Application of STAT3 / ZBP1 signaling pathway as drug target in screening anti-ulcerative colitis drugs

Abstract

The application discloses application of a TAT3 / ZBP1 signal path as a drug target in screening of anti-ulcerative colitis drugs, and for the first time discloses that in ulcerative colitis (UC), a transcription factor STAT3 directly combines a ZBP1 gene promoter region and up-regulates expression of ZBP1, and then activates RIPK1 / RIPK3 / MLKL-mediated intestinal epithelial cell necroptosis, and aggravates intestinal inflammation. The STAT3 / ZBP1 signal path is established as an effective target for ulcerative colitis drug screening, and a new screening strategy and evaluation system is provided for development of an ulcerative colitis treatment drug targeting necroptosis.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of the STAT3 / ZBP1 signaling pathway as a drug target in screening drugs for ulcerative colitis. Background Technology

[0002] Ulcerative colitis (UC) is a chronic, relapsing, nonspecific inflammatory bowel disease that primarily affects the colonic mucosa and submucosa, clinically manifesting as abdominal pain, diarrhea, and bloody, mucous stools. The pathogenesis of UC is not fully understood, but it is currently believed to be related to multiple factors, including genetic susceptibility, gut microbiota dysbiosis, immune dysregulation, and impaired intestinal mucosal barrier function. Existing treatments mainly include aminosalicylic acid preparations, glucocorticoids, immunosuppressants, and biologics; however, these treatments suffer from limited efficacy, significant long-term toxic side effects, and a high relapse rate. Therefore, there is an urgent need to develop novel, highly effective, and low-toxicity therapeutic drugs and screening strategies.

[0003] In recent years, necroptosis, as a form of programmed cell necrosis, has received widespread attention for its role in the pathogenesis of colitis (UC). Necrophobic apoptosis, mediated by receptor-interacting protein kinases 1 / 3 (RIPK1 / RIPK3) and mixed lineage kinase domain-like proteins (MLKL), leads to cell membrane rupture, release of cellular contents, and subsequently induces a strong inflammatory response. Studies have shown that aberrant activation of necroptosis exists in the intestinal epithelial cells of UC patients, and inhibiting necroptosis can significantly alleviate experimental colitis.

[0004] Astragalus polysaccharide (APS) is the main active ingredient of the traditional Chinese medicine Astragalus membranaceus. It possesses various pharmacological activities, including immunomodulation, anti-inflammation, antioxidant effects, and intestinal barrier protection, and exhibits low toxicity and good biocompatibility. Previous studies have shown that Astragalus polysaccharide can alleviate DSS (sodium dextran sulfate)-induced ulcerative colitis in mice by regulating intestinal flora and balancing Th17 / Treg homeostasis.

[0005] ZBP1 (Z-DNA binding protein 1) is a key regulatory molecule in the necrotizing apoptosis pathway. It responds to danger signals such as Z-type nucleic acids, initiating the RIPK1 / RIPK3 / MLKL signaling cascade to induce necrotizing apoptosis. While it is known that ZBP1 is upregulated in the intestinal tissue of patients with inflammatory bowel disease (IBD), its upstream transcriptional regulatory mechanisms remain unclear.

[0006] STAT3 (signal transducer and activator of transcription 3) is a core transcription factor in the JAK / STAT signaling pathway, widely involved in biological processes such as inflammation, immunity, and cell survival. Previous studies have shown that STAT3 is abnormally activated in ulcerative colitis (UC), but whether STAT3 directly regulates ZBP1 transcription and thus affects necrotizing apoptosis in intestinal epithelial cells has not been previously reported. Summary of the Invention

[0007] Objective: To overcome the shortcomings of the existing technology, this invention provides the application of the STAT3 / ZBP1 signaling pathway as a drug target in the screening of anti-ulcerative colitis drugs. Inhibiting this signaling pathway can effectively alleviate ulcerative colitis.

[0008] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0009] In a first aspect, the present invention provides the application of the STAT3 / ZBP1 signaling pathway as a drug target in screening anti-ulcerative colitis drugs, characterized in that the STAT3 / ZBP1 signaling pathway is a pathway in which STAT3 acts as a transcription factor to regulate the expression of the ZBP1 gene.

[0010] In some embodiments, the drug treats ulcerative colitis by inhibiting the STAT3 / ZBP1 signaling pathway, thereby inhibiting necrotizing apoptosis of intestinal epithelial cells.

[0011] In some embodiments, the screening method includes screening small molecule compounds or biomacromolecules that can block the binding of STAT3 to the ZBP1 promoter by molecular docking.

[0012] In a second aspect, the present invention provides a method for screening candidate drugs for the treatment and / or prevention of ulcerative colitis, the method comprising: detecting the effect of candidate drugs on the STAT3 / ZBP1 signaling pathway; wherein the STAT3 / ZBP1 signaling pathway is a pathway in which STAT3 acts as a transcription factor to regulate the expression of the ZBP1 gene.

[0013] Furthermore, the detection of the effect of the candidate drug on the STAT3 / ZBP1 signaling pathway includes detecting the effect of the candidate drug on the binding ability of the STAT3 to the promoter region of the ZBP1 gene.

[0014] Furthermore, the effect of the candidate drug on the binding ability of STAT3 to the promoter region of the ZBP1 gene was detected using chromatin immunoprecipitation (ChIP) technology.

[0015] In some embodiments, the candidate drug includes one or more of small molecule compounds, peptides, nucleic acids, and antibodies.

[0016] Thirdly, the present invention provides a kit for screening candidate drugs for the treatment and / or prevention of ulcerative colitis, the kit comprising reagents for detecting the binding ability of STAT3 to the ZBP1 promoter.

[0017] Furthermore, the reagents for detecting the binding ability of STAT3 to the ZBP1 promoter include an anti-STAT3 antibody and ChIP primers for amplifying the ZBP1 promoter region.

[0018] Beneficial effects:

[0019] 1. This invention reveals for the first time the molecular mechanism by which STAT3, as a transcription factor, directly binds to the ZBP1 promoter and transcribes and activates ZBP1, thereby driving necrotizing apoptosis of intestinal epithelial cells, thus improving the theoretical basis for the pathogenesis of UC.

[0020] 2. Based on this new mechanism, a drug screening method targeting the STAT3 / ZBP1 signaling axis is provided, which can efficiently screen candidate drugs that can inhibit necrotizing apoptosis and alleviate UC.

[0021] 3. The corresponding reagent kits are provided, which are easy to operate and provide reliable results, making them suitable for high-throughput drug screening.

[0022] 4. It provides new drug targets (STAT3, ZBP1 and their interaction interface) for the treatment of UC, which has important clinical translational value. Attached Figure Description

[0023] Figure 1 This figure shows the results of the APS anti-ulcerative colitis mechanism screening experiment based on network pharmacology validation in this embodiment of the invention. Figure 1 In the middle A, Venn diagram of the overlapping target points of APS monomer and IBD is shown. Figure 1 Screening results with B as the core target; Figure 1 The figure in C represents the GO enrichment analysis results of APS monomers and overlapping disease targets; Figure 1 The figure in D shows the KEGG enrichment analysis results of APS monomers and overlapping targets of the disease; Figure 1 Figure E shows the molecular docking results of APS with STAT3 and TNF-α.

[0024] Figure 2 This is a ChIP experimental result diagram showing the binding of STAT3 and ZBP1 promoters in an embodiment of the present invention. Among them, Figure 2 A in the diagram represents the predicted STAT3 binding site in the ZBP1 promoter region; Figure 2Figure B shows the results of ChIP-qPCR. *P<0.05, **P<0.01, ***P<0.001.

[0025] Figure 3 The figure shows the experimental results of the effect of STAT3 overexpression reversing APS on ZBP1 protein expression in this embodiment of the invention. *P<0.05, **P<0.01, ***P<0.001.

[0026] Figure 4 This figure shows the experimental results of the inhibitory effect of STAT3 overexpression on APS in reversing necroptosis in an embodiment of the present invention. Wherein, Figure 4 Image A shows the results of PI / Hoechst fluorescence staining; Figure 4 B in the chart represents the LDH release rate statistics; Figure 4 Figure C shows the results of cell necrosis rate detected by 7-AAD flow cytometry. ***P<0.001. Detailed Implementation

[0027] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the present invention or its application or use.

[0028] Unless otherwise specifically stated, the relative arrangement, numerical expressions, and values ​​of the components and steps set forth in these embodiments do not limit the scope of the invention. It should also be understood that, for ease of description, the dimensions of the various parts shown in the drawings are not drawn to actual scale. Techniques, methods, and devices known to those skilled in the art may not be discussed in detail, but where appropriate, such techniques, methods, and devices should be considered part of the specification. In all examples shown and discussed herein, any specific values ​​should be interpreted as merely exemplary and not as limitations. Therefore, other examples of exemplary embodiments may include different values. It should be noted that similar reference numerals and letters in the following figures denote similar items; therefore, once an item is defined in one figure, it need not be further discussed in subsequent figures.

[0029] The present invention will be further described below with reference to the embodiments.

[0030] Example 1: Astragalus polysaccharide targets and binds to STAT3

[0031] 1. Identification of the target sites of Astragalus polysaccharides

[0032] The SMILES structure of 2-(chloromethyl)-4-(4-nitrophenyl)thiazole, a representative monomer of Astragalus polysaccharide, was obtained from the PubChem database (https: / / pubchem.ncbi.nlm.nih.gov / ). This structure was then input into the following eight target prediction databases: SwissTargetPrediction (http: / / swisstargetprediction.ch / ), TargetNET (http: / / targetnet.scbdd.com / ), superPRED (https: / / prediction.charite.de / ), TCMIP (http: / / www.tcmip.cn / ), HERB (http: / / herb.ac.cn / ), SEA (https: / / sea.bkslab.org / ), CTD (https: / / ctdbase.org / ), and STITCH (http: / / stitch.embl.de / ).

[0033] Target gene names returned from various databases were collected, duplicates were removed, and the target names were standardized to official gene symbols using the UniProt database (https: / / www.uniprot.org / ). A total of 280 Astragalus polysaccharide-related targets were obtained.

[0034] 2. Obtaining disease targets for ulcerative colitis

[0035] Using "Ulcerative Colitis" as the keyword, i.e., ulcerative colitis (UC), we searched the following five disease target databases: GeneCards (https: / / www.genecards.org / ), DisGeNET (https: / / www.disgenet.org / ), TTD (https: / / db.idrblab.net / ttd / ), PharmGKB (https: / / www.pharmgkb.org / ), and CTD (https: / / ctdbase.org / ).

[0036] By merging all search results and removing duplicates, 5983 UC-related disease targets were obtained.

[0037] 3. Overlapping target screening

[0038] 280 Astragalus polysaccharide-related targets and 5983 UC-related disease targets were imported into the Venny2.1 online platform (https: / / bioinfogp.cnb.csic.es / tools / venny / ), and the intersection was taken. For example... Figure 1 As shown in Figure A, there are 214 overlapping targets, which are potential candidate targets for the treatment of UC by Astragalus polysaccharide.

[0039] 4. Construction of protein-protein interaction (PPI) network and screening of core targets

[0040] The 214 overlapping target points were imported into the STRING database (https: / / string-db.org / ), with the species set to "Homo sapiens," the minimum interaction confidence threshold set to 0.400, isolated nodes hidden, and a PPI network constructed. Subsequently, the PPI network data was imported into Cytoscape 3.10.1 software, and the "Analyze Network" plugin was used to calculate the betweenness centrality, closeness centrality, and degree centrality of each node. Figure 1 As shown in Figure B, the top 10 core targets by degree centrality were selected in descending order: TNF, STAT3, CASP3, EGFR, ESR1, NFKB1, PTGS2, GSK3B, ERBB2, and MTOR.

[0041] 5. GO functional enrichment analysis and KEGG signaling pathway enrichment analysis

[0042] Gene Ontology (GO) enrichment analysis was performed on 214 overlapping targets using the R language's clusterProfiler package (version 4.0.0). The species was set to "hsa", and a p-value < 0.05 after correction was used as the significance threshold. Figure 1 As shown in Figure C, the main targets of Astragalus polysaccharides are enriched in biological processes such as the regulation of inflammatory response and the regulation of transcription factor activity.

[0043] KEGG pathway enrichment analysis was performed on 214 overlapping targets using the clusterProfiler package. Figure 1As shown in Figure D, the targets of Astragalus polysaccharides are significantly enriched in inflammation-related pathways such as apoptosis, necroptosis, TNF signaling pathway, and IL-17 signaling pathway.

[0044] 6. Molecular docking verification

[0045] The three-dimensional crystal structures of the core targets TNF (PDB ID: 2AZ5) and STAT3 (PDB ID: 6NUQ) were downloaded from the RCSB PDB database. The three-dimensional structure (SDF format) of 2-(chloromethyl)-4-(4-nitrophenyl)thiazole, a representative monomer of Astragalus polysaccharide, was downloaded from PubChem. The ligands and receptors were converted to PDBQT format using OpenBabel software, hydrogen atoms were added, and Gasteiger charges were calculated.

[0046] like Figure 1 As shown in Figure E, molecular docking was performed using AutoDock Vina 1.2.0 software. The center coordinates of the docking box were set according to the active site of the target, and the box size was set to 20 Å × 20 Å × 20 Å. After docking calculation, the conformation with the lowest binding energy was extracted as the optimal binding mode.

[0047] Calculation results: The binding energy between Astragalus polysaccharide monomers and STAT3 protein is -6.3 kcal / mol (less than -5 kcal / mol), indicating good binding activity; the binding energy with TNF protein is -4.8 kcal / mol (greater than -5 kcal / mol), indicating weaker binding activity. These results suggest that STAT3 may be a more direct target of Astragalus polysaccharides.

[0048] 7. Result Determination

[0049] The above network pharmacology analysis preliminarily revealed that the potential core target of Astragalus polysaccharide in treating UC is STAT3, which mainly involves the regulation of inflammatory response and necrosis-apoptosis pathway. The results of this analysis provide direction for the ChIP experiment and cell necrosis-apoptosis model verification in subsequent embodiments of this invention.

[0050] Example 2: Verification of the binding of STAT3 to the ZBP1 promoter

[0051] Experimental materials: HT29 human colonic epithelial cell line (purchased from the Cell Bank of the Chinese Academy of Sciences), mouse anti-human / mouse STAT3 monoclonal antibody (purchased from CST, catalog number 9139), mouse IgG (purchased from Shanghai Beyotime Biotechnology Co., Ltd., catalog number A7028), BeyoChIP TMChIP Assay Kit (protein A / G magnetic beads, purchased from Beyotime Biotechnology Co., Ltd., catalog number P2080S), protease inhibitor mixture (purchased from Beyotime Biotechnology Co., Ltd., catalog number P1005), SDS lysis buffer (purchased from Beyotime Biotechnology Co., Ltd., catalog number P0013G), glycine solution (purchased from Beyotime Biotechnology Co., Ltd., catalog number P2080S-2), proteinase K (purchased from Beyotime Biotechnology Co., Ltd., catalog number ST532).

[0052] Experimental methods:

[0053] 1. Culture HT29 cells in a culture dish until the density is approximately 80%.

[0054] 2. Prepare 50 mL of ice-cold PBS, add the mixture of protease and phosphatase inhibitor, and dilute the 100X protease and phosphatase inhibitor to 1X.

[0055] 3. Add 37% formaldehyde to a large dish and mix gently until the final formaldehyde concentration is 1%. Then incubate at 37°C for 10 minutes to crosslink the target protein and the corresponding genomic DNA.

[0056] 4. Add 1.1 mL of glycine solution (10X) and mix gently. Incubate at room temperature for 5 minutes. Place the culture dish containing the cell sample on an ice bath. Aspirate all the culture medium containing formaldehyde and glycine, ensuring as little liquid as possible remains.

[0057] 5. Add 5 mL of ice-cold PBS containing protease inhibitors to wash the cells, aspirate the liquid thoroughly, and try to remove all liquid residue. Add another 5 mL of ice-cold PBS containing protease inhibitors to wash the cells further, aspirate the liquid thoroughly, and try to remove all liquid residue.

[0058] 6. Add 1 mL of ice-cold PBS containing protease inhibitors. Use a cell scraper or shovel to scrape off the cells and collect them into a centrifuge tube, ensuring a cell count of 1 × 10⁻⁶. 7 .

[0059] Centrifuge at 7.4℃, 1000g, for 2 minutes to fully precipitate the cells. If insufficient precipitation is observed, extend the centrifugation time. Aspirate the supernatant to minimize liquid residue.

[0060] 8. Preparation of SDS lysis buffer containing protease inhibitors: First, incubate the SDS lysis buffer in a suitable temperature bath to fully dissolve any SDS that may precipitate, and mix thoroughly. Then, add 100× of the protease and phosphatase inhibitor mixture to dilute it to a working concentration of 1×. Finally, resuspend the cell pellet collected in the previous step in 0.2 mL of the prepared inhibitor-containing SDS lysis buffer.

[0061] 9. Incubate on ice for 10 minutes to fully lyse the cells.

[0062] 10. Sonication is used to shear the genomic DNA, breaking it down into fragments of 200-1000 bp in size. During sonication, the sample should be kept in an ice bath. The sonication conditions are set as follows: 10 seconds of sonication followed by a 10-second pause, for a total of 20 cycles. The actual power is 10-40 W, using a 2-3 mm sonication head.

[0063] 11. Centrifuge the ultrasonically treated sample at 12000 g for 5 min at 4℃. Transfer the supernatant (approximately 0.2 mL) to a 2 mL centrifuge tube and place it in an ice bath.

[0064] 12. Prepare 2.0 mL of ChIP Dilution Buffer containing protease inhibitors. Add 1.8 mL of ChIP Dilution Buffer containing protease inhibitors to dilute the sonicated sample to a final volume of 2 mL, which is the whole cell lysis buffer.

[0065] 13. Take 20 µL (1%) of whole-cell lysis buffer for subsequent detection. Add 50 µL of Protein A / G magnetic beads to the remaining whole-cell lysis buffer and slowly rotate at 4°C for 30 minutes. The purpose is to reduce non-specific binding between the Protein A / G magnetic beads and the target protein or target DNA sequence. Then place on a magnetic rack for 10 seconds to separate, and transfer the supernatant to a new 2 mL centrifuge tube.

[0066] 14. Add 1 µg of primary antibody to the sample and mix slowly by rotating or shaking at 4°C overnight or for at least 4 hours. Use normal IgG (mouse IgG) as a negative control.

[0067] 15. Add 80 µL of Protein A / G Magnetic Beads and mix slowly by rotating or swaying at 4°C for 60 minutes to precipitate the protein complex recognized by the primary antibody.

[0068] 16. Place the beads on a magnetic rack for 10 seconds to separate, then remove the supernatant, being careful not to touch the magnetic beads. Wash the magnetic beads sequentially with the following solutions: ① Wash once with low-salt wash buffer. ② Wash once with high-salt wash buffer. ③ Wash once with LiCl wash buffer. ④ Wash twice with Tris-EDTA wash buffer. Use 1 mL of wash buffer each time, and wash slowly at 4°C by rotating or agitating for 3-5 minutes each time. Then place the beads on a magnetic rack for 10 seconds to separate, carefully removing the supernatant, being careful not to touch the magnetic beads.

[0069] 17. Prepare an appropriate amount of fresh elution buffer.

[0070] 18. Add 250 µL of elution buffer. Vortex to mix, and continue eluting for 3-5 minutes at room temperature by rotating or shaking.

[0071] 19. Place on a magnetic rack and separate for 10 seconds. Transfer the supernatant to a new centrifuge tube. Add 250 µL of elution buffer to the precipitate. Vortex to mix and continue eluting at room temperature by rotating or shaking for 3-5 minutes.

[0072] 20. Place on a magnetic rack for 10 seconds to separate, then remove the supernatant. Combine with the supernatant obtained in step 19, for a total of approximately 500 µL of supernatant.

[0073] 21. Add 20 µL of 5 M NaCl to 500 µL of supernatant and mix well. Heat at 65°C for 4 hours to remove cross-links between proteins and genomic DNA. For a 20 µL whole-cell lysate sample, add 1 µL of 5 M NaCl, mix well, and heat at 65°C for 4 hours, similarly to remove cross-links between proteins and genomic DNA.

[0074] 22. Add 10 µL of 0.5 M EDTA, 20 µL of 1 M Tris (pH 6.5), and 2 µL of 20 mg / mL proteinase K to approximately 520 µL of sample. Mix well and incubate at 45°C for 60 minutes.

[0075] 23. Add 550 µL of Tris to balance the phenol, vortex vigorously to mix, then centrifuge at 12,000 g for 5 min at 4 °C. Transfer approximately 500 µL of the supernatant to another centrifuge tube.

[0076] 24. Add 500 µL of chloroform, vortex vigorously to mix, then centrifuge at 12000 g for 5 min at 4 °C. Transfer the supernatant to another centrifuge tube.

[0077] 25. Add 20 µg of glycogen, 50 µL of 3M NaAc (pH 5.2), and then 1.25 mL of anhydrous ethanol. Mix well and precipitate at -70°C for at least 1 hour, or at -20°C for at least 8 hours.

[0078] Centrifuge at 26.4℃, 12000 g for 10 min, carefully aspirate most of the supernatant, and do not touch the precipitate.

[0079] 27. Add approximately 1 mL of 70% ethanol to wash the precipitate. Centrifuge at 12000-14000 g for 10 minutes at 4°C, carefully aspirate most of the supernatant, and avoid contact with the precipitate.

[0080] Centrifuge at 28.4℃, 12000 g for 1 min, and very carefully remove any residual liquid.

[0081] 29. Resuspend the DNA precipitate with ddH2O for PCR detection of the target gene.

[0082] 30. Based on the ZBP1 promoter sequence in the NCBI database, predict the STAT3 binding site using the JASPAR website: Site 1: CTTCCAGGAAA (SEQ ID NO.1); Site 2: AAGCAGGAAAA (SEQ ID NO.2); Site 3: ATGACAGAAAC (SEQ ID NO.3).

[0083] like Figure 2 As shown in Figure A, ChIP-qPCR primers were designed using these three high-scoring sites. The primer sequences are as follows: Forward primer for site 1: GAAACAGCTGGAATCTGACTCCT (SEQ ID NO.4), reverse primer: GCCTTGTCCTGCATCATCCTTTA (SEQ ID NO.5); Forward primer for site 2: ATTGACTTGCCCCAGACTTACTG (SEQ ID NO.6), reverse primer: CCAGACTAGTCAACTCCAACCTC (SEQ ID NO.7). Forward primer for site 3: CTGAGAGGTGGGAGGATCGCTG (SEQ ID NO.8), reverse primer: GGGCTGGGGCTGGTTATCTGG (SEQ ID NO.9).

[0084] 31. Using purified DNA as a template, perform qPCR and calculate the enrichment factor of each primer amplification signal relative to the whole cell lysate.

[0085] (1) Samples were prepared on ice and divided into whole cell lysis buffer group (whole cell lysis buffer), IgG group (IgG) and experimental group (STAT3).

[0086] (2) Add samples according to the following table:

[0087] Table 1. Reagents and Dosage

[0088] (3) Adjust the PCR conditions according to the table below:

[0089] Table 2 PCR conditions

[0090] 32. Agarose gel electrophoresis

[0091] (1) Rubber preparation

[0092] ① Add 0.6 g agarose to 40 mL TAE buffer and shake the conical flask to mix.

[0093] ②In the microwave oven on high temperature mode, boil 3 times, pausing for a few seconds when boiling is observed.

[0094] ③ Cool to room temperature to about 50°C, then add 4 µL of Gel-Red dye.

[0095] ④ Pour the agarose gel into the mold at room temperature and let it solidify for 30 minutes.

[0096] (2) Sample loading

[0097] Slowly remove the comb and transfer the agarose gel to a horizontal electrophoresis tank filled with fresh TAE buffer. Load the samples in the following order: whole cell lysis buffer group / IgG group / experimental group. Load 5 µL of whole cell lysis buffer group, 10 µL of IgG group and experimental group, and 4 µL of DNA molecular weight marker.

[0098] (3) Electrophoresis

[0099] Set a constant voltage of 100 V, and stop electrophoresis when the bands reach the lower third of the gel, which takes about 30 minutes.

[0100] (4) Development

[0101] Place the gel in the center of the Bio-Rad developer and adjust the appropriate parameters to take a picture.

[0102] Experimental results:

[0103] like Figure 2As shown in Figure B, compared with the IgG control, the DNA immunoprecipitated with anti-STAT3 antibody was significantly enriched at two predicted sites in the ZBP1 promoter (site 1: -2467 bp to -2457 bp; site 2: -1995 bp to -1985 bp), indicating that STAT3 directly binds to the ZBP1 promoter region.

[0104] Example 3: Effect of STAT3 overexpression reversing the effect of Astragalus polysaccharide on ZBP1 protein expression

[0105] Experimental materials: plv3-STAT3 overexpression plasmid (purchased from Miaoling Plasmid Platform, China, catalog number #P88614), empty vector control (purchased from Miaoling Plasmid Platform, China, catalog number #P75957), Lipofectamine 2000 (Lipofectamine 2000, purchased from Invitrogen, USA), STAT3 primary antibody (mouse anti-human / mouse STAT3 monoclonal antibody, CST, catalog number: #9139), ZBP-1 primary antibody (rabbit anti-human / mouse ZBP-1 dopone antibody, Proteintech, catalog number: 13285-1-AP), GAPDH primary antibody (mouse anti-human / mouse GAPDH monoclonal antibody, Proteintech, catalog number: #60004-1-Ig). Astragalus polysaccharide (APS, #A689980, purchased from Macklin, China, CAS number 89250-26-0, purity ≥90%).

[0106] Experimental methods:

[0107] (1) Cell culture and treatment: Human colon adenocarcinoma cell line HT29 was cultured in DMEM medium containing 10% FBS. Necrotic apoptosis model was induced by TSZ (TNF-α, SMAC mimic, Z-VAD-FMK). Cells were divided into control group (CON), TSZ group (TSZ), TSZ+APS group (TSZ+APS), and TSZ+APS+plv3-STAT3 overexpression group (TSZ+APS+plv3-STAT3).

[0108] (2) HT29 cells were seeded into 6-well plates and cultured until 70% confluence.

[0109] (3) In a sterile EP tube, use 250 µL of Opti-MEM ® Dilute 2 µg of plasmid in serum-free medium. Mix gently.

[0110] (4) In another EP tube, use 250 µL of Opti-MEM ®Dilute 5.0 µL of Lipofectamine 2000 (liposome 2000) with serum-free medium. Mix gently and incubate at room temperature for 5 minutes.

[0111] (5) Gently mix the two diluents and let stand at room temperature for 20 minutes to form a transfection complex.

[0112] (6) Add 500 µL of the transfection complex dropwise to the cell culture wells that have been replaced with fresh antibiotic-free complete culture medium. Gently shake the culture plate to mix.

[0113] (7) Place the transfected HT29 cells back into a 37°C, 5% CO2 incubator and incubate for 24 hours.

[0114] (8) Replace with a culture medium containing 0.1% TSZ and incubate for 12 h.

[0115] (9) Remove the supernatant and wash the cells with PBS.

[0116] (10) Add total cell protein extraction lysis buffer to a 6-well plate at 100 µL / well, shake well and place on ice for 10 min to lyse. Collect the lysate into a 1.5 mL centrifuge tube using a cell scraper and pipette and place on ice.

[0117] (11) Ultrasonic fragmentation for 1 min (ultrasonic 3 s, pause 3 s).

[0118] (12) After sonication, centrifuge at 12000 g, 4℃ for 10-15 min. The resulting supernatant is the total cell protein. Label the name and date.

[0119] (13) Take the supernatant to determine the protein concentration, and transfer the remaining supernatant (80 µL) into a new 1.5 mL centrifuge tube, add 20 µL of 5×SDS protein loading buffer, and dilute the final concentration to 1×.

[0120] (14) Metal bath, 95℃, 5 min, to denature the sample.

[0121] (15) 12000 g, 4℃, centrifuge for 5-10 min, and place on ice for later use.

[0122] (16) Gel preparation:

[0123] ① Clean the glass plate with ddH2O, spin dry, align and insert it into the glue clamp, and check for any leakage.

[0124] ② Prepare a 10% separating gel, add a modified coagulant, shake to mix, pour into a glass plate, press with 1 mL of anhydrous ethanol, and let stand at room temperature for 15-20 min.

[0125] ③ Discard the anhydrous ethanol and absorb the remaining liquid.

[0126] ④ Prepare a 10% concentrated gel, add the improved accelerator and shake to mix well, pour into a glass plate, slowly insert a comb to avoid generating air bubbles, and let stand at room temperature for 10 minutes.

[0127] (17) Electrophoresis:

[0128] ① Add the protein sample using a pipette with an appropriate volume according to the sample loading volume, and add 3-5 μL of color-prestained protein molecular markers on both sides.

[0129] ② Slowly inject the electrophoresis solution into the electrophoresis tank at 100 V for 20 min.

[0130] ③ After bromophenol blue enters the separating gel, run at 150 V for 50 min. Stop electrophoresis once it reaches the bottom.

[0131] (18) Transfer: The experiment was completed using the Bio-Rad wet transfer system.

[0132] ① Cut the PVDF membrane into 5×8 cm pieces and activate it in anhydrous methanol.

[0133] ② Equilibrate the transfer clamp, sponge, filter paper, separating gel, and PVDF membrane with transfer buffer. Place the components in the following order: transfer clamp (black side), sponge, 3 layers of filter paper, protein gel, PVDF membrane, 3 layers of filter paper, sponge, and transfer clamp (transparent side), avoiding air bubbles.

[0134] ③ Place the transfer clamp into the transfer tank, pour in the transfer solution, and then place it in an ice box.

[0135] ④ Transfer conditions: 220 V, 120 min.

[0136] (19) Blocking: After the transfer is complete, take out the PVDF membrane, put it into the blocking solution with the protein side facing up, and incubate it on a shaker at room temperature for 60 min.

[0137] (20) Primary antibody incubation: Discard the blocking solution, remove the PVDF membrane, wash with TBST 3 times, each time for 8-10 min. Cut the membrane according to the molecular weight of the target protein, add the diluted primary antibody, and incubate overnight at 4°C on a shaker for 12-14 h.

[0138] (21) Secondary antibody incubation: The primary antibody was recovered the next day, and the primary antibody was washed with TBST 3 times, each time for 8-10 min. The secondary antibody prepared with TBST was added, and the mixture was incubated on a shaker at room temperature for 1 h, and then washed with TBST 3 times, each time for 8-10 min.

[0139] (22) Development: Add ECL chemiluminescence (reagent A solution: B solution = 1:1) mixture to the PVDF film to completely cover the film, and expose it using a Bio-Rad imager.

[0140] Experimental results:

[0141] like Figure 3 As shown, compared with the blank control group, the expression level of ZBP1 protein in the TSZ-treated group was significantly upregulated; while compared with the TSZ group, the expression of ZBP1 protein in the TSZ + APS treatment group (TSZ+APS group) was significantly downregulated. Further studies showed that STAT3 overexpression could antagonize the above-mentioned effects of APS. These results suggest that in the TSZ-induced programmed necrosis cell model, STAT3 overexpression can reverse the inhibitory effect of APS on ZBP1 protein expression.

[0142] Example 4: Effects of inhibiting the STAT3 / ZBP1 pathway on necrotizing apoptosis and its application in drug screening.

[0143] Experimental materials: Astragalus polysaccharide (APS, #A689980, purchased from Macklin Biotechnology, China, CAS No. 89250-26-0, purity ≥90%). TSZ (TNF-α, SMAC mimic, Z-VAD-FMK; catalog No. C1058S, purchased from Beyotime Biotechnology, Shanghai), plv3-STAT3 overexpression plasmid (purchased from Miaoling Plasmid Platform, China, catalog No. #P88614), empty vector control (purchased from Miaoling Plasmid Platform, China, catalog No. #P75957), propidium iodide (PI) staining kit (catalog No. C1008S, purchased from Beyotime Biotechnology, Shanghai), lactate dehydrogenase (LDH) cytotoxicity assay kit (catalog No. C0016, purchased from Beyotime Biotechnology, Shanghai), 7AAD / Annexin kit (catalog No. 559763, purchased from BD Biosciences, USA), Lipofectamine 2000 (purchased from Invitrogen, USA).

[0144] Experimental methods:

[0145] (1) Cell culture and treatment: Human colon adenocarcinoma cell line HT29 was cultured in DMEM medium containing 10% FBS. Necrotic apoptosis model was induced by TSZ (TNF-α, SMAC mimic, Z-VAD-FMK). Cells were divided into control group (CON), TSZ group (TSZ), TSZ+APS group (TSZ+APS), and TSZ+APS+plv3-STAT3 overexpression group (TSZ+APS+plv3-STAT3).

[0146] (2) HT29 cells were seeded into 6-well plates and cultured until 70% confluence.

[0147] (3) In a sterile EP tube, use 250 µL of Opti-MEM ® Dilute 2 µg of plasmid in serum-free medium. Mix gently.

[0148] (4) In another EP tube, use 250 µL of Opti-MEM ® I. Dilute 5.0 µL of Lipofectamine 2000 with serum-free medium. Mix gently and incubate at room temperature for 5 minutes.

[0149] (5) Gently mix the two diluents and let stand at room temperature for 20 minutes to form a transfection complex.

[0150] (6) Add 500 µL of the transfection complex dropwise to the cell culture wells that have been replaced with fresh antibiotic-free complete culture medium. Gently shake the culture plate to mix.

[0151] (7) Place the transfected HT29 cells back into a 37°C, 5% CO2 incubator and incubate for 24 hours.

[0152] (8) Replace with a culture medium containing 0.1% TSZ and incubate for 12 h.

[0153] (9) PI / Hoechst (propidium iodide / Hoechst) fluorescent staining:

[0154] ① For one well of a 6-well plate, aspirate the culture medium and wash the cells once with PBS.

[0155] ② Add 1 mL of PI staining working solution. Incubate at 37°C for 30 minutes in a cell culture incubator.

[0156] ③After incubation at 37℃, remove the supernatant and wash twice with serum-free culture medium or HBSS.

[0157] ④ Add 2 mL of serum-free culture medium or HBSS and observe under a fluorescence microscope. The maximum excitation wavelength of the complex formed by PI and DNA is 535 nm, and the maximum emission wavelength is 617 nm.

[0158] (10) LDH release detection:

[0159] ① Preparation of INT solution (1X): According to the required amount of INT solution (1X), take an appropriate amount of INT solution (10X) and dilute it to 1X with INT diluent. For example, take 20 μL of INT solution (10X), add 180 μL of INT diluent, mix well and you will have prepared 200 μL of INT solution (1X).

[0160] ② Preparation of LDH detection working solution: Based on the number of samples to be tested (including controls), prepare an appropriate amount of fresh detection working solution just before the test.

[0161] Table 3. Preparation of working solution

[0162] ③ Add 60 μL of LDH detection working solution to each well.

[0163] ④ Mix well and incubate at room temperature (approximately 25°C) in the dark for 30 minutes (you can wrap it in aluminum foil and place it on a horizontal shaker or a side-swing shaker and shake it slowly). Then measure the absorbance at 490 nm.

[0164] ⑤ Calculation (the absorbance of the background blank control well should be subtracted from the absorbance of each group measured).

[0165] ⑥Cytotoxicity or mortality rate (%) = (Absorbance of treated sample - Absorbance of sample control well) / (Absorbance of maximum enzyme activity of cells - Absorbance of sample control well) × 100%.

[0166] (11) Flow cytometry:

[0167] ① Collect the cells to be tested, centrifuge at 1000 rpm for 5 min to obtain cell pellet.

[0168] ② Wash the cells once with PBS and centrifuge at 1000 rpm for 5 min.

[0169] ③ Add 100 μL of 1× binding buffer and resuspend the cells.

[0170] ④ Add 2 μL of Annexin V-PE staining solution (annexin V-phycoerythrin) and mix well, then add 2 μL of 7-AAD and mix well.

[0171] ⑤ Incubate at room temperature in the dark for 20 minutes.

[0172] ⑥ Within 1 hour, the percentage of early apoptotic, late apoptotic, and necrotic cells in the total cell count was determined using flow cytometry. The orange fluorescence of Annexin V-PE was detected via the PE channel (FL2); the red fluorescence of 7-AAD was detected via the 7-AAD channel (FL4).

[0173] ⑦ Cells that are Annexin V- and 7-AAD+ (double-positive) are defined as cells in late apoptosis or necrosis.

[0174] Experimental results:

[0175] like Figure 4As shown, TSZ treatment significantly increased the number of PI-positive cells, LDH release rate, and the proportion of 7-AAD-positive cells (P<0.001 vs. control group). Astragalus polysaccharide treatment significantly reduced these indicators (P<0.01 vs. TSZ group). After STAT3 overexpression, the protective effect of astragalus polysaccharide was significantly weakened (P<0.05 vs. TSZ+APS+empty vector group). These results indicate that STAT3 overexpression reverses the inhibition of necroptosis by astragalus polysaccharide through ZBP1 upregulation. Therefore, detecting whether candidate drugs can block the STAT3 / ZBP1 signaling axis can be an effective method for screening anti-UC drugs.

[0176] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of the STAT3 / ZBP1 signaling pathway as a drug target in screening drugs for ulcerative colitis, characterized in that, The STAT3 / ZBP1 signaling pathway is a pathway in which STAT3 acts as a transcription factor, binds to the promoter region of the ZBP1 gene, and upregulates the expression of the ZBP1 gene. The STAT3 binds to the -2467 bp to -2457 bp region and / or the -1995 bp to -1985 bp region of the ZBP1 gene promoter; The drug treats ulcerative colitis by blocking the STAT3 / ZBP1 signaling pathway, thereby inhibiting necrosis and apoptosis of intestinal epithelial cells.

2. The application according to claim 1, characterized in that, The screening method includes screening small molecule compounds or biomacromolecules that can block the binding of STAT3 to the -2467 bp to -2457 bp region and / or -1995 bp to -1985 bp region of the ZBP1 promoter by molecular docking.

3. A method for screening candidate drugs for the treatment and / or prevention of ulcerative colitis, characterized in that, The method includes: using chromatin immunoprecipitation technology to detect whether candidate drugs can block the STAT3 / ZBP1 signaling pathway; if they can block the STAT3 / ZBP1 signaling pathway, candidate drugs for the treatment and / or prevention of ulcerative colitis are obtained. The STAT3 / ZBP1 signaling pathway is a pathway in which STAT3, as a transcription factor, binds to the -2467 bp to -2457 bp region and / or the -1995 bp to -1985 bp region of the ZBP1 gene promoter and upregulates the expression of the ZBP1 gene.

4. The method according to claim 3, characterized in that, The candidate drugs include one or more of small molecule compounds, peptides, nucleic acids, and antibodies.

5. A kit for screening candidate drugs for the treatment and / or prevention of ulcerative colitis, characterized in that, The kit includes reagents for detecting the binding ability of STAT3 to the -2467 bp to -2457 bp region and / or the -1995 bp to -1985 bp region of the ZBP1 promoter.

6. The reagent kit according to claim 5, characterized in that, The reagents used to detect the binding ability of STAT3 to the -2467 bp to -2457 bp and / or -1995 bp to -1985 bp regions of the ZBP1 promoter include anti-STAT3 antibody and ChIP primers for amplifying the ZBP1 promoter region.

Images