genome sequencing. as well as Haplotype phasing is performed based on i) SNP array data or ii) sequencing data of each individual library in the individual libraries; and Based on the individual sample haplotype blocks, the single nucleotide polymorphisms observed in the haplotype phasing data will be associated with one of the at least two different DNA samples.

76. The method of claim 75, wherein generating the fully adapted DNA fragment involves: Tag fragmentation of the merged DNA sample is initiated in solution to generate at least two different binding complexes; The at least two different binding complexes are introduced into the flow cell, whereby the at least two different binding complexes are attached to the primers in the flow cell. Transposases that remove at least two different binding complexes; and Initiate the extension reaction.

77. The method of claim 75, wherein generating the fully adapted DNA fragment involves: The merged DNA sample is introduced into a flow cell having a transposon complex to which it is attached. Tag fragmentation of the merged DNA sample is initiated in the flow cell; Transposases that remove the transposon complex; as well as Initiate the extension reaction.

78. The method according to any one of claims 75 to 77, wherein the haplotype phasing relates to comparison-based haplotype phasing or assembly-based haplotype phasing.

79. A method comprising: The first indexed binding complex is generated in the following manner: The first DNA sample is tagged and fragmented using multiple first transposon complexes and second transposon complexes, each of the first transposon complexes comprising: The first transposon terminal includes a portion of the first non-transfer strand that hybridizes with the first transfer strand having a 5' phosphate group; and A first sequencing primer sequence complement is attached to the portion of the first non-transfer strand; and Each of the second transposable complexes comprises: The second transposon terminus includes a portion of the second non-transfer strand that hybridizes with the second transfer strand having a 5' phosphate group; and A second sequencing primer sequence complement is attached to the portion of the second non-transfer strand to generate a first DNA sample fragment having the first or second transfer strand attached thereto. as well as The first unique double-indexed strand is respectively connected to the first transfer strand and the second transfer strand attached to the first DNA sample fragment; The second indexed binding complex is generated in the following manner: The second DNA sample is tagged and fragmented using a second plurality of the first transposon complex and the second transposon complex to generate a second DNA sample fragment having the first transfer strand or the second transfer strand attached thereto. as well as The second unique double-indexed strand is respectively connected to the first transfer strand and the second transfer strand attached to the second DNA sample fragment; Merge the first indexed binding complex and the second indexed binding complex; and The combined first indexed binding complex and the second indexed binding complex are introduced into the flow cell.

80. The method according to claim 79, wherein: One of the first unique double-addition index chain or the second unique double-addition index chain contains a 5' functional group; and The 5' functional group is attached to the surface within the flow cell.

81. The method according to claim 79, wherein: The first tag fragmentation buffer and the first unique double-indexed strand are mixed with the first DNA sample and the plurality of first transposon complexes and second transposon complexes; and Tag fragmentation and concatenation to form the first indexed binding complex occur simultaneously.

82. The method according to claim 79, wherein: The second tag fragmentation buffer and the second unique double-indexed strand are mixed with the second DNA sample and the second plurality of first transposon complexes and second transposon complexes; and Tag fragmentation and ligation to form the second indexed binding complex occur simultaneously.

83. The method of claim 79, wherein during the generation of each of the first indexed binding complex and the second indexed binding complex, the tag fragmentation and ligation are performed sequentially.

84. The method of claim 79, wherein prior to merging the first indexed binding complex and the second indexed binding complex, the method further comprises: Remove the unattached first unique double-indexed chain from the first sample fluid containing the first indexed binding complex; as well as Remove the unattached second unique double-indexed chain from the second sample containing the second indexed binding complex.

85. The method of claim 84, wherein removing the unattached first unique double index chain and removing the unattached second unique double index chain involves exposing the first sample fluid and the second sample fluid to a 3' → 5' exonuclease.

86. The method according to claim 79, wherein: Connecting the first unique double-indexed strand to the first transfer strand and the second transfer strand attached to the first DNA sample fragment involves: The ligation mixture is added to the tag-fragmented first DNA sample to form a mixture, wherein the ligation mixture contains DNA ligase and 3' → 5' exonuclease; as well as The mixture is exposed to the connection temperature for a first predetermined time; as well as After the predetermined time, the method further includes: The 3' → 5' exonuclease is activated by removing the unattached first unique double index strand from the mixture through exposure to the exonuclease activation temperature; and Ethylenediaminetetraacetic acid (EDTA) was added to terminate the activity of the 3' → 5' exonuclease.

87. A reagent kit, the reagent kit comprising: A first fluid, the first fluid comprising a plurality of first transposon complexes and second transposon complexes, each of the first transposon complexes comprising: The first transposon terminal includes a portion of the first non-transfer strand that hybridizes with the first transfer strand having a 5' phosphate group; and The first sequencing primer sequence is attached to the portion of the first non-transfer strand; and Each of the second transposable complexes comprises: The second transposon terminus includes a portion of the second non-transfer strand that hybridizes with the second transfer strand having a 5' phosphate group; and The second sequencing primer sequence is attached to the portion of the second non-transfer strand; A second fluid, the second fluid containing a first unique double-addition index chain; and The third fluid contains a second unique double-addition index chain.

88. The kit of claim 87, further comprising a flow cell, the flow cell comprising: A recessed portion, which is separated by a gap region; and Primer set, the primer set being attached to the recess; One of the first unique double-addition index chain or the second unique double-addition index chain includes a 5' functional group that will be attached to the recess or to the gap region.

89. The kit of claim 87, further comprising a flow cell, the flow cell comprising: Swimming lanes; and Primer set, the primer set being attached to the swim lane; One of the first unique double-addition index chain or the second unique double-addition index chain contains a 5' functional group to be attached to the swim lane.