A cell subpopulation and uses thereof

Abstract

The application relates to the technical field of stem cells, in particular to a cell subpopulation and application thereof. ‑ The application discloses a mesenchymal stem cell with stronger anti-inflammatory effect and weaker pro-inflammatory potential, which can avoid treatment resistance and promote improvement of treatment effect when applied to treatment of acute pneumonia mice, and has good clinical application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of stem cells, in particular to a cell subpopulation and application thereof. BACKGROUND

[0002] Mesenchymal stem cells (MSCs) are a kind of multipotent stem cells, which have unique self-renewal, multi-directional differentiation and immunoregulatory potential, and in addition, have low immunogenicity, so they are widely used in the clinical treatment of graft-versus-host disease (GvHD), sepsis and infectious pneumonia and other inflammatory diseases, and can be expected in the future.

[0003] However, with the development of a large number of clinical studies, scholars have found that there is a huge individual difference in the clinical efficacy of MSCs, some patients are effective, and some patients are ineffective. For example, MSCs cannot improve the inflammatory indicators and immunoglobulin levels of patients with severe pneumonia, and the respiratory function and ARDS state of patients with acute respiratory distress syndrome (ARDS). It can be seen that there is a significant resistance effect when MSCs are transplanted to treat inflammatory diseases, but the resistance mechanism is still unclear.

[0004] FKN protein (Fractalkine, CX3CL1, NM_002996.6) is a protein encoded by CX3CL1 gene, which belongs to the CX3C chemokine family and is the only known member of the family, which is a single transmembrane integral membrane. SUMMARY

[0005] The purpose of the present application is to overcome the shortcomings of the prior art and provide a cell subpopulation and application thereof.

[0006] The inventors found that LPS can induce the pro-inflammatory phenotype reprogramming of Ad-MSCs, thereby exerting significant pro-inflammatory function, which significantly reduces the therapeutic effect of Ad-MSCs on acute pneumonia mice, and thus the persistent LPS stimulation in vivo may be the key reason for the treatment resistance of Ad-MSCs.

[0007] There are five functionally heterogeneous subpopulations (pro-inflammatory subpopulation, protein synthesis dominant subpopulation, strong proliferation subpopulation, high metabolism subpopulation and high adhesion subpopulation) in the mixed population of Ad-MSCs, and FKN + The pro-inflammatory subpopulation of Ad-MSCs has stronger pro-inflammatory capacity than unsorted Ad-MSCs, which may be the key cell subpopulation that exerts pro-inflammatory function and leads to treatment resistance during treatment, and FKN - Ad-MSCs have stronger anti-inflammatory effect and weaker pro-inflammatory potential than unsorted Ad-MSCs; at the same time, FKN + Ad-MSCs and FKN -The stem cell basic functions of Ad-MSCs, such as proliferation, migration and tri-lineage differentiation (osteogenic, chondrogenic and adipogenic) ability, are consistent with those of unsorted Ad-MSCs, and all have transplantation potential; FKN is not only a surface marker molecule of the pro-inflammatory easy-enabled Ad-MSC cell subpopulation, but also an effect regulating molecule for the pro-inflammatory function reprogramming thereof, and knocking down or overexpressing FKN can affect the exertion of the pro-inflammatory function of Ad-MSCs and the treatment effect on acute pneumonia mice; in terms of molecular mechanism, FKN can combine with TLR4 to activate the NF-κB signaling pathway, thereby promoting inflammation, that is, FKN + Ad-MSCs synergistically amplify the LPS-mediated pro-inflammatory function reprogramming through the FKN / TLR4 / NF-κB signal axis, resulting in infection pneumonia MSC treatment resistance; in the treatment of acute pneumonia mice, FKN - Ad-MSCs have better protection and inflammation control effect on lung tissue than unsorted Ad-MSCs.

[0008] Therefore, FKN - Ad-MSCs for the treatment of acute pneumonia can not only avoid treatment resistance, but also promote the improvement of treatment effect, and are high-quality clinical seed cell subpopulation.

[0009] The first object of the present application is to provide a mesenchymal stem cell subpopulation.

[0010] The second object of the present application is to provide the use of any of the mesenchymal stem cell subpopulations in the preparation of a pneumonia drug.

[0011] In order to achieve the above object, the present application is realized by the following technical scheme: The present application takes FKN as a cell surface target protein / surface marker of mesenchymal stem cells, and uses cell sorting technology to obtain a mesenchymal stem cell subpopulation, which is FKN - mesenchymal stem cells (FKN - MSC). Based on the common knowledge in the art, FKN - represents FKN-negative cells.

[0012] The present application claims a mesenchymal stem cell subpopulation, which is FKN - mesenchymal stem cells (FKN - MSC).

[0013] As a specific embodiment, the FKN - mesenchymal stem cells are obtained by removing mesenchymal stem cells capable of binding to FKN antibodies through cell sorting technology using FKN antibodies. Preferably, the mesenchymal stem cell subpopulation is FKN - human mesenchymal stem cells (FKN- hMSC).

[0014] Preferably, the mesenchymal stem cell subpopulation is FKN - human adipose-derived mesenchymal stem cells (FKN - Ad-hMSC).

[0015] Preferably, the method for preparing the mesenchymal stem cell subpopulation comprises isolating and culturing mesenchymal stem cells, mixing the mesenchymal stem cells with FKN antibodies, and removing the mesenchymal stem cells bound to the FKN antibodies to obtain the mesenchymal stem cell subpopulation.

[0016] More preferably, the method for preparing the mesenchymal stem cell subpopulation comprises isolating and culturing mesenchymal stem cells, mixing the mesenchymal stem cells with FKN antibodies coupled with magnetic beads, and removing the mesenchymal stem cells bound to the FKN antibodies (FKN + positive cells) by magnetic sorting to obtain the mesenchymal stem cell subpopulation.

[0017] Preferably, the mesenchymal stem cells are adipose-derived mesenchymal stem cells.

[0018] The application also claims the use of any of the mesenchymal stem cell subpopulations in the preparation of a medicament for treating pneumonia.

[0019] Preferably, the pneumonia is acute pneumonia.

[0020] Preferably, the mesenchymal stem cell subpopulation inhibits T cell proliferation.

[0021] Preferably, the mesenchymal stem cell subpopulation protects lung tissue, improves lung tissue inflammation, reduces CD45 + immune cell infiltration, and / or avoids treatment resistance.

[0022] Preferably, the mesenchymal stem cell subpopulation inhibits pro-inflammatory factor secretion.

[0023] More preferably, the mesenchymal stem cell subpopulation inhibits pro-inflammatory factor secretion in serum.

[0024] More preferably, the mesenchymal stem cell subpopulation inhibits pro-inflammatory factor secretion in lung tissue.

[0025] More preferably, the pro-inflammatory factor is IL-1β, IL-6, and / or TNF-α.

[0026] Compared with the prior art, the application has the following beneficial effects: The application provides a FKN -The mesenchymal stem cell subpopulation has stronger anti-inflammatory effect and weaker pro-inflammatory potential relative to unsorted mesenchymal stem cells, and application to the treatment of acute pneumonia mice can avoid treatment resistance and promote improvement of treatment effect, and has good clinical application value. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 Figure 4 is a graph of the secretion concentration of IL-1β, IL-6 and TNF-α of Ad-MSCs after LPS stimulation.

[0028] Figure 2 Figure 5 is a graph of the effect of Ad-MSCs on T cell proliferation before and after LPS stimulation.

[0029] Figure 3 Figure 6 is a graph of the effect of Ad-MSCs on the secretion of pro-inflammatory factors in normal mice before and after LPS stimulation; A is the concentration of IL-6 in the serum of normal mice (PBS represents the PBS injection group mixed with the matrix glue, unstimulated MSC represents the matrix glue injection group mixed with MSCs not treated with LPS, and LPS-stimulated MSC represents the matrix glue injection group mixed with LPS-treated MSCs); B is the concentration of TNF-α in the serum of normal mice. n=3.

[0030] Figure 4 Figure 7 is a graph of the effect of Ad-MSCs on immune cell recruitment in normal mice before and after LPS stimulation; A is a graph of HE and CD45 immunohistochemical staining of the matrix glue (scale = 500 μm, PBS represents the PBS injection group mixed with the matrix glue, unstimulated MSC represents the matrix glue mixed with MSCs not treated with LPS, and LPS-stimulated MSC represents the injection group mixed with LPS-treated MSCs); B is a graph of CD45 + Figure 8 is a graph of the proportion of immune cells. n=3.

[0031] Figure 5 Figure 9 is a graph of the effect of Ad-MSCs on the treatment effect of acute pneumonia mice before and after LPS stimulation; A is a graph of HE staining of lung tissue (scale = 100 μm, blank control represents the normal mouse group, PBS represents the PBS treatment group, unstimulated MSC represents the MSC treatment group not treated with LPS, and LPS-stimulated MSC represents the MSC treatment group treated with LPS); B is a graph of the pathological score of lung tissue. n=3.

[0032] Figure 6 Figure 10 is a graph of the cell subpopulation heterogeneity of Ad-MSCs and the screening of pro-inflammatory subpopulations.

[0033] Figure 7Sorting and identification of pro-inflammatory subset of Ad-MSCs; A: Flow cytometry of FKN membrane expression level after sorting (FKN - -MSC represents FKN-negative MSCs, FKN + -MSCs represent FKN-positive MSCs); B: Protein expression of FKN; C: Statistical chart of FKN protein expression; D: Transcriptional expression of FKN; E: Statistical chart of IL-1β, IL-6 and TNF-α transcriptional expression of cells in each group; F: Statistical chart of IL-1β, IL-6 and TNF-α secretion of cells in each group. n=3.

[0034] Figure 8 FKN + Ad-MSCs promote T cell proliferation; statistical chart of T cell proliferation after co-culture of cells in each group with T cells. n=3.

[0035] Figure 9 Unsorted Ad-MSCs, FKN + Ad-MSCs and FKN - Proliferation characteristics of Ad-MSCs; A: Heat map of expression of cell proliferation-related genes; B: Statistical chart of CCK-8 staining results; C: RTCA results chart.

[0036] Figure 10 Unsorted Ad-MSCs, FKN + Ad-MSCs and FKN - Migration characteristics of Ad-MSCs: Heat map of expression of migration-related genes (left panel is chemokine receptors and right panel is adhesion molecules).

[0037] Figure 11 Transwell experiment for detecting unsorted Ad-MSCs, FKN + Ad-MSCs and FKN - Quantification of Ad-MSC cell migration.

[0038] Figure 12 Scratch experiment for unsorted Ad-MSCs, FKN + Ad-MSCs and FKN - Quantification of Ad-MSC cell migration.

[0039] Figure 13 Unsorted Ad-MSCs, FKN + Ad-MSCs and FKN -Tri-lineage differentiation properties of Ad-MSCs; A: Osteogenic differentiation staining; B: Adipogenic differentiation staining; C: Chondrogenic differentiation staining; 100x scale bar = 100 μm, 400x scale bar = 50 μm.

[0040] Figure 14 Knockdown and overexpression of FKN in Ad-MSCs; A: Knockdown and overexpression of FKN in wild-type Ad-MSCs; B: Effect of LPS on membrane expression of FKN in wild-type Ad-MSCs; C: Effect of LPS on transcriptional expression of FKN in wild-type Ad-MSCs. n = 3.

[0041] Figure 15 FKN regulates the secretion of pro-inflammatory factors in Ad-MSCs; A: Transcriptional expression of IL-6 in wild-type Ad-MSCs, FKN-knockdown MSCs and FKN-overexpression MSCs after LPS induction; B: Transcriptional expression of TNF-a in each group of cells after LPS induction; C: Secretion of IL-6 in each group of cells after LPS induction; D: Secretion of TNF-a in each group of cells after LPS induction. n = 3.

[0042] Figure 16 Effect of FKN on T cell proliferation: Histogram of the mean fluorescence intensity of T cells after co-culture. n = 3.

[0043] Figure 17 Effect of FKN on the level of inflammation in mice; A: Matrix gel HE and CD45 immunohistochemical staining graph (scale = 500 μm); B: Lung tissue HE staining graph (top scale = 2.5 mm, bottom scale = 500 μm); C: Lung tissue CD45 immunohistochemical staining graph (top scale = 2.5 mm, bottom scale = 500 μm); D: Matrix gel CD45 + immune cell ratio histogram; E: Lung tissue histopathology score histogram; F: Lung tissue CD45 + immune cell ratio histogram. n = 3.

[0044] Figure 18 Effect of FKN - Ad-MSCs and FKN + Phosphoproteomic analysis of FKN

[0045] Figure 19 Effect of FKN - Ad-MSCs and FKN + Activation of NF-κB in Ad-MSCs; A: WB graph; B: FKN- Ad-MSCs and FKN + Statistical graph of NF-κB activation in Ad-MSCs. n=3.

[0046] Figure 20 FKN for FKN + Effect of NF-κB activation in Ad-MSCs; A: WB graph; B: FKN for FKN + Statistical graph of NF-κB activation effect in Ad-MSCs. n=3.

[0047] Figure 21 Unsorted Ad-MSCs, FKN + Ad-MSCs and FKN - Ad-MSCs suppress / pro-inflammatory gene expression; A: suppressive inflammatory factor gene expression; B: pro-inflammatory factor gene expression.

[0048] Figure 22 Unsorted Ad-MSCs and FKN before and after LPS induction - Effect of Ad-MSCs on T cell proliferation: T cell proliferation statistical graph. n=3.

[0049] Figure 23 Unsorted Ad-MSCs and FKN - Effect of Ad-MSCs on pro-inflammatory factor levels in acute pneumonia mice; A: IL-1L, IL-6 and TNF-α concentration statistical graph in mouse lung tissue homogenate; B: IL-1β, IL-6 and TNF-α concentration statistical graph in mouse serum. n=3.

[0050] Figure 24 Unsorted Ad-MSCs and FKN - Effect of Ad-MSCs on lung inflammation in acute pneumonia mice; A: mouse lung tissue HE staining graph (top scale=2.5 mm, bottom scale=500 μm); B: mouse lung tissue CD45 immunohistochemical staining graph (top scale=2.5 mm, bottom scale=500 μm); C: lung tissue histopathology score statistical graph; D: lung tissue CD45 + Immune cell proportion statistical graph. n=3.

[0051] The above graphs, ; the number in the flow graph is the average fluorescence intensity; the relative proliferation rate=1+(T cell group alone-experimental group) / experimental group. DETAILED DESCRIPTION

[0052] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0053] The experimental animals used were BALB / c female mice, purchased from Spiford (Beijing) Biotechnology Co., Ltd., aged 6-8 weeks and weighing 19-20 g. They were kept in a clean breeding room for at least 2 weeks before modeling, with a light cycle of 12 hours during the day and 12 hours at night.

[0054] 1. Preparation of matrix gel or paraffin sections of lung tissue (1) Sample trimming: Remove the matrix gel or lung tissue from 4% paraformaldehyde, trim the target area, and place it in the embedding frame.

[0055] (2) Washing: Place the matrix gel or lung tissue in distilled water and wash for 20 min.

[0056] (3) Dehydration, clearing, and wax impregnation are carried out in the following order: 70% ethanol for 2 hours, 80% ethanol for 2 hours, 90% ethanol for 1 hour, 90% ethanol for 2 hours, anhydrous ethanol (twice) for 1 hour each time, xylene (twice) for 1 hour each time, melting paraffin wax for 1 hour, and melting paraffin wax for 2 hours.

[0057] (4) Place the tissue soaked in wax into the embedding machine for tissue embedding: Put the melted wax into the embedding mold. After the wax in the mold has solidified slightly, take the tissue out of the embedding frame and put it into the embedding mold. Use the bottom of the tweezers to gently press the tissue so that the tissue is completely flat in the mold. Then cover the embedding frame on the mold containing the tissue and gently move it to a -20 ℃ freezing stage to cool. After the wax solidifies, take the wax block out of the mold and trim the wax block.

[0058] (5) Sectioning: Place the trimmed wax block on a paraffin microtome and section it to a thickness of 4 micrometers. Float the section on 42°C warm water in a slide spreader to flatten the tissue. Use a glass slide to vertically lift the tissue. After the water on the tissue has been drained slightly, place it in a 60°C baking machine to bake the section for 30 min to 2 h. After the water has dried and the wax has melted, remove it and store it at room temperature for later use.

[0059] (6) Dewaxing of paraffin sections, the procedure is as follows: environmentally friendly dewaxing agent (3 times) 10 min, anhydrous ethanol 5 min, 95% ethanol 5 min, 85% ethanol 5 min, 75% ethanol 5 min, rinse with distilled water (3 times) 3 min, to obtain paraffin sections.

[0060] 2. HE staining The obtained paraffin sections were stained with hematoxylin for 4 min, rinsed with distilled water for 2 min, stained with 0.8% hydrochloric acid ethanol for 2 s, rinsed with distilled water for 10 s, bluing with lithium carbonate aqueous solution for 10 s, rinsed with distilled water for 2 min, stained with eosin for 20 s, stained with 95% ethanol for 5 s, stained with anhydrous ethanol (twice) for 2 min, cleared with environmentally friendly transparentizing agent, and sealed.

[0061] 3. CD45 immunohistochemical staining The obtained paraffin sections were incubated with antigen retrieval solution for 3 min (microwave on high), cooled naturally for 1 h, and the above two steps were repeated 3 times. They were then incubated with 3% H2O2 for 30 min (room temperature, protected from light), rinsed with distilled water for 5 min, circled, rinsed with TBST for 5 min, incubated with 10% goat serum for 30 min (room temperature), incubated overnight with primary antibody working solution (4 ℃), warmed to room temperature for 15 min (room temperature), rinsed with TBST (3 times) for 3 min, rinsed with TBST (3 times) for 3 min, incubated with secondary antibody working solution for 45 min (37 ℃), rinsed with TBST (3 times) for 3 min, rinsed with TBST (3 times) for 3 min, developed with DAB for 2 min, incubated with hematoxylin for 1 min, rinsed with distilled water for 3 min, incubated with 0.8% hydrochloric acid ethanol for 2 s, bluing with lithium carbonate aqueous solution for 10 s, rinsed with distilled water for 2 min, rinsed with anhydrous ethanol (2 times) for 2 min, air-dried for 2 h, mounted with neutral resin, and rinsed with distilled water (3 times) for 5 min.

[0062] 4. The sections stained with HE and CD45 immunohistochemically were scanned, examined under a microscope, and the images were acquired and analyzed.

[0063] The pathological scoring criteria for lung tissue are as follows: 0 points, no reaction in the alveolar walls; 1 point, diffuse reaction in the alveolar walls, mainly neutrophils, no thickening of the alveolar walls; 2 points, diffuse presence of neutrophils and monocytes in the alveolar walls, with mild thickening; 3 points, significant thickening of the alveolar walls by 2 to 3 times due to the presence of inflammatory cells; 4 points, thickening of the alveolar walls, with a lung consolidation rate not exceeding 25%; 5 points, thickening of the alveolar walls, with a lung consolidation rate exceeding 50%.

[0064] Example 1: Preparation of LPS-induced human adipose-derived mesenchymal stem cells and their anti-inflammatory activity I. LPS-induced Ad-MSCs 1. Experimental Methods Human adipose-derived mesenchymal stem cells (hAD-MSCs, or Ad-MSCs) were purchased from Chongqing Fumei Stem Cell Biotechnology Development Co., Ltd., and cultured in DMEM / F-12 containing serum substitute in a constant temperature incubator at 37 ℃ (5% CO2).

[0065] During the 4th to 6th generations, LPS (final concentration 1 μg / mL) was added to the culture medium to stimulate Ad-MSCs (0 h, 6 h, 24 h and 48 h). After that, the culture medium supernatant was collected and the secretion of IL-1β, IL-6 and TNF-α was detected by ELISA.

[0066] 2. Experimental Results See results Figure 1 LPS induced a significant upregulation of the secretion of IL-1β, IL-6 and TNF-α in a time-dependent manner. The secretion of IL-1β and IL-6 reached its peak 48 h after LPS stimulation, while the secretion of TNF-α reached its peak 6 h after LPS stimulation and gradually decreased over time.

[0067] Therefore, it was determined that LPS induced pro-inflammatory phenotype reprogramming in Ad-MSCs.

[0068] Example 2: LPS-induced Ad-MSCs promote T cell proliferation I. Isolation of T cells 1. Experimental Methods (1) Centrifuge fresh blood samples from healthy volunteers at 800 g for 5 min to separate serum, inactivate the serum in a 56℃ water bath for 30 min, and store at -20℃.

[0069] (2) Dilute the blood sample with an equal volume of physiological saline, mix thoroughly, and carefully pour it into a lymphocyte separation tube (centrifuge at 800 g for 1 min before use). Set the centrifuge to a slow acceleration and deceleration setting and centrifuge the blood sample mixture at 800 g for 20 min.

[0070] (3) Aspirate all the liquid on the sieve plate in the lymphocyte separation tube, pour it into a clean centrifuge tube, add serum-free lymphocyte culture medium and wash twice, then centrifuge at 250 g for 10 min.

[0071] (4) Serum-free culture medium for lymphocytes (add approximately 10) 5 Cells were resuspended with CD3 / CD28 magnetic beads and human IL-2 recombinant protein at a final concentration of 300 IU / mL, transferred to T25 cell culture flasks, and incubated. IL-2 was added once every 48 h.

[0072] 2. Co-culture of T cells and Ad-MSCs (1) Ad-MSCs prepared in Example 1 were seeded in 6-well plates and stimulated with LPS for 6 h (final concentration of 1 μg / mL). A co-culture group without LPS stimulation was also set up.

[0073] (2) Collect T cells, count them, and then dilute to 10⁻⁶. 7 ~10 8 T cell suspensions were obtained at 100 cells / mL, and a portion of the cells were taken out as a blank control (T cell group alone).

[0074] (3) Add CFSE to the T cell suspension to a final concentration of 5 μM and incubate at room temperature in the dark for 20 min.

[0075] (4) Add 5 times the volume of serum-free lymphocyte culture medium containing 10% FBS to stop staining, and centrifuge at 500 g for 5 min.

[0076] (5) After discarding the supernatant, resuspend the cells in serum-free lymphocyte culture medium.

[0077] (6) Aspirate the culture medium of Ad-MSCs, wash with PBS 3 times, and then add serum-free lymphocyte culture medium.

[0078] (7) Add T cell suspension at a ratio of T cells:Ad-MSCs=5:1 and add IL-2 recombinant protein (final concentration of 300 IU / mL).

[0079] (8) T cells were collected 3 days later, and the CFSE fluorescence intensity of T cells was detected by flow cytometry.

[0080] II. Experimental Results See results Figure 2 The proliferation rate of T cells after co-culturing with Ad-MSCs changed. Compared with the T cell-only group, the T cell proliferation rate in the unstimulated co-culture group was slower (relative proliferation rate <1), while the T cell proliferation rate in the LPS-stimulated co-culture group was faster (relative proliferation rate >1). The T cell proliferation rate in the LPS-stimulated co-culture group was significantly different from that in the unstimulated co-culture group.

[0081] The results showed that resting Ad-MSCs without LPS stimulation had a certain degree of anti-inflammatory effect, while Ad-MSCs stimulated by LPS promoted T cell proliferation and had a certain pro-inflammatory effect.

[0082] Example 3: Subcutaneous injection of Ad-MSCs mixed matrix gel into normal mice and detection of immune cell infiltration in the matrix gel. I. Experimental Methods According to the grouping, Ad-MSCs were seeded in culture dishes and stimulated with LPS for 6 h (final concentration 1 μg / mL); a control group was set up without LPS stimulation. After trypsin digestion, cells were collected by centrifugation at 300 g for 5 min, and the collected cells were resuspended in 1 mL PBS to obtain a cell suspension. The cell suspension was mixed with an equal volume of matrix gel and then subcutaneously injected into normal mice in the groin, with each mouse receiving 200 μL of the mixture. A control group was set up and injected with an equal volume of PBS.

[0083] The levels of IL-6 and TNF-α in orbital blood serum were measured by ELISA on days 1, 2, and 3 after injection.

[0084] Three days later, the matrix gel was removed and fixed in 4% paraformaldehyde for 24 h. Paraffin sections were prepared, and HE and CD45 immunohistochemical staining was used to evaluate the infiltration of immune cells.

[0085] II. Experimental Results The results of serum IL-6 and TNF-α levels are shown in the figure. Figure 3 Compared to PBS injection, injection of unstimulated Ad-MSCs slightly increased serum IL-6 and TNF-α levels, with only IL-6 showing a significant difference on day 1; other results showed no significant difference. Compared to PBS-injected and unstimulated Ad-MSCs, LPS-stimulated Ad-MSCs significantly induced an upregulation of serum IL-6 and TNF-α levels. This demonstrates that LPS stimulation of Ad-MSCs can induce increased secretion of pro-inflammatory factors IL-6 and TNF-α in normal mice, exhibiting a certain degree of pro-inflammatory function.

[0086] HE and CD45 immunohistochemical staining are shown in the figure. Figure 4 The results showed that, compared with the PBS-mixed matrix gel injection group, both the unstimulated Ad-MSCs and the LPS-stimulated Ad-MSCs-mixed matrix gel injection group significantly induced CD45. + Recruitment of immune cells. Furthermore, the LPS-stimulated group induced CD45 levels compared to the unstimulated group. + Immune cell recruitment was more significant. This demonstrated that resting Ad-MSCs (without LPS stimulation) could induce immune cell recruitment in normal mice, and that LPS promoted the recruitment of immune cells by Ad-MSCs, indicating that LPS further amplified the pro-inflammatory function of Ad-MSCs.

[0087] Example 4: Evaluation of the efficacy of LPS-induced Ad-MSCs tail vein injection in treating LPS-induced acute pneumonia in mice. I. Experimental Methods 1. Preparation of LPS-induced acute pneumonia mouse model Mice were anesthetized by intraperitoneal injection of 0.5% sodium pentobarbital (5 μL / g). The tongue of the mice was pulled out with tweezers, and 50 μL of LPS solution (1 g / L) was dripped into the posterior pharyngeal wall. The nasal cavity of the mice was immediately pinched for 20 seconds. Then the tongue and nose were released, and the mice were placed in the rearing cage and allowed to wake up naturally. Mice that were not treated with LPS were used as controls.

[0088] 2. LPS-induced Ad-MSCs tail vein injection for the treatment of acute pneumonia in mice After LPS treatment for 4 h, 10 mg / mole was administered to each mouse. 6 Ad-MSCs, administered via tail vein injection (with LPS-untreated mice as controls) at a dose of 1 cell / 100 μL, were either LPS-stimulated or unstimulated (final concentration 1 μg / mL after 6 h), with PBS injection as a control. Mice were euthanized 3 days later, and lung tissue was harvested and fixed in 4% paraformaldehyde for 24 h. HE and CD45 immunohistochemical staining were used to evaluate the integrity of the lung tissue and the infiltration of immune cells.

[0089] II. Experimental Results The results showed that ( Figure 5 Compared with the control group injected with PBS, injection of Ad-MSCs without LPS stimulation significantly improved pathological damage in lung tissue. However, after LPS stimulation, the therapeutic effect of Ad-MSCs on acute pneumonia significantly decreased, and the degree of lung tissue damage increased. This demonstrates that LPS-induced pro-inflammatory MSCs are a significant cause of MSC therapy resistance.

[0090] Example 5: Obtaining Heterogeneous Subpopulations of Human Ad-MSCs I. Culture and Sequencing of Ad-MSCs 1. Experimental Methods Ad-MSCs were cultured according to the method in Example 1. During passages 4-6, LPS (final concentration 1 μg / mL) was added to the culture medium to stimulate the Ad-MSCs (0 h, 6 h, 24 h, and 48 h). The culture medium was then discarded, and the cells were digested with 0.25% trypsin-containing cell digestion solution containing EDTA. The digestion was observed under a microscope. Digestion was stopped once the cells became rounded and detached from the bottom of the culture dish. The cells were centrifuged, the supernatant was discarded, and the cells were resuspended in PBS, centrifuged again, and the supernatant was discarded. The cells were then resuspended in 500 μL of TRIzol to lyse them. The cells were then sent to Chongqing Life Source Technology Co., Ltd. for single-cell RNA sequencing (scRNA-seq).

[0091] 2. Experimental Results scRNA-seq sequencing results are shown below Figure 6After cell quality control and data standardization, a total of 33,354 Ad-MSCs atlases were obtained. After UMAP dimensionality reduction visualization and unbiased clustering, seven cell subpopulations (cluster 1–7) were obtained. The changes in cell number in each subpopulation showed that the cell number in cluster 1 was positively correlated with LPS in a time-dependent manner.

[0092] Furthermore, transcriptomic features of the four groups of Ad-MSCs showed that cluster 1 highly expressed pro-inflammatory genes, such as classic pro-inflammatory factors (IL-1β, IL-6, and TNF-α) and chemokines (CXCL10 and CXCL11). Therefore, cluster 1 is considered to be a pro-inflammatory heterogeneous subset of Ad-MSCs.

[0093] II. Screening of marker molecules for heterogeneous subsets of pro-inflammatory human Ad-MSCs In-depth analysis was conducted on differentially expressed genes in cluster 1. pct.1 represents the percentage of cells expressing the gene in the cluster, and pct.2 represents the percentage of cells expressing the gene in other subpopulations. Differentially expressed genes were ranked using the pct.1 / pct.2 ratio; a higher ratio indicates a purer cell subpopulation selected using that molecule, meaning it is more likely to serve as a cell subpopulation marker. The top 30 genes were selected as pre-selected marker molecules, and subsequently, seven molecules that can be expressed on the cell membrane (FKN, GBP4, IL4I1, TNFSF10, CXCL11, SERPINB2, and CXCL10) were identified.

[0094] To further identify the cluster 1 subset, potential marker genes in cluster 1 were screened among the four groups based on a log2 fold change greater than 0.2, with the percentage of cells expressing these genes in cluster 1 (pct.1) being at least 1% higher than in other cells (pct.2). Crossover analysis of marker genes using Venn diagrams revealed the presence of 17 marker genes stably expressed in cluster 1, among which FKN was identified as a cell membrane protein gene.

[0095] In summary, considering the specificity of cells in a resting state, FKN was designated as a marker molecule for the cluster 1 subgroup.

[0096] 3. FKN - Ad-MSCs and FKN + Ad-MSCs Magnetic Bead Sorting 1. Experimental Methods Ad-MSCs (unsorted Ad-MSCs) cultured according to the method in Example 1 were digested with trypsin, washed 1-2 times with PBS, centrifuged and the PBS was discarded. Cell sorting buffer and PE-FKN antibody were added and incubated in the dark for 15 min. After centrifugation to remove the antibody, cell sorting buffer and PE magnetic beads were added again and incubated in the dark for another 10 min. Cell sorting buffer was then added to dilute the cells, and the cells were passed through a column. Before passing the cells through the column, the LS sorting column was rinsed twice with cell sorting buffer.

[0097] FKN + Ad-MSCs, labeled with PE magnetic beads, are adsorbed onto the sorting column under the influence of a magnetic field; FKN - Ad-MSCs are not labeled with PE magnetic beads and flow directly into the receiving tube.

[0098] Remove the sorting column from the magnetic rack and rinse twice with cell sorting buffer. Since the magnetic field is no longer present, the FKN... + Ad-MSCs will flow directly into the receiving tube. FKN + Ad-MSCs and FKN - Ad-MSCs were centrifuged, and a portion was collected for flow cytometry identification. If the purity was low, cells could be collected again by column chromatography. If the purity was high, stem cell culture medium could be added, and the cells could be incubated for expansion culture.

[0099] FKN + Ad-MSCs and unsorted Ad-MSCs were stimulated with LPS (final concentration 1 μg / mL) for 6 h to activate them, while those not stimulated with LPS were in a resting state. qRT-PCR and ELISA were used to detect FKN after 6 h of LPS stimulation. + mRNA expression and protein secretion of pro-inflammatory factors (IL-1β, IL-6 and TNF-α) in Ad-MSCs and unsorted Ad-MSCs (supernatant).

[0100] 2. Experimental Results See results Figure 7 FKN was detected in unsorted Ad-MSCs cells. + The proportion of Ad-MSCs was 7.13%. Subsequently, FKN was separated using magnetic bead sorting technology. + The Ad-MSCs subpopulation was isolated, and the expression rate of FKN after separation was 90.03%.

[0101] At the mRNA and protein levels, FKN + FKN expression in Ad-MSCs was also significantly higher than in unsorted Ad-MSCs. This indicates that LPS can induce FKN expression. +The transcriptional level of FKN was upregulated in both Ad-MSCs and unsorted Ad-MSCs. However, it had no effect on protein expression, possibly because protein expression is delayed, and its upregulation occurs later than the upregulation of mRNA expression.

[0102] The results showed that FKN + Ad-MSCs showed higher gene expression and secretion of pro-inflammatory factors in both the resting state (without LPS stimulation) and the LPS-induced activated state than in unsorted Ad-MSCs, but the expression and secretion of pro-inflammatory factors were only significantly upregulated in the activated state.

[0103] III. Unsorted Ad-MSCs and FKN + Effects of Ad-MSCs on T cell proliferation 1. Experimental Methods Same as Example 2.

[0104] 2. Experimental Results result( Figure 8 The display shows that, regardless of whether it is in a resting or active state, FKN + Ad-MSCs demonstrated a stronger ability to promote T cell proliferation than unsorted Ad-MSCs. This further demonstrates the effectiveness of FKN... + Ad-MSCs are a group of cells with high pro-inflammatory properties.

[0105] Example 6: Unsorted Ad-MSCs, FKN + Ad-MSCs and FKN - Comparison of the proliferation capacity of Ad-MSCs I. Experimental Methods 1. Cell culture FKN obtained in Example 5 was cultured in a 37°C (5% CO2) incubator using DMEM / F-12 containing serum substitute. + Ad-MSCs, FKN - Ad-MSCs and unsorted Ad-MSCs cells were cultured for passages 4 to 6 for subsequent experiments.

[0106] 2. Transcription sequencing to detect unsorted Ad-MSCs and FKN + Ad-MSCs and FKN - Proliferative capacity of Ad-MSCs Following the method in Example 1, FKN cells cultured to the 4th to 6th generations were stimulated with LPS (final concentration 1 μg / mL). + Ad-MSCs, FKN -Ad-MSCs and unsorted Ad-MSCs cells were collected for 0 h or 6 h and sent to Shanghai Zhongke New Life Biotechnology Co., Ltd. for RNA-seq sequencing.

[0107] 3. CCK-8 staining detection of unsorted Ad-MSCs and FKN + Ad-MSCs and FKN - Proliferative capacity of Ad-MSCs Take FKN cells cultured to the 4th to 6th generation. + Ad-MSCs, FKN - Ad-MSCs and unsorted Ad-MSCs cells were digested and centrifuged, resuspended in 1 mL of stem cell culture medium (containing 1 μg / mL LPS), counted, and diluted to 20 cells / μL. Cells were then aliquoted into new EP tubes, and seeded into 96-well plates at 100 μL / well. The plates were then incubated for 6 h. After 6 h, the 96-well plates were removed, and 10 μL / well of CCK-8 was added. The plates were then incubated for another 30 min. Finally, the absorbance of each well at 450 nm was measured using a microplate reader to quantify the cell proliferation rate.

[0108] 4. Real-time analysis of cell proliferation Add 80 μL of stem cell culture medium to the RTCA microplate, place it in the RTCA real-time label-free cell analyzer for calibration (the instrument is placed in a cell culture incubator), and determine the baseline.

[0109] Take FKN cells cultured to the 4th to 6th generation. + Ad-MSCs, FKN - Ad-MSCs and unsorted Ad-MSCs were digested, centrifuged, resuspended in 1 mL of stem cell culture medium, and counted. Cells were added to calibrated RTCA microplates at a density of 1000 cells per well, and the culture medium was brought to a final volume of 200 μL. Simultaneously, LPS (final concentration 1 μg / mL) was added to the LPS-treated group. The plates were incubated in a clean bench at room temperature for 30 min to allow complete cell adhesion. Cell proliferation was then monitored using an RTCA real-time label-free cell analyzer.

[0110] II. Experimental Results See results Figure 9 RNA-seq showed that there were no significant differences in the expression of proliferation-related genes and proliferation activity among the three cell types before and after LPS stimulation. CCK-8 staining and real-time RTCA cell proliferation analysis revealed unsorted Ad-MSCs and FKN cells. + Ad-MSCs and FKN -Ad-MSCs showed decreased proliferation after LPS stimulation, but gradually recovered with prolonged stimulation, further indicating that the effect of LPS on Ad-MSCs is time-dependent. In summary, compared with unsorted Ad-MSCs, FKN... + Ad-MSCs and FKN - The proliferation capacity of Ad-MSCs did not change significantly.

[0111] Example 7 Unsorted Ad-MSCs, FKN + Ad-MSCs and FKN - Comparison of migration capabilities of Ad-MSCs I. Experimental Methods 1. Transcription sequencing to detect unsorted Ad-MSCs and FKN + Ad-MSCs and FKN - Migration capability of Ad-MSCs.

[0112] Same as Example 6.

[0113] 2. Transwell detection of unsorted Ad-MSCs and FKN + Ad-MSCs and FKN - Migration capabilities of Ad-MSCs Take the FKN cultured to the 4th to 6th generations from Example 6. + Ad-MSCs, FKN - Ad-MSCs and unsorted Ad-MSCs cells were digested, centrifuged, resuspended in 1 mL stem cell culture medium (containing 1 μg / mL LPS), counted, and diluted to 20 cells / μL.

[0114] Then, remove the Transwell chambers and their associated 24-well plates. Add 650 μL of culture medium (containing 1 μg / mL LPS) to the plate, and add 100 μL of cell suspension to the Transwell chambers. Make up the volume to 200 μL with culture medium, ensuring the liquid level in the plate covers the lower edge of the chamber but does not exceed the upper edge to prevent cell overflow. Incubate for 6 hours. Afterward, discard the culture medium, fix the Transwell chambers with 4% paraformaldehyde, stain with crystal violet, wash twice with PBS, and observe cell migration under a microscope.

[0115] 3. Scratch test to detect unsorted Ad-MSCs and FKN + Ad-MSCs and FKN - Migration capabilities of Ad-MSCs FKN cultured to the 4th to 6th generations in Example 6 +Ad-MSCs, FKN - Ad-MSCs and unsorted Ad-MSCs were seeded into 6-well plates when cell confluence was >80%, and then cultured in a cell culture incubator. When cell confluence in the 6-well plates reached 100%, the plates were removed, and a straight line was drawn in the middle of each well using a 1 mL pipette tip with the aid of a ruler or plate cap, ensuring even pressure and a straight line. The culture medium was then aspirated, and the plates were washed twice with PBS to remove detached cells. Fresh culture medium was then added, followed by LPS (final concentration 1 μg / mL), and the plates were incubated in the cell culture incubator. After 6 h, 12 h, 24 h, and 48 h, the plates were removed, photographed under a microscope to observe cell migration, and the trace area was statistically analyzed using ImageJ software.

[0116] II. Experimental Results See results Figures 10 to 12 RNA-seq sequencing Figure 10 The results showed that there were no significant differences in the expression of migration-related genes and migration ability among the three cell types before and after LPS stimulation; the scratch assay ( Figure 11 The results showed no significant differences in the migration of the three cell types after LPS stimulation among the groups. Only in the Transwell assay (…) Figure 12 In this study, LPS stimulation for 6 h slightly reduced cell migration ability, but the difference was not significant. In summary, compared with unsorted Ad-MSCs, FKN... + Ad-MSCs and FKN - The migration ability of Ad-MSCs did not change significantly.

[0117] Example 8: Unsorted Ad-MSCs, FKN + Ad-MSCs and FKN - Trilineal differentiation potential of Ad-MSCs I. Experimental Methods 1. Trilineal differentiation induction FKN cultured to the 4th to 6th generations in Example 6 + Ad-MSCs, FKN - The trilineage differentiation potential of Ad-MSCs and unsorted Ad-MSCs cells was assessed.

[0118] Osteogenic induction: Before seeding cells, add 1 mL of 0.1% gelatin to each well of a 6-well plate, gently shake to spread the cells evenly at the bottom, and then incubate in a clean bench for 30 min. Remove the gelatin and seed the cells (unsorted Ad-MSCs, FKN...). + Ad-MSCs and FKN - Ad-MSCs) were respectively administered at 2×105 Cells were seeded into 6-well plates coated with gelatin, and each well was topped with 2 mL of complete culture medium. The plates were then incubated in a cell culture incubator. When cell confluence reached 70%, the culture medium was aspirated, and 2 mL of osteogenic differentiation induction medium was added to each well. The medium was replaced with fresh osteogenic differentiation induction medium every 3 days. After 4 weeks of induction, cell morphology and growth were observed, and osteogenic differentiation was assessed using Alizarin Red staining.

[0119] Chondrogenic induction: Cells (unsorted Ad-MSCs, FKN) + Ad-MSCs and FKN - Ad-MSCs were seeded into 10 cm diameter cell culture dishes. When cell confluence was >90%, the cells were transferred to 15 mL centrifuge tubes and centrifuged at 250 g for 4 min, then the supernatant was discarded. 0.5 mL of chondrogenic differentiation induction premix was added, the cell pellet was resuspended, and centrifuged again at 250 g for 4 min, then the supernatant was discarded. The pellet was then resuspended in 0.5 mL of complete chondrogenic differentiation induction medium and centrifuged at 150 g for 5 min. The cap was loosened to allow gas exchange, and the centrifuge tubes were placed upright in a cell culture incubator without shaking. When cell clusters appeared (usually after 24 or 48 h), the bottom of the centrifuge tube was gently tapped to detach the chondrocytes and suspend them in the medium. During induction, the chondrogenic differentiation induction medium was replaced every 2 days, 0.5 mL per tube. Induction continued until chondrocytes with a diameter of 1.5–2 mm formed in the tubes, at which point the tubes were ready for section staining.

[0120] Adipogenic induction: Before seeding cells, add 1 mL of 0.1% gelatin to each well of a 6-well plate, gently shake to spread the gelatin evenly at the bottom of the plate, and then incubate in a clean bench for 30 min. Remove the gelatin and seed the cells (unsorted Ad-MSCs, FKN...). + Ad-MSCs and FKN - Ad-MSCs) were respectively administered at 2×10 5 Cells were seeded in 6-well plates coated with gelatin, and each well was topped with 2 mL of complete culture medium. The plates were then incubated in a cell culture incubator. When cell confluence reached 100%, the culture medium was aspirated, and 2 mL of human Ad-MSCs adipogenic differentiation induction medium A was added to each well. After 3 days of induction, medium A was aspirated, and 2 mL of human Ad-MSCs adipogenic differentiation induction medium B was added. After 1 day, medium B was aspirated again, and medium A was added for another 3 days of induction. This process of alternating between medium A for 3 days and medium B for 1 day was repeated, with daily observation of cell status. If cells shrank or died during induction with medium A, medium B was immediately replaced until the cells recovered (medium A stimulates lipid droplet formation, while medium B maintains lipid droplet morphology and promotes droplet enlargement). Once sufficient and appropriately sized lipid droplets appeared, staining was prepared.

[0121] 2. Trilineal Differentiation Detection Osteogenic differentiation detection: After osteogenic induction and differentiation, the culture medium was aspirated and the samples were washed twice with PBS. 2 mL of 4% paraformaldehyde solution was added to each well for fixation for 30 min. The fixative was then washed away, followed by two washes with PBS to remove as much fixative as possible. Next, 2 mL of Alizarin Red working solution was added to each well and stained at room temperature for 10 min. The staining solution was aspirated and the samples were washed twice with PBS to remove as much excess staining solution as possible. Finally, 2 mL of PBS was added to each well, and the osteogenic staining was observed under a microscope.

[0122] Chondrogenic differentiation detection: (1) Fixation: Wash the induced cartilage balls twice with PBS, and then fix with 4% paraformaldehyde solution for 30 min.

[0123] (2) Dehydration: The fixed cartilage balls were dehydrated by sequentially using alcohol of varying concentrations: 50% ethanol for 30 min, 70% ethanol for 30 min, 80% ethanol for 30 min, 95% ethanol for 30 min, and anhydrous ethanol for 30 min.

[0124] (3) Transparent: Xylene becomes transparent by mixing equal volumes of xylene and anhydrous ethanol for 2 h, pure xylene for 1.5 h, and pure xylene for 1 h.

[0125] (4) Wax impregnation: Remove the clearing agent and allow the paraffin to penetrate into the cartilage ball for embedding. The process is as follows: mix xylene and paraffin in equal volumes for 40 min (40 ℃), and then mix pure paraffin for 30 min (55 ℃).

[0126] (5) Embedding: Take out the cartilage ball, place it in the mold, pour in paraffin wax, let it stand and cool, then take out the wax block and trim it.

[0127] (6) Slicing: 3 μm thick continuous slices.

[0128] (7) Attaching the slide: Attach the cartilage ball slices to a glass slide and dry them in an oven at 35 ℃.

[0129] (8) Dewaxing: The dewaxing procedure for cartilage bulb sections is as follows: pure xylene for 15 min, pure xylene for 10 min, xylene and anhydrous ethanol mixed in equal volumes for 10 min, 95% ethanol for 10 min, 85% ethanol for 10 min, 70% ethanol for 10 min, and 50% ethanol for 10 min.

[0130] (9) Staining: After dewaxing, the slides are dried, then alixin blue is dropped onto the slides and stained at 37 ℃ for 1 h. The slides are then rinsed with tap water for 5 min and dried.

[0131] (10) Observe the effect of alisin blue staining under a microscope. The alisin blue staining part shows the acidic mucopolysaccharides in the cartilage tissue.

[0132] Adipogenic differentiation detection: After adipogenic differentiation was completed, the culture medium was aspirated and the plates were washed twice with PBS. 2 mL of 4% paraformaldehyde solution was added to each well for fixation for 30 min. The fixative was then washed away, followed by two washes with PBS to remove as much fixative as possible. Oil Red O working solution was mixed and centrifuged at 250 g for 4 min. The supernatant was collected, and 2 mL was added to each well of the plate. Staining was performed at room temperature for 30 min. The staining solution was aspirated, and the plates were washed twice with PBS to remove as much excess staining solution as possible. 2 mL of PBS was then added to each well, and the adipogenic staining was observed under a microscope.

[0133] II. Experimental Results Osteogenesis, chondrogenesis, and adipogenesis were analyzed using alizarin red, aliasin blue, and Oil Red O staining. Results ( Figure 13 The results showed that all three cell types exhibited significant calcium deposition (red), acidic mucopolysaccharides (blue) in cartilage tissue, and clear lipid droplets (red), indicating that all three cell types possess the potential for osteogenic, chondrogenic, and adipogenic differentiation. In summary, unsorted Ad-MSCs and FKNs from the three cell types... + Ad-MSCs and FKN - All Ad-MSCs possessed trilineal differentiation potential, and there were no significant differences among the groups.

[0134] Example 9: FKN molecules participate in regulating the expression and secretion of pro-inflammatory factors. I. Experimental Methods (i) Knockdown and overexpression of the FKN gene in wild-type Ad-MSCs 1. Overexpression of FKN gene (1) Construction of lentiviral vector overexpressing FKN The constructed lentiviral vector was provided by Jikai Gene Medical Technology Co., Ltd., and the specific information is as follows: The gene name is: CX3CL1 (NM_002996); The species is: human; The tool type is: lentivirus; Original sequence: Ubi-MCS-3FLAG-SV40-EGFP-IRES-puromycin; The viral titer was 1.00E+8 TU / mL.

[0135] (2) Lentiviral transfection of MSCs Ad-MSCs (wild-type Ad-MSCs, i.e., unsorted Ad-MSCs) were seeded into 6-well plates at a density of 5 × 10⁻⁶. 4 Cells were cultured in a cell culture incubator until 30% confluence, ready for transfection. The 6-well plate was removed, the culture medium was aspirated, and 1 mL of fresh stem cell culture medium was added, followed by 40 μL of HitransGP (25×) infection reagent and 20 μL of lentivirus solution. The plate was then incubated for 18 h. The plate was then removed, the old culture medium was replaced with fresh medium, and the plate was incubated again. After 48 h, the infection efficiency was observed under a fluorescence microscope, yielding FKN-overexpressing Ad-MSCs (FKN OE Ad-MSCs).

[0136] 2. Knock down the FKN gene (1) Construction and amplification culture of competent DH5α Escherichia coli carrying FKN shRNA lentiviral vector Wuhan Miaoling Biotechnology Co., Ltd. constructed and synthesized a plasmid and transformed competent DH5α Escherichia coli strains to obtain a recombinant strain for knocking down FKN, which was then cultured and amplified in LB liquid medium.

[0137] The FKN shRNA sequence information includes: target sequence 21 bp, loop sequence 6 bp, and guide sequence 21 bp. CCCGGAGCTGTGGTAGTAATTCTCGAGAATTACTACCACAGCTCCGGG (SEQ ID NO: 1).

[0138] (2) Plasmid extraction The endotoxin-free plasmid extraction kit produced by Tiangen Biotech Co., Ltd. was used to extract plasmids from the recombinant strains used to knock down FKN, obtaining the target plasmid. The extraction method was performed according to the instructions included with the kit. The plasmid was then air-dried in a clean bench.

[0139] (3) Amplification of plasmid genes 293T cells were seeded into 6-well plates. When the cell confluence reached 90%, transfection could be performed. The specific steps are as follows: Take a sterile EP tube and add 100 μL of Opti-MEM medium and 4 μg of the target plasmid and helper plasmid. Gently mix with a pipette. Take another sterile EP tube and add 100 μL of DMEM medium and 6 μL of transfection reagent (Lipofectamine). TMThe plasmid and transfection reagent from two EP tubes were then gently mixed with a pipette and incubated at room temperature for 5 min. The plasmid and transfection reagent were then mixed and incubated at room temperature for 20 min. The culture medium was then aspirated from the 6-well plate, and 200 μL of the mixed reagent was added to one well of the 6-well plate. After 6 h, the solution in the 6-well plate was replaced with 2 mL of fresh culture medium. After 48 h of incubation, the supernatant was collected for subsequent transfection of MSCs.

[0140] (4) Transfect MSCs and screen for FKN knockdown cells Wild-type Ad-MSCs were seeded into 6-well plates at a density of 5 × 10⁶. 4 Cells were cultured in a cell culture incubator until 90% confluence, at which point knockdown could be performed. The 6-well plate was removed, the culture medium was aspirated, and 1 mL of fresh stem cell culture medium was added, followed by 40 μL of the infection reagent HitransGP (25×) and 100 μL of the culture supernatant collected in the previous step. The plate was then cultured again for 18 h. The plate was then removed, the old culture medium was replaced with fresh culture medium, and the plate was cultured again. After 24 h, puromycin (final concentration 1 μg / mL) was added to the culture medium, and FKN knockdown Ad-MSCs (FKN KD Ad-MSCs) were obtained through screening.

[0141] (II) Effects of knockdown or overexpression of FKN on Ad-MSCs qRT-PCR and ELISA were used to detect the expression and secretion of pro-inflammatory factors (IL-1β, IL-6 and TNF-α) in wild-type Ad-MSCs, FKN KD Ad-MSCs and FKN OE Ad-MSCs after or without LPS induction (final concentration 1 μg / mL, 6h).

[0142] T cells were isolated according to the method in Example 2. The T cells were co-cultured with Ad-MSCs (wild-type Ad-MSCs, FKN KDAd-MSCs and FKN OE Ad-MSCs) to detect the effect of Ad-MSCs on T cell proliferation.

[0143] Wild-type Ad-MSCs, FKN KD Ad-MSCs, and FKN OE Ad-MSCs were mixed in a matrix gel according to the method in Example 3, and normal mice were subcutaneously injected with the gel and immune cell infiltration was detected.

[0144] LPS-induced acute pneumonia mice were prepared according to the method in Example 4. Wild-type Ad-MSCs, FKN KDAd-MSCs, and FKN OE Ad-MSCs were administered at a dose of 10 per mouse. 6The dose was administered via tail vein injection, with PBS injection serving as a control. HE and CD45 immunohistochemical staining were used to evaluate the integrity of lung tissue and the extent of immune cell infiltration.

[0145] (3) FKN - Ad-MSCs and FKN + FKN phosphorylated proteomics analysis in Ad-MSCs FKN-Ad-MSCs and FKN were obtained according to the method in Example 5. + Ad-MSCs were used for phosphorylated proteomics analysis.

[0146] II. Experimental Results The results are as follows Figure 14 and 15 As shown, wild-type Ad-MSCs in the resting state (without LPS stimulation) expressed low levels of FKN. After LPS stimulation, the expression of FKN showed a time-dependent increase followed by a decrease, essentially returning to pre-stimulation levels after 48 hours, demonstrating the dynamic expression of FKN. Furthermore, at the transcriptional and protein levels, overexpression of FKN in wild-type Ad-MSCs, followed by LPS induction, significantly upregulated the expression and secretion of pro-inflammatory factors IL-6 and TNF-α, proving the pro-inflammatory effect of FKN. However, knockdown of FKN in wild-type Ad-MSCs, followed by LPS induction, only showed a decreasing trend in the expression and secretion of pro-inflammatory factors IL-6 and TNF-α, without significant differences. This may be because wild-type Ad-MSCs themselves have low FKN expression levels, and knockdown of FKN has little effect on the expression of their pro-inflammatory factors.

[0147] result Figure 16 As shown, LPS stimulation of both wild-type Ad-MSCs and FKN-overexpressing Ad-MSCs promoted T cell proliferation (relative proliferation rate > 1), but FKN knockdown Ad-MSCs appeared to have no effect on T cell proliferation, consistent with their levels of secreted pro-inflammatory factors. Notably, compared to wild-type Ad-MSCs, FKN knockdown Ad-MSCs showed a significantly reduced ability to promote T cell proliferation, while FKN-overexpressing Ad-MSCs showed a significantly enhanced ability. This further demonstrates that FKN can participate in the pro-inflammatory function of Ad-MSCs by promoting T cell proliferation.

[0148] result Figure 17 As shown, in normal mice, three cell types mixed with a matrix gel were subcutaneously injected into the groin. Three days later, the matrix gel was collected, and HE and CD45 IHC staining results indicated that, compared to wild-type Ad-MSCs, FKN KD Ad-MSCs recruited CD45. +The ability of immune cells was significantly reduced, but FKN OE Ad-MSCs recruited CD45. + The ability of immune cells was significantly enhanced. After successful induction of acute pneumonia in BALB / c female mice using LPS, three cell types were injected via the tail vein. Lung tissue was harvested three days later to analyze the degree of pathological damage and immune cell infiltration. HE and CD45 IHC staining results showed that, compared with wild-type Ad-MSCs, FKN KDAd-MSCs reduced CD45 levels. + Immune cell infiltration improved lung inflammation more effectively, while FKN OE Ad-MSCs showed poorer therapeutic effects. In mice, FKN was confirmed to be involved in the pro-inflammatory function of MSCs and was associated with resistance to MSC treatment.

[0149] The results of phosphorylated proteomics analysis are shown below. Figure 18 As shown, the results indicate that FKN + Ad-MSCs uniquely contain 282 phosphorylated proteins, FKN - Ad-MSCs have 355 unique phosphorylated proteins, indicating that the two cell types have significant differences in the activation of signaling pathways.

[0150] See results Figure 19 Compared to FKN - Ad-MSCs, FKN + The phosphorylation level of NF-κB p65 was significantly upregulated in Ad-MSCs. This demonstrates that FKN + High-level activation of the NF-κB signaling pathway in Ad-MSCs.

[0151] See results Figure 20 Without LPS stimulation, FKN + Surprisingly, the NF-κB pathway in MSCs showed high levels of activation, which was further enhanced after LPS stimulation. Knockdown of FKN... + Expression of FKN in MSCs significantly reduced the activation level of the NF-κB pathway. This demonstrates that FKN can activate the NF-κB signaling pathway in MSCs, inducing a pro-inflammatory phenotype.

[0152] Example 10 RNA-seq detection of unsorted Ad-MSCs and FKN - Ad-MSCs and FKN + Expression level of anti-inflammatory factors in Ad-MSCs I. Experimental Methods FKN cultured to the 4th to 6th generations in Example 6 + Ad-MSCs, FKN -RNA-seq was performed on Ad-MSCs and unsorted Ad-MSCs cells, with or without LPS induction (final concentration 1 μg / mL, 6 h).

[0153] II. Experimental Results See results Figure 21 At rest (without LPS induction), FKN - The expression levels of anti-inflammatory factors in Ad-MSCs were significantly higher than those in unsorted Ad-MSCs and FKN. + Ad-MSCs, unsorted Ad-MSCs showed intermediate levels of anti-inflammatory factor expression, while FKN... + The expression of anti-inflammatory factors in Ad-MSCs was at its lowest level in all three cell types. Regarding the expression of pro-inflammatory genes, FKN... + The expression levels of Ad-MSCs were significantly higher than those of unsorted Ad-MSCs and FKN. - Ad-MSCs, while unsorted Ad-MSCs and FKN - The expression levels of Ad-MSCs were all low. This indicates that FKN... - Ad-MSCs have the therapeutic potential of weakened pro-inflammatory function and enhanced anti-inflammatory function.

[0154] Example 11 Unsorted Ad-MSCs and FKN - Effects of Ad-MSCs on T cell proliferation I. Experimental Methods To simulate the high LPS microenvironment in mice with acute pneumonia, LPS-induced unsorted Ad-MSCs and FKN were detected. - The effect of Ad-MSCs on T cell proliferation. Unsorted Ad-MSCs and FKN were obtained according to the method in Example 5. - Ad-MSCs were subjected to LPS stimulation (final concentration 1 μg / mL, 6 h) or no stimulation, and T cells were isolated according to the method in Example 2, and the effect on T cell proliferation was detected.

[0155] II. Experimental Results The results are as follows Figure 22 The results showed that both types of MSCs without LPS stimulation could inhibit T cell proliferation (relative proliferation rate <1), and compared with unsorted Ad-MSCs, FKN - Ad-MSCs exhibited a stronger inhibitory effect; unsorted Ad-MSCs, after LPS induction, significantly promoted T cell proliferation (relative proliferation rate > 1), while FKN... - Ad-MSCs still have an inhibitory effect on T cell proliferation (relative proliferation rate <1).

[0156] LPS still weakened FKN - Ad-MSCs showed no significant difference in their inhibitory effect on T cell proliferation, while LPS significantly induced and enhanced the T cell proliferation-promoting effect of unsorted Ad-MSCs. This demonstrates the effectiveness of FKN... - Ad-MSCs have better anti-inflammatory potential than wild-type Ad-MSCs and are largely unaffected by LPS induction.

[0157] Example 12 FKN - Effects of Ad-MSCs on Lung Inflammation in Mice with Acute Pneumonia I. Experimental Methods LPS-induced acute pneumonia mice were prepared according to the method in Example 4, and unsorted Ad-MSCs and FKN were obtained according to the method in Example 5. + Ad-MSCs and FKN - Ad-MSCs. 10 per mouse 6 Ad-MSCs were administered via tail vein injection at a dose of 100 μL per cell, with PBS injection serving as a control.

[0158] Three days later, blood was collected from the orbital cavity, and the mice were euthanized. Lung tissue was removed, and a portion of it was fixed in 4% paraformaldehyde for 24 hours. HE and CD45 (HE and IHC) immunohistochemical staining was used to evaluate the integrity of the lung tissue and the infiltration of immune cells. Lung tissue homogenate was prepared from a portion of the tissue. The levels of IL-1β, IL-6 and TNF-α in serum and lung tissue homogenate were detected by ELISA.

[0159] The method for preparing lung tissue homogenate is as follows: Weigh the lung tissue and place it in a homogenizing tube. Add PBS to the tube at a ratio of 1g lung tissue to 3mL PBS. Add 3 grinding balls to each tube, tighten the cap, and place the tube in a tissue homogenizer. Use the default program for homogenization. After homogenization, remove the tube and centrifuge at 2500 rpm for 5 minutes. Transfer the supernatant to a new EP tube for subsequent cytokine concentration detection.

[0160] II. Experimental Results ELISA results can be found Figure 23 Compared with the control group injected with PBS, unsorted Ad-MSCs and FKN - Ad-MSCs significantly reduced lung tissue ( Figure 23 A in the middle) and serum ( Figure 23 The levels of IL-1β, IL-6, and TNF-α in (B) were also examined. Additionally, compared to unsorted Ad-MSCs, FKN... - Ad-MSCs reduced IL-1β, IL-6, and TNF-α levels even more significantly. Even after FKN...- After treatment with Ad-MSCs, serum levels of IL-1β, IL-6, and TNF-α decreased to levels comparable to those in normal mice, but lung tissue levels of IL-1β, IL-6, and TNF-α remained higher than in normal mice. Interestingly, unsorted Ad-MSCs also significantly inhibited the levels of pro-inflammatory factors in the serum and lung tissue of mice with acute pneumonia, but the inhibitory effect was limited, and the levels of pro-inflammatory factors remained significantly higher than in normal mice. In conclusion, the ELISA results demonstrated that FKN - Ad-MSCs were more effective than unsorted Ad-MSCs in inhibiting the release of pro-inflammatory factors in mice with acute pneumonia.

[0161] The extent of lung tissue damage and the status of immune cell infiltration are shown in the figure. Figure 24 Compared with the control group injected with PBS, the injection of unsorted Ad-MSCs and FKN - Ad-MSCs can significantly reduce inflammatory damage in lung tissue and alleviate CD45. + Immune cell infiltration. Compared to the unsorted Ad-MSCs treatment group, FKN... - Ad-MSCs are even more effective at protecting lung tissue and improving lung inflammation. Even after FKN... - After Ad-MSCs treatment, the integrity of lung tissue and CD45 + The cellular level was comparable to that of normal mice. This demonstrates that FKN is effective in treating LPS-induced acute pneumonia in mice. - Ad-MSCs showed better efficacy than unsorted Ad-MSCs and no treatment resistance was observed.

Claims

1. A subpopulation of mesenchymal stem cells, characterized in that, The mesenchymal stem cell subpopulation is FKN. - Mesenchymal stem cells.

2. The mesenchymal stem cell subpopulation according to claim 1, characterized in that, The mesenchymal stem cell subpopulation is FKN. - Human mesenchymal stem cells.

3. The mesenchymal stem cell subpopulation according to claim 1, characterized in that, The mesenchymal stem cell subpopulation is FKN. - Human adipose-derived mesenchymal stem cells.

4. The mesenchymal stem cell subpopulation according to claim 1, characterized in that, The method for preparing the mesenchymal stem cell subpopulation is as follows: isolate and culture mesenchymal stem cells; mix them with FKN antibody, and obtain the mesenchymal stem cell subpopulation by removing the mesenchymal stem cells that bind to FKN antibody.

5. The use of the mesenchymal stem cell subsets described in any one of claims 1 to 4 in the preparation of pneumonia drugs.

6. The application according to claim 5, characterized in that, The pneumonia in question is acute pneumonia.

7. The application according to claim 5, characterized in that, The mesenchymal stem cell subsets inhibit T cell proliferation.

8. The application according to claim 5, characterized in that, The mesenchymal stem cell subsets protect lung tissue, improve lung tissue inflammation, and reduce CD45 levels. + Immune cell infiltration and / or treatment resistance.

9. The application according to claim 5, characterized in that, The mesenchymal stem cell subsets inhibit the secretion of pro-inflammatory factors.

10. The application according to claim 9, characterized in that, The pro-inflammatory factors are IL-1β, IL-6 and / or TNF-α.

Images