The reagent for regulating expression level of ndrg2 is applied in the preparation of a preparation for treating preeclampsia

Abstract

The present application relates to the field of molecular biology, and particularly relates to application of a reagent for regulating NDRG2 expression level in preparation of a preparation for treating preeclampsia. 6 A methylation modification level; and reducing the expression level of NDRG2. 6 A methylation modification regulates NDRG2 mRNA stability and further promotes the molecular mechanism of NDRG2 expression. 6 A methylation modification regulates NDRG2 mRNA stability and further promotes the molecular mechanism of NDRG2 expression. Based on this mechanism, by regulating the expression level of NDRG2, the present application effectively inhibits the invasion, migration and proliferation of placental trophoblast cells, promotes the expression of apoptosis and inflammatory factors, which provides a new technical means for targeted treatment of preeclampsia.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to the application of a reagent that regulates the expression level of NDRG2 in the preparation of a treatment for preeclampsia. Background Technology

[0002] Hypertensive disorders of pregnancy are the most common complications during pregnancy, generally classified as chronic hypertension, preeclampsia, chronic hypertension complicated by preeclampsia, and gestational hypertension. Hypertensive disorders of pregnancy are a major cause of serious and life-threatening maternal and infant complications. Preeclampsia, in particular, accounts for 2% to 15% of all pregnancies and is a common complication during pregnancy. Preeclampsia is mainly characterized by the first sustained elevation of blood pressure after 20 weeks of gestation, accompanied by proteinuria or generalized edema, and certain forms of hematologic disorders, such as thrombocytopenia, or signs of distal organ damage, including kidney damage, abnormal liver function, pulmonary edema, and brain and visual disturbances. Current treatments for preeclampsia include early differential diagnosis, perinatal blood pressure control and assessment, prenatal aspirin treatment for high-risk women, betamethasone treatment for patients under 34 weeks of gestation, and intravenous magnesium sulfate. However, termination of pregnancy and timely delivery of the fetus and placenta remain the most effective treatment methods to date. This exposes a major shortcoming of current technologies: clinically, besides termination of pregnancy, there is a lack of drugs that can target the core pathogenesis of preeclampsia without termination of pregnancy. Therefore, developing a novel preeclampsia treatment strategy that does not rely on termination of pregnancy has become an urgent technical problem to be solved in this field. Summary of the Invention

[0003] To overcome the shortcomings of existing technologies, this invention aims to provide a new strategy for treating preeclampsia. This invention uses NDRG2 as a therapeutic target and provides biological products that regulate the expression of NDRG2, thus providing a new means for the diagnosis and treatment of preeclampsia.

[0004] To achieve the above objectives, this invention provides the application of a reagent for regulating NDRG2 expression levels in the preparation of a preeclampsia treatment agent, wherein regulating NDRG2 expression levels refers to at least one of the following: 1) Increase the m of NDRG2 mRNA 6 A. Methylation modification level; 2) Reduce the expression level of NDRG2.

[0005] Preferably, the reagent refers to at least one of the following: A. Any one of the shRNAs shown in SEQ ID NO.2 to SEQ ID NO.4; B. Interfering adenovirus of NDRG2; C, IGF2BP1 interfering RNA.

[0006] Preferably, the reagent further includes a lentiviral venom capable of expressing the shRNA in A.

[0007] Preferably, the sequence used to prepare the NDRG2 interfering adenovirus is any one of SEQ ID NO.5 to SEQ ID NO.8.

[0008] Preferably, the sequence of the interfering RNA of IGF2BP1 is any one of the sequences shown in SEQ ID NO.9 to SEQ ID NO.12.

[0009] Preferably, the preeclampsia treatment formulation further includes pharmaceutically acceptable excipients.

[0010] Preferably, the excipients include at least one of a protective agent, a buffer, and a surfactant.

[0011] Preferably, the protective agent includes at least one of sucrose, mannitol, and PEG.

[0012] Preferably, the buffer comprises at least one of Tris-HCl, HEPES, and PBS.

[0013] Preferably, the surfactant includes at least one of polysorbate 80 and F-68.

[0014] Preferably, the dosage form of the preeclampsia treatment preparation is an injection.

[0015] The beneficial effects of this invention are: This invention provides the application of a reagent for regulating NDRG2 expression levels in the preparation of a treatment for preeclampsia. Regulating NDRG2 expression levels refers to at least one of the following: 1) increasing the mRNA expression of NDRG2. 6 A) Methylation modification level; 2) Reduced NDRG2 expression level. This invention is the first to use the NDRG2 gene as a therapeutic target for preeclampsia and reveals m 6 A-methyl reading protein IGF2BP1 via m 6 A-methylation modification regulates NDRG2 mRNA stability, thereby promoting NDRG2 expression. Based on this mechanism, this invention provides a method targeting the NDRG2 gene to enhance NDRG2 mRNA stability. 6 Treatment of preeclampsia involves reducing A-methylation levels or lowering NDRG2 expression levels. Both strategies effectively inhibit the invasion, migration, and proliferation of placental trophoblasts while promoting apoptosis and the expression of inflammatory factors, thereby reversing the core pathological processes of preeclampsia.

[0016] This invention provides the first m-based method for treating preeclampsia. 6 A. Targeted therapeutic strategies for epigenetic transcriptional regulation; on the other hand, the constructed gene intervention agents possess clear sequence information and verifiable biological functions, demonstrating direct clinical translational potential. This invention fills a gap in the field of... 6 A modification fills a research gap in the field of regulation of trophoblast function in preeclampsia. Attached Figure Description

[0017] Figure 1 Total m in placental tissue and trophoblasts in preeclampsia 6 Changes in modification level A; where A represents the m-level of RNA in preeclamptic placental tissue detected by liquid chromatography-tandem mass spectrometry (LC-MS / MS). 6 A is the level of modification; B is EpiQuik m 6 A quantitative RNA methylation detection kit was used to detect m-methylation in RNA from placental tissue in preeclampsia. 6 A represents the modification level; C represents the m-level in placental tissue RNA detected by dot blot hybridization. 6 A represents the modification level; D represents the total m in the three feeder cell lines as detected by LC-MS / MS. 6 A is the level of modification; E is EpiQuikm. 6 A quantitative RNA methylation detection kit (colorimetric method) was used to detect total mRNA in three trophoblast cell lines. 6 A represents the level of modification; in the figure, Normal represents the normal group, Preeclampsia represents the preeclampsia group, Normoxia represents the normoxic group, and Hypoxia represents the hypoxic group; ** indicates P <0.01, *** indicates P <0.001.

[0018] Figure 2 m in placental mRNA in preeclampsia 6 The overall pattern of A modification; where A represents the number of common and unique peaks in placental tissues of normal and preeclampsia women; B represents the number of common and unique genes in placental tissues of normal and preeclampsia women; C and D represent the number of m genes in placental tissues of the Normal and Preeclampsia groups. 6 A. Schematic diagram of modification sites; E. All identified m in the two groups of placental tissues. 6 Distribution of peak A; F and G represent the m values ​​in placental tissue of the Normal and Preeclampsia groups, respectively. 6 A represents the distribution of modified peaks on gene functional elements; H is a volcano plot showing the differences in placental tissue between normal and preeclamptic women. 6The number of peaks modified by A, where blue represents m. 6 A modifies the lowered peak level, and red indicates m. 6 A modifies the peak that is raised in level.

[0019] Figure 3 mRNA in placental tissue during preeclampsia 6 A. Correlation analysis between modification level and transcription level; where A is a volcano plot showing the number of differentially expressed genes in placental tissues of normal and preeclamptic women, with blue dots indicating downregulated differentially expressed genes and red dots indicating upregulated differentially expressed genes; B is a four-quadrant plot showing m in placental tissues of the two groups. 6 A shows the distribution of genes with significant differences in both level and mRNA expression; C is a Veen plot showing genes with overlapping expression in meRIP-seq and RNA-seq in the two groups of placental tissues, while a cluster heatmap shows the differential expression of 81 genes; D is GO analysis of differentially expressed genes shared by meRIP-seq and RNA-seq; E is KEGG enrichment analysis of differentially expressed genes shared by meRIP-seq and RNA-seq.

[0020] Figure 4 This is for the validation of genes of interest (sites) based on meRIP-qPCR; where A represents the m-sites of five gene-specific target genes (GALNT3, HMGB3, LMCD1, NDRG2, THOP1) in preeclamptic placental tissue detected by meRIP-qPCR. 6 A. Modification level; B. IGV analysis showing NDRG2 at m 6 A represents the enrichment of the binding motif region; C represents the detection of NDRG2 in three feeder cell lines (HTR-8 / SVneo, Bewo, and JEG-3) by MeRIP-qPCR. 6 A indicates the level of modification; ** indicates the level of modification. P <0.01.

[0021] Figure 5 Figure 1 shows the expression of NDRG2 in preeclamptic placental tissue and trophoblast cells; A represents the mRNA level of NDRG2 in preeclamptic placental tissue detected by qRT-PCR; B represents the protein expression level of NDRG2 in preeclamptic placental tissue detected by Western blot; C represents the statistical results of Figure B; D represents the Western blot results of NDRG2 in three trophoblast cell lines (HTR-8 / SVneo, Bewo, and JEG-3); E represents the qRT-PCR results of NDRG2 in the three trophoblast cell lines; F represents the statistical results of Figure D; * indicates... P <0.05, ** indicates P <0.01.

[0022] Figure 6 This study describes the construction of stable cell lines for NDRG2 overexpression and knockdown. A shows the NDRG2 mRNA expression level in HTR-8 / SVneo cells after qRT-PCR transfection with NDRG2-overexpressing lentivirus (Lv-NDRG2) and its control lentivirus (Lv-GFP); B shows the NDRG2 protein expression level and its statistical graph in HTR-8 / SVneo cells after transfection with NDRG2-overexpressing lentivirus (Lv-NDRG2) and its control lentivirus (Lv-GFP); C shows the NDRG2 mRNA expression level in HTR-8 / SVneo cells after qRT-PCR transfection with NDRG2-interfering lentivirus (sh-NDRG2) and its control lentivirus (sh-NC); and D shows the Western blot analysis of NDRG2 expression. blot analysis of NDRG2 protein expression levels and statistical graphs in HTR-8 / SVneo cells after transfection with interfering NDRG2 lentivirus (sh-NDRG2) and its control lentivirus (sh-NC); E shows the NDRG2 mRNA expression level in Bewo cells after qRT-PCR transfection with overexpressing NDRG2 lentivirus (Lv-NDRG2) and its control lentivirus (Lv-GFP); F shows the NDRG2 protein expression level and statistical graphs in Bewo cells after transfection with overexpressing NDRG2 lentivirus (Lv-NDRG2) and its control lentivirus (Lv-GFP); G shows the NDRG2 mRNA expression level in Bewo cells after qRT-PCR transfection with interfering NDRG2 lentivirus (sh-NDRG2) and its control lentivirus (sh-NC); H shows the Western blot analysis of NDRG2 protein expression levels and statistical graphs in Bewo cells after transfection with interfering NDRG2 lentivirus (sh-NDRG2) and its control lentivirus (sh-NC); The following graphs show the expression levels of NDRG2 protein in Bewo cells after transfection with interfering NDRG2 lentivirus (sh-NDRG2) and its control lentivirus (sh-NC) using blot analysis; I represents the NDRG2 mRNA expression level in JEG-3 cells after transfection with overexpressing NDRG2 lentivirus (Lv-NDRG2) and its control lentivirus (Lv-GFP) using qRT-PCR; J represents the NDRG2 protein expression level in JEG-3 cells after transfection with overexpressing NDRG2 lentivirus (Lv-NDRG2) and its control lentivirus (Lv-GFP) using Western blot analysis; K represents the NDRG2 mRNA expression level in JEG-3 cells after transfection with interfering NDRG2 lentivirus (sh-NDRG2) and its control lentivirus (sh-NC) using qRT-PCR; and L represents the NDRG2 protein expression level in JEG-3 cells after transfection with interfering NDRG2 lentivirus (sh-NDRG2) and its control lentivirus (sh-NC) using Western blot analysis.

[0023] Figure 7 The effects of NDRG2 on the invasive ability of placental trophoblasts are shown in Figure A. Figure A shows the changes in the invasive ability of HTR-8 / SVneo, Bewo, and JEG-3 cells after transfection with NDRG2-overexpressing lentivirus (Lv-NDRG2) and NDRG2-interfering lentivirus (sh-NDRG2) as detected by Transwell assays (scale bar = 200 µm). Figure B shows the number of invasive cells in HTR-8 / SVneo cells. Figure C shows the number of invasive cells in Bewo cells. Figure D shows the number of invasive cells in JEG-3 cells. * indicates... P <0.05, ** indicates P <0.01.

[0024] Figure 8 The effects of NDRG2 on the migration ability of placental trophoblasts are shown in Figure A, which depicts changes in the migration ability of HTR-8 / SVneo, Bewo, and JEG-3 cells after transfection with NDRG2-overexpressing lentivirus (Lv-NDRG2) and NDRG2-interfering lentivirus (sh-NDRG2) in a wound healing assay (scale bar = 200 µm); Figure B shows the cell migration rate in HTR-8 / SVneo cells; Figure C shows the cell migration rate in Bewo cells; and Figure D shows the cell migration rate in JEG-3 cells. * indicates... P <0.05, ** indicates P <0.01.

[0025] Figure 9 The effect of NDRG2 on placental trophoblast apoptosis; where A is the flow cytometry-based detection of apoptosis in HTR-8 / SVneo, Bewo, and JEG-3 cells after transfection with NDRG2-overexpressing lentivirus (Lv-NDRG2) and NDRG2-interfering lentivirus (sh-NDRG2), respectively; B is a statistical graph of apoptosis in HTR-8 / SVneo cells; C is a statistical graph of apoptosis in Bewo cells; D is a statistical graph of apoptosis in JEG-3 cells; * indicates P <0.05, ** indicates P <0.01.

[0026] Figure 10The study investigated the effect of NDRG2 on the proliferation of placental trophoblast cells. A showed the changes in HTR-8 / SVneo cells after transfection with NDRG2-overexpressing lentivirus (Lv-NDRG2) and NDRG2-interfering lentivirus (sh-NDRG2), respectively, as measured by CCK-8 assay. B showed the changes in Bewo cells after transfection with NDRG2-overexpressing lentivirus (Lv-NDRG2) and NDRG2-interfering lentivirus (sh-NDRG2), respectively, as measured by CCK-8 assay. C showed the changes in JEG-3 cells after transfection with NDRG2-overexpressing lentivirus (Lv-NDRG2) and NDRG2-interfering lentivirus (sh-NDRG2), respectively, as measured by CCK-8 assay. * indicates... P <0.05, ** indicates P <0.01.

[0027] Figure 11 The study investigated the effects of NDRG2 on the expression of inflammatory factors in placental trophoblast cells. A showed the mRNA expression of IL-1β in trophoblast cells transfected with NDRG2-overexpressing lentivirus (Lv-NDRG2) using qRT-PCR; B showed the mRNA expression of IL-1β in trophoblast cells transfected with NDRG2-interfering lentivirus (sh-NDRG2) using qRT-PCR; C showed the mRNA expression of IL-6 in trophoblast cells transfected with NDRG2-overexpressing lentivirus (Lv-NDRG2) using qRT-PCR; and D showed the mRNA expression of IL-6 in trophoblast cells transfected with NDRG2-interfering lentivirus (sh-NDRG2) using qRT-PCR. -6 mRNA expression; E: qRT-PCR detection of IL-8 mRNA expression in feeder cells transfected with NDRG2 overexpressing lentivirus (Lv-NDRG2); F: qRT-PCR detection of IL-8 mRNA expression in feeder cells transfected with NDRG2 interfering lentivirus (sh-NDRG2); G: qRT-PCR detection of TNF-α mRNA expression in feeder cells transfected with NDRG2 overexpressing lentivirus (Lv-NDRG2); H: qRT-PCR detection of TNF-α mRNA expression in feeder cells transfected with NDRG2 interfering lentivirus (sh-NDRG2); * indicates P <0.05, ** indicates P <0.01.

[0028] Figure 12The effects of NDRG2 on RUPP pregnant mice, placenta, and fetal development are shown in the following figures: A represents the systolic blood pressure measurements on day 12 (E12) and day 20 (E20) of gestation in RUPP pregnant mice after injection of NDRG2 interfering adenovirus; B represents the 24-hour urinary protein content on day 13 (E13) and day 19 (E19) of gestation in RUPP pregnant mice after injection of NDRG2 interfering adenovirus; C represents the embryo resorption rate after injection of NDRG2 interfering adenovirus in RUPP pregnant mice; D represents the placental wet weight analysis after injection of NDRG2 interfering adenovirus in RUPP pregnant mice; E represents the statistical results of figure D; F represents the newborn fetal weight analysis after injection of NDRG2 interfering adenovirus in RUPP pregnant mice; and G represents the statistical results of figure F. WT indicates RUPP pregnant mice injected with the negative control adenovirus, and KD-NDRG2 indicates RUPP pregnant mice injected with NDRG2 interfering adenovirus. * indicates... P <0.05, ** indicates P <0.01.

[0029] Figure 13 The results show that NDRG2 is associated with clinicopathological features of preeclampsia; A represents the Pearson correlation analysis between NDRG2 and systolic blood pressure in placental tissue; B represents the Pearson correlation analysis between NDRG2 and diastolic blood pressure in placental tissue; C represents the Pearson correlation analysis between NDRG2 and neonatal birth weight in placental tissue; and D represents the Pearson correlation analysis between NDRG2 and BMI in placental tissue.

[0030] Figure 14 For mass spectrometry-based screening of proteins binding to NDRG2: where A is a schematic diagram showing m in the 5′-UTR region targeting NDRG2. 6 Site A shows the design of a probe; B is a silver-stained image showing the protein binding to NDRG2 retrieved from feeder cells after RNA-pull down; C is a Veen image showing the use of an NC probe and m in the 5′-UTR region targeting NDRG2. 6 A shows the number of overlapping proteins in the probe dropdown list, with the top 10 proteins listed in red dashed boxes. D is a three-line table listing the score and sequence coverage information of the top 10 proteins. The score is the score given by the database search software for matching the corresponding proteins, and the sequence coverage refers to the proportion of amino acid sequences covered by all peptides to the entire protein sequence. E shows the protein expression of IGF2BP1 and IGF2BP3 in HTR-8 / SVneo cells after RNA-pulldown. F shows the enrichment of NDRG2 after IGF2BP1 and IGF2BP3 in three feeder cell lines (HTR-8 / SVneo, Bewo, and JEG-3) using RNA-binding protein immunoprecipitation (RIP). * indicates the enrichment of NDRG2 after IGF2BP1 and IGF2BP3 in the dropdown list.P <0.05, ** indicates P <0.01.

[0031] Figure 15 The table shows the expression of IGF2BP1 in preeclamptic placental tissue and trophoblast cells. A represents the mRNA expression level of IGF2BP1 in preeclamptic placental tissue detected by qRT-PCR; B represents the protein expression level of IGF2BP1 in preeclamptic placental tissue detected by Western blot; C represents the protein expression level of IGF2BP1 in three trophoblast cell lines (HTR-8 / SVneo, Bewo, and JEG-3) detected by Western blot; D is a statistical graph of the Western blot results; and E represents the mRNA expression level of IGF2BP1 in the three trophoblast cell lines (HTR-8 / SVneo, Bewo, and JEG-3) detected by qRT-PCR. * indicates... P <0.05, ** indicates P <0.01.

[0032] Figure 16 The effects of IGF2BP1 on NDRG2 mRNA stability and expression are shown in Figure A, where Pearson correlation analysis reveals the correlation between IGF2BP1 and NDRG2 expression; and Figure B shows the effect of luciferase assay on the expression of IGF2BP1 interfering RNA and NDRG2 mRNA rich in the 5′-UTR region. 6 Wild-type (NDRG2-WT) and m modified sequences 6 A. Luciferase activity of NDRG2 after co-transfection of 293T cells with the mutant plasmid (NDRG2-Mut) at site A; C. Protein expression level of NDRG2 in three feeder cell lines (HTR-8 / SVneo, Bewo, JEG-3) after IGF2BP1 interference detected by Western blot; D. Western blot statistical graph; E. NDRG2 mRNA expression level in three feeder cell lines (HTR-8 / SVneo, Bewo, JEG-3) after IGF2BP1 interference detected by qRT-PCR; F. Efficiency of NDRG2 mRNA transcription in HTR-8 / SVneo cells after IGF2BP1 interference and treatment with actinomycin D for different time periods; G. Efficiency of NDRG2 mRNA transcription in Bewo cells after IGF2BP1 interference and treatment with actinomycin D for different time periods; H. Efficiency of NDRG2 mRNA transcription in Bewo cells after IGF2BP1 interference and treatment with actinomycin D. D) Detect the efficiency of NDRG2 mRNA transcription in JEG-3 cells after different treatment times. * indicates P<0.05, ** indicates P <0.01. Detailed Implementation

[0033] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0034] The specific technical solution of this invention is as follows: (1) Placental tissue samples were collected from 80 pregnant women who underwent cesarean section at the General Hospital of Ningxia Medical University between 2020 and 2022, including 40 preeclampsia cases and 40 normal cases. The m-values ​​in the placental tissue were detected by liquid chromatography-tandem mass spectrometry (LC-MS / MS) and dot blot. 6 Changes in A methylation levels; subsequently, placental tissues from six pairs of normal and preeclamptic women were selected for meRIP-seq and RNA-seq to plot the preeclamptic m... 6 A methylation modification map, bioinformatics analysis combined with meRIP-qPCR screening and identification of mRNA methylation modification patterns. 6 The gene NDRG2 showed the most significant changes in modification level. The expression of NDRG2 in placental tissue was detected by real-time quantitative polymerase chain reaction (qRT-PCR) and Western blot.

[0035] (2) Three types of placental trophoblast cells (HTR-8 / SVneo, Bewo, and JEG-3) were cultured in vitro. Hypoxia treatment was applied to these trophoblast cells to establish an in vitro model of preeclampsia, dividing them into a normoxic group (Normoxia group) and a hypoxic group (Hypoxia group). m 6 ARNA methylation kit detects m in trophoblast cells 6 Changes in A methylation levels; NDRG2 m-molecules in feeder cells were detected using meRIP-qPCR. 6 A. Methylation level; qRT-PCR and Western blot were used to detect the expression of NDRG2 in feeder cells.

[0036] (3) In vitro experiments (cell level) to observe the effect of NDRG2 on the biological function of placental trophoblast cells: Stable transgenic placental trophoblast cells (HTR-8 / SVneo, Bewo, JEG-3) infected with lentiviruses that overexpress and knock down NDRG2 were constructed. After hypoxia treatment, the effects of NDRG2 on trophoblast cell invasion, migration, apoptosis and proliferation were detected by Transwell assay, wound healing / cell scratch assay, flow cytometry and CCK-8 assay. The mRNA expression levels of inflammation-related factors (IL-1β, IL-6, IL-8, TNF-α) in trophoblast cells were detected by qRT-PCR.

[0037] (4) In vivo experiments (animal level) to observe the role of NDRG2 in the occurrence and development of preeclampsia: The preeclampsia animal model was constructed by uterine blood flow hypoperfusion (RUPP). NDRG2 interfering adenovirus was injected in situ into the placenta of pregnant rats in the RUPP group. Preeclampsia-like symptoms in pregnant rats were observed by detecting blood pressure and 24-hour urinary protein. The development of placenta and fetus was assessed by embryo absorption rate, placental wet weight and fetal rat weight.

[0038] (5) To explore the mechanism by which NDRG2 affects the biological function of placental trophoblasts and participates in the occurrence of preeclampsia: targeting the m in the 5′-UTR region of NDRG2. 6 A probe was designed at site A, and the NDRG2 probe was used to screen for NDRG2 m-sites using an RNA-pull-down assay combined with mass spectrometry. 6 The A-modified methyl reading protein is insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1). The mRNA and protein expression of IGF2BP1 in human placental tissue and trophoblast cells were detected using qRT-PCR and Western blot. After interfering with IGF2BP1, the luciferase activity of NDRG2 was detected using a dual-luciferase system. The mRNA and protein expression of NDRG2 in trophoblast cells after IGF2BP1 interference were detected using qRT-PCR and Western blot. The efficiency of NDRG2 mRNA transcription in trophoblast cells was detected after interfering with IGF2BP1 and treating with actinomycin D for different durations.

[0039] Example 1 The application of reagents regulating NDRG2 expression levels in the preparation of agents for treating preeclampsia, wherein the nucleotide sequence of NDRG2 described in this invention is shown in SEQ ID NO.1, and is as follows: (1) Total m in placental tissue and trophoblasts in preeclampsia 6 A modifies the change in level.

[0040] Total mRNA levels were detected in placental tissues from normal pregnant women and women with preeclampsia. 6A modification level, results showed that compared with the Normal group, the Preeclampsia group had m ​​in placental tissue 6 A methylation levels were significantly reduced, see Figure 1 A~C; Three feeder cell lines (HTR-8 / SVneo, Bewo, JEG-3) were cultured in vitro, and after hypoxia treatment, it was found that compared with the Normoxia group, the m in the Hypoxia group was higher. 6 The methylation level of A was significantly reduced, see Figure 1 The presence of D and E suggests that m6A modification may be involved in regulating the occurrence and development of preeclampsia.

[0041] (2) m in placental mRNA during preeclampsia 6 The overall pattern modified by A.

[0042] Using meRIP-seq sequencing analysis, we first mapped the m in the placenta during preeclampsia. 6 A methylation modification map, after data analysis, depicted the mRNA in the placenta during preeclampsia. 6 Changes in A-methylation modification characteristics. Results showed that meRIP-seq enriched 26068 and 25671 unique m-methylation features in the Preeclampsia and Normal groups, respectively. 6 A modifies the enriched regions (peaks), corresponding to 11675 and 11719 unique m, respectively. 6 A modifier gene, see Figure 2 A and B; using HOMER software, high-confidence functional sequences were searched in the identified peak regions, revealing highly enriched m sequences in the Normal and Preeclampsia groups. 6 The A modification site is located on a motif with GGAC characteristics, see... Figure 2 C and D; then, analyze m 6 The distribution of A methylation modification in the transcriptomes of the Normal and Preeclampsia groups, overall, m 6 A peak is mainly located in the coding region (CDS) and 3′-UTR, see Figure 2 E; at the same time, according to m 6 The location of peak A in the RNA transcriptome was divided into 5′-UTR, start codon, CDS, stop codon, 3′-UTR, and ncRNA. Further analysis was conducted on the Normal and Preeclampsia groups. 6 The distribution ratio of A-modified peaks on gene functional elements can be observed between the two groups of overall m. 6 A modifications exhibit a similar distribution across gene functional elements, primarily concentrated in the CDS and stop codon regions, see [link to relevant documentation]. Figure 2F and G; next, with log2(FC)≥1 or log2(FC)≤-1, and P ≤0.05 was used as a screening criterion to analyze the m between the Normal group and the Preeclampsia group. 6 Abundance of Apeak. Analysis of differential peaks revealed a total of 2210 differential peaks, including 908 m-peaks. 6 The peak of upregulated A methylation modification level, and 1302 m 6 The peak at which the methylation modification level is downregulated is seen in [the image / reference]. Figure 2 The above results suggest that the placenta in preeclampsia has a unique m 6 A methylation modification pattern, a unique m in preeclamptic placental tissue 6 The gene corresponding to peak A may contain specific m that can regulate the occurrence and development of preeclampsia. 6 A. Methylation modification genes.

[0043] (3) mRNA in placental tissue during preeclampsia 6 Correlation analysis between A modification level and transcription level.

[0044] Analysis of RNA-seq sequencing results revealed 287 differentially expressed genes in the Normal and Preeclampsia groups. Volcano plots showed 149 upregulated genes and 138 downregulated genes. (See attached image) Figure 3 A; joint analysis of meRIP-seq and RNA-seq sequencing data yielded results in m 6 Gene analysis data showing differences in both A-methylation modification and transcriptional levels identified m in 29 genes. 6 Significant changes were observed in A methylation modification and transcriptional levels, including m 6 Five genes showed upregulated A methylation levels and upregulated mRNA expression (referred to as "hyper-up" genes). 6 There are 7 genes whose A methylation modification level and mRNA expression are both downregulated (referred to as "hypo-down"). 6 There are 10 genes where A methylation modification levels are upregulated but mRNA expression is downregulated (referred to as "hyper-down"). 6 There are 7 genes whose A methylation modification levels are downregulated but whose mRNA expression is upregulated (referred to as "hypo-up" genes), see [link to relevant documentation]. Figure 3 Further analysis revealed 81 overlapping genes in meRIP-seq and RNA-seq. A clustering heatmap showed the differential expression of these 81 overlapping genes. (See section B) Figure 3C; GO and KEGG enrichment analyses were performed on 81 overlapping expression genes. GO analysis results showed that the GO entries mainly enriched in the 81 differentially expressed genes were associated with extracellular space, extracellular matrix adhesion, and O-glycan, etc. (See [reference needed]). Figure 3 The D;KEGG enrichment analysis results showed that the 81 differentially expressed genes were mainly enriched in signaling pathways such as the PI3K-Akt signaling pathway and the MAPK signaling pathway. Figure 3 The above results suggest that in the placental tissue of the Normal and Preeclampsia groups, m 6 Significant changes were observed in both A methylation modification levels and expression levels. GO and KEGG enrichment analyses revealed m... 6 Genes with A-methylation modifications may be associated with cellular processes and signaling pathways related to the pathogenesis of preeclampsia, such as invasion, migration, and inflammation. Furthermore, because gene expression is regulated by multiple factors, differentially altered m... 6 The impact of A-methylation modification on gene expression warrants further investigation.

[0045] (4) Validation of genes of interest based on meRIP-qPCR.

[0046] Combining meRIP-seq and RNA-seq data, and by examining the functions of the aforementioned overlapping genes, and performing IGV and conservation analyses on genes that all showed significant peaks and differences, this invention initially screened five genes of interest for further validation analysis. meRIP-qPCR was used to detect the m-values ​​of these five gene-specific candidate genes (GALNT3, HMGB3, LMCD1, NDRG2, and THOP1). 6 Modification level A, results show: only NDRG2 m 6 The level of A modification was significantly reduced, while the levels of m modification in the other four candidate genes (GALNT3, HMGB3, LMCD1, THOP1) were significantly reduced. 6 The level of modification A did not change significantly, see Figure 4 A; meanwhile, IGV analysis showed the relative abundance of the m6A site in NDRG2 mRNA, see Figure 4 In addition, the m6A modification level of NDRG2 in three trophoblast cell lines (HTR-8 / SVneo, Bewo, and JEG-3) was also examined. It was found that the m6A modification level of NDRG2 was significantly reduced in trophoblast cells after hypoxia treatment. The cellular level results were consistent with the human level results. (See Figure B). Figure 4 C.

[0047] (5) Expression of NDRG2 in placental tissue and trophoblasts in preeclampsia.

[0048] Western blot and qRT-PCR were used to detect the expression of NDRG2 in placental tissue and trophoblasts in preeclampsia. The results showed that, compared with the Normal group, the mRNA and protein expression of NDRG2 in placental tissue of the Preeclampsia group were significantly increased. In vitro culture of three trophoblast cell lines (HTR-8 / SVneo, Bewo, and JEG-3) revealed that, after hypoxia treatment, the mRNA and protein expression of NDRG2 in the Hypoxia group were also significantly increased compared with the Normal group. These results are shown in […]. Figure 5 This indicates that NDRG2's m 6 The A modification and expression levels were consistent with the results of meRIP-seq and RNA-seq sequencing; therefore, NDRG2 was selected for further analysis.

[0049] (6) Construction of stable cell lines with NDRG2 overexpression and knockdown.

[0050] This invention provides three shRNAs for preparing interfering lentiviruses to construct NDRG2 knockdown-stable cell lines, the specific sequences of which are as follows: SEQ ID NO.2, shNDRG2-1:GATGTGGGACTCAACTATAAA; SEQ ID NO.3, shNDRG2-2: CTTTGAGCGTGGAGGTGATAT; SEQ ID NO. 4, shNDRG2-3: CTGTTGTTCCCTTTGGGATATC.

[0051] Three feeder cell lines (HTR-8 / SVneo, Bewo, and JEG-3) were cultured in vitro, transfected with NDRG2 overexpressing and knockdown lentiviruses, and screened with puromycin. The results showed that, compared with the control lentivirus group (Lv-GFP), the mRNA and protein expression levels of NDRG2 in the HTR-8 / SVneo, Bewo, and JEG-3 cell lines transfected with NDRG2 overexpressing lentivirus (Lv-NDRG2) were significantly increased, with statistically significant differences. (See attached figures). Figure 6 A, B, E, F, I, and J; After transfection with NDRG2 interfering lentivirus (sh-NDRG2), compared with the control lentivirus (sh-NC), the mRNA and protein expression levels of NDRG2 in HTR-8 / SVneo, Bewo, and JEG-3 cell lines were significantly reduced, with statistically significant differences. Among them, sh-NDRG2-1 had the best interference effect, so sh-NDRG2-1 was selected for subsequent experiments. Figure 6The results indicate that NDRG2 overexpression and knockdown stabilized cell lines were successfully constructed.

[0052] (7) Effect of NDRG2 on the invasive ability of placental trophoblasts.

[0053] The effect of NDRG2 on the invasive ability of placental trophoblasts (HTR-8 / SVneo, Bewo, JEG-3) was detected using a Transwell assay. The results showed that after transfection with lentivirus overexpressing NDRG2 (Lv-NDRG2), the number of cells that passed through the Transwell chamber filter membrane was significantly reduced, and the invasive ability of trophoblasts was decreased. P <0.01); however, after transfection with NDRG2 interfering lentivirus (sh-NDRG2), the number of cells passing through the Transwell chamber filter membrane significantly increased, and the trophoblast invasion ability was enhanced. P <0.01), suggesting that NDRG2 can inhibit the shuttle invasion ability of trophoblasts, see [reference needed]. Figure 7 .

[0054] (8) Effect of NDRG2 on the migration ability of placental trophoblasts.

[0055] The effect of NDRG2 on the migration ability of placental trophoblast cells (HTR-8 / SVneo, Bewo, JEG-3) was detected using a wound healing assay. The results showed that transfection with lentivirus overexpressing NDRG2 (Lv-NDRG2) did not significantly change the scratch distance, but cell migration ability decreased. P <0.01); while transfection with NDRG2 interfering lentivirus (sh-NDRG2) significantly shortened the scratch distance and increased cell migration ability ( P <0.01), suggesting that NDRG2 can inhibit the migration ability of trophoblast cells, see Figure 8 .

[0056] (9) Effect of NDRG2 on placental trophoblast apoptosis.

[0057] The effect of NDRG2 on apoptosis of placental trophoblast cells (HTR-8 / SVneo, Bewo, and JEG-3) was detected by flow cytometry. The results showed that transfection with an NDRG2-overexpressing lentivirus (Lv-NDRG2) significantly increased the apoptosis rate of all three trophoblast cell types; while transfection with an NDRG2-interfering lentivirus (sh-NDRG2) significantly decreased the apoptosis rate of all three trophoblast cell types. These differences were statistically significant, suggesting that NDRG2 can promote trophoblast cell apoptosis. Figure 9 .

[0058] (10) Effect of NDRG2 on the proliferative capacity of placental trophoblasts.

[0059] The effect of NDRG2 on the proliferation of placental trophoblast cells (HTR-8 / SVneo, Bewo, JEG-3) was detected using the CCK-8 assay. The results showed that transfection with lentivirus overexpressing NDRG2 (Lv-NDRG2) significantly reduced absorbance and decreased the proliferation capacity of trophoblast cells. P <0.01); however, after transfection with NDRG2 interfering lentivirus (sh-NDRG2), the absorbance increased significantly, and the proliferative capacity of trophoblast cells increased ( P <0.01), suggesting that NDRG2 can inhibit the proliferative capacity of trophoblast cells, see [reference needed]. Figure 10 .

[0060] (11) Effect of NDRG2 on the expression of inflammatory factors in placental trophoblasts.

[0061] The effect of NDRG2 on the mRNA expression of inflammation-related factors in placental trophoblasts (HTR-8 / SVneo, JEG-3, Bewo) was detected by qRT-PCR. The results showed that transfection with NDRG2-overexpressing lentivirus (Lv-NDRG2) significantly increased the mRNA expression of inflammation-related factors IL-1β, IL-6, IL-8, and TNF-α in placental trophoblasts. Conversely, transfection with NDRG2-interfering lentivirus (sh-NDRG2) significantly decreased the mRNA expression of these factors in placental trophoblasts. The differences were statistically significant. Figure 11 The results suggest that NDRG2 can promote the expression of inflammation-related factors in trophoblasts.

[0062] (12) Effects of NDRG2 on RUPP pregnant mice, placenta and fetal development.

[0063] This invention provides four shRNAs for preparing interfering adenovirus to investigate the effects of NDRG2 on RUPP pregnant mice, placenta, and fetal development. The four shRNAs showed no significant difference in efficacy; therefore, the following experimental results only show the results of SEQ ID NO.5, the sequence information of which is as follows: SEQ ID NO.5: GCATCCTGCAGTACTTAAATTTTCAAGAGAAATTTAAGTACTGCAGGATGCTTTTTTT; SEQ ID NO.6: GGACTCAACTATAAATCTTGCTTCAAGAGAGCAAGATTTATAGTTGAGTCCTTTTTT; SEQ ID NO.7: GGACACCGTTGAAGGTCTTGTTTCAAGAGAACAAGACCTTCAACGGTGTCCTTTTTT; SEQ ID NO.8: GCCGTGGTGGAATGTAATTCATTCAAGAGATGAATTACATTCCACCACGGCTTTTT.

[0064] To clarify the effects of NDRG2 on RUPP pregnant mice, placenta, and fetal development, NDRG2 interfering adenovirus was injected orally into the placenta of RUPP pregnant mice (designated as the KD-NDRG2 group). Blood pressure was measured in both the WT and KD-NDRG2 groups. The results showed that postoperative blood pressure in the KD-NDRG2 group increased more slowly than in the WT group, and the change in blood pressure before and after surgery was significantly lower. Simultaneously, 24-hour urinary protein levels in the KD-NDRG2 group were less increased than in the WT group, and the change in urinary protein levels before and after surgery was significantly lower in the KD-NDRG2 group. Embryo resorption rate was significantly lower in the KD-NDRG2 group compared to the WT group. Statistical analysis of placental wet weight and fetal weight showed that placental wet weight and fetal weight were significantly higher in the KD-NDRG2 group compared to the WT group. These results are detailed below. Figure 12 This indicates that knocking down NDRG2 can inhibit the occurrence and development of preeclampsia.

[0065] (13) NDRG2 is associated with the clinicopathological features of preeclampsia.

[0066] To further explore the clinical significance of NDRG2 in the progression of preeclampsia, this invention analyzed the correlation between NDRG2 and the clinicopathological features of preeclampsia. The results showed that placental NDRG2 levels were positively correlated with systolic blood pressure, diastolic blood pressure, and BMI, and negatively correlated with gestational age at delivery and neonatal birth weight. Figure 13 These results indicate that NDRG2 can serve as a predictive biomarker associated with clinicopathological features of preeclampsia.

[0067] (14) Screening for proteins that bind to NDRG2 based on mass spectrometry.

[0068] In order to screen out those involved in regulating NDRG2 m 6 A-modified methyl-reading proteins primarily target the m in the 5′-UTR region of NDRG2. 6 A site design probe (see) Figure 14(A) Subsequently, the NDRG2 probe was used to extract the NDRG2-binding protein from HTR-8 / SVneo cells via RNA-pull down assay. Silver staining analysis of the protein products revealed that, compared to the NC probe group, the NDRG2 probe group showed a distinct specific band in the protein products after RNA-pull down assay. (See A). Figure 14 Therefore, mass spectrometry analysis was subsequently used to analyze proteins binding to NDRG2. The mass spectrometry results showed that there were 141 overlapping proteins in the NC probe group and the NDRG2 probe group. The top 10 proteins were YBX1, MYH9, IGF2BP1, hnRNPA0, KRT18, hnRNPA1, IGF2BP3, hnRNPU, RBMX, and ACTG1. Figure 14 C; Score and sequence coverage information for the top 10 proteins, as shown below. Figure 14 Listed in D, including those involved in m 6 The major methyl reading proteins IGF2BP1 and IGF2BP3 modified by A were analyzed. RNA pull-down combined with Western blot was used to detect the protein expression of IGF2BP1 and IGF2BP3 in HTR-8 / SVneo cells. It was found that IGF2BP1 protein expression was clearly observed after pulling down the NDRG2 probe, while IGF2BP3 protein expression was not observed. Figure 14 Further verification using RIP experiments revealed that after IGF2BP1 was pulled down, the enrichment fold of NDRG2 in the three feeder cell lines (HTR-8 / SVneo, Bewo, and JEG-3) significantly increased, while the enrichment fold of NDRG2 after IGF2BP3 was not as significant as that after IGF2BP1 was pulled down. The difference was statistically significant. (See [link to RIP experiment]). Figure 14 Therefore, the subsequent discussion will mainly focus on the regulatory role of IGF2BP1 on NDRG2.

[0069] (15) Expression of IGF2BP1 in placental tissue and trophoblasts in preeclampsia.

[0070] The expression of IGF2BP1 in placental tissues from normal and preeclampsia women was detected by Western blot and qRT-PCR. The results showed that, compared with the normal group, the mRNA and protein expression of IGF2BP1 in placental tissues of the preeclampsia group were significantly increased. Figure 15 A and B; In vitro culture of three feeder cell lines (HTR-8 / SVneo, Bewo, JEG-3) revealed that the mRNA and protein expression of IGF2BP1 in the Hypoxia group was significantly increased compared to the Normoxia group. Figure 15C~E.

[0071] (16) Effects of IGF2BP1 on NDRG2 mRNA stability and expression.

[0072] The sequence of the IGF2BP1 interfering RNA in this invention is as follows: SEQ ID NO.9: sh-IGF2BP1-1, CCAUCCGCAACAUCACAAATT; SEQ ID NO.10: sh-IGF2BP1-2, GCAAACUCAAGGAGGAGAATT; SEQ ID NO.11: sh-IGF2BP1-3,GUAAGAUGAUCUUGGAGAUTT; SEQ ID NO. 12: sh-IGF2BP1-4, GUCAUUGGCAAAGGUGGAATT.

[0073] The effects of the four interfering RNAs were not significantly different, therefore the following experiments will only show the results of SEQ ID NO.9.

[0074] Pearson correlation analysis showed a positive correlation between IGF2BP1 and NDRG2 expression (r=0.9596). P <0.0001), see Figure 16 A; To further determine whether IGF2BP1 regulates NDRG2 is m 6 A-methylation modification-dependent, this invention constructs an NDRG2 5′-UTR region rich in m 6 Wild-type (NDRG2-WT) and m modified sequences 6 The mutant plasmid with the A site mutation (NDRG2-Mut), after co-transfection of 293T cells with IGF2BP1 interfering RNA, showed the following results using a dual-luciferase reporter system: IGF2BP1 interference significantly inhibited luciferase activity in the NDRG2-WT group, while luciferase activity in the NDRG2-Mut group was not significantly affected. Figure 16 B; qRT-PCR and Western blot were used to detect the mRNA and protein expression of NDRG2 in three feeder cell lines (HTR-8 / SVneo, Bewo, and JEG-3) after IGF2BP1 interference. The results showed that after IGF2BP1 interference, the mRNA and protein expression levels of NDRG2 were significantly reduced in all three feeder cell lines, and the differences were statistically significant. (See Figure B) Figure 16The C~E values ​​were analyzed. Three feeder cell lines (HTR-8 / SVneo, Bewo, and JEG-3) were treated with actinomycin D after IGF2BP1 interference, and the degradation rate of NDRG2 mRNA was detected by qRT-PCR. The results showed that compared with the control group, the degradation rate of NDRG2 mRNA was accelerated and the half-life was significantly shortened after IGF2BP1 interference, with statistically significant differences. (See Figure C~E). Figure 16 The above results indicate that IGF2BP1 recognizes NDRG2 gene mRNA. 6 The A modification site regulates the stability of NDRG2 mRNA, thereby promoting NDRG2 gene expression.

[0075] From the content, we can know that: (1) m of NDRG2 6 A methylation levels were significantly reduced in preeclamptic placental tissue and hypoxia-induced placental trophoblasts, while NDRG2 expression levels were significantly increased.

[0076] (2) NDRG2 participates in the regulation of the occurrence and development of preeclampsia by inhibiting the invasion, migration and proliferation of placental trophoblasts, promoting cell apoptosis and the expression of inflammatory factors.

[0077] (3) m 6 A-methyl reading protein IGF2BP1 via m 6 A-methylation modification regulates NDRG2 mRNA stability, thereby promoting NDRG2 expression.

[0078] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0079] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of a reagent that regulates NDRG2 expression levels in the preparation of a treatment for preeclampsia, characterized in that, Regulating NDRG2 expression levels refers to at least one of the following: 1) Increase the m of NDRG2 mRNA 6 A. Methylation modification level; 2) Reduce the expression level of NDRG2.

2. The application as described in claim 1, characterized in that, The reagent refers to at least one of the following: A. Any one of the shRNAs shown in SEQ ID NO.2 to SEQ ID NO.4; B. Interfering adenovirus of NDRG2; C, IGF2BP1 interfering RNA.

3. The application as described in claim 2, characterized in that, The reagent also includes lentiviral venom capable of expressing the shRNA described in A.

4. The application as described in claim 2, characterized in that, The sequence used to prepare NDRG2 interfering adenovirus is any one of SEQ ID NO.5 to SEQ ID NO.

8.

5. The application as described in claim 2, characterized in that, The interfering RNA sequence of IGF2BP1 is any one of the sequences shown in SEQ ID NO.9 to SEQ ID NO.

12.

6. The application as described in claim 1, characterized in that, The formulation for treating preeclampsia also includes pharmaceutically acceptable excipients.

7. The application as described in claim 1, characterized in that, The excipients include at least one of a protective agent, a buffer, and a surfactant.

8. The application as described in claim 1, characterized in that, The acceptable dosage form for the treatment of preeclampsia is an injection.

Images