Method for creating early flowering short growth period oilseed rape wa817

CN122648469APending Publication Date: 2026-08-28SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610877342.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-17
Publication Date
2026-08-28

AI Technical Summary

Technical Problem

但目前推广的油稻品种存在茬口矛盾,尤其是川渝地区,水稻必须在三月中上旬播种才会使抽穗期避开夏季高温,而油菜成熟则是在五月中上旬,这种时间差异导致南方冬季有大量耕地被闲置

Benefits of technology

[0012] The innovation and beneficial effects of this invention are as follows: This invention edits rapeseed... BnaTFL1Genetic screening was conducted to identify the rapeseed WA817, which exhibits superior performance in various aspects, particularly a shortened growth period. This mutant gene can be used to cultivate new early-flowering and/or short-growing rapeseed germplasm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122648469A_ABST
    Figure CN122648469A_ABST
Patent Text Reader

Abstract

The application belongs to the field of genetic engineering, and particularly relates to a method for creating early flowering and / or short growth period rapeseed WA817. The application edits the rapeseed BnaTFL1 gene by using a CRISPR / Cas9 gene editing technology, and breeds the obtained gene editing material, to obtain early flowering and / or short growth period germplasm WA817. The germplasm can be used to create new early flowering and / or short growth period rapeseed varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a method for creating an early-flowering and / or short-growing rapeseed variety WA817. Background Technology

[0002] Brassica napus L. AACC, 2n = 38 plays a crucial role among oilseed crops in my country, accounting for approximately one-third of the global planting area and total seed production. It supplies China with 5.2 million tons of high-quality rapeseed oil annually, making it the third largest source of vegetable oils. Breeding early-flowering, short-growing-period rapeseed varieties can fully utilize fallow winter fields in southern China, enabling rice-oilseed rotation and year-round high-efficiency production. This approach avoids competing with grain crops for land while expanding the effective planting scale of rapeseed, ensuring stable total yield through production layout. This study focuses on oilseed security and aims to maintain and increase yields. It utilizes gene editing to improve flowering time traits to achieve guaranteed yields in the field.

[0003] In southern China, the rice-oilseed oil rotation system can effectively address the problem of idle land. Planting rapeseed after the autumn rice harvest allows for the effective utilization of fallow winter fields, thereby reducing costs, increasing efficiency, and maximizing land use. The rice-oilseed oil rotation system not only benefits the utilization of fallow winter fields in the south but also enhances the annual total yield and economic benefits per unit area. However, currently promoted rice-oilseed oil varieties present a crop rotation conflict, especially in the Sichuan-Chongqing region. Rice must be sown in mid-March to avoid the summer heat during the heading period, while rapeseed matures in mid-May. This time difference results in a large amount of arable land being left idle in the south during winter. Rapeseed has indeterminate inflorescences, and its plant height and maturity are inconsistent. The currently promoted rapeseed varieties have excessively long flowering times, hindering the successful implementation of the rice-oilseed oil rotation. Timely flowering of rapeseed can not only resolve the crop rotation conflict with rice but also avoid yield reduction and pest infestation caused by weather factors. Determinate inflorescences not only flower earlier than wild indeterminate inflorescences but also have a shorter growth period and plant height. Based on the vernalization and flowering requirements of Brassica napus, it is classified into three ecotypes: winter-type, semi-winter-type, and spring-type. Flowering time, the plant's vernalization requirements, and its responsiveness to vernalization are the main factors influencing the climatic adaptation of superior germplasm regions. The flowering time of plants is strictly controlled by environmental and developmental signals. Plants need to reach a certain stage of developmental capacity before they can cope with changes in environmental factors, such as photoperiod, winter temperature, and water stress. Timely flowering allows rapeseed to transition from the vegetative to the reproductive stage, enabling seed development to be completed under favorable environmental conditions. This adaptive effect ensures that plants flower synchronously at the optimal time to maximize seed yield. Therefore, creating early-flowering rapeseed varieties suitable for mechanized harvesting has become a trend in the industrialization of rapeseed.

[0004] rapeseed BnaTFL1Gene mutations can advance the flowering time of rapeseed and shorten the flowering period, thereby shortening its growth period. This invention utilizes the CRISPR / Cas9 system to target genes related to rapeseed growth period traits. BnaTFL1 Mutations were performed to obtain plants with excellent traits such as early flowering and / or short growth period without affecting yield and agronomic traits, so as to rapidly cultivate new rapeseed germplasm with short flowering period. Summary of the Invention

[0005] The purpose of this invention is to provide a method for creating early-flowering and / or short-growing rapeseed.

[0006] This invention provides a method for cultivating rapeseed with early flowering and / or short growth period, characterized in that: the gene with the sequence shown in SEQ ID NO. 1 in the rapeseed to be improved is replaced with the gene with the sequence shown in SEQ ID NO. 3, and rapeseed plants with shortened growth period are selected.

[0007] In some implementations, the methods for the above-mentioned gene substitution include any of the following: (1) Using rapeseed containing the gene sequence shown in SEQ ID NO. 3 as a donor, the gene sequence shown in SEQ ID NO. 3 is directionally introduced into rapeseed recipient containing the gene sequence shown in SEQ ID NO. 1 through sexual hybridization until the gene sequence shown in SEQ ID NO. 3 completely replaces the gene sequence shown in SEQ ID NO. 1.

[0008] (2) Using genetic engineering techniques, the gene in the rapeseed to be improved, which is the sequence shown in SEQ ID NO. 1, is targeted and modified to the gene shown in SEQ ID NO. 3.

[0009] In some implementations, the aforementioned donor rapeseed comes from seeds with accession number CCTCC NO: P202618.

[0010] The present invention also provides the application of the above-mentioned mutant gene, or the above-mentioned mutant protein, or the above-mentioned method in the creation of rapeseed that is resistant to pod cracking and has early flowering and / or short growth period.

[0011] The rapeseed provided by this invention is deposited at the China Center for Type Culture Collection (address: No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province). The culture name and distinguishing characteristics are: Brassica napus L., WA817, CCTCC NO: P202618, deposit date: June 14, 2026.

[0012] The innovation and beneficial effects of this invention are as follows: This invention edits rapeseed... BnaTFL1Genetic screening was conducted to identify the rapeseed WA817, which exhibits superior performance in various aspects, particularly a shortened growth period. This mutant gene can be used to cultivate new early-flowering and / or short-growing rapeseed germplasm. Attached Figure Description

[0013] Figure 1 Structural diagram of the target gene and schematic diagram of the target site. Arrows indicate target sites and directions.

[0014] Figure 2 The location of the target target domain.

[0015] Figure 3 Early flowering in gene-edited plants. Detailed Implementation

[0016] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0017] As used herein, “rapeseed” refers to any rapeseed plant and includes all plant varieties that can be bred with rapeseed, including the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which the plant can regenerate, plant callus, and complete plant cells in the plant or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in a amino to carboxyl direction. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Committee on Biochemical Nomenclature. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and, unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to that of naturally occurring nucleotides. As used herein, the term “encoding” or “encoded” in the context of a particular nucleic acid means that the nucleic acid contains the necessary information to guide the translation of that nucleotide sequence into a particular protein. Codons are used to represent the information encoding the protein. As used herein, “full-length sequence” referring to a particular polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. Full-length polynucleotides encode the full-length, catalytically active form of that particular protein. The terms “polypeptide” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. This term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. This term is also used for naturally occurring amino acid polymers. The terms “residue” or “amino acid residue” or “amino acid” are used interchangeably in this document to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively, “protein”). Amino acids can be naturally occurring amino acids, and unless otherwise limited, may include known analogs of natural amino acids that can function in a similar manner to naturally occurring amino acids.

[0018] As used herein, the terms "isolated" and "purified" may be used interchangeably to refer to nucleic acids or peptides or their biologically active portions, which are substantially or essentially free of components typically associated with or reacting with the nucleic acid or peptide as found in their natural environment. Thus, when isolated or purified nucleic acids or peptides are produced using recombinant techniques, they are substantially free of other cellular material or culture media, or when isolated or purified nucleic acids or peptides are chemically synthesized, they are substantially free of chemical precursors or other chemicals. "Isolated" nucleic acids typically do not contain sequences (such as protein-coding sequences) naturally flanking the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid may comprise a nucleotide sequence of less than about 0.5 kb naturally flanking the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.

[0019] In this application, the terms "comprising," "including," or variations thereof should be understood to include other elements, numbers, or steps besides those described. "Test plant" or "test plant cell" refers to a plant or plant cell in which genetic modification has taken effect, or a progeny cell of such a modified plant or cell containing the modification. "Control," "control plant," or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell. Control plants or plant cells may include, for example: (a) wild-type plants or cells, i.e., plants or cells with the same genotype as the genetic modification starting material, the genetic modification producing the test plants or cells; (b) plants or plant cells with the same genotype as the starting material but transformed with an empty construct (i.e., a construct with no known effect on the target trait, such as a construct containing the target gene); (c) plants or plant cells that are non-transformed isomers of the test plants or plant cells; (d) plants or plant cells that are genetically identical to the test plants or plant cells but not exposed to conditions or stimuli that would induce the expression of the target gene; or (e) the test plants or plant cells themselves, which are under conditions where the target gene is not expressed.

[0020] Those skilled in the art will readily recognize that advances in molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, have provided a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequences and potential gene sequences of proteins of interest in agriculture.

[0021] In some embodiments, the nucleotide sequence of this application may be modified to perform conserved amino acid substitutions. Principles and examples of conserved amino acid substitutions are further described below. In some embodiments, the nucleotide sequence of this application may be substituted without altering the amino acid sequence according to disclosed monocotyledonous codon preferences; for example, a codon encoding the same amino acid sequence may be substituted with a codon preferred by monocotyledons without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application may be substituted with a different codon encoding the same amino acid sequence, thereby changing the nucleotide sequence without altering the encoded amino acid sequence. Conserved variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiments due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in this application may be substituted according to a codon preferred by monocotyledons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side-chain substituents, such as the hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having the various properties considered above are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978), *Atlas of Protein Sequence and Structure* (Natl. Biomed. Res. Found., Washington, D. C.) (incorporated herein by reference). Conserved substitutions, such as replacing one amino acid with another amino acid having similar properties, can be performed. Identification of sequence consistency includes hybridization techniques. For example, a known nucleotide sequence, in whole or in part, can be used as a probe for selective hybridization with other corresponding nucleotide sequences present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism.

[0022] In some embodiments, a fragment of a nucleotide sequence and the amino acid sequence it encodes is also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide of an embodiment or a portion of the amino acid sequence of a polypeptide. A fragment of the nucleotide sequence may encode a protein fragment that retains the biological activity of the native or corresponding full-length protein and thus has protein activity. Mutant proteins include biologically active fragments of native proteins containing consecutive amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants containing a nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed using an expression vector containing a nucleotide sequence of at least one embodiment and a promoter operatively linked thereto that drives expression in plant cells. Transformed plant cells and transgenic plants represent plant cells or plants whose genome contains a heteropolynucleotide. Generally, the heteropolynucleotide is stably integrated into the genome of the transformed plant cell or transgenic plant to pass the polynucleotide to offspring. The heteropolynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants involved in this application include plant cells, plant protoplasts, plant cell tissue cultures capable of regenerating plants, plant callus, plant masses, and plant cells that are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, fruits, ears, husks, straw, roots, root tips, anthers, etc. This application also includes plant cells, protoplasts, tissues, callus, embryos, flowers, stems, fruits, leaves, and roots derived from transgenic plants of this application or their progeny, and thus at least partially containing the nucleotide sequences of this application.

[0023] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance thereof are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook J & Russell DW, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available and conventional methods well known to those skilled in the art. Example

[0024] Example 1 BnaTFL1 Gene editing The inventors used the CRISPR-Cas9 method to edit BnaA03.TFL1 Gene, BnaA03.TFL1( BnaA03G0021400WE The nucleotide and amino acid sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively. This application selects a targeted... BnaA03.TFL1 We designed and constructed a CRISPR-Cas9 gene editing vector targeting specific targets (see target diagram). Figure 1 The target (CGGTACAACCGATGCTACAT) is located on the PEBP domain (see...). Figure 2 ).

[0025] Gene editing vectors were constructed based on the designed target sites, and the specific process is as follows: PCR amplification primers were designed according to the target sites. After primer synthesis, amplification was performed using the PGTR plasmid as a template. The PCR products were then used to construct the final CRISPR expression vector PV58-K via homologous recombination. Positive clones were screened by colony PCR. Positive clones were selected and sequenced. After confirming the sequences were correct, genetic transformation was performed using Agrobacterium-mediated transformation. The editing vector includes an sgRNA expression cassette driven by the U6 promoter and a Cas9 expression cassette driven by the 35S promoter (see schematic diagram of the vector T-DNA). Figure 3 ).

[0026] The constructed editing vector was transformed into rapeseed to obtain edited plants. The specific process is as follows: The constructed vector was transformed into Brassica napus Westar using Agrobacterium-mediated transformation. After genetic transformation operations such as seed germination, infection, co-culture, callus induction, differentiation, and rooting, 30 T0 generation single plants (named W1-W30) were obtained.

[0027] The gene editing vectors and rapeseed transformation methods described above are all routine experimental procedures in this field.

[0028] Example 2: Identification and Screening of Edited Plants The transformed plants were subjected to positive tests, and 30 successfully transformed plants were selected. T1 generation seeds from these materials were harvested. The T1 generation of these materials, along with the control Westar plants, were planted. PCR amplification and sequencing were used to identify the gene editing status of these lines. Plants containing homozygous edited genotypes were selected from each line (involving 11 lines), and their flowering time and other agronomic traits were investigated, including day to flowers (DTF), flowering period, growth period, plant height, number of effective branches, number of effective siliques, length per silique, number of seeds per silique, yield per plant, and thousand-seed weight. The results showed that among these 11 lines, WA817 had the shortest DTF, flowering period, and growth period (Table 1).

[0029]

[0030] Example 3: Investigation of agronomic traits of gene-edited lines The inventors further investigated the flowering period and other agronomic traits of the gene-edited lines in the Hainan planting environment, including the day-to-flowers (DTF), flowering period, growth period, plant height, number of effective branches, number of effective siliques, length per silique, and number of seeds per silique. One-way ANOVA (α=0.05) was used to analyze the significance of these traits. The results are shown in Table 2. WA817 exhibited early flowering, with significantly reduced day-to-flowering, flowering period, and growth period compared to the wild type. Front and side views of the early-flowering WA817 line and control plants are shown in Table 2. Figure 3 .

[0031]

[0032] The inventors further identified and confirmed the WA817 genotype and the WA817 target gene. BnaA03.TFL1 The mutated sequence is shown in SEQ ID NO. 3, and the amino acid sequence encoded by the mutated gene is shown in SEQ ID NO. 4. The comparison with the wild-type sequence is shown in Table 3.

[0033] "-" indicates a missing base, bolded bases indicate insertions, and PAM sequences are indicated by boxes.

[0034] Using rapeseed containing the gene sequence shown in SEQ ID NO. 3 as a donor, the gene sequence shown in SEQ ID NO. 3 can be directionally introduced into a rapeseed recipient containing the gene sequence shown in SEQ ID NO. 1 through sexual hybridization. Alternatively, genetic engineering techniques can be used to target and modify the gene sequence shown in SEQ ID NO. 1 in the rapeseed to be improved into the gene sequence shown in SEQ ID NO. 3. Both methods can yield commercially valuable new rapeseed germplasm with early flowering and / or short growth period.

[0035] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for cultivating early-flowering and / or short-growing-period rapeseed, characterized in that: The gene with the sequence shown in SEQ ID NO. 1 in the rapeseed to be improved was replaced with the gene with the sequence shown in SEQ ID NO. 3, and rapeseed plants with shortened growth period were screened.

2. The method according to claim 1, characterized in that: The gene replacement method includes any of the following: (1) Using rapeseed containing the gene sequence shown in SEQ ID NO. 3 as a donor, the gene sequence shown in SEQ ID NO. 3 is directionally introduced into rapeseed recipient containing the gene sequence shown in SEQ ID NO. 1 through sexual hybridization until the gene sequence shown in SEQ ID NO. 3 completely replaces the gene sequence shown in SEQ ID NO.

1. (2) Using genetic engineering techniques, the gene in the rapeseed to be improved, which is shown in SEQ ID NO. 1, is targeted and modified to the gene shown in SEQ ID NO.

3.

3. The method according to claim 2, characterized in that: The donor rapeseed was obtained from seeds with accession number CCTCC NO: P202618.

4. The application of the method according to any one of claims 1-3 in the creation of early-flowering and / or short-growing rapeseed.