Genetically engineered k. marxianus, construction method and application

Abstract

The application discloses a construction method of genetically engineered Kluyveromyces marxianus, a strain and application thereof. The application is characterized in that a codon-optimized exogenous gene tHMG gene and a Y215CrtBY gene are integrated into an ADH2 site of a starting strain, and a codon-optimized exogenous gene PrCrtE gene and a Y215CrtI gene are integrated into a GPD1 site of the starting strain. The genetically engineered Y215L strain provided by the application can efficiently ferment and produce lycopene. The genetically engineered Y215L strain also has industrial application value in promoting proliferation of fibroblasts, eliminating free radicals, resisting inflammation, promoting secretion capacity of fibroblasts ECM matrix, and promoting expression of fibroblast anti-aging related mRNA.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to a genetically engineered Kluyveromyces martensii, its construction method, and its application. Background Technology

[0002] Carotenoids are a class of naturally occurring, fat-soluble yellow, orange-red, or red pigments synthesized by plants, algae, and some bacteria and fungi. Due to their excellent antioxidant, coloring, and bioactivity, they are widely used in food and feed, pharmaceuticals, and cosmetics. Because of their significant applications, the production of these pigments based on metabolic engineering and synthetic biology techniques has attracted considerable attention in recent years; however, achieving efficient and low-cost production remains a challenge. Carotenoids are important pigments for photosynthesis in plants. Based on their chemical structure and functional groups, they can be divided into carotenes and lutein. Carotenes include hydrocarbon compounds such as β-carotene, α-carotene, and lycopene; lutein includes oxygenated hydrocarbon compounds such as zeaxanthin, astaxanthin, and oxalool. Carotenoids produced through oxidative cleavage (such as crocin, crocin, β-ionone, and retinol) are classified as apocarotenoids. Crocin is a water-soluble carotenoid, which is more easily absorbed than other common fat-soluble pigments and has better effects in anti-oxidation, anti-inflammation and neuroprotection.

[0003] Currently, carotenoids are mainly obtained through plant extraction or chemical synthesis. However, plant extraction suffers from problems such as unstable raw material supply and the use of toxic solvents, while chemical synthesis exacerbates environmental degradation and is also costly. In contrast, microbial synthesis offers a more promising alternative. Using synthetic biology techniques, lycopene and its derivatives can be produced efficiently in engineered microbial hosts. Compared to traditional methods, microbial synthesis significantly reduces dependence on natural plant resources, enables continuous and stable production in bioreactors, lowers costs, reduces environmental pollution, and aligns with green chemistry principles and sustainable development trends.

[0004] Max Kluyveromycin ( Kluyveromyces marxianusAs an unconventional yeast, *Kluyveromyces martensii* is a promising cell factory for producing heterologous proteins. Unlike traditional *Saccharomyces cerevisiae*, it is a Crabtree-negative yeast, meaning it does not undergo aerobic ethanol fermentation, thus avoiding the formation of toxic byproducts of ethanol under aerobic conditions. Furthermore, it can grow rapidly even at high temperatures (>40°C), effectively reducing the cost of cooling bioreactors and mitigating contamination risks in industrial production. In addition, *Kluyveromyces martensii* has the ability to utilize various sugars such as lactose and inulin to produce high-value enzymes such as inulinase and β-galactosidase, as well as chemical products such as ethanol, lactic acid, and fatty acids. Due to its food safety status, clear genetic background, and abundant synthetic biology tools, it is considered an ideal heterologous expression host. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a genetically engineered Kluyveromyces martensii, its construction method, and its application.

[0006] A method for constructing genetically engineered Kluyveromyces martensii involves integrating codon-optimized exogenous genes tHMG and Y215CrtBY into the ADH2 site of the starting strain, and codon-optimized exogenous genes PrCrtE and Y215CrtI into the GPD1 site of the starting strain.

[0007] All exogenous genes are based on Kluyveromyces marxianus Codon optimization was performed, and the nucleotide sequences of the tHMG gene are shown in SEQ ID NO.1, the Y215CrtBY gene in SEQ ID NO.2, the PrCrtE gene in SEQ ID NO.3, and the Y215CrtI gene in SEQ ID NO.4. The tHMG gene originally originated from *Saccharomyces cerevisiae*, and the CrtBY and CrtI genes originally originated from *Rhodotorula rubrum*. After codon optimization, they were named Y215CrtBY and Y215CrtI genes, respectively. The CrtE gene originally originated from *Rhodotorula rubrum* and was named PrCrtE gene after codon optimization.

[0008] The starting strain is Kluyveromyces martensii (Kluyveromyces masculinus). Kluyveromyces marxianus NBRC1777.

[0009] The *Kluyveromyces martensii* obtained by the construction method of this invention (… Kluyveromyces marxianus Genetically engineered bacteria Y215L was deposited at the China Center for Type Culture Collection on May 22, 2026, with accession number CCTCC NO: M2026966, deposited at Wuhan University, Wuhan, China.

[0010] The application of the genetically engineered strain Y215L provided by this invention in the fermentation production of lycopene.

[0011] Furthermore, in producing natural pigments, the fermentation medium for the genetically engineered bacterium Y215L is as follows: glucose 80 g / L, glycerol 10 g / L, yeast extract 5 g / L, potassium dihydrogen phosphate 0.8 g / L, magnesium sulfate heptahydrate 0.41 g / L, and calcium chloride dihydrate 0.66 g / L. The fermentation conditions are: first fermentation at 42℃ and 200 rpm for 12 h, then fermentation at 30℃ and 200 rpm for 108 h. It should be noted that the fermentation medium and fermentation conditions of the genetically engineered bacterium Y215L of this invention can be further optimized as needed.

[0012] This invention also provides the application of the genetically engineered bacterium Y215L in the preparation of products that promote fibroblast proliferation, products that scavenge free radicals, products with anti-photoaging effects, and products that promote the secretion of fibroblast ECM matrix and / or the expression of anti-aging-related mRNAs in fibroblasts. Specifically, it can effectively promote the mRNA expression of type I collagen in fibroblasts, effectively promote the mRNA expression of FN1 in fibroblasts, and significantly promote the mRNA expression of CD44 in fibroblasts.

[0013] The product is prepared using the fermentation product cells of genetically engineered bacteria Y215L as raw material. The type of product is not limited to cosmetics.

[0014] The advantages of this invention are: This invention provides a novel genetic modification method for *Kluyveromyces martensii*, which, by expressing an exogenous pigment-producing gene, constructs strain Y215L capable of efficiently producing the natural pigment lycopene. The genetically engineered strain Y215L promotes fibroblast proliferation, scavenges free radicals, exhibits anti-photoaging and antioxidant effects, enhances fibroblast ECM matrix secretion, and promotes the expression of fibroblast anti-aging-related mRNAs, demonstrating significant industrial application value. Attached Figure Description

[0015] Appendix Figure 1 The image shown is an electrophoresis diagram of the first round of gene integration verification.

[0016] Appendix Figure 2 The image shown is an electrophoresis diagram of the second round of gene integration verification.

[0017] Appendix Figure 3 This is a diagram showing the results of fibroblast proliferation promotion.

[0018] Appendix Figure 4 This is a graph showing the DPPH removal rate.

[0019] Appendix Figure 5 It is the effect of Y215L on fibroblasts stimulated by UVA.

[0020] Appendix Figure 6 It is the expression level of type I collagen (COL1A1) mRNA in fibroblasts.

[0021] Appendix Figure 7 It is the expression level of fibronectin (FN1) mRNA in fibroblasts.

[0022] Appendix Figure 8 It represents the expression level of CD44 mRNA in fibroblasts.

[0023] Appendix Figure 9 The result is that strain Y215L produces pigment. Detailed Implementation

[0024] The specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. Unless otherwise specified, the methods described are conventional methods. Unless otherwise specified, the materials described are readily available from publicly available commercial sources. The illustrative embodiments and descriptions of the present invention are used to explain the present invention and do not constitute an undue limitation of the present invention. It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0025] The strains used in the examples include the starting strain. Kluyveromyces marxianus NBRC1777 (hereinafter referred to as 1777) and the genetically engineered bacteria constructed in this invention Kluyveromyces marxianus Y215L (hereinafter referred to as Y215L), among which, Kluyveromyces marxianus NBRC1777 is a commercially available wild-type strain, selected from soil. Both strains were preserved in glycerol tubes. Salmon sperm DNA: purchased from Solarbio, salmon sperm DNA 10 mg / mL (catalog number: H1060).

[0026] The four genes, tHMG (sequence shown in SEQ ID NO.1), Y215CrtBY (sequence shown in SEQ ID NO.2), PrCrtE (sequence shown in SEQ ID NO.3), and Y215CrtI (sequence shown in SEQ ID NO.4), with optimized codons, were synthesized by Qingke Biosynthesis Co., Ltd. The amino acid sequences of the expressed tHMG gene are shown in SEQ ID NO.5, Y215CrtBY gene in SEQ ID NO.6, PrCrtE gene in SEQ ID NO.7, and Y215CrtI gene in SEQ ID NO.8. Fibroblasts: Shanghai Aiji Biotechnology Co., Ltd. CCK8 detection kit: purchased from Beyotime Cell Counting Kit-8 (C0037). Reagents and equipment not mentioned are all commercially available products, and preparation and detection methods not specified are standard methods in this field.

[0027] Example 1: Preparation and genetic transformation of Kluyveromyces martensii competent cells Step 1: Cell activation and culture YPD liquid culture medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L.

[0028] Seed culture medium: YPD liquid medium.

[0029] The *Kluyveromyces martensii* 1777 strain to be transformed was inoculated into seed culture medium and cultured overnight. Then, the seed culture was cultured according to OD... 600 An initial inoculation density of 0.1 was used to inoculate the culture into centrifuge tubes containing 5 mL of YPD liquid medium. The inoculated culture system was then placed in a 37°C constant temperature shaker and cultured overnight at 200-250 rpm for 20 hours to obtain active cells in the late logarithmic growth phase. Each 1 mL of overnight culture can be used as an independent transformation unit.

[0030] Step 2: Bacterial cell collection and preliminary washing Take 1 mL of the overnight culture obtained in step one and transfer it to a 1.5 mL sterile EP tube. Place the EP tube containing the bacteria in a centrifuge and centrifuge at 8000 rpm for 30 seconds to allow the bacteria to settle completely. Carefully discard the supernatant, avoiding disturbing the bacterial precipitate. Add 1 mL of sterile deionized water to the bacterial precipitate and resuspend the bacteria by vortexing or gentle aspiration. Centrifuge again at 8000 rpm for 30 seconds, discard the supernatant, and complete the preliminary washing step.

[0031] Step 3: Washing with LiAc / TE buffer and preparation of competent cells Add 500 μL of pre-cooled 1×LiAc / TE buffer (containing 0.1 M lithium acetate, 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) to the bacterial pellet treated in step two, and gently pipette to mix. Centrifuge at 8000 rpm for 30 seconds and discard the supernatant. Repeat the above LiAc / TE buffer washing step once, for a total of two washings. After the last centrifugation, use a pipette to thoroughly remove any remaining supernatant, ensuring that there is no liquid residue on the bacterial surface, to obtain a pure competent cell pellet.

[0032] Step 4: Preparation of the conversion mixture Perform the following operations in an ice environment: Add the following components sequentially to the competent cell pellet obtained in step three, with the following dosage per 1 mL of original bacterial culture: Vector DNA: 10 μL salmon sperm DNA, boiled in a boiling water bath for 5 minutes before use, and immediately cooled in an ice bath; Guide RNA (gRNA): 1-1.5 μg, preferably 100-150 ng / μL; Exogenous DNA fragment: 2-3 μg; Dithiothreitol (DTT): Add an appropriate volume of 1 M DTT stock solution to make the final concentration of DTT in the final conversion system reach 10 mM, preferably 4 μL. Polyethylene glycol (PEG) solution: 300 μL, wherein the PEG solution is composed of 40% (w / v) PEG 4000, 0.1 M lithium acetate, 10 mM Tris-HCl (pH 7.5), and 1 mM EDTA; Use a pipette to repeatedly blow and aspirate to thoroughly mix the above components with the competent cells, forming a homogeneous transformation mixture.

[0033] It should be noted that the exogenous DNA fragment described in this invention contains four genes: tHMG, Y215CrtBY, PrCrtE, and Y215CrtI, and undergoes two independent transformations. The first transformation involves converting the tHMG-Y215CrtBY fragment to the ADH2 site, using 2-3 μg of the tHMG-Y215CrtBY fragment and 1-1.5 μg of gRNA targeting the ADH2 site. The second transformation involves converting the PrCrtE-Y215CrtI fragment to the GPD1 site, using 2-3 μg of the PrCrtE-Y215CrtI fragment and 1-1.5 μg of gRNA targeting the GPD1 site. After successful genomic verification following the first transformation, passage and plasmid removal are required, which takes approximately 3-4 days, after which the second transformation can be performed.

[0034] The guide RNA (gRNA) was independently constructed. The gRNA sequence targeting the ADH2 site is: caacgtctccgtctccgaaa (SEQ ID NO. 9); the gRNA sequence targeting the GPD1 site is: gttgccggtatttccgttgc (SEQ ID NO. 10).

[0035] Step 5: Heat shock treatment and conversion induction The transformation mixture obtained in step four was transferred to a constant temperature metal bath and incubated at 30°C for 15 minutes to allow the cells to adapt. Then the transformation mixture was transferred to a 47°C water bath for heat shock treatment for 15 minutes to promote the entry of exogenous DNA into the cells. After the heat shock treatment, the transformation mixture was immediately placed on ice to cool for 2-3 minutes.

[0036] Step Six: Resuscitation, Culture, and Screening The heat-shocked transformation mixture was briefly centrifuged at 8000 rpm for 1 minute to allow the bacterial cells to settle. The supernatant was carefully discarded, and the bacterial pellet was retained. 1 mL of fresh YPD liquid medium was added to the bacterial pellet, and the bacterial cells were gently resuspended by aspiration. The resuspended bacterial cells were placed in a 30°C incubator and allowed to recover and culture for 1.5 hours to allow the cells to regain activity and express the resistance marker gene. After the recovery culture, the mixture was centrifuged at 8000 rpm, and the supernatant was discarded. 100 μL of sterile deionized water was added to the bacterial pellet, and the bacterial cells were gently resuspended by aspiration. The resuspended bacterial suspension was evenly spread on a YPD solid selection plate containing hygromycin B (concentration of 300 μg / mL). The plate was placed in a 37°C incubator and inverted for 48 hours. Positive transformants were observed and picked.

[0037] Step 7: Preliminary Culture and Validation Preparation of Positive Clones Single colonies were picked from the screening plate and inoculated into EP tubes containing 1 mL of YPD liquid medium (containing 300 μg / mL hygromycin B). The inoculated culture system was placed in a constant temperature shaker at 37°C and cultured with shaking. After the bacterial culture showed obvious turbidity, the genome was extracted for verification. Positive clones that were verified were then expanded and preserved.

[0038] Step 8: Extraction of Genomic DNA ① Take 100-200 μL of bacterial culture (OD200) 600 ≈0.4), centrifuge at 5000 rpm for 2 minutes, and collect the bacterial pellet; ② Add 100 μL of lysis buffer (containing 200 mM lithium acetate, 1% SDS) to the bacterial pellet, resuspend thoroughly, and then transfer to a 1.5 mL EP tube; ③ Incubate the EP tube in a 70°C metal bath for 15 minutes, then add 300 μL of anhydrous ethanol directly to the tube and gently invert to mix. ④ Centrifuge at 12000 rpm for 5 minutes, discard the supernatant, and retain the precipitate; ⑤ Add 200 μL of 70% ethanol to the precipitate, wash the precipitate, centrifuge at 12000 rpm for 2 minutes, and discard the supernatant; repeat the above washing steps once; open the EP tube and place it in an oven to dry for 15-30 minutes. ⑥ Add 100 μL of sterile deionized water to the dried precipitate and gently blow or aspirate to fully dissolve the DNA; use a NanoDrop spectrophotometer to determine the DNA concentration and purity. ⑦ Store the extracted genomic DNA at -20°C for later use.

[0039] Step 9: PCR Validation of Integration Site For integration events at the ADH2 and GPD1 sites, specific validation primers were designed in the upstream genomic sequence and inside the integration fragment, respectively, and PCR amplification was performed for validation. The primer sequences are shown in Table 1.

[0040] Table 1 Primer sequences used for PCR validation

[0041] The first round of integration verification of tHMG-Y215CrtBY was successful:

[0042] The electrophoresis image for the first round of gene integration verification is shown below. Figure 1 As shown.

[0043] The second round of integration verification showed that PrCrtE-Y215CrtI integration was successful:

[0044] The electrophoresis image for the second round of gene integration verification is shown below. Figure 2 As shown.

[0045] Example 2: Microbial culture and fermentation This invention employs a graded culture medium preparation system, specifically including three types: resuscitation medium, fermentation medium, and digestion medium.

[0046] The resuscitation medium was based on YPD medium and consisted of 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose. After being sterilized by autoclaving at 121°C for 20 minutes, it was cooled in a clean bench for later use.

[0047] The main components of the fermentation medium were glucose 80 g / L, glycerol 10 g / L, yeast extract 5 g / L, sodium chloride 20 g / L, and potassium dihydrogen phosphate 0.8 g / L.

[0048] The fermentation medium was prepared separately into two components, A and B. Component A contained 0.41 g / L magnesium sulfate heptahydrate, and component B contained 0.66 g / L calcium chloride dihydrate. Both components were sterilized at 121℃ for 20 minutes. After the fermentation medium cooled, they were added to the main culture medium in sequence to form a complete fermentation system.

[0049] The bacterial culture process is divided into two stages: (1) Resuscitation culture: Take the strain out of the -80℃ freezer, place it in a 37℃ water bath to thaw quickly, take a single colony and inoculate it into 100 mL of resuscitation medium, and culture it at 30℃ and 200 rpm for 48 hours to obtain seed liquid; (2) Shake flask expansion culture: The revived seed liquid was transferred to the fermentation medium. The culture temperature was adjusted according to the characteristics of the strain. The 1777 strain was cultured at 25℃ and 200 rpm, and the Y215L strain was cultured at 30℃ and 200 rpm. The culture period was 48 hours. After the culture was completed, the bacterial cells were collected for subsequent experimental treatment.

[0050] Example 3: Sample Processing Take 20 g each of two bacterial cells, Y215L and 1777, and perform the following operations respectively: ① The bacterial cells were homogenized under high pressure with ultrapure water as the solvent. The homogenization was performed three times at 1000 bar to prepare 185 mL of homogenized solution. ② Mix the homogenized solution in advance, take 30 mL of each suspension, and centrifuge the sample. Centrifugation parameters: 7000 rpm, 10 min, room temperature; ③ After centrifugation, obtain the supernatant and precipitate. Separate the supernatant and precipitate into 50 mL centrifuge tubes. ④ Use 10% citric acid to adjust the pH of the supernatant to 4.5 and mix thoroughly; ⑤ Centrifuge the pH-adjusted supernatant again. Centrifugation parameters: 7000 rpm, 10 min, room temperature; ⑥ Take the supernatant as the test sample Y215L-S, 1777-S; ⑦ Resuspend the precipitate obtained in step ③ with 3 mL DMSO, vortex the precipitate thoroughly using a vortex shaker to make it a suspension again, and let it stand at room temperature for 10 min. ⑧ Centrifuge again at 7000 rpm for 10 min at room temperature; ⑨ Collect the supernatant as the test sample Y215L-P, 1777-P.

[0051] The obtained samples Y215L-S, 1777-S, Y215L-P, and 1777-P were also used in subsequent embodiments.

[0052] Table 2 Sensory Record Sheet for Sample Preparation

[0053] Compared to 1777, Y215L's distinctive orange color demonstrates the successful construction of the strain and its ability to produce natural pigments.

[0054] Example 4: The effect of Y215L on the proliferation of dermal cells To investigate the proliferative effect of Y215L on fibroblasts, DMEM + 10% FBS + triple antibody was used as the culture medium. Cells were seeded at a density of 8000 cells / well in 96-well plates and cultured at 37°C under constant humidity with CO2 until 80% confluence. The fibroblasts in the wells were then starved for 12 hours with serum-free DMEM + triple antibody medium before adding samples. Y215L-S, Y215L-P, 1777-S, and 1777-P were used as detection groups at 0.01% (v / v) and 0.05% (v / v), respectively. Serum-free DMEM + triple antibody medium served as the blank control (NT), and 1777 was used as the model strain for comparative testing.

[0055] Cell viability was detected using a CCK8 assay kit. 24 hours after sample addition, the 96-well plate was removed from the incubator, the culture medium was aspirated, the plate was rinsed twice with 1X PBS, and the CCK8 assay working solution was added. The plate was incubated for 1 hour in a 37°C, humidified CO2 incubator. After the solution changed color, the absorbance was read at 450 nm using a microplate reader.

[0056] Relative percentage = (Sample average OD value / NT average OD value) * 100%.

[0057] according to Figure 3 It can be seen that both Y215L-S and Y215L-P can effectively enhance the proliferation capacity of fibroblasts, and can significantly promote the proliferation of fibroblasts compared with the 1777 group.

[0058] Example 5: Scavenging effect of Y215L on free radicals Weigh 3 mg of DPPH powder, add 72 mL of anhydrous ethanol, shake thoroughly to dissolve completely, store in the dark, and use within 5 hours. Dilute the above DPPH solution with anhydrous ethanol at a volume ratio of 2:1, and adjust the absorbance to the range of 0.6~1.0 to obtain the DPPH working solution. Accurately transfer different volumes of the test sample solution (0.5% (v / v) and 3% (v / v) of Y215L-S and 1777-S were set as detection groups) into reaction tubes, add an appropriate amount of DPPH working solution, shake well, and react at room temperature in the dark for 30 min. Measure the absorbance A of the reaction solution at a wavelength of 519 nm using a spectrophotometer; at the same time, set up a blank control group (no sample added, only DPPH working solution added), and measure its absorbance, which is recorded as A0. The free radical scavenging capacity of the sample was calculated using the formula: DPPH free radical scavenging rate = (A0-A) / A0 × 100%. Three parallel experiments were set up for each sample, and the average value was taken as the final result. VC (vitamin C) was used as a positive control.

[0059] Vitamin C (VC) was used as a positive control, and its DPPH free radical scavenging ability was measured under the same conditions. This was then used as a reference standard for evaluating the antioxidant activity of the samples. Because VC has strong free radical scavenging ability, stable properties, rapid reaction, and good reproducibility, and is widely recognized as a classic antioxidant reference substance, it can intuitively and reliably evaluate the DPPH scavenging activity level of the test samples. Therefore, it is often used as a standard positive reference in this system.

[0060] according to Figure 4 It can be seen that Y215L-S can effectively remove DPPH at both 0.5% (v / v) and 3% (v / v) addition levels, and the effect is more significant than that of 1777-S.

[0061] Example 6: The role of Y215L in helping dermal cells resist UVA A UVA-stimulated fibroblast model was created to simulate UV-induced skin inflammation. Fibroblasts were seeded in 8000-well 96-well plates and cultured until 80% confluence. UVA was applied at 10 J / cm². 2 Fibroblasts were treated with appropriate doses. A no-irradiation group served as a negative control, and an irradiation-only group (without sample) served as a blank control. Y215L-P and 1777-P were used as detection groups at 0.05% (v / v). After stimulation, the test samples were added, and the cells were returned to the incubator and incubated for 24 h. Cell viability was then detected using a CCK8 assay kit. The 96-well plates were removed from the incubator, the culture medium was aspirated, and the cells were washed twice with 1X PBS. CCK8 working solution was added, and the plates were incubated at 37°C under constant humidity in a CO2 incubator for 1 hour. After the solution changed color, the absorbance was read at 450 nm using a microplate reader.

[0062] Relative percentage = (Sample average OD value / NT average OD value) * 100%.

[0063] Depend on Figure 5 It is known that Y215L-P can effectively help fibroblasts resist UVA damage, and its effect is significantly better than that of 1777-P.

[0064] Example 7: The effects of Y215L-P and 1777-P on the ECM matrix secretion capacity and anti-aging-related mRNA expression levels of fibroblasts were detected by qPCR. Y215L-P and 1777-P were set up as detection groups at 0.05% (v / v), and NT served as the blank control group. The primer sequences used are shown in Table 3.

[0065] Table 3 qPCR Primer Design Table

[0066] The COL1A1 gene encodes type I collagen, the main protein in the dermis of human skin. This protein is a core component for maintaining skin firmness, elasticity, and structural integrity. During skin aging, the expression levels of the COL1A1 gene and its corresponding protein decrease significantly, leading to problems such as skin laxity and wrinkle formation. Therefore, COL1A1 can serve as a key biomarker for evaluating the anti-aging efficacy of skincare ingredients. In ingredient efficacy assessment, the mRNA transcription level and protein expression of COL1A1 in fibroblasts under the influence of the tested ingredient can be detected. Combined with changes in collagen degradation-related protease activity and aging-related signaling pathways, it can be determined whether the tested ingredient can effectively upregulate COL1A1 expression, promote endogenous type I collagen synthesis, and inhibit collagen degradation. This allows for the quantification and verification of the ingredient's anti-aging activity and mechanism of action.

[0067] Depend on Figure 6 It is known that Y215L-P can effectively promote the mRNA expression of type I collagen in fibroblasts, while 1777-P will downregulate the mRNA expression of type I collagen.

[0068] The FN1 gene encodes fibronectin, a crucial component of the extracellular matrix in the dermis. This protein mediates fibroblast adhesion, migration, and proliferation, maintaining the integrity, resilience, and repair capabilities of skin tissue. During skin aging, the expression levels of the FN1 gene and protein gradually decline, leading to a loosening of the extracellular matrix network, weakened skin support, impaired barrier function, and accelerated appearance of signs of aging. Therefore, FN1 can serve as an important biomarker for evaluating the anti-aging efficacy of skincare ingredients. In evaluating the efficacy of these ingredients, the mRNA transcription level and protein expression of FN1 after the tested ingredient acts on skin fibroblasts can be measured. Combined with indicators of cell activity and matrix remodeling, this can determine whether the tested ingredient can effectively upregulate FN1 expression, repair and stabilize the extracellular matrix, thereby objectively verifying its effects and application value in improving skin laxity, strengthening skin texture, and delaying skin aging.

[0069] Depend on Figure 7 It can be seen that Y215L-P can effectively promote the expression of FN1 mRNA in fibroblasts, while 1777-P will downregulate the expression of FN1 mRNA.

[0070] CD44 is a key gene encoding cell surface adhesion molecules. Its expression products are widely found in skin fibroblasts and keratinocytes, participating in intercellular adhesion, extracellular matrix interactions, tissue repair, and microenvironment homeostasis regulation. It is crucial for maintaining the integrity, elasticity, and self-repair capabilities of skin tissue. During skin aging, the expression levels of the CD44 gene and protein significantly decrease, leading to reduced cell adhesion, disrupted matrix architecture, weakened skin repair function, and exacerbated signs of aging such as sagging and roughness. Therefore, CD44 can serve as an important biomarker for evaluating the anti-aging efficacy of skincare ingredients. By detecting the mRNA transcription level and protein expression of CD44 after the test ingredient acts on skin cells, combined with indicators related to cellular physiological state, it is possible to determine whether the test ingredient can effectively upregulate CD44 expression, improve the skin cell microenvironment, and enhance tissue repair capabilities, thereby objectively verifying its effects in delaying skin aging and repairing skin texture.

[0071] Depend on Figure 8 It can be seen that Y215L-P can significantly promote the mRNA expression of CD44 in fibroblasts, while 1777-P has no significant promoting effect.

[0072] Example 8: Y215L fermentation for pigment production I. Fermentation: Remove the glycerol storage tube of strain Y215L from the -80℃ freezer, aspirate 100 μL of bacterial culture, and inoculate it into 5 mL of liquid YPD medium (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose). Activate the culture for 24 h at 30℃ and 200 rpm. Then, inoculate 1 mL of the bacterial culture into YPD seed culture medium and incubate for a second activation at 30℃ and 200 rpm for 12 h. Follow the initial inoculation OD... 600 =0.1, inoculated into 50 mL of fermentation medium (80 g / L glucose, 10 g / L glycerol, 5 g / L yeast extract, 0.8 g / L potassium dihydrogen phosphate, 0.41 g / L magnesium sulfate heptahydrate, 0.66 g / L calcium chloride dihydrate), sealed with a breathable membrane, fermented first at 42℃ and 200 rpm for 12 h, then at 30℃ and 200 rpm for 108 h, OD of the bacterial culture was... 600 ≈6.75, sampled for subsequent pigment extraction.

[0073] II. Pigment Extraction: 1. Take 1 mL of the bacterial culture after fermentation for 120 h and place it in a 2 mL centrifuge tube. Centrifuge at 12000 rpm for 5 min, discard the supernatant, wash with 1 mL ddH2O, centrifuge at 12000 rpm for 5 min, wash twice, centrifuge to remove the supernatant, and resuspend the bacterial cells in 1 mL acetone. 2. Add 500 μL of grinding beads to the centrifuge tube; 3. Add the sample to the fully automatic rapid sample grinder, set the grinding conditions to 4℃, 60 Hz, 180 s, and grind for 6 cycles; 4. After grinding, centrifuge at 4℃ and 12000 rpm for 10 min, and collect the supernatant into a new centrifuge tube; 5. Add 500 μL of acetone to the original centrifuge tube for re-extraction, sonicate for 10 min, mix thoroughly, and repeat several times until the bacterial cells turn white; 6. After mixing the extracts from steps 4 and 5, place them in a vacuum concentrator, set the temperature to room temperature to evaporate the organic solvent, and finally redissolve with 1 mL of acetone.

[0074] III. Pigment Detection: Pigment yield was determined using a Waters high-performance liquid chromatography (HPLC) system. Chromatographic separation was performed using a C18 analytical column (4.6 mm × 250 mm) at 40 °C. The mobile phase was acetonitrile:methanol:isopropanol (5:3:2), with isocratic elution and a flow rate of 1.0 mL / min. A UV detector with a detection wavelength of 450 nm was used, and the injection volume was 10 μL.

[0075] Lycopene standard was purchased from Macklin, CAS No.: 502-65-8, catalog number L823832-20 mg.

[0076] The liquid chromatography detection results are shown below. Figure 9 The lycopene content reached 124.978 mg / L.

[0077] In summary, Y215L-P has the effects of promoting fibroblast proliferation, resisting photoaging, resisting free radicals, anti-aging, and anti-oxidation. It can be used for the biosynthesis of lycopene and has the potential to be developed into skin care, moisturizing products or color cosmetics.

[0078] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention.

Claims

1. A method for constructing genetically engineered Kluyveromyces martensii, characterized in that: The codon-optimized exogenous genes tHMG and Y215CrtBY were integrated into the ADH2 site of the starting strain, and the codon-optimized exogenous genes PrCrtE and Y215CrtI were integrated into the GPD1 site of the starting strain. The nucleotide sequence of the tHMG gene is shown in SEQ ID NO.1, the nucleotide sequence of the Y215CrtBY gene is shown in SEQ ID NO.2, the nucleotide sequence of the PrCrtE gene is shown in SEQ ID NO.3, and the nucleotide sequence of the Y215CrtI gene is shown in SEQ ID NO.

4.

2. The construction method according to claim 1, characterized in that, The starting strain is Kluyveromyces martensii (Kluyveromyces masculinus). Kluyveromyces marxianus NBRC1777.

3. A strain of *Kluyveromyces martensii* obtained by the construction method according to claim 1 (… Kluyveromyces marxianus The genetically engineered bacterium Y215L was deposited at the China Center for Type Culture Collection on May 22, 2026, with accession number CCTCC NO: M2026966, and deposit address: Wuhan University, Wuhan, China.

4. The application of the genetically engineered strain Y215L as described in claim 3 in the fermentation production of lycopene.

5. The application according to claim 4, characterized in that, The fermentation medium for the genetically engineered strain Y215L is: glucose 80 g / L, glycerol 10 g / L, yeast extract 5 g / L, potassium dihydrogen phosphate 0.8 g / L, magnesium sulfate heptahydrate 0.41 g / L, and calcium chloride dihydrate 0.66 g / L.

6. The application according to claim 4, characterized in that, The fermentation conditions for the genetically engineered strain Y215L are as follows: first ferment at 42℃ and 200 rpm for 12 h, and then ferment at 30℃ and 200 rpm for 108 h.

7. The use of the genetically engineered bacterium Y215L according to claim 3 in the preparation of products that promote fibroblast proliferation.

8. The application of the genetically engineered bacterium Y215L according to claim 3 in the preparation of products that scavenge free radicals and in the preparation of products with anti-photoaging effects.

9. The use of the genetically engineered bacterium Y215L according to claim 3 in the preparation of products that promote the secretion of fibroblast ECM matrix and / or promote the expression of fibroblast anti-aging related mRNAs.

10. The application according to any one of claims 7-9, characterized in that, The product is prepared using the fermentation product cells of genetically engineered bacteria Y215L as raw material.

Images