Compositions, kits and methods for detecting ebv-associated nucleic acid markers

CN122503548APending Publication Date: 2026-08-04SANSURE BIOTECH INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SANSURE BIOTECH INC
Filing Date
2026-05-27
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

[0003]EBV的临床精准诊断是对EBV引起的疾病进行防控的重要环节,然而其目前仍面临多重技术瓶颈

Benefits of technology

(1)本发明提供的组合物中同时包含针对EB病毒mRNA和EB病毒源性miRNA的特异性引物(及可选的探针),可以更为准确地确定样品是否受到EBV感染,尤其是可以实现对低病毒载量样品的准确检测,从而对EBV的防控和治疗提供的更为准确的依据。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122503548A_ABST
    Figure CN122503548A_ABST
Patent Text Reader

Abstract

The application relates to the technical field of biological detection, and discloses a composition, a kit and a detection method for detecting an EB virus related nucleic acid marker. The composition provided by the application comprises primers for detecting EB virus mRNA and EB virus derived miRNA. Through the combined use of specific primers designed for specific EB virus mRNA and EB virus derived miRNA, the application can realize rapid, high-specificity and high-sensitivity detection of the EB virus, thereby providing more accurate diagnosis information for the subsequent treatment and prevention and control of EB virus infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a composition, kit, and detection method for detecting EB virus-related nucleic acid markers. Background Technology

[0002] Epstein-Barr virus (EBV) is a herpesvirus that can induce diseases including infectious mononucleosis (IM), chronic active EBV infection (CAEBV), and EBV-associated hemophagocytic lymphohistiocytosis (EBV-HLH). The EBV life cycle includes a latent period and a lysis replication period. During the latent period, a small number of viral genes and non-coding RNAs are expressed. Under specific conditions, the virus is reactivated and enters the lysis cycle, expressing all viral genes and producing infectious viral progeny.

[0003] Accurate clinical diagnosis of EBV is crucial for the prevention and control of EBV-related diseases; however, it still faces several technical bottlenecks. For example, traditional serological testing methods are susceptible to false positives due to factors such as immunosuppression, and false negatives may occur when antibodies are not produced or are too low in the early stages of infection. Furthermore, viral nucleic acid testing still suffers from insufficient sensitivity, especially in the early stages of infection when viral load is low and cannot be accurately detected. Moreover, viral nucleic acid test results cannot determine whether the virus is in a latent state or actively replicating. In addition, while imaging and tissue biopsy can provide pathological evidence, imaging results lack etiological confirmation, and tissue biopsy is an invasive procedure with many limitations in clinical application.

[0004] Therefore, there is an urgent need to develop new detection methods for EBV that are faster, more accurate, easier to operate, have lower detection limits, and can accurately detect samples in the early stages of EBV infection or samples with low EBV load. Summary of the Invention

[0005] The purpose of this invention is to overcome the aforementioned problems in the prior art and provide a composition, kit, and detection method for detecting EBV-related nucleic acid biomarkers. The composition provided by this invention simultaneously contains specific amplification primers targeting both EBV mRNA and EBV-derived miRNA, which can improve the accuracy of EBV detection, especially for samples with low viral load.

[0006] To achieve the above objectives, a first aspect of the present invention provides a composition for detecting EB virus-related nucleic acid markers, wherein the EB virus-related nucleic acid markers include EB virus mRNA and EB virus-derived miRNA, wherein the EB virus mRNA is selected from EBNA1 mRNA and / or BRLF1 mRNA, and the composition includes the following primers for detecting EB virus-related nucleic acid markers: Primers used for detecting EBNA1 mRNA include primer pairs with nucleotide sequences as shown in SEQ ID NO:3-4, or primer pairs that have at least 80% identity with the primers shown in SEQ ID NO:3-4; Primers used for detecting BRLF1 mRNA include primer pairs with nucleotide sequences as shown in SEQ ID NO:6-7, or primer pairs that have at least 80% identity with the primers shown in SEQ ID NO:6-7; The primer pair used to detect EB virus-derived miRNA includes a universal sequence and a specific variable region sequence from the 5' end to the 3' end, wherein the universal sequence is shown in SEQ ID NO:1-2.

[0007] A second aspect of the present invention provides a kit comprising the composition described in the first aspect for detecting EB virus-related nucleic acid biomarkers.

[0008] A third aspect of the present invention provides a method for non-diagnostic detection of EB virus-related nucleic acid markers in a sample, the method comprising in vitro amplification of the nucleic acid of the sample to be tested using the composition of the first aspect or the kit of the second aspect.

[0009] Through the above technical solution, the present invention can achieve at least the following beneficial effects: (1) The composition provided by the present invention contains specific primers (and optional probes) targeting EB virus mRNA and EB virus-derived miRNA, which can more accurately determine whether a sample is infected with EBV, especially the accurate detection of samples with low viral load, thus providing a more accurate basis for the prevention and treatment of EBV.

[0010] (2) The composition of the present invention may simultaneously contain primers (and optional probes) targeting multiple EBV mRNAs and multiple EBV-derived miRNAs, which work together to achieve simultaneous detection of up to six EBV-related nucleic acid markers, thereby achieving rapid, highly sensitive and highly accurate detection.

[0011] (3) In some preferred embodiments, the composition provided by the present invention may further include primers (and optional probes) for detecting EBV infection characteristic miRNAs of the host, as well as exogenously added internal controls and their corresponding primers (and optional probes) for excluding false negatives caused by experimental operations, equipment failures and reagent failures, thereby providing better assurance for the accuracy of detection.

[0012] (4) The primers and probes contained in the composition provided by the present invention do not interfere with each other, and have good simultaneous detection effect on multiple detection targets in the sample. They also have good specificity and anti-interference ability, which can achieve accurate and highly sensitive screening of EBV. Moreover, the detection operation is convenient and suitable for large-scale promotion and application. Attached Figure Description

[0013] Figure 1 This is a graph showing the results of testing clinically positive sputum samples using the kit from Example 1.

[0014] Figure 2 This is a graph showing the results of testing clinical negative sputum samples using the kit from Example 1.

[0015] Figures 3A-3H The following figures show the results of testing simulated samples of EBNA1 mRNA, BRLF1 mRNA, miR-BART13-5p, miR-BART2-5p, miR-BHRF1-2-5p, miRNA-BHRF1-1, hsa-miR-155-5p, and cel-miR-39 at a concentration of 100 copies / mL using the kit from Example 1.

[0016] Figure 4 This is a graph showing the results of testing clinically positive sputum samples using Comparative Kit A in Comparative Example 1.

[0017] Figure 5 This is a graph showing the results of testing clinically positive sputum samples using Comparative Kit B in Comparative Example 1. Detailed Implementation

[0018] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0019] In this invention, unless otherwise specified, the given nucleotide sequences are listed in the order of 5'→3'.

[0020] In this invention, "EB virus-associated nucleic acid markers" refer to nucleic acids or fragments thereof that can indicate the presence of EB virus in a sample, or that the sample is infected with EB virus. Specifically, they can include EB virus mRNA and EB virus-derived miRNA. "EB virus-derived miRNA" refers to miRNA expressed by EB virus.

[0021] The inventors of this invention ingeniously designed a series of PCR primers and probes based on the sequences of EBV and its expressed (multiple) miRNAs. These primers and probes do not form non-specific bindings or dimers, can coexist in the reaction system, and do not adversely affect each other when used together. By using these PCR primers, EBV and its expressed miRNAs can be simultaneously amplified in a single tube, enabling efficient detection and determination of whether a sample is infected with EBV. Further research revealed that the specific primer combinations provided by this invention also exhibit good sensitivity and specificity, offering new detection methods and related products for early rapid screening of EBV and identification of samples with low EBV load.

[0022] Based on this, a first aspect of the present invention provides a composition for detecting EB virus-related nucleic acid markers, characterized in that the EB virus-related nucleic acid markers include EB virus mRNA and EB virus-derived miRNA, wherein the EB virus mRNA is selected from EBNA1 mRNA and / or BRLF1 mRNA, and the composition includes the following primers for detecting EB virus-related nucleic acid markers: Primers used for detecting EBNA1 mRNA include primer pairs with nucleotide sequences as shown in SEQ ID NO:3-4, or primer pairs that have at least 80% identity with the primers shown in SEQ ID NO:3-4; Primers used for detecting BRLF1 mRNA include primer pairs with nucleotide sequences as shown in SEQ ID NO:6-7, or primer pairs that have at least 80% identity with the primers shown in SEQ ID NO:6-7; The primer pair used to detect EB virus-derived miRNA includes a universal sequence and a specific variable region sequence from the 5' end to the 3' end, wherein the universal sequence is shown in SEQ ID NO:1-2.

[0023] TGTCTATGATCACGTCTACACCACAGCACAGTCTAACGACCATCAGCATCGCGTT (SEQ ID NO: 1) CGCACCCTGCACTGGATGACTCTGCG (SEQ ID NO:2) In this invention, EBNA1 mRNA and BRLF1 mRNA have the general meaning in the art, and those skilled in the art can consult their specific sequences from public databases (such as NCBI). For example, the nucleotide sequence of EBNA1 mRNA can be found in GenBank: AY825078.1, and the nucleotide sequence of BRLF1 mRNA can be found in GenBank: M17547.1 (preferably referring to nucleotides 1-737 therein).

[0024] The inventors of this invention discovered in their research that when detecting EBV-related nucleic acid markers, if the target includes miRNA (any miRNA related to or unrelated to EBV, such as EBV-derived miRNA, host-generated miRNA after EBV infection, host-generated miRNA, exogenously added miRNA as an internal reference, etc.), using the sequence SEQ ID NO: 1-2 as a universal adapter for the miRNA primer (also referred to as the "universal sequence" in this invention), and further adding a specific variable region sequence targeting the target miRNA (i.e., a specific sequence for amplifying different target miRNAs, preferably 3-8 nt in length) to the 3' end, efficient amplification of multiple different miRNAs in the detection system can be achieved. The specific miRNA types contained in the amplified products can then be detected by sequencing, fluorescence detection, and other methods. Furthermore, in further research, the inventors of this invention also found that independently adding specific variable region sequences to the 3' end of the aforementioned universal primers resulted in better miRNA detection in the sample.

[0025] It should be noted that, in this invention, the primers for EB virus mRNA and EB virus-derived miRNA contained in the above composition can be the complete sequences listed above, or partial fragments of the above sequences can be selected, or sequences formed by adding several nucleotides on the basis of them, as long as the purpose of rapidly and accurately identifying EB virus mRNA and EB virus-derived miRNA in the sample can be achieved.

[0026] In this invention, "identity" refers to the percentage of identical sequences between two sequences. For example, 90% identity between sequence 1 and sequence 2 means that 90% of sequence 1 is identical to sequence 2, or 90% of sequence 2 is identical to sequence 1. Differences between the two sequences can be due to nucleotide deletions, additions, or substitutions. For example, sequence a containing 100 nucleotides, with 20 consecutive nucleotides deleted from its 5' end to obtain sequence b, has 80% identity with sequence a compared to sequence b, while sequence b has 100% identity with sequence a.

[0027] According to a preferred embodiment of the present invention, the primers used for detecting EB virus mRNA can each independently have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% identity with the primer sequences listed above.

[0028] According to a preferred embodiment of the present invention, the EB virus-derived miRNA is selected from at least one of miR-BART13-5p, miR-BART2-5p, miR-BHRF1-2-5p and miRNA-BHRF1-1.

[0029] Preferably, the primers used to detect miR-BART13-5p include primer pairs with nucleotide sequences as shown in SEQ ID NO:9-10, or primer pairs that have at least 80% identity with the primers shown in SEQ ID NO:9-10.

[0030] Preferably, the primers used to detect miR-BART2-5p include primer pairs with nucleotide sequences as shown in SEQ ID NO:12-13, or primer pairs with at least 80% identity to the primers shown in SEQ ID NO:12-13.

[0031] Preferably, the primers used to detect miR-BHRF1-2-5p include primer pairs with nucleotide sequences as shown in SEQ ID NO:15-16, or primer pairs with at least 80% identity to the primers shown in SEQ ID NO:15-16.

[0032] Preferably, the primers used to detect miRNA-BHRF1-1 include primer pairs with nucleotide sequences as shown in SEQ ID NO:18-19, or primer pairs with at least 80% identity to the primers shown in SEQ ID NO:18-19.

[0033] According to a preferred embodiment of the present invention, the primers used to detect the above-mentioned EB virus-derived miRNA can each independently have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% identity with the primer sequences listed above.

[0034] In some preferred embodiments, the composition may further include primers for detecting host miRNA. When the composition contains primers for detecting host miRNA, the combination of amplification results of host miRNA and EB virus-related nucleic acid markers helps to eliminate false negatives caused by operational errors during sample collection and processing.

[0035] Preferably, the host miRNA includes hsa-miR-155-5p.

[0036] According to some particularly preferred embodiments, the primers used to detect hsa-miR-155-5p include primer pairs with nucleotide sequences as shown in SEQ ID NO:21-22, or primer pairs that have at least 80% identity with the primers shown in SEQ ID NO:21-22.

[0037] In some preferred embodiments, the composition further includes an exogenous internal control and primers for detecting the exogenous internal control. The exogenous internal control refers to a nucleic acid fragment added to the detection system during the detection process that is not present in the host or the target being detected (such as the aforementioned EB virus-related nucleic acid markers and host miRNAs). Adding the exogenous internal control and primers for detecting it can eliminate false negatives caused by operational errors or instrument problems during sample nucleic acid extraction and amplification.

[0038] Preferably, the exogenous internal reference includes cel-miR-39. cel-miR-39 is a synthetically produced miRNA whose sequence is derived from nematodes (C. elegans). Caenorhabditis elegans For the specific sequence, please refer to SEQ ID NO:47.

[0039] UCACCGGGUGUAAAUCAGCUUG (SEQ ID NO:47) According to some particularly preferred embodiments, the primers used for detecting cel-miR-39 include primer pairs with nucleotide sequences as shown in SEQ ID NO:24-25, or primer pairs having at least 80% identity with the primers shown in SEQ ID NO:24-25. For example, they may have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% identity.

[0040] When using the composition provided by this invention, the products of in vitro amplification of nucleic acids in a sample using this composition can be detected using any method commonly used in the art to determine whether the sample contains the corresponding EB virus-related nucleic acid marker. Exemplarily, gel electrophoresis, sequencing, nucleic acid probe methods, etc., can be used to detect the amplification products obtained using the composition of this invention. In some preferred embodiments, rapid detection can also be achieved by using a method such as fluorescent PCR, which utilizes nucleic acid probes with labeled groups (fluorescent groups) and primers for in vitro amplification.

[0041] According to some preferred embodiments of the present invention, the composition further includes a probe for detecting EB virus-related nucleic acid markers, and at least one of an optional host miRNA and an optional exogenous internal control. As is well known to those skilled in the art, the primers and probes contained in the composition of the present invention should target corresponding detection targets, and the probes should be able to bind to the amplification product fragments. Their correspondences will not be listed and described in detail here. The term "optional" in "optional host miRNA and optional exogenous internal control" means that the host miRNA and exogenous internal control probes in the composition are not essential and can be adjusted according to actual needs and the specific components of the composition (e.g., whether it contains corresponding primers or exogenous internal controls).

[0042] In this invention, when specific primers and probes are used in combination, better detection results can be obtained (especially in the combined detection of several different combinations of EB virus-related nucleic acid markers, as well as optional host miRNAs and optional exogenous internal controls).

[0043] For example, according to some preferred embodiments of the present invention, the probe for detecting EBNA1 mRNA is as shown in SEQ ID NO:5, or has at least 80% identity with SEQ ID NO:5.

[0044] According to some preferred embodiments of the present invention, the probe for detecting BRLF1 mRNA is as shown in SEQ ID NO:8, or has at least 80% identity with SEQ ID NO:8.

[0045] According to some preferred embodiments of the present invention, the probe used to detect miR-BART13-5p is as shown in SEQ ID NO:11, or has at least 80% identity with SEQ ID NO:11.

[0046] According to some preferred embodiments of the present invention, the probe used to detect miR-BART2-5p is as shown in SEQ ID NO:14, or has at least 80% identity with SEQ ID NO:14.

[0047] According to some preferred embodiments of the present invention, the probe used to detect miR-BHRF1-2-5p is as shown in SEQ ID NO:17, or has at least 80% identity with SEQ ID NO:17.

[0048] According to some preferred embodiments of the present invention, the probe for detecting miRNA-BHRF1-1 is as shown in SEQ ID NO:20, or has at least 80% identity with SEQ ID NO:20.

[0049] According to some preferred embodiments of the present invention, the probe used to detect hsa-miR-155-5p is as shown in SEQ ID NO:23, or has at least 80% identity with SEQ ID NO:23.

[0050] According to some preferred embodiments of the present invention, the probe for detecting cel-miR-39 is as shown in SEQ ID NO:26, or has at least 80% identity with SEQ ID NO:26.

[0051] Similar to the primers mentioned above, the probes described above can also independently possess at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, and 99.9% identity with the probe sequences listed above. It should be further noted that the identity of the primers and probes with the listed sequences may be the same or different.

[0052] The compositions of the present invention may include primers and probes for detecting one EBV mRNA and one EBV-derived miRNA (and optionally, host miRNA, exogenous internal reference, etc.), or may simultaneously include primers and probes for detecting multiple EBV mRNAs and one or more EBV-derived miRNAs (and optionally, host miRNA, exogenous internal reference, etc.). For example, according to some preferred embodiments of the present invention, the compositions include any one or more sets of primers and optional probes from (1) and any one or more sets of primers and optional probes from (2): (1) A combination of primers and optional probes for detecting EBV mRNA, comprising at least one of the following: Primer pairs SEQ ID NO:3-4, and optional probe SEQ ID NO:5 (for the detection of EBNA1 mRNA); Primer pairs SEQ ID NO:6-7, and optional probe SEQ ID NO:8 (for the detection of BRLF1 mRNA); (2) A combination of primers and optional probes for detecting EBV-derived miRNAs, comprising at least one of the following: Primer pairs SEQ ID NO:9-10, and optional probe SEQ ID NO:11 (for detection of miR-BART13-5p); Primer pairs SEQ ID NO:12-13, and optional probe SEQ ID NO:14 (for the detection of miR-BART 2-5p); Primer pairs SEQ ID NO:15-16, and optional probe SEQ ID NO:17 (for the detection of miR-BHRF1-2-5p); Primer pairs SEQ ID NO:18-19, and optional probe SEQ ID NO:20 (for the detection of miRNA-BHRF1-1).

[0053] Preferably, the composition further comprises the primer and optional probe combination of (3) and / or (4) the primer and optional probe combination: (3) Primer pairs SEQ ID NO:21-22, and optional probe SEQ ID NO:23 (for the detection of hsa-miR-155-5p); (4) Primer pair SEQ ID NO:24-25, and optional probe SEQ ID NO:26 (for the detection of cel-miR-39).

[0054] After amplifying nucleic acids in a sample using the composition of this invention, the amplification products can be detected using any method commonly used in the art, thereby achieving qualitative or quantitative detection of EBV mRNA, EBV-derived miRNA (and optional host miRNA, optional exogenous internal reference, etc.), in the sample. For example, the amplification products can be isolated, purified, and sequenced. Alternatively, a labeling group can be modified onto the probe, and then detection can be performed using a corresponding detection method targeting the labeling group. Compared to sequencing the amplification products, detecting the labeling group modified on the probe is more convenient and faster. Therefore, according to a preferred embodiment of this invention, the probe is modified with a labeling group. Any labeling group commonly used in the art for nucleic acid detection, especially labeling groups that can be modified into the probe sequence, is applicable to this invention. For example, in a particularly preferred embodiment, a fluorescent labeling group can be used.

[0055] Since the composition provided by this invention can be used simultaneously for nucleic acid detection of multiple different detection targets, in order to more clearly distinguish the detection results of different detection targets, it is preferable that the probes (5' ends) for different detection targets are modified with different fluorescent labeling groups. Preferably, the different fluorescent labeling groups can be detected simultaneously through different channels. The "detection target" refers to the aforementioned EBV mRNA, EBV-derived miRNA, host miRNA, exogenous internal reference, and other substances that are desired to be detected by the primers and probes in the composition.

[0056] According to some preferred embodiments of the present invention, the fluorescent labeling group may be selected from at least one of FAM, HEX, VIC, ROX, CY5, QUASAR705, ATTO425, CY7, and AF405.

[0057] Preferably, the probe (3' end) is further modified with a fluorescence quenching group. Preferably, the fluorescence quenching group is selected from at least one of BHQ0, BHQ1, BHQ2, BHQ3, SQ1, SQ2, and Dabcyl.

[0058] In this invention, the combination of fluorescent labeling groups and fluorescent quenching groups modified on the probe is well known to those skilled in the art. In use, it can be selected according to the actual situation (such as the desired number of detection targets, the channel settings of the detection equipment, etc.), and will not be elaborated here.

[0059] In the above-described composition provided by this invention, the primers (and optional probes) for each detection target can be packaged independently, or primers (and optional probes) for multiple detection targets can be packaged together. Since non-specific binding does not occur between the primers (and optional probes) in the above-described composition of this invention, preferably, to save packaging materials, reduce production and usage costs, and simplify detection operations, the primers (and optional probes) in the composition are in a mixed-package form.

[0060] A second aspect of the present invention provides a kit comprising the composition described in the first aspect for detecting EB virus-related nucleic acid biomarkers.

[0061] The kit of the present invention may contain only the composition of the first aspect, and when used, it may be used in conjunction with reagents from other sources (e.g., purchased separately or prepared by oneself) to detect EB virus-related nucleic acid markers in samples. Alternatively, the kit may contain other reagents required for detection (such as reagents required for subsequent detection processes, specifically, reagents required for PCR, gel electrophoresis, sequencing, etc.; or reagents for detecting pre-processed samples, specifically, reagents required for sample pretreatment, reagents required for sample nucleic acid extraction, etc.).

[0062] According to some preferred embodiments of the present invention, the kit further comprises a buffer, an enzyme, deoxyribonucleoside triphosphate, an RNase inhibitor, and Mg. 2+ At least one of the sources.

[0063] Preferably, the buffer solution comprises tris(hydroxymethyl)aminomethane hydrochloride buffer (Tris-HCl buffer). Tris-HCl buffer is a buffer solution containing Tris-HCl, and its specific formulation is well known in the art and will not be described in detail here. The present invention does not impose any particular limitation on the specific source of the buffer solution used; it can be a commercially available finished product or a solution prepared according to existing technology.

[0064] Preferably, the enzyme (at least) includes at least one of UNG enzyme (also known as UDG enzyme), DNA polymerase (e.g., various Taq enzymes), and reverse transcriptase (also known as reverse transcriptase, RT enzyme, etc.). The present invention does not impose any particular limitation on the specific source of the various enzymes used; they can be commercially available finished enzymes or self-prepared enzyme preparations.

[0065] Preferably, the Mg 2+ The source includes water-soluble inorganic salts of magnesium, such as MgCl2.

[0066] The deoxyribonucleoside triphosphates included in the kit of this invention are raw materials used for complementary pairing with template sequences during in vitro nucleic acid amplification. The specific types of deoxyribonucleoside triphosphates included can be selected according to actual needs. Preferably, the deoxyribonucleoside triphosphates may include dATP (containing adenine), dGTP (containing guanine), dTTP (containing thymine), dCTP (containing cytosine), and dUTP (containing uracil). This invention does not impose any particular restrictions on the specific source of the deoxyribonucleoside triphosphates in the kit; they can be self-prepared compounds or commercially available finished products. For example, commercially available dNTPs(U) reagents (containing dATP, dGTP, dTTP, dCTP, and dUTP) can be used directly.

[0067] In some preferred embodiments, the kit may also include a positive control reagent and / or a negative control reagent.

[0068] This invention does not impose any particular restrictions on the specific selection of reagents used as positive and negative controls in the kit, and they can be selected according to conventional techniques in the art. For example, reagents such as physiological saline and buffer solutions that do not contain the target sequence can be used as negative controls. As another example, mixed plasmids containing the target sequence or its corresponding amplified fragment, or synthetic nucleic acids (such as DNA or RNA) containing the amplified fragment can be used as positive controls.

[0069] In some preferred embodiments, the kit may further include reagents and / or materials for sample (pre)treatment. Since EBV test samples are typically throat swabs, saliva, sputum, etc., which contain a large number of substances that affect nucleic acid extraction and release and inhibit in vitro nucleic acid amplification, reagents / materials to remove these substances can be included in the kit to obtain better detection results. Any reagent / material in the art capable of achieving the above objectives can be used in the kit of the present invention. For example, the kit may contain a sputum digestion solution (i.e., a reagent that digests and degrades viscous substances such as mucin in sputum, improving its dispersibility and reducing viscosity), a filter membrane (such as a filter membrane for filtering and removing large molecules such as mucin clumps in sputum / saliva or digested sputum, with a pore size typically 1-10 μm, preferably 3-7 μm; or a filter membrane for enriching viral particles and exosomes, with a pore size typically not exceeding 1 μm, preferably not exceeding 0.5 μm, and more preferably 0.1-0.5 μm. The filter membrane can be made of materials commonly used in the art, such as polyethersulfone (PES), etc.), and a sample preservation solution (such as a sample preservation solution for preserving pharyngeal swabs). The present invention does not impose any particular restrictions on the source of the above-mentioned reagents and / or materials used for sample (pre)treatment. For example, the relevant finished products can be obtained directly through commercial purchase or customization, or they can be prepared by the individual according to the requirements described above.

[0070] A third aspect of the present invention provides a method for detecting EB virus-related nucleic acid markers in a sample, the method comprising in vitro amplification of the nucleic acid of the sample to be tested using the composition described in the first aspect or the kit described in the second aspect.

[0071] This invention enables the combined detection of one or more EBV mRNAs and one or more EBV-derived miRNAs. For example, the method of this invention can jointly detect one or two of the aforementioned EBV mRNAs, and one, two, three, or four of the aforementioned four EBV-derived miRNAs, and the EBV mRNAs and EBV-derived miRNAs to be jointly detected can be any combination of the aforementioned types. Those skilled in the art can determine the specific combination of EBV mRNAs and EBV-derived miRNAs to be detected according to this invention and actual circumstances, which will not be elaborated further here.

[0072] In the method of this invention, except for the in vitro amplification of nucleic acid in the sample using the composition or kit of this invention, other steps can be performed using conventional methods in the art. During the in vitro amplification and detection of nucleic acid, in addition to the composition or kit of this invention, other reagents required in this process can be conventional reagents commonly used in the art for in vitro nucleic acid amplification and detection of amplification products.

[0073] For example, in some preferred embodiments, the method of the present invention may include: (1) Extract and / or purify the nucleic acid of the sample to be tested to obtain the sample nucleic acid; (2) Use the nucleic acid extracted in step (1) as a template for in vitro amplification.

[0074] Preferably, the method further includes a step of pre-treating the sample to be tested before step (1).

[0075] In a preferred embodiment, the pretreatment includes the removal of inhibitors present in the sample. "Inhibitors present in the sample" refers to substances that adversely affect the operation of each step in the method of the present invention and the final result. Preferably, the inhibitors include inhibitors that inhibit the release of EB virus and its related exosomes (i.e., exosomes secreted and released by host cells due to EB virus infection, which may contain EB virus, EB virus-derived miRNA, etc.) (e.g., mucins, free proteins, etc.), and / or inhibitors that inhibit the in vitro amplification of sample nucleic acids (e.g., salivary enzymes, polysaccharides, etc.).

[0076] Preferably, the method may further include (3) analyzing and detecting the in vitro amplification product obtained in step (2).

[0077] In a preferred embodiment, since the probe is modified with fluorescent labeling groups or other markers, the target in the sample can be qualitatively or quantitatively detected and analyzed by means of fluorescence detection or other methods of detecting the markers. Those skilled in the art can also use any known method for detecting / analyzing in vitro amplified nucleic acid products to detect the in vitro amplified products obtained in the above method, and then analyze the presence of the target in the sample. Other specific detection methods will not be elaborated here.

[0078] Compared to traditional detection methods such as serological typing, single-target PCR, and genome sequencing, the method of using the composition of this invention for in vitro nucleic acid amplification and qualitative or quantitative detection using labeled groups modified on the probe significantly shortens the detection time. Furthermore, this invention, by jointly detecting EBV mRNA and EBV-related miRNAs, can accurately determine whether a sample is infected with EBV, and can also accurately detect low viral load samples in the early stages of EBV infection, thus improving the accuracy and sensitivity of EBV detection.

[0079] Therefore, the present invention further provides the application of the composition described in the first aspect, the kit described in the second aspect, or the method described in the third aspect in improving the accuracy and sensitivity of EBV detection.

[0080] It should be noted that the methods and applications provided in this invention can be diagnostic or non-diagnostic. For example, diagnostic aspects may include using the compositions, kits, or methods of this invention to test samples from patients or suspected patients to determine whether they are infected with EBV. Non-diagnostic aspects may include using the compositions, kits, or methods of this invention to test human, animal, or environmental samples to complete related research, (non-diagnostic) testing, disease control, environmental monitoring, etc. Furthermore, the compositions, kits, or methods of this invention can be used in laboratory research to test laboratory samples (such as in vitro cultured EBV, in vitro or in vivo models of EBV infection (such as in vitro cultured cells, organoids, tissues, and laboratory animals, etc.)) to complete related disease mechanism research, drug testing, and development.

[0081] In some preferred embodiments, the methods and applications provided by the present invention are non-diagnostic.

[0082] The present invention will be described in detail below through embodiments. It should be understood that the following embodiments are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0083] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available products purchased from regular chemical or biological reagent / material suppliers, and all reagents are of analytical grade.

[0084] Example 1 This embodiment illustrates the preparation of the reagent kit provided by the present invention.

[0085] 1. Prepare primers and probes The EBV genome and EB-derived exosome nucleic acids were studied. Primers and probes were designed specifically for the detection targets in Table 1, and Kangde Biotechnology Co., Ltd. was commissioned to synthesize the primers and probes according to Table 2.

[0086] Table 1

[0087] Table 2

[0088] 2. Prepare the unit reaction reagent kit for PCR reaction. Prepare the corresponding reagents according to the required amount of reagents for the unit reaction reagent kit (i.e., the reagent kit used to test one sample in one PCR reaction) in Table 3.

[0089] Table 3

[0090] Note: In Table 3, the PCR buffer is PCR buffer (S09) purchased from Hunan Kangde Biotechnology Co., Ltd.; the amounts of upstream primer, downstream primer and probe are the amounts used for one sequence.

[0091] 3. Prepare internal standard reagent and control reagent. Negative control: sterile saline.

[0092] Positive control: A mixture of amplified fragment plasmids. The amplified fragment plasmids were prepared by inserting the DNA sequences of the amplified fragments obtained by amplifying each detection target using the primers in Table 1 into pUC57.

[0093] 4. Prepare the reagent kit The reagents prepared in steps 1-3 are combined and packaged according to the target detection capacity of a single kit.

[0094] Example 2 This embodiment illustrates the combined detection effect of the kit provided by the present invention on EB-related nucleic acid biomarkers in samples.

[0095] (a) PCR detection 1. Prepare the nucleic acid sample to be tested. The samples used in this embodiment are clinically positive sputum samples that have been confirmed to be infected with EBV through sequencing (sequencing results show that the sample contains EBNA1 mRNA, BRLF1 mRNA, miR-BART13-5p, miR-BART2-5p, miR-BHRF1-2-5p and miRNA-BHRF1-1, and the sample contains host-expressed hsa-miR-155-5p) and clinically negative sputum samples that have not been confirmed to be infected with EBV through sequencing.

[0096] Simulated sample pretreatment: Sputum liquefaction solution Y1002 from Sansure Biotech Inc. was used to liquefy the above-mentioned clinical positive and clinical negative sputum samples according to its instructions. After liquefaction, the samples were filtered through a PES membrane (5μm pore size) to remove mucin clumps, and then enriched with viral particles and exosomes through a 0.22μm ultrafiltration membrane (100kDa molecular weight cutoff). Finally, low-frequency pulsed ultrasound was used (ultrasound frequency 25kHz, ultrasound power 30W, 5 seconds working / 10 seconds intermittent, total duration 30 seconds, ice bath operation throughout) to obtain the pretreated nucleic acid samples.

[0097] 2. Sample addition and PCR amplification Take 4 µL each of the pretreated nucleic acid sample, positive control, and negative control, and add them to PCR reaction tubes. Add 16 µL of the unit PCR reaction reagent kit to each tube (see Table 3 for specific components). Mix well and place in the SLAN-96P fully automated medical PCR analyzer. Perform PCR reaction according to the reaction conditions in Table 4.

[0098] Table 4

[0099] Detection criteria: If the Ct value of the CY5 channel is ≤40 and shows a clear S-shaped amplification curve, the test is considered valid. In addition, if the Ct value of any of the channels FAM, HEX, ROX, QUASAR 705, ATTO 425, CY7, or AF405 is ≤40 and shows a clear S-shaped amplification curve, it is considered EBV infection. If the Ct value of the CY5 channel is >40, the test is considered invalid and needs to be tested again.

[0100] The test results of clinically positive sputum samples are as follows Figure 1 As shown. Referring to the above judgment criteria, all tests on this sample were positive, indicating that the composition and kit of the present invention can jointly detect multiple EB virus mRNAs and EB virus-derived miRNAs, as well as host miRNAs and exogenous internal controls. Positive control: Detection results are similar to those of clinically positive sputum samples. Clinically negative sputum samples: No amplification curves were observed in any channel except for the exogenous internal control (CY5 channel) (see...). Figure 2 Negative control: The test results were similar to those of clinically negative sputum samples.

[0101] (ii) Specificity test The methods described in Experiment (I) were used to detect the cluster partners micro-BART12-5p, micro-BART14-5p, micro-BART1-5p, and micro-BHRF1-3-5p, respectively. The synthesized miRNAs were added to sputum samples that had been verified to be free of these miRNAs by sequencing, and the resulting samples were used for testing. The results showed that the kit of this invention did not produce any amplification curves for these samples, indicating that all samples showed clear negative detection results, demonstrating that the composition and kit provided by this invention have excellent specificity.

[0102] (III) Sensitivity Test Sensitivity (LOD) testing was performed on each detection target, using the following method: Using sputum samples that were sequenced and verified to be free of EBV genomic nucleic acid and EBV-related miRNAs, the amplification products obtained from different primers in Experiment (I) were prepared into simulated samples at different concentrations. These simulated samples were then tested according to the method in Experiment (I) (each simulated sample of amplification product was tested 20 times for each concentration) to determine the detection limit. Table 5 shows the detection rate of the amplified sequence of each detection target at each concentration (detection rate = number of detected targets / total number of detected targets). As can be seen from the table, although the detection rate is less than 1 / 1 at 50 copies / mL, some samples can still be detected positively, indicating that the kit of the present invention still has a certain detection capability for samples with extremely low levels of the detection target. Figures 3A-3H The results of detection of 100 copies / mL simulated samples of EBNA1 mRNA, BRLF1 mRNA, miR-BART13-5p, miR-BART2-5p, miR-BHRF1-2-5p, miRNA-BHRF1-1, hsa-miR-155-5p, and cel-miR-39 are shown in the figure. As can be seen from the figure, all the detection targets can be detected at this concentration.

[0103] Table 5

[0104] Comparative Example 1 (a) Comparison kit A Comparative kit A was prepared using the method described in Example 1, except that the universal sequence in the primers for the miRNA was replaced with SEQ ID NO:27-28 (the sequence of the variable region connected to the 3' end of the universal primer remained unchanged). That is, this comparative kit used the primers and probes listed in Table 7.

[0105] GTTGTCTATGATCACGTCTACACCACAGCACAGTCTAACGACCATCAGCATCGCGTTT (SEQ ID NO:27, replace the universal sequence in the upstream primer) CGTTTCCCTG (SEQ ID NO:28, replace the universal sequence in the downstream primer) Table 7

[0106] The same clinically negative and positive sputum samples were tested according to the method in Experiment (I) of Example 2. The test results of the clinically negative sputum samples were the same as those in Experiment (I). Figure 2 Similarly; the test results of clinically positive sputum samples are as follows Figure 4 As shown.

[0107] pass Figure 4 It can be seen that when the sample was tested using comparison kit A, some amplification curves were missing, and the amplification efficiency of the target samples with amplification curves was also different. Figure 1 Compared to the significantly reduced levels, the overall detection performance of this comparison kit is poor.

[0108] (ii) Comparison kit B Comparative kit B was prepared using the method described in Example 1, except that the downstream primers for miR-BHRF1-2-5p, miRNA-BHRF1-1, hsa-miR-155-5p, and cel-miR-39 in Table 2 were replaced with the downstream primers for miR-BHRF1-2-5p, miRNA-BHRF1-1, hsa-miR-155-5p, and cel-miR-39 in Table 7.

[0109] The same clinically positive sputum samples were tested using the kit from Example 1 and the comparative kit B of this example, following the method described in Experiment (I) of Example 2, to test the combined detection efficacy of these primers and probes. Results are shown in Table 9 and... Figure 5 .

[0110] Table 9

[0111] As can be seen from the results in Table 9, although the amplification efficiency of the HEX channel was improved after replacing the downstream primer sequences of some targets in the kit B, the amplification efficiency of the FAM, ROX, and QUASAR 705 channels was reduced. Furthermore, the channels after replacing the downstream primers showed false negatives. This indicates that the primers and probes for each detection target in the kit provided by this invention can affect each other, and better joint detection results can only be achieved when specific primer-probe combinations are used.

[0112] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A composition for detecting EB virus-related nucleic acid markers, characterized in that, The EB virus-related nucleic acid biomarkers include EB virus mRNA and EB virus-derived miRNA, wherein the EB virus mRNA is selected from EBNA1 mRNA and / or BRLF1 mRNA, and the composition includes the following primers for detecting EB virus-related nucleic acid biomarkers: Primers used for detecting EBNA1 mRNA include primer pairs with nucleotide sequences as shown in SEQ ID NO:3-4, or primer pairs that have at least 80% identity with the primers shown in SEQ ID NO:3-4; Primers used for detecting BRLF1 mRNA include primer pairs with nucleotide sequences as shown in SEQ ID NO:6-7, or primer pairs that have at least 80% identity with the primers shown in SEQ ID NO:6-7; The primer pair used to detect EB virus-derived miRNA includes a universal sequence and a specific variable region sequence from the 5' end to the 3' end, wherein the universal sequence is shown in SEQ ID NO:1-2.

2. The composition according to claim 1, wherein, The EB virus-derived miRNA is selected from at least one of miR-BART13-5p, miR-BART2-5p, miR-BHRF1-2-5p, and miRNA-BHRF1-1; Preferably, the primers used to detect miR-BART13-5p include primer pairs with nucleotide sequences as shown in SEQ ID NO:9-10; Preferably, the primers used to detect miR-BART2-5p include primer pairs with nucleotide sequences as shown in SEQ ID NO:12-13; Preferably, the primers used to detect miR-BHRF1-2-5p include primer pairs with nucleotide sequences as shown in SEQ ID NO:15-16; Preferably, the primers used to detect miRNA-BHRF1-1 include primer pairs with nucleotide sequences as shown in SEQ ID NO:18-19; More preferably, the composition further includes primers for detecting host miRNA, wherein the host miRNA preferably includes hsa-miR-155-5p, and more preferably the primers for detecting hsa-miR-155-5p include primer pairs with nucleotide sequences as shown in SEQ ID NO:21-22; More preferably, the composition further includes an exogenous internal control and primers for detecting the exogenous internal control, preferably the exogenous internal control includes cel-miR-39, and more preferably the primers for detecting cel-miR-39 include primer pairs with nucleotide sequences as shown in SEQ ID NO:24-25.

3. The composition according to claim 1 or 2, wherein, The composition further includes a probe for detecting EB virus mRNA and EB virus-derived miRNA, as well as at least one of optional host miRNA and optional exogenous internal control; Preferably, the probe used to detect EBNA1 mRNA is shown in SEQ ID NO:5; Preferably, the probe used to detect BRLF1 mRNA is shown in SEQ ID NO:8; Preferably, the probe used to detect miR-BART13-5p is shown in SEQ ID NO:11; Preferably, the probe used to detect miR-BART2-5p is shown in SEQ ID NO:14; Preferably, the probe used to detect miR-BHRF1-2-5p is as shown in SEQ ID NO:17; Preferably, the probe used to detect miRNA-BHRF1-1 is as shown in SEQ ID NO:20; Preferably, the probe used to detect hsa-miR-155-5p is as shown in SEQ ID NO:23; Preferably, the probe used to detect cel-miR-39 is shown in SEQ ID NO:

26.

4. The composition according to claim 3, wherein, The probe is modified with a labeling group, preferably a fluorescent labeling group.

5. A reagent kit, characterized in that, The kit comprises the composition for detecting EB virus-associated nucleic acid markers as described in any one of claims 1-4.

6. The kit according to claim 5, wherein, The kit also contains buffer, enzyme, deoxyribonucleoside triphosphate, RNase inhibitor, and Mg. 2+ At least one of the sources; Preferably, the buffer solution comprises tris(hydroxymethyl)aminomethane hydrochloride buffer solution; Preferably, the enzyme includes at least one of UNG enzyme, DNA polymerase, and reverse transcriptase.

7. The kit according to claim 5 or 6, wherein, The kit also includes a positive control reagent and / or a negative control reagent.

8. The kit according to any one of claims 5-7, wherein, The kit also contains reagents for extracting and / or purifying nucleic acids from samples; And / or, the kit may also contain reagents and / or materials for sample processing.

9. A method for non-diagnostic detection of EB virus-related nucleic acid markers in a sample, characterized in that, The method includes in vitro amplification of the nucleic acid of the sample to be tested using the composition of any one of claims 1-4 or the kit of any one of claims 5-8.

10. The method according to claim 9, wherein, The method includes: (1) Extract and / or purify the nucleic acid of the sample to be tested to obtain the sample nucleic acid; (2) Use the nucleic acid extracted in step (1) as a template for in vitro amplification; Preferably, the method further includes a step of pre-treating the sample to be tested before step (1), preferably the pre-treatment includes the removal of inhibitors present in the sample, more preferably the inhibitors include inhibitors that inhibit the release of EB virus and its related exosomes, and / or inhibitors that inhibit the in vitro amplification of sample nucleic acids.