A SNP molecular marker related to litter size on pig chromosome 3 and application thereof

Abstract

The application belongs to the technical field of molecular biology and molecular marker, and particularly relates to a SNP molecular marker related to the litter size trait on a pig chromosome 3 and application. The SNP site of the SNP molecular marker related to the litter size trait on the pig chromosome 3 corresponds to a G>A mutation at 63972905bp on the chromosome 3 of the international pig reference genome 11.1 version. The molecular marker is obtained through whole genome association analysis and is significantly related to the litter size trait of a sow. The application establishes a high-efficiency and accurate molecular marker assisted breeding technology by using the molecular marker, and applies the molecular marker to genetic improvement of the litter size trait of a breeding pig, so that the litter size of the pig is improved, the profit of an enterprise is increased, and the core competitiveness is increased.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and molecular marker technology, specifically relating to an SNP molecular marker located on chromosome 3 of pigs that is associated with the trait of healthy offspring number and its application. Background Technology

[0002] In pig farming, the number of healthy piglets born alive is a core indicator of sow reproductive performance, directly impacting the production efficiency and economic benefits of pig farms. This trait is regulated by multiple factors, including genetics and environment, and has moderate to low heritability. Traditional breeding methods for genetic improvement of the healthy piglet number have been slow. Therefore, utilizing marker-assisted selection (MAS) technology for early selection of pigs with this trait will effectively accelerate the breeding improvement process, increase sow reproductive efficiency, and enhance the economic benefits of pig farms.

[0003] With the rapid development of molecular genetics and genomics technologies, marker-assisted selection (MAS) and genomic selection (GS) have gradually become important techniques in animal genetic breeding. By utilizing genetic markers significantly associated with target economic traits, genetic potential can be assessed at an early stage in an individual, thereby improving the accuracy of selection for traits with low heritability and accelerating the breeding process. Genome-wide association studies (GWAS) use statistical methods to associate SNP markers covering the entire genome with complex phenotypes to detect genetic variations most likely to influence related phenotypes. With the development of high-throughput sequencing technology, whole-genome resequencing technology can provide high-density SNP markers, significantly improving the statistical power and resolution of GWAS and helping to discover more significant association sites. Therefore, conducting GWAS analysis of the viability trait based on whole-genome resequencing data helps to deeply elucidate its genetic regulatory mechanisms and provides a theoretical basis for subsequent functional gene mining and precision breeding applications.

[0004] Landrace and Large White pigs are the main lean-type pig breeds introduced to my country, characterized by rapid growth, high feed conversion ratio, and strong reproductive performance. They are often used as parent pigs in Duroc × Landrace × Large White commercial pig breeds. Therefore, genetic improvement of the litter size trait in core Landrace and Large White pig herds can enhance sow reproductive performance, thereby improving the competitiveness of pig farming enterprises and bringing significant economic benefits.

[0005] Currently, research on SNP molecular markers related to the number of healthy piglets in Landrace and Large White pigs is relatively limited. Among these studies, CN116287293A, using Large White pigs as the research subject, disclosed an SNP marker located in the third intron sequence of the porcine SRRM3 gene, which is a G>T mutation. CN114736975A, using both Landrace and Large White pigs as research populations, identified and disclosed an SNP molecular marker associated with the sow's litter size trait, located at locus A>G on chromosome 2, position 7047076 in the international porcine genome Sscrofa 11.1 version. CN119799918A, using Large White pigs as the research subject, disclosed that the SNP locus rs318687930 (G>A mutation) is significantly associated with the number of healthy piglets. The discovery of these molecular markers provides important marker resources for further elucidating the genetic basis of porcine reproductive traits and conducting marker-assisted selection. However, the number of molecular markers currently available for the healthy piglet count trait in Landrace and Large White pigs is still relatively limited, and the marker density and coverage are insufficient to fully meet the precision requirements of large-scale molecular breeding. It is necessary to develop more SNP molecular markers related to this trait to further improve the molecular breeding system and enhance the efficiency of genetic improvement. Summary of the Invention

[0006] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide a SNP molecular marker located on chromosome 3 of pigs that is associated with the healthy piglet count trait. This molecular marker is obtained through genome-wide association analysis and can significantly affect the healthy piglet count trait of Landrace or Large White pigs.

[0007] Another object of the present invention is to provide the application of the above-mentioned SNP molecular markers located on chromosome 3 of pigs that are associated with the healthy offspring number trait.

[0008] Another object of the present invention is to provide an application of a product for detecting SNP molecular markers located on chromosome 3 of pigs that are associated with the healthy offspring number trait.

[0009] The fourth objective of this invention is to provide a method for identifying the number of healthy piglets in a sow's first litter.

[0010] The fifth objective of this invention is to provide a method for screening sows with a high number of healthy piglets in their first litter.

[0011] The sixth objective of this invention is to provide a method for genetic improvement of pigs.

[0012] The objective of this invention is achieved through the following technical solution:

[0013] A SNP molecular marker located on chromosome 3 of pigs and associated with the number of healthy piglets, wherein the SNP site of the molecular marker corresponds to the G>A mutation at position 63972905 bp on chromosome 3 of the International Swine Reference Genome Version 11.1; the polymorphism of the base at this site affects the number of healthy piglets in the first litter of sows, wherein sows with the A / A genotype and the G / A genotype have a higher number of healthy piglets in the first litter than sows with the G / G genotype.

[0014] The preferred nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, wherein R in the sequence is G or A.

[0015] The SNP site of the SNP molecular marker is the G506-A506 nucleotide mutation at position 506 of the sequence marked in SEQ ID NO:1 (a single base mutation of nucleic acid at position 506 of this sequence fragment, named: g.506 G>A).

[0016] The application of the SNP molecular markers includes at least one of the following (1)-(6):

[0017] (1) Determine the number of healthy piglets in the sow's first litter;

[0018] (2) Prepare a product for identifying the number of healthy piglets born in a sow's first litter;

[0019] (3) Select sows with a high number of healthy piglets in their first litter;

[0020] (4) Prepare products for screening sows with a high number of healthy piglets in their first litter;

[0021] (5) Genetic breeding of the number of healthy piglets in sows;

[0022] (6) Prepare products for genetic breeding of sow piglet number traits.

[0023] The preferred type of pig is a Landrace or Large White pig.

[0024] An application of a product for detecting SNP molecular markers located on chromosome 3 of pigs that are associated with the healthy offspring number trait, said application comprising at least one of the following (1)-(6):

[0025] (1) Determine the number of healthy piglets in the sow's first litter;

[0026] (2) Prepare a product for identifying the number of healthy piglets born in a sow's first litter;

[0027] (3) Select sows with a high number of healthy piglets in their first litter;

[0028] (4) Prepare products for screening sows with a high number of healthy piglets in their first litter;

[0029] (5) Genetic breeding of the number of healthy piglets in sows;

[0030] (6) Prepare products for genetic breeding of sow piglet number traits.

[0031] The product includes at least one of reagents, kits, chips, and testing devices.

[0032] The reagent comprises primer pairs or probes, wherein the primer pairs are used to amplify nucleic acid fragments containing the above-mentioned SNP sites, and the probes are capable of specifically recognizing and binding to the nucleic acid sequences of the above-mentioned SNP sites; probes carrying different labeling groups (e.g., fluorescent groups) can be designed to correspond to different genotypes of the above-mentioned SNP sites, thereby achieving genotyping detection.

[0033] The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows:

[0034] Upstream primer-F: 5'-TGCAGCCGGTAAACATACGG-3';

[0035] Downstream primer primer-R: 5'-CTGGGGCGCTCTGAAAATAGT-3'.

[0036] The kit contains the aforementioned primer pairs or probes; more preferably, it also contains reaction buffer, etc.

[0037] The chip uses a solid-phase carrier to fix the primer pairs or probes to achieve high-throughput detection.

[0038] The aforementioned detection equipment is compatible with the detection process of the above-mentioned reagents, kits, and chips, and completes signal acquisition, genotype interpretation, and result output.

[0039] The preferred type of pig is a Landrace or Large White pig.

[0040] The genetic breeding method is preferably molecular marker-assisted genetic breeding.

[0041] A method for identifying the number of healthy piglets in a sow's first litter includes the following steps: detecting the SNP site of the aforementioned SNP molecular marker on chromosome 3 of the pig, and determining whether the number of healthy piglets in the sow's first litter is high or low based on whether the single nucleotide of the SNP site is G or A; wherein, sows with the A / A genotype and the G / A genotype have a higher number of healthy piglets in their first litter than sows with the G / G genotype.

[0042] The preferred type of pig is a Landrace or Large White pig.

[0043] A method for selecting sows with a high number of healthy piglets in their first litter includes the following steps:

[0044] The SNP sites of the above-mentioned SNP molecular markers on chromosome 3 of pigs were detected. Individuals with the G / G genotype were culled, and individuals with the A / A or G / A genotypes were retained as breeding pigs. Among them, the number of healthy piglets in the first litter of sows with the A / A genotype and the G / A genotype was higher than that of sows with the G / G genotype.

[0045] The preferred type of pig is a Landrace or Large White pig.

[0046] The detection method includes the following steps:

[0047] (1) Extract genomic DNA from the pigs to be tested;

[0048] (2) Using the above primer pair as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products;

[0049] (3) Sequencing the PCR amplification products to obtain sequencing results;

[0050] (4) Determine the genotype based on the sequencing results.

[0051] A method for genetic improvement of pigs, comprising the following steps:

[0052] The above-mentioned SNP molecular markers of breeding pigs in the core breeding pig herd were identified, and corresponding selections were made based on the SNP molecular markers: breeding pigs with the A / A and G / A genotypes at position 63972905bp on chromosome 3 of the International Swine Reference Genome 11.1 were selected for successive generations, while breeding pigs with the G / G genotype were culled, in order to increase the frequency of allele A in each generation, thereby increasing the number of healthy piglets.

[0053] The preferred type of pig is a Landrace or Large White pig.

[0054] The present invention has the following advantages and effects compared with the prior art:

[0055] (1) This invention studies and identifies molecular markers related to the number of healthy piglets in sows located on the nucleotide sequence of chromosome 3 of pigs, verifies their effect on the number of healthy piglets in the first litter of sows, and finally establishes a molecular marker-assisted selection breeding technology for rapid improvement of the number of healthy piglets in the first litter of sows. This technology is applied to the genetic improvement of the trait of the number of healthy piglets in the first litter of sows, thereby increasing the number of healthy piglets in sows, increasing enterprise profits, and increasing core competitiveness.

[0056] (2) Based on the SNP molecular marker located on chromosome 3 of pigs that is related to the number of healthy piglets, this invention provides a product for detecting the SNP molecular marker and its application. Based on the SNP molecular marker, primer pairs and kits, etc., efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select for the number of healthy piglets, accelerate the breeding process, and apply it to the genetic improvement of the number of healthy piglets in breeding pigs, thereby increasing the number of healthy piglets in sows, improving the reproductive efficiency of sows, and thus increasing the profits of enterprises and increasing their core competitiveness.

[0057] (3) This invention provides a method for pig genetic improvement by selecting the dominant allele of this molecular marker, which can accelerate the genetic progress of pigs, shorten the time for pig improvement, and thus effectively improve the economic benefits of breeding pigs. Specifically, if this invention selects all individuals with the G / G and G / A types of the SNP molecular marker related to the number of healthy piglets into A / A type individuals, the number of healthy piglets increases by approximately 1.29 and 0.38, respectively. A 5000-sow farm can then provide approximately 4180-14190 more pigs annually, significantly improving the farm's reproductive efficiency and bringing significant economic benefits. Therefore, the potential for high healthy piglet count to generate revenue for the pig industry is enormous. In this invention, by selecting the dominant allele (A) of this SNP molecular marker in pigs, the reproductive efficiency of sows can be improved, thereby increasing the economic benefits of the pig farm. Attached Figure Description

[0058] Figure 1 This is a genome-wide association study (GWAS) plot of the trait of number of healthy piglets in a sow's first litter, located on chromosome 3 in pigs; where: the horizontal axis represents the physical location of chromosome 3 in pigs; the vertical axis represents -log10( P -value).

[0059] Figure 2 This is a box plot comparing the number of healthy piglets in the first litter of sows with different genotypes in Large White pigs. The boxes represent the 25%-75% interquartile range, the horizontal lines inside the boxes represent the median, and the labels above indicate the significance of phenotypic differences between different genotypes. p value.

[0060] Figure 3 This is a box plot comparing the number of healthy piglets in the first litter of sows with different genotypes in Landrace pigs. The boxes represent the 25%-75% interquartile range, the horizontal lines inside the boxes represent the median, and the labels above indicate the significance of phenotypic differences between different genotypes. p value. Detailed Implementation

[0061] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0062] Example 1 explains in detail the process of determining the number of healthy piglets in the first litter of sows in this invention.

[0063] 1. Laboratory animals

[0064] This invention used a total of 1167 purebred sows, including 156 purebred American Landrace pigs and 1011 purebred French Large White pigs. The experimental pig herd used above was the core breeding herd of the breeding farm, and the herd's pedigree was recorded in detail. The pigs had free access to feed and water, and the entire feeding method and rearing conditions were kept consistent, following conventional methods.

[0065] 2. Phenotypic data

[0066] In this invention, the phenotypic trait of sows producing healthy piglets is derived from the detailed reproductive data of sows in the breeding population production records (including total number of piglets born, number of live piglets, number of stillborn piglets, number of mummies, date of farrowing, breed, etc.) and the piglet nursing records (date of birth, piglet breed, birth weight, parent information, etc.).

[0067] This invention uses a segmented regression method to analyze the average weight and number of live piglets in the first litter, thereby establishing a standard threshold for distinguishing between healthy and weak piglets. Healthy piglets are defined as having a birth weight of not less than 0.895 kg, while weak piglets are defined as having a birth weight of less than 0.895 kg.

[0068] In this invention, the number of healthy piglets in a sow's first litter is defined as follows:

[0069] The number of piglets born to a sow in her first litter with a birth weight ≥ 0.895 kg and who survive in good health.

[0070] 3. Sample Collection

[0071] The collected sow ear tissue samples were soaked in a 75% ethanol solution and stored at -20°C for later use.

[0072] Example 2 provides a detailed explanation of the invention process of obtaining the SNP molecular marker in this invention.

[0073] 1. Extraction of DNA from sow ear tissue

[0074] Whole-genome DNA was extracted from ear tissue samples of all sows in Example 1 using the standard phenol-chloroform method. The DNA from the sow population was quality-tested and its concentration determined using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 ng / μL.

[0075] 2. Resequencing, genotyping, and quality control, etc.

[0076] (1) 10× resequencing of the whole pig genome: The DNA sample obtained in step 1 was sent to a sequencing company for 10× deep whole genome resequencing based on the BGI DNBSEQ-T7 high-throughput sequencing platform.

[0077] (2) Genotype detection: After the sequencing data is quality controlled by FASTP, high-quality clean reads are aligned to the international pig reference genome Sscrofa11.1 using BWA software. SNP detection, genotype determination and preliminary filtering are performed using the standard procedures of GATK and SAMtools software.

[0078] (3) The obtained genotype data were quality controlled using PLINK v1.90 software. Data with a detection rate <95%, minor allele frequency (MAF) <5%, or deviation from Hardy-Weinberg equilibrium (HWE) P≤10 were excluded. -10 SNP markers.

[0079] 3. Genome-wide association study (GWAS)

[0080] To eliminate population stratification effects, this invention employs a linear mixed model with single-point regression analysis combined with the fastGWA module of GCTA software for GWAS analysis. The analysis model utilizes inter-individual genomic relationships and the first three principal components (PCA) to correct for population stratification effects. The genomic significance threshold set for the GWAS analysis is 5.00 × 10⁻⁶. -8 .

[0081] (1) The analysis model is as follows:

[0082] y=Xα+Zβ+Wμ+e

[0083] Where y is the individual's phenotypic vector; α is the fixed effect size, X is the fixed effect matrix; β is the genotype effect vector, Z is the genotype matrix; μ is the random effect vector, W is the random effect matrix; and e is the residual vector.

[0084] (2) The specific analysis method is as follows:

[0085] ① Using the genotype data obtained in step 1 as the object, the kinship matrix (GRM) of the experimental population was calculated using the --make-grm function of the GCTA software. The GRM, as the random effects covariance matrix in the mixture model, mainly functions to measure the "true genetic similarity" between samples and is used to control for biases caused by population structure and implicit kinship.

[0086] ②Then, using the constructed kinship matrix, the first three principal components of the population are calculated using --pca.

[0087] ③Then, genotype and phenotypic data are added to the model, and genome-wide association analysis is performed using --fastGWA.

[0088] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It is known that there are loci on chromosome 3 that significantly affect the number of healthy piglets in a sow's first litter, with the strongest associated SNP being g.506 G>A (corresponding to the G>A mutation at 63972905 bp on chromosome 3 in International Swine Reference Genome Version 11.1). p =1.68×10 -8 ).

[0089] 4. Association analysis between different genotypes and the number of healthy piglets phenotype:

[0090] according to Figure 1 Tables 1 and 2 show that the SNP site g.506 G>A of the molecular marker is highly significantly correlated with the number of healthy piglets in the first litter of sows. p =1.68×10 -8 Further, PLINK (v1.9) software was used to extract the genotype of each individual in the experimental pig herd at the corresponding mutation site from the sequencing file. After counting the number of individuals with each genotype, the genotypes of these individuals were correlated with the number of healthy piglets in the first litter of their sows. Then, R language was used to statistically analyze the differences in phenotypic distribution under different genotypes. Among them, under the additive inheritance effect, Large White and Landrace pigs with A / A and G / A genotypes had a higher number of healthy piglets in the first litter than Large White and Landrace pigs with G / G genotypes (Tables 1 and 2). Figure 2 and Figure 3 This result indicates that A is the dominant allele and G is the unfavorable allele. Therefore, in the breeding process, it is necessary to gradually eliminate breeding pigs with the G / G genotype and retain breeding pigs with the A / A and G / A genotypes to increase the frequency of allele A at this locus generation by generation, thereby increasing the number of healthy piglets from sows.

[0091] Table 1. Correlation analysis of SNP sites g.506 G>A of molecular markers with the number of healthy offspring.

[0092]

[0093] Table 2. Correlation analysis of genotype and phenotype between Large White and Landrace pigs.

[0094]

[0095] Note: A total of 1167 sows were used for analysis, including 1011 Large White sows and 156 Landrace sows. Different lowercase letters on the same row indicate significant differences. p <0.05), the same letter indicates that the difference is not significant.

[0096] Example 3: A detailed explanation of the invention process for detecting SNP markers.

[0097] (1) The target fragment containing SNP loci significantly associated with the number of healthy piglets in the first litter of sows is a 1006 bp nucleotide sequence from chromosome 3 (SEQ ID NO:1). The upstream and downstream primers for sequence amplification are primer-F and primer-R, and their nucleic acid sequences are as follows:

[0098] Upstream primer-F: 5'-TGCAGCCGGTAAACATACGG-3' (SEQ ID NO:2);

[0099] Downstream primer-R: 5'-CTGGGGCGCTCTGAAAATAGT-3' (SEQ ID NO:3).

[0100] (2) PCR amplification system and conditions

[0101] Prepare a 10 μL system, including 1.0 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR reaction program is as follows: 95℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, for 30 cycles; 72℃ for 10 min.

[0102] (3) DNA sequence sequencing identification: Sequencing was performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions for each gene fragment. The obtained sequences were compared with the pig genome sequences in the emsembl database to identify the mutations at the corresponding SNP sites. The sequencing results are shown below:

[0103] SEQ ID NO:1 (Sus scrofa chr3:63972400-63973404, Sscrofa11.1):

[0104] TGAAAATCACATTTATACAGAAAACCAATCAAGTACAGAAAACAATACCTAAGATAATTTTAAATGGAGCCTTGGAGGCATTTAAATTGTCTTAGAAAATGTTCACTGCACAAAGTTTTCAGGGAGCACAAAAACCATGACACTGTGTTCTCCTTGCCTTCTCGCTCTGCTTCTCGGTCAGCCTTTAGAATCTACATCACTCCTCCCTCCTTTCAGCACCAGAAGCCTTGCCTCTTTTTTCCAAGACTCTTCTGTAAAAATACTCTCAGGATGAATTGCTTCTACATGAATGATTGCGTATTTATTTAATAAAATGCTA TGCAGCCGGTAAACATACGG TTTGAGAAGGTTTATTGATCTGGTAACATAGTCACAATATATTAAGTCAAGAAAATAGATTGCAAATCACCATTTACAAAGAGTCCAATGTTTAAAACTCAAGGTACAATGTATGTGTGTCTCTGTATGTGTGTATAAATGTATCACTCATATGAGGTTAAAGAR( G / A) CATTGGAAAGACATACAAGATAATCAATAATGGAAAAATAAAAGAGAATTTCATGGCAATGGTATGTATCAGAAGTCCCAGGACAGTCATAGGAACTCTTAGAGTTGGTGCACTCTGCAACGTACCAAAGCAATAGTAAAAATTTACACACGATAAAAATTTTAATGTATAGAATTATTTTAAAAGATTATCAACAACGATTATCCTTAGGGGGTGAGTTTCTAAACTGATTTCCTTTCATTCTTTGTGTTTTATCCTTTACAATGAACATATATTTCTTTTGCAACGTGAAAAAAAAAAAAAAAAAAGCAGTGTAAAGCCT ACTATTTTCAGAGCGCCCCAGGCCCTGGCTATCATGCCACATGTTCCTCTCCTAGTGTATGTTGAAAGCTTGGTGGAGTTTGGGCCAGAGATCTCATTTCCAACCTCGACCTCTCACAAACAGAATCCAACAGGAACTCTCTTTCCATTAAATTGACCTATCGCAAAAGTTATGACAA

[0105] Note: R marked in the sequence indicates a mutation site (G or A); the underline in the sequence indicates the primer binding position, where the upstream primer binds to positions 324-343 of the sequence, and the downstream primer binds in reverse complementary order to positions 834-852 of the sequence.

[0106] Example 4: Analysis of the G>A effect of SNP site g.506 for molecular markers

[0107] This invention provides a SNP molecular marker significantly associated with the number of healthy piglets in a sow's first litter. Using this SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process for healthy piglets. If this invention selects all individuals with the G / G and G / A types of the molecular marker significantly associated with the number of healthy piglets in a sow's first litter into A / A type individuals, the number of healthy piglets will increase by approximately 1.29 and 0.38, respectively. In a large-scale pig farm with 10,000 pigs and 5,000 breeding sows, providing an additional 1.29 and 0.38 piglets per litter, and assuming a sow has 2.2 litters per year, this translates to an additional 4,180-14,190 pigs per year. With each pig reaching market weight of 120 kg, this will bring significant economic benefits to the farm. Therefore, genetic improvement of the sow's healthy piglet count trait brings substantial economic benefits to pig farms. In individuals with this SNP molecular marker, by selecting the dominant allele (A) of this SNP in the sow population, the reproductive performance of sows can ultimately be improved, thereby increasing the enterprise's profits.

[0108] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a product for detecting SNP molecular markers located on chromosome 3 of pigs that are associated with the healthy offspring number trait, characterized in that... The application includes at least one of the following (1)-(6): (1) Determine the number of healthy piglets in the sow's first litter; (2) Prepare a product for identifying the number of healthy piglets born in a sow's first litter; (3) Select sows with a high number of healthy piglets in their first litter; (4) Prepare products for screening sows with a high number of healthy piglets in their first litter; (5) Genetic breeding of the number of healthy piglets in sows; (6) Prepare products for genetic breeding of the sow piglet number trait; The SNP molecular markers mentioned above correspond to the G>A mutation at 63972905 bp on chromosome 3 of the International Swine Reference Genome Version 11.

1. The polymorphism of the bases at this site affects the number of healthy piglets in the first litter of sows. Sows with the A / A genotype and the G / A genotype have a higher number of healthy piglets in the first litter than sows with the G / G genotype. The pigs mentioned are American Landrace or French Large White.

2. The application according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, where R in the sequence is G or A.

3. The application according to claim 1, characterized in that: The product contains at least one of reagents and kits.

4. The application according to claim 3, characterized in that: The reagents described include primer pairs or probes; The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-TGCAGCCGGTAAACATACGG-3'; Downstream primer primer-R: 5'-CTGGGGCGCTCTGAAAATAGT-3'.

5. The application according to claim 3, characterized in that: The kit contains primer pairs or probes; The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-TGCAGCCGGTAAACATACGG-3'; Downstream primer primer-R: 5'-CTGGGGCGCTCTGAAAATAGT-3'.

6. The application according to claim 5, characterized in that: The kit also includes a reaction buffer.

7. A method for determining the number of healthy piglets, characterized in that... Includes the following steps: Detect the SNP site of the SNP molecular marker as described in claim 1 on chromosome 3 of pigs, and determine whether the number of healthy piglets in the first litter of sows is high or low based on whether the single nucleotide of the SNP site is G or A. Among them, the number of healthy piglets in the first litter of sows with A / A genotype and G / A genotype is higher than that of sows with G / G genotype. The pigs mentioned are American Landrace or French Large White.

8. A method for selecting sows with a high number of healthy piglets in their first litter, characterized in that... Includes the following steps: Detect the SNP sites of the SNP molecular markers as described in claim 1 on chromosome 3 of pigs, eliminate individuals with the G / G genotype, and retain individuals with the A / A or G / A genotypes as breeding pigs, wherein the number of healthy piglets in the first litter of sows with the A / A genotype and the G / A genotype is higher than that of sows with the G / G genotype. The pigs mentioned are American Landrace or French Large White.

9. The method according to claim 7 or 8, characterized in that: The detection method includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using primer pairs as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products; (3) Sequencing the PCR amplification products to obtain sequencing results; (4) Determine the genotype based on the sequencing results; The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-TGCAGCCGGTAAACATACGG-3'; Downstream primer primer-R: 5'-CTGGGGCGCTCTGAAAATAGT-3'.

10. A method for genetic improvement of pigs, characterized in that... Includes the following steps: Identify the SNP molecular markers as described in claim 1 for breeding pigs in the core breeding pig herd, and make corresponding selections based on the SNP molecular markers: select breeding pigs with A / A and G / A genotypes at position 63972905bp on chromosome 3 of the International Swine Reference Genome 11.1 for successive generations, and cull breeding pigs with the G / G genotype to increase the frequency of allele A in each generation, thereby increasing the number of healthy piglets; The pigs mentioned are American Landrace or French Large White.

Images