Mutant spike proteins as vaccines against sars-cov-2

Abstract

The present invention relates to a second generation vaccine against COVID-19 to eliminate or reduce the binding of the SARS-CoV-2 spike (S) protein or parts thereof to human angiotensin-converting enzyme 2 (hACE2). Such vaccines have several advantages to avoid immune dysregulation pathways activated after the S protein / hACE2 interaction, while maintaining the ability to elicit a strong and robust antibody neutralization response against SARS-CoV-2. The present invention also relates to the use of the S protein for therapeutic use and for vaccines in the prevention or treatment of SARS-CoV-2 infection or a disease or disorder caused by such infection.

Description

Technical Field

[0001] This invention relates to second-generation vaccines against COVID-19 to eliminate or reduce the binding of the SARS-CoV-2 spike (S) protein or a portion thereof to human angiotensin-converting enzyme 2 (hACE2). Such vaccines offer several advantages in avoiding dysregulated immune pathways activated following S protein / hACE2 interaction, while maintaining the ability to elicit a strong and robust antibody-neutralizing response to SARS-CoV-2. The invention also relates to the use of such vaccines in the prevention or treatment of SARS-CoV-2 infection or the disease or condition caused by such infection. Background Technology

[0002] Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) is a highly contagious and pathogenic coronavirus. Although the World Health Organization (WHO) declared the outbreak over in May 2023, the virus continues to evolve and evade the immune response triggered by infection and / or vaccination, affecting the lives of many people worldwide. Therefore, novel, safe, and highly immunogenic vaccines are needed. SARS-CoV-2 infection begins with the interaction between the viral glycoprotein spike (S) and human angiotensin-converting enzyme 2 (hACE2). The S protein attaches hACE2 to the host cell via a receptor-binding domain (RBD) located in the S1 domain. This interaction allows TMPRSS2 to cleave the S protein, leading to activation of the S2 domain, thereby enabling the viral membrane to fuse with the host cell membrane. Lamers et al. SARS-CoV-2 pathogenesis. Nature Reviews Microbiology 20, 270-284, 2022 Baldari et al. Emerging roles of SARS-CoV-2 Although hACE2 was previously considered only a component of the renin-angiotensin system, recent reports have highlighted its widespread distribution in different tissues and organs and its potential contribution to the extrapulmonary manifestations of COVID-19. Spike-ACE2 in immune evasion and pathogenesis. Trends in Immunology 44, 424- Onnis et al. 434, 2023 Among the different pathways involving hACE2, recent findings suggest that the SARS-CoV-2 S protein utilizes hACE2 signaling to inhibit immune synaptic assembly and CD8. + Cytotoxic T lymphocyte-mediated killing ( SARS-CoV-2 Spike protein suppresses CTL-mediated killing by inhibiting immune synapse assembly. Journal of Experimental Medicine 220, e20220906, 2022 Figure 1 Similar effects can also be used to disrupt different activities of innate and adaptive immune responses, highlighting the key role of the S protein / hACE2 axis in SARS-CoV-2 immune escape.

[0003] Since all current SARS-CoV-2 vaccines are based on the sequence and structure of the S protein of strains (collected from Wuhan) or variant strains of concern, there is a need to develop second-generation vaccines to avoid activation of hACE2 signaling and overcome potential defects of the current antigen while maintaining high immunogenicity. Summary of the Invention

[0004] This invention relates to second-generation vaccines against COVID-19 to eliminate or reduce the binding of the SARS-CoV-2 S protein or a portion thereof to ACE2 (particularly human ACE2). Such vaccines offer several advantages in avoiding dysregulated immune pathways activated following S protein / hACE2 interaction, while maintaining the ability to elicit a strong and robust antibody-neutralizing response to SARS-CoV-2. In fact, current vaccines are based on the wild-type sequence of the SARS-CoV-2 S protein, allowing this protein to bind to hACE2. This interaction is associated with immune escape mechanisms and may exacerbate the severity of COVID-19. Data from the authors of this invention demonstrate that novel mutant sets can be introduced into the S protein RBD using computer prediction to reduce binding activity to hACE2. After computer simulation evaluation and manual curation of the amino acid mutations of the introduced antigen, a set of 21 RBD residues were selected for mutagenesis (amino acid positions 417, 446, 447, 449, 453, 455, 456, 473, 475, 476, 484, 486, 487, 489, 493, 496, 498, 500, 501, 502 and 505).

[0005] Thirty-seven unique combinations were selected from these residues and are described in the sequence listing that is part of this specification. These combinations include (1) N487M; Y505K, (2) K417A; N487M; Y505K, (3) N487G; Y489K; Y505K, (4) N487M; Y489K; Y505K, (5) K417L; N487M; Y489K; Y505K, (6) K417Q; N487M; Y489K; Y505K and (7) K417L; N487M; Y489K; Y505G. These combinations were selected because computer simulation studies predicted that they would significantly reduce binding to hACE2 while having the fewest mutated residues. For seven sequences (mut 2S-MK; mut 3S-AMK; mut 3S-GKK; mut 3S-MKK; mut 4S-LMKK; mut 4S-QMKK; mut 4S-LMKG), we experimentally validated the computer-predicted data. For the remaining thirty sequences, only the predicted loss of binding and stability data were evaluated. All seven experimentally validated S protein mutants were recombinantly expressed via transient CHO transfection for in vitro evaluation. Specifically, the inventors performed two different ELISA assays to characterize the antigen. The first ELISA was used to confirm that the quaternary structure of the newly generated S protein mutants was not altered by the introduction of the selected mutations.

[0006] To achieve this goal, five different monoclonal antibodies (mAbs) were used. These mAbs target three different RBD sites, namely the NTD and S2 domains of the SARS-CoV-2 S protein. A second ELISA allowed us to assess the binding activity of the novel mutant S protein to hACE2. The inventors obtained results showing that the generated mutant S protein maintained its quaternary structure while exhibiting a 3.3-fold reduction in binding to hACE2 as measured by ELISA.

[0007] Therefore, in some aspects, the present invention provides an immunogenic polypeptide comprising or composed of a receptor-binding domain (RBD) of the SARS-CoV-2 spike protein, wherein one or more residues at positions 417, 449, 477, 487, 489, 493, 494, 500, 502, and 505 of the receptor-binding domain (RBD) are mutated, wherein the positions are numbered with reference to SEQ ID NO:1.

[0008] In some aspects, the present invention provides an isolated nucleic acid molecule and a vector, said nucleic acid molecule comprising a nucleotide sequence encoding an immunogenic polypeptide according to any embodiment disclosed herein, said vector comprising said nucleic acid molecule.

[0009] In some aspects, the present invention provides an immunogenic composition comprising an immunogenic polypeptide or nucleic acid molecule or carrier according to any embodiment disclosed herein, optionally comprising one or more adjuvants or excipients.

[0010] In some respects, the present invention provides the use of the immunogenic peptides and immunogenic compositions disclosed herein for the prevention and / or treatment of SARS-CoV-2 infection or disease or condition caused by such infection, particularly COVID-19 disease.

[0011] In some respects, the present invention provides the use of the immunogenic peptides and immunogenic compositions disclosed herein for use as vaccines against SARS-CoV-2 infection.

[0012] This invention encompasses any combination of the foregoing aspects and embodiments. Attached Figure Description

[0013] Figure 2 Conservation analysis of the RBD domain in the SARS-CoV-2 S protein. More than 11 million sequences were downloaded from GISAID and aligned to determine the mutation frequency of each residue that makes up the SARS-CoV-2 RBD domain. hACE2 interacting residues are highlighted in purple, and receptor-binding motifs (RBMs) are highlighted in red.

[0014] Figure 3 The predicted results of binding affinity (A) and protein stability (B) are combined. Binding affinity is measured by comparing WT free energy and mutation free energy. G score. Similarly, stability was measured by comparing WT RBD monomers with mutant monomers.

[0015] Figure 4 Comparison of binding affinity and stability of constructs with two, three, and four mutations. Pareto optimal solutions are highlighted in yellow.

[0016] Figure 5 ELISA results. A) The table shows the binding of mAb to the mutant SARS-CoV-2 S protein. The experiment was performed three times using the technique. B) The figure shows the ability of the mutant SARS-CoV-2 S protein to bind to hACE2, and the fold decrease in binding compared to the corresponding WT SARS-CoV-2 S protein. Mean and standard deviation are shown in the figure.

[0017] Figure 6A schematic diagram of the SARS-CoV-2 S protein RBD. This diagram illustrates four key anchor points of interaction between the SARS-CoV-2 RBD and hACE2, manually identified by experts through 3D visualization.

[0018] Figure 7 Serum-mediated virus neutralization against SARS-CoV-2 strains (collected from Wuhan). This figure illustrates the inhibition of viral infectivity in cell culture in the presence of serum neutralizing antibodies. The experiment was performed three times.

[0019] Immunogenic polypeptide Second-round ELISA results of the mutated SARS-CoV-2 S protein. This figure shows the ability of the mutated SARS-CoV-2 S protein to bind to hACE2, and the fold-fold decrease in binding compared to the corresponding WT SARS-CoV-2 S protein. The experiment was performed three times. The mean and standard deviation are shown in the figure. Detailed Implementation

[0020] Unless otherwise defined herein, scientific and technical terms used in connection with this invention shall have the meanings commonly understood by one of ordinary skill in the art.

[0021] Furthermore, unless the context requires otherwise, singular terms shall include plural terms, and plural terms shall include singular terms. Generally, terms and techniques related to cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization as described herein are well-known and commonly used in the art. Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well-known in the art and as described in the various general and more specific references cited and discussed in this specification. For example, see Sambrook et al. Molecular Cloning: A Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989) and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992), and Harlow and Lane Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1990), which are incorporated herein by reference.

[0022] Unless otherwise stated, the following terms shall be understood to have the following meanings: As used herein, the terms “peptide,” “protein,” and “amino acid sequence” generally refer to a polymer of amino acid residues and are not limited to the minimum length of the product. The peptides of this invention can be prepared in a variety of ways, such as by chemical synthesis (at least partially), by digestion of longer peptides using proteases, by RNA translation, or by purification from cell cultures of the organism itself (e.g., from recombinant expression). Biological methods are generally limited to the production of L-amino acid-based peptides, but D-amino acids (or other non-natural amino acids, such as iodotyrosine or methylphenylalanine, azide monoalanine, etc.) can be introduced using manipulation of translational mechanisms (e.g., aminoacyl-tRNA molecules) (Ibba (1996) Biotechnol Genet Eng Rev 13:197-216).

[0023] The term "peptide" includes natural or artificial proteins, protein fragments, and peptide analogs of protein sequences, i.e., isolated or purified peptides. Peptides can be monomers or polymers.

[0024] The terms “isolated protein” and “isolated polypeptide” refer to a protein or polypeptide that, due to its origin or derived source, (1) is unrelated to the naturally associated components that accompany it in its natural state, (2) does not contain other proteins from the same species, (3) is expressed by cells from a different species, or (4) is not present in nature. Therefore, a polypeptide synthesized chemically or synthesized in a cellular system different from the cells of its natural origin will be “isolated” from its naturally associated components. Proteins can also be substantially free of naturally associated components by using protein purification techniques well known in the art. A protein or polypeptide is “substantially pure,” “substantially homogeneous,” or “substantially purified” when at least about 60% to 75% of the sample exhibits a single polypeptide. A polypeptide or protein can be a monomer or a polymer. Substantially pure polypeptides or proteins typically constitute about 50%, 60%, 70%, 80%, or 90% w / w of a protein sample, more commonly about 95%, and preferably have a purity exceeding 99%. Protein purity or homogeneity can be indicated by a variety of methods known in the art, such as polyacrylamide gel electrophoresis of a protein sample followed by staining the gel with a staining agent well known in the art to visualize individual polypeptide bands. For certain purposes, higher resolution can be provided by using HPLC or other purification methods known in the art.

[0025] The term "peptide fragment" as used in this article refers to a polypeptide with an amino terminus and / or a carboxyl terminus missing, but whose remaining amino acid sequence is identical to the sequence at the corresponding position in the natural sequence.

[0026] The term "SARS-CoV-2" refers to Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), which is the type of coronavirus that causes coronavirus disease 2019 (COVID-19).

[0027] As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides with a length of at least 10 bases, which may be ribonucleotides or deoxyribonucleotides, or any modified form of nucleotides. This term includes both single-stranded and double-stranded forms.

[0028] The term “isolated polynucleotide” as used herein refers to a polynucleotide of genomic origin, cDNA origin, or synthetic origin or some combination thereof, in which, due to its origin, “isolated polynucleotide” (1) is not associated with all or part of the polynucleotide that is found in nature when the “isolated polynucleotide” is found, (2) is operatively linked to a polynucleotide that is not linked to in nature, or (3) is not present in nature as part of a larger sequence.

[0029] As used herein, the term "nucleic acid" is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA), as well as analogs of DNA or RNA produced using nucleotide analogs. Nucleic acids can be single-stranded or double-stranded.

[0030] The term "naturally occurring nucleotide" as used herein includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotide" as used herein includes nucleotides with modified or substituted sugar groups, etc. The term "oligonucleotide linkage" as used herein includes oligonucleotide linkages such as those in phosphate thioesters, phosphate dithioesters, phosphate selenoate, phosphate diselenoate, phosphate anilothioate, phosphate horaniladate, and phosphate amidate. For example, see LaPlanche et al., Nucl. Acids Res. 14:9081 (1986); Stec et al., J. Am. Chem. Soc. 106:6077 (1984); Stein et al., Nucl. Acids Res. 16:3209 (1988); Zon et al., Anti-Cancer Drug Design 6:539 (1991); Zon et al.. Oligonucleotides and Analogues: A Practical Approach, pp.87-108 (F. Eckstein, Ed., Oxford University Press, Oxford England (1991)); US Patent No. 5,151,510; Uhlmann and Peyman, Chemical Reviews 90:543 (1990), the disclosures of which are incorporated herein by reference. As used herein, the term "expression control sequence" refers to a polynucleotide sequence essential to the expression and processing of the coding sequence to which it is linked. Expression control sequences include appropriate transcription initiation, termination, promoter, and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and sequences that enhance protein secretion when needed. The nature of such control sequences varies from host organism to host organism; in prokaryotes, such control sequences typically include promoters, ribosome binding sites, and transcription termination sequences; in eukaryotes, such control sequences typically include promoters and transcription termination sequences. The term "control sequence" is intended to include at least all components whose presence is essential for expression and processing, and may also include other components whose presence is favorable, such as leader sequences and fusion chaperone sequences.As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. In some embodiments, the vector is a plasmid, a circular double-stranded DNA fragment in which additional DNA fragments can be linked. In some embodiments, the vector is a viral vector in which additional DNA fragments can be linked to a viral genome. In some embodiments, the vector is capable of autonomous replication in the host cell to which it is introduced (e.g., bacterial vectors of bacterial replication origin and cell-free mammalian vectors). In other embodiments, the vector (e.g., a non-cell-free mammalian vector) can integrate into the host cell's genome after introduction into the host cell, thereby replicating along with the host genome.

[0031] As used in this article, the term "recombinant host cell" (or simply "host cell") refers to a cell into which a recombinant expression vector has been introduced. It should be understood that "recombinant host cell" and "host cell" refer not only to the specific test cell but also to the progeny of such cells. Progeny may undergo modifications due to mutations or environmental influences, and therefore may actually differ from the parent cell, but are still included within the scope of the term "host cell" as used herein.

[0032] In the context of nucleotide or amino acid sequences, the term "percent sequence identity" refers to the number of residues in two sequences that are identical when aligned to achieve maximum correspondence. The length of a sequence identity comparison can be at least about 9 nucleotides, typically at least about 18 nucleotides, more typically at least about 24 nucleotides, typically at least about 28 nucleotides, more representatively at least about 32 nucleotides, and preferably at least about 36, 48, or more nucleotides. Many different algorithms are known in the art for measuring the identity of nucleotide sequences. For example, FASTA, Gap, or Bestfit can be used to compare polynucleotide sequences. These programs provide alignments of the best overlapping regions between the query and search sequences and percentages of sequence identity (Pearson, Methods Enzymol. 183:63-98 (1990); Pearson, Methods MoI. Biol. 132:185-219 (2000); Pearson, MethodsEnzymol. 266:227-258 (1996); Pearson, J MoI. Biol 276:71-84 (1998); incorporated herein by reference). When referring to nucleic acids or their fragments or amino acids, the term "substantial similarity" or "substantial sequence similarity" means that, when optimally aligned with appropriate nucleotide insertions or deletions in another nucleic acid (or its complementary strand), at least about 85%, preferably at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% of the nucleotide bases are identical, as measured by any well-known sequence identity algorithm (such as FASTA, BLAST, or Gap as described above). When applied to peptides, the term "substantial identity" means that two peptide sequences, when optimally aligned, for example by using the default gap weights provided with the program, such as by the GAP or BESTFIT, share at least 70%, 75%, or 80%, preferably at least 90% or 95%, more preferably at least 97%, 98%, or 99% sequence identity. In some embodiments, dissimilar residue positions differ due to conserved amino acid substitutions. "Conserved amino acid substitution" means that one amino acid residue is replaced by another amino acid residue with a side chain R group having similar chemical properties (such as charge or hydrophobicity). Generally, conserved amino acid substitutions do not substantially alter the functional properties of a protein. When two or more amino acid sequences differ from each other due to conserved substitutions, the percentage of sequence identity can be adjusted upwards to correct the conservatism of the substitution. Methods for making such adjustments are well known to those skilled in the art. For example, see Pearson, Methods MoI. Biol. 243:307-31 (1994).Examples of amino acid groups with side chains having similar chemical properties include 1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) aliphatic hydroxyl side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartic acid and glutamic acid; and 7) sulfur-containing side chains: cysteine ​​and methionine. Conserved amino acid substituents are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamic acid-aspartic acid, and asparagine-glutamine. Alternatively, a conserved substitution is any change with a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al, Science 256:1443-45 (1992), which is incorporated herein by reference. "Moderately conserved" substitution refers to any change that has a non-negative value in the PAM250 log-likelihood matrix. Peptide sequence identity is typically measured using sequence analysis software. Protein analysis software uses similarity measures assigned to various substitutions, deletions, and other modifications, including conserved amino acid substitutions, to match sequences. For example, GCG includes programs such as "Gap" and "Bestfit," which can be used with the default parameters specified by the program to determine sequence homology or sequence identity between closely related peptides, such as homologous peptides from different biological species or homology or identity between wild-type proteins and their mutant counterparts.

[0033] The expression "reduced binding to ACE2" means that, relative to a polypeptide containing or composed of a non-mutated or natural RBD, one or more mutations in the receptor-binding domain (RBD) are designed to reduce or decrease the binding of the polypeptide of the present invention (containing or composed of the mutated RBD or a portion thereof) to angiotensin-converting enzyme 2 (ACE2), particularly to human ACE2 (hACE2).

[0034] The binding activity of the peptide to ACE2 can be determined and characterized by any technique or assay known to those skilled in the art, for example, particularly ELISA assays. In one aspect, ELISA assays are performed as disclosed in paragraph 1.7 of the Experimental Section of this specification.

[0035] The immunogenic peptides or nucleic acid molecules or immunogenic compositions of the present invention induce an immune response in an individual or host (human or non-human), but avoid activation of ACE2 signaling due to their reduced binding to ACE2.

[0036] The immunogenic products described herein selectively induce an immune response in an individual or host (human or non-human animal) and can be identified and characterized by methods described herein and those conventionally practiced in the art. These methods include in vivo assays, such as those used in animal immunization studies. Various in vitro assays, such as immunochemical methods for detecting and analyzing antibodies, include Western immunoblot analysis, ELISA, immunoprecipitation, radioimmunoassay, and combinations thereof. Other methods and techniques that can be used to analyze and characterize immune responses include neutralization assays (such as plaque reduction assays or assays measuring cytopathic effect (CPE), or any other neutralization assay performed by those skilled in the art). These and other assays and methods known in the art can be used to characterize immunogens and their variants.

[0037] The statistical significance of results obtained in various measurements can be calculated and understood using methods that are routinely practiced by professionals in the relevant field.

[0038] As used herein, "immunogenic composition," "vaccine," or "vaccine formulation" refers to a composition containing an antigenic molecule, wherein administration of the composition to an individual will elicit a humoral and / or cellular immune response against the target antigenic / immunogenic molecule. Immunogenic compositions can be directly introduced into recipient individuals, for example, via injection, inhalation, oral administration, intranasal administration, or any other parenteral, mucosal, or transdermal (e.g., rectal or vaginal) route.

[0039] In any part of this specification or claims, the expression "comprising" or "including" may be replaced with "consisting of" or "consist(s) of".

[0040] Nucleic acid molecule A first aspect of the present invention provides an immunogenic polypeptide comprising or composed of a receptor-binding domain (RBD) of the SARS-CoV-2 spike protein, wherein the RBD is mutated at one or more residues at positions 417, 449, 477, 487, 489, 493, 494, 500, 502, and 505, wherein the positions are numbered according to SEQ ID NO:1. In some aspects, the immunogenic polypeptide is mutated at at least 2, 3, or all of the said positions. In particular, the one or more mutations in the RBD can reduce the binding of the immunogenic polypeptide to ACE2, particularly to human ACE2, compared to a polypeptide comprising or composed of a non-mutated or natural RBD.

[0041] In a preferred embodiment, the present invention provides an immunogenic polypeptide comprising or composed of the SARS-CoV-2 spike protein having SEQ ID NO:1, wherein the receptor-binding domain (RBD) of the protein is mutated at one or more residues at positions 417, 449, 477, 487, 489, 493, 494, 500, 502, and 505, wherein the numbering of the positions refers to SEQ ID NO:1.

[0042] In some embodiments, one or more of the RBD residues are mutated in alanine, leucine, methionine, lysine, glycine, or glutamine.

[0043] In some embodiments, the present invention provides an immunogenic polypeptide comprising or composed of an RBD of the SARS-CoV-2 spike protein having one or more of the following mutations: K417A, K417L, K417Q, Y449K, Y449N, Y449W, Y449M, S477Q, S477Y, S477N, N487M, N4 87G, N487A, N487I, N487P, N487S, N487K, N487L, Y489K, Y489V, Y489R, Q493Y, Q493A, Q493W, Q493I, S494I, T500V, T500I, G502T, G502I, G502A, G502S, G502F, Y505K, Y505Q, and Y505G, wherein the numbering of the positions is referenced to SEQ ID NO: 1.

[0044] Preferably, the immunogenic peptide comprises a mutant RBD having at least 2, 3, or 4 such mutations.

[0045] According to a specific implementation scheme, the immunogenic peptide comprises or consists of an RBD of the SARS-CoV-2 spike protein having one of the following mutation groups: (1) N487M and Y505K; or (2) K417A, N487M and Y505K; or (3) N487G, Y489K and Y505K; or (4) N487M, Y489K, Y505K; or (5) K417L, N487M, Y489K and Y505K; or (6) K417Q, N487M, Y489K and Y505K; or (7) K417L, N487M, Y489K and Y505G; or (8) S477Q, N487P and Y489V; or (9) S477Q, N487P and Y489R; or (10) S477Q, N487G and Y489V; or (11) S477Q, N487S and Y489V; or (12) S477Q, N487K and Y489V; or (13) S477Q, N487G and Y489R; or (14) S477Q, N487K and Y489R; or (15) S477Q, N487S and Y489R; or (16) S477Q, N487M and Y489R; or (17) S477Q, N487I and Y489R; or (18) S477Q, N487P, T500V and G502T; or (19) S477Q, N487P, T500I and G502T; or (20) S477Q, N487P, T500V and G502I; or (21) S477Q, N487P, T500I and G502I; or (22) S477Q, N487P, Q493Y and S494I; or (23) S477Q, N487P, Q493A and S494I; or (24) S477Q, N487P, Q493W and S494I; or (25) Q493Y, S494I, T500V and G502I; or (26) S477Y, N487L, T500V and G502A; or (27) Q493W, S494I, T500V, and G502I; or (28) N487P, Q493Y, Y449K and G502T; or (29) N487P, Q493Y, Y449K and Y505Q; or (30) N487P, Q493A, Y449N and G502T; or (31) N487P, Q493W, Y449W and Y505Q; or (32) N487P, Q493Y, Y449N and T500I; or (33) N487A, Q493W, Y449M and G502S; or (34) N487G, Q493W, Y449N and T500V; or (35) S477N, Q493Y, Y449N and G502F; or (36) N487M, Q493W, Y449W and T500I; or (37) N487I, Q493I, Y449W and T500I; The location number is referred to as SEQ ID NO: 1.

[0046] In some embodiments, the immunogenic polypeptide comprises or is composed of the RBD of the SARS-CoV-2 spike protein, wherein the RBD of the SARS-CoV-2 spike protein comprises or is composed of sequences selected from the following: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:3 ... NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0047] According to some embodiments of the invention, immunogenic peptides and their variants can be synthesized or recombinantly generated. For example, immunogenic peptides can be expressed by polynucleotides operatively linked to expression control sequences (such as promoters) in a nucleic acid expression construct. For example, they can be expressed in mammalian cells, yeast, bacteria, insects, or other cells under the control of appropriate expression control sequences. Cell-free translation systems can also be used to produce such coronavirus proteins using nucleic acids (including RNA) and expression constructs. Suitable cloning and expression vectors for prokaryotic and eukaryotic hosts are routinely used by those skilled in the art and are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, (1989) and Third Edition (2001), and may include plasmids, granules, shuttle vectors, viral vectors, and vectors disclosed therein containing chromosomal origins of replication.

[0048] Vector In some aspects, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding an immunogenic polypeptide according to any embodiment disclosed herein.

[0049] In a preferred embodiment, the isolated nucleic acid molecule comprises or is composed of nucleic acid sequences selected from or composed of the following nucleic acid sequences: SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 or SEQ ID NO:15.

[0050] Preferably, the nucleic acid molecule is a DNA or mRNA sequence. By using RNA instead of DNA for gene vaccination, the risk of unwanted genome integration and the development of anti-DNA antibodies can be minimized or avoided.

[0051] In some implementations, the mRNA is contained within lipid nanoparticles.

[0052] Lipid nanoparticles, formed from cationic lipids and other lipid components such as neutral lipids, cholesterol, PEG, PEGylated lipids, and oligonucleotides, have been used to block RNA degradation in plasma and promote cellular uptake of oligonucleotides. Procedures for manufacturing the mRNA vaccines described herein are known in the art, see, for example, US 10,576,146, US 10,485,884, and US 9,950,065, which are incorporated herein by reference.

[0053] Immunogenic composition In some aspects, the present invention provides a carrier comprising a nucleic acid molecule encoding an immunogenic polypeptide according to any embodiment disclosed herein.

[0054] In some aspects, the present invention provides a vector for use as a vaccine or expression vector to produce the immunogenic polypeptide.

[0055] The vector according to any embodiment disclosed herein optionally includes an expression control sequence operatively linked to the nucleic acid molecule.

[0056] In some embodiments, the vector is selected from RNA viral vectors, DNA viral vectors, plasmid viral vectors, adenovirus vectors, adeno-associated virus vectors, herpesvirus vectors, and retroviral vectors.

[0057] In some embodiments, the vector is an adenovirus vector known in the art, particularly a simian adenovirus vector.

[0058] For example, WO 2005 / 071093 describes several replication-defective recombinant simian adenoviruses. Vectors containing these nucleic acid molecules can be used to transfect or transform suitable mammalian, plant, bacterial, or yeast host cells. Transfection or transformation can be performed by any known method of introducing polynucleotides into host cells. Methods for introducing heterologous polynucleotides into mammalian cells are well known in the art, including dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transduction, protoplast fusion, electroporation, encapsulation of polynucleotides in liposomes, lipid nanoparticles, and direct microinjection of DNA into the cell nucleus. Furthermore, nucleic acid molecules can be introduced into mammalian cells via viral vectors. Methods for transforming cells are well known in the art (e.g., see U.S. Patent Nos. 4,399,216, 4,912,040, 4,740,461, and 4,959,455, which are incorporated herein by reference).

[0059] Khare, In some aspects, the present invention provides an immunogenic composition or vaccine comprising an immunogenic polypeptide or nucleic acid molecule or carrier according to any embodiment disclosed herein, optionally comprising one or more adjuvants and / or excipients.

[0060] The amount of immunogenic compound in each composition or vaccine dose is selected to induce an immune protective response in a typical vaccine without significant adverse side effects. This amount will vary depending on the specific immunogen used and the type and amount of adjuvant used. The optimal dose for a particular vaccine can be determined through standard studies observing individual antibody titers and other responses. Generally, each dose is expected to contain 1-1000 μg of immunogen, such as 1-200 μg or 10-100 μg. A typical dose will contain 10-50 μg, such as 15-25 μg, and appropriately about 20 μg of immunogen. Alternatively, a "dose-sparing" approach may be used, for example, in an epidemic situation. This is based on the finding that using a lower dose of antigen can provide the same protective effect due to the presence of an effective adjuvant. Therefore, each human dose may contain significantly lower amounts of immunogen, such as 0.1 to 10 μg, 0.5 to 5 μg, 1 to 3 μg, and appropriately 2 μg of protein per dose. The term "human dose" refers to a dose of volume suitable for human use. Typically, this is between 0.3 and 1.5 ml. In one embodiment, the human dose is 0.5 ml. Following the initial vaccination, individuals typically receive a booster at an interval of 2 to 4 weeks, for example, 3 weeks, and optionally, repeat the booster whenever there is a risk of infection. In one specific embodiment of the invention, a single-dose vaccination regimen is provided, wherein a single dose of the immunogenic compound combined with an adjuvant is sufficient to provide protection against SARS-CoV-2 without the need for any booster after the initial vaccination.

[0061] The immunogenic compositions of the present invention can be provided by any of a variety of routes, such as oral, topical, subcutaneous, mucosal (usually intravaginal), intravenous, intramuscular, intranasal, sublingual, intradermal and suppository.

[0062] Therefore, the immunogenic composition according to any embodiment disclosed in this specification may be in any form suitable for administration by oral, topical, subcutaneous, mucosal (usually vaginal), intravenous, intramuscular, intranasal, sublingual, intradermal or suppository route.

[0063] Immunization can be prophylactic or therapeutic. The invention described herein is primarily, but not limited to, prophylactic vaccination against SARS-CoV-2. Suitable pharmaceutically acceptable carriers or excipients for use in this invention are well known in the art, including, for example, water or buffers. Vaccine preparation is generally described in the following literature: Pharmaceutical Biotechnology, Vol. 61 Vaccine Design - the subunit and adjuvant approach, edited by Powell and Newman, Plenum Press New York, 1995; New Trends and Developments in Vaccines, edited by Voller et al, University Park Press, Baltimore, Maryland, USA 1978.

[0064] In some embodiments, the immunogenic compositions of the present invention may further comprise one or more adjuvants, such as oil-in-water emulsions, mineral-containing compositions, saponin formulations, and other adjuvants known in the art. Methods for producing oil-in-water emulsions are well known to those skilled in the art. Typically, this method involves reacting an oil phase (optionally containing tocopherol) with a surfactant such as PBS / TWEEN 80. TM The solutions are mixed and then homogenized using a homogenizer. Suitable mineral-containing compositions for use as adjuvants in this invention include mineral salts such as aluminum and calcium salts. Disclosed herein are mineral salts such as hydroxides (e.g., oxyhydroxides), phosphates (e.g., hydroxyphosphates, orthophosphates), sulfates, etc. (e.g., see chapters 8 & 9 of Vaccine design: the subunit and adjuvant approach (1995) Powell & Newman. ISBN 0-306-44867-X), or mixtures of different mineral compounds, wherein the compounds take any suitable form (e.g., gel, crystals, amorphous, etc.), and are preferably adsorbed. Mineral-containing compositions can also be formulated as metal salt particles (see WO00 / 23105).

[0065] Medical use The peptides, nucleic acid molecules, carriers, and immunogenic compositions described herein can be used to prevent and / or treat SARS-CoV-2 infection or diseases or conditions caused by this infection. Therefore, immunity can be preventative or therapeutic.

[0066] Preferably, the polypeptides, nucleic acid molecules, carriers, or immunogenic compositions described herein are used for prophylactic vaccination against SARS-CoV-2.

[0067] As previously stated, peptides, nucleic acid molecules, carriers, and immunogenic compositions according to any of the embodiments described herein can be provided via any of a variety of routes, such as oral, topical, subcutaneous, mucosal (typically intravaginal), intravenous, intramuscular, intranasal, sublingual, intradermal, and suppository.

[0068] In some implementations, the peptides, nucleic acid molecules, vectors, and immunogenic compositions described herein are used as vaccines against SARS-CoV-2 infection, particularly for the prevention or treatment of SARS-CoV-2 infection or disease or condition caused by such infection, and more particularly for the prevention of COVID-19 disease.

[0069] The following experimental sections are provided for illustrative purposes only and are not intended to limit the scope of the invention as defined in the appended claims. The claims are an integral part of the specification.

[0070] Example Various computer analyses and in vitro experiments were performed to prepare and characterize the novel SARS-CoV-2 mutant S protein. The process for generating and characterizing the novel mutant S protein is described below.

[0071] 1.1 Selection of residues for mutation formation The aim of this study was to reduce the interaction strength between the RBD domain of the SARS-CoV-2 S protein and the human hACE2 receptor. By analyzing the crystal structure of the RBD-hACE2 complex downloaded from the PDB database (PDB ID: 6M0J), the RBD residues interacting with hACE2 were identified, and all residues within 5 Å of the protein interface were found to interact. As a result, residues 417, 446, 447, 449, 453, 455, 456, 473, 475, 476, 484, 486, 487, 489, 493, 496, 498, 500, 501, 502, and 505 were selected for mutation. For each interacting site, a list of potential substitutions was determined by analyzing over 11 million available SARS-CoV-2 S protein sequences. The basic principle was to select amino acid substitutions that were less likely to occur, which is related to the virus's harmful adaptation. Over 11 million sequences were downloaded from the GISAID database (…). S., et al. GISAID's Role in Pandemic Response. China CDC weekly 3, 1049-1051, Figure 1 2021The comparison was performed using an internal script. Frequencies were generated for each position in the RBD, and low-frequency amino acid substitutions were selected for single-point mutation analysis. Eastman, P., et al. OpenMM 8: ).

[0072] 1.2 Selection of Single-Point Mutations The impact of single-point mutations was assessed using two quantitative measures: protein stability and binding affinity, modeled as the predicted energy difference between the wild-type (WT) and mutant structures. G) indicates that the unit is kcal / mol. To calculate the stability of the mutated protein, the monomeric form of RBD was mutated and then compared with the WT, while for binding affinity, the complex RBD-hACE2 was mutated and compared with the original structure. In both analyses, Rosetta Flex was used with OpenMM molecular dynamics software and a custom internal script to perform the calculations. Molecular Dynamics Simulation with Machine Learning Potentials. The Journal of Physical Chemistry B 128, 109-116, 2024; Barlow, K.A., et al. Flex ddG: Rosetta Ensemble-Based Estimation of Changes in Protein–Protein Binding Affinity upon Mutation. The Journal of Physical Chemistry B 122, 5389-5399, Tyka, M.D., Jung, K. & Baker, D. Efficient sampling of protein 2018 Rosetta Flex ddG is a state-of-the-art technique for predicting changes in protein-protein and protein-ligand binding free energy. Rosetta is a software suite for macromolecular modeling and design that uses physical and knowledge-based potentials based on all-atom mixing and provides a suite of different protocols to perform specific tasks such as structure prediction, molecular docking, and homology modeling. The Flex ddG protocol has been found to outperform machine learning methods and is comparable to molecular dynamics methods when tested on large datasets of ligand binding free energy changes after protein mutation. The structure of the S protein RBD-hACE2 complex was downloaded from the PDB database (PDB ID: 6M0J). The structure was relaxed using Rosetta FastRelax Mover. conformational space using fast loop building and batch minimization on ​ highly parallel computers. Journal of Computational Chemistry 33, 2483-2491, 2012 For each selected residue in the relaxed structure, a restriction file (Resfile) describing a single point mutation is generated, and backrub sampling is performed around the mutation site. The structure is then allowed to be globally reassembled and relaxed along with the WT and mutant. InterfaceAnalyzerMover Calculate binding energy G_cross, and the relationship between mutants and WT models The difference between G_cross is taken as G. Figure 2The predicted binding affinity (Figure A) and protein stability (Figure B) are shown. Compared with the strain (collected from Wuhan) (PDBID 6M0J), both showed higher values. G-measurement. For each previously identified residue, the substitution of a subset of native amino acids for WT-type amino acids was calculated individually based on the observed mutations in that residue. Fifty models were generated for each mutant, and... The G scores were averaged. Of all 200 single-point mutations analyzed, 143 mutants had positive G scores. G score, which indicates a potential mutation with reduced affinity. The highest predicted value is for mutation A489G. The G score was 3.2 kcal / mol. Meanwhile, Rosetta Flex ddG was used to predict changes in the stability of monomeric RBD proteins due to single-point mutations. G). The predicted stability changes are given as the predicted energy difference between the simulated wild-type and mutant structures. The inventors then analyzed the predicted substitutions based on their expertise and analysis of the 3D structure of the molecules from which the amino acid substitutions to be experimentally tested were determined.

[0073] 1.3 Identification of candidate sequences by combining single-point mutations A list of single-point mutations was analyzed to identify mutation combinations with high overall predicted binding affinity and stability compared to the WT protein. Specifically, all possible combinations of two, three, and four mutations were calculated, with the combined scores of affinity and stability calculated as separate sets. For each mutation set, Pareto optimal solutions were identified and further analyzed, with the final number of Pareto optimal solutions for two, three, and four mutations being 5, 22, and 42, respectively. Figure 3 The candidate list is generated via Pymol( Rigsby, R.E. & Parker, A.B. Using the PyMOL application to reinforce visual understanding of protein structure. Biochemistry and molecular biology education : a bimonthly publication of the International Union of Biochemistry and Molecular Biology 44, 433-437, 2016 Manual examination was conducted to better understand changes in RBD-hACE2 interactions using virtual reality. Table 1 summarizes the mutations selected for experimental validation, along with their predicted stability and binding affinity.

[0074] Table 1. Predicted affinity and stability of the selected mutations for experimental validation.

[0075] 1.4 Cloning of the mutant SARS-CoV-2 S protein GeneArt Strings DNA fragments were resuspended in water and amplified using Q5® High-Fidelity DNA Polymerase (NEB). The forward primer was 5'-CAGAGAGCATCGTACGATTTCCAAAC-3', and the reverse primer was 5'-GGTATTGGTCCCGGGGGTGATCACAG-3', following the manufacturer's instructions. GenElute was used according to the manufacturer's instructions. TM PCR products were purified using a PCR Clean-Up Kit (Sigma-Aldrich). The amplified DNA fragments were digested with BsiWI-HF and XmaI restriction endonucleases (NEB) and then purified using GenElute. TM Purification was performed using a PCR Clean-Up Kit. The S protein expression plasmid was digested with BsiWI-HF and XmaI restriction endonucleases and purified from agarose gels using the QIAquick Gel Extraction Kit (QIAGEN). The digested DNA fragments were ligated to the S protein expression plasmid using T4 DNA ligase (NEB). The ligation product was then used to transform One Shot® TOP10 chemically competent E. coli according to the manufacturer's instructions. E. coli (Invitrogen) TM Selected colonies were isolated by plasmid isolation / restriction endonuclease and sequencing analysis. Following the manufacturer's instructions, plasmids were purified from recombinant *E. coli* using NucleoBond® Xtra Midi / Maxi-high copy plasmid purification (MACHEREY-NAGEL). E. Coli Large-scale isolation of plasmid DNA from cultures. Plasmids were isolated using NanoDrop. TM Prescribe in fixed quantities and store at -20°C before use.

[0076] 1.5 Expression and purification of mutant SARS-CoV-2 S protein According to the manufacturer's instructions, the plasmid encoding the mutant SARS-CoV-2 S protein was transiently transfected into ExpiCHO. TM Expression System (Gibco) TM After harvesting and centrifugation for clarification, the cell culture supernatant was filtered through a 0.22µm filter and then subjected to HisTrap. TM HP His-tagged protein purification column (Cytiva) was used for purification via immobilized metal affinity chromatography. ÄKTA go TMChromatographic analysis was performed at room temperature using the Cytiva system. Specifically, the culture supernatant of the S protein cell culture was added to 5 mL of HisTrap. TM The HP column, previously equilibrated in buffer A (20 mM NaH₂PO₄, 500 mM NaCl + 30 mM imidazole, pH 7.4), was washed in buffer A with 3 column volumes (CVs), and all 3 column volumes of wash were collected as the column wash fraction. Recombinant protein was eluted from the column using 5 CVs of 60% buffer B (20 mM NaH₂PO₄, 500 mM NaCl + 500 mM imidazole, pH 7.4). The elution fraction was collected in 1 mL fractions. The eluted fractions were analyzed by SDS-PAGE, and appropriate fractions containing recombinant protein were combined. The protein-containing fraction was dialyzed overnight in PBS buffer at 4°C. The final protein concentration was determined by NanoDrop. TM Determination. Purified proteins are stored at -80°C before use.

[0077] 1.6 ELISA assay to assess the quaternary structure of the mutant S protein In short, 384-well plates (microplate clear, Greiner Bio-one) were incubated overnight at room temperature with 3 μg / mL streptavidin (Thermo Fisher) diluted in Bethyl Laboratories buffer. The next day, 3 μg / mL S protein diluted in PBS was added and incubated for 1 hour at room temperature. Then, the plates were saturated at 37°C for 1 hour with 50 μl / well of blocking buffer (phosphate-buffered saline and 1% BSA). After blocking, 25 μl / well of monoclonal antibody (mAb) diluted in sample buffer (phosphate-buffered saline, 1% BSA, 0.05% Tween-20) was added to the plates and incubated at 37°C. Then, goat anti-human IgG-AP (Goat Anti-Human IgG-AP, Thermo Fisher Scientific) diluted 1:20000 in sample buffer was added, and the plate was incubated at 37°C for 1 hour. The plate was then incubated with alkaline phosphatase Yellow (pNPP) (Sigma) for 20–30 minutes. Optical density (OD) values ​​were read at 405 nm using a Varioskan LuxReader (Thermo Fisher Scientific). After each incubation step, the plate was washed three times with 100 μl of wash buffer (phosphate-buffered saline and 0.05% Tween-20) per well. The sample buffer was used as a blank, and the positive threshold for the sample was set to twice the blank OD. Each case was tested three times, and the tested sample was considered positive if the OD value was twice that of the blank. Figure 4 Figure A shows the results of the tested mAbs binding to the mutated SARS-CoV-2 S protein. All mAbs bound to all seven mutated SARS-CoV-2 S proteins, confirming that their quaternary structure was maintained, except for irrelevant mAbs as expected.

[0078] 1.7 ELISA assay to assess the binding of mutant S protein to hACE2 The ELISA assay was performed as described in paragraph 1.6 above, but after blocking, 3 μg / mL hACE2 diluted in sample buffer was added to the plate at 25 μl / well. Figure 4Figure B shows the results of the binding of the mutant SARS-CoV-2 S protein to hACE2. Compared with the wild-type SARS-CoV-2 S protein, all mutant SARS-CoV-2 S proteins showed reduced binding to ACE2, especially mut 2S-MK, mut 4S-LMKG, and 4S-QMKK, with reductions of -1.8-fold (-1.8x), -3.1-fold (-3.1x), and -3.3-fold (-3.3x), respectively.

[0079] 1.8 Identifying candidate sequences by combining single-point mutations with theoretical loss of binding to hACE2. In addition to the seven sequences listed and experimentally validated in the preceding paragraphs, we selected another thirty novel sequences that, compared to the WT protein, showed a higher probability of loss of binding and stability in the overall prediction. As described in paragraphs 1.2 and 1.3, stability and loss of binding with hACE2 were predicted, employing machine learning methods and expert manual screening to select mutations (Table 2). Three different strategies were used to select residues to mutate. We manually divided the S protein receptor-binding motif (RBM) into four main anchors for hACE2 binding. These four anchors were named top, high-mid, low-mid, and bottom, as follows: Figure 5 As shown. The top anchor is composed of residues F456, A475, G476, N477, N487, and Y489. The medium-high anchor is formed by residues Y453, Q493, and S494, while the medium-low anchor is formed by residues Y449 and R498. Finally, the bottom anchor is composed of residues T500, Y501, G502, and H505. Figure 5 Based on the locations of the four anchors manually identified by experts through 3D visualization, we defined three main strategies to eliminate the binding of the SARS-CoV-2 S protein to hACE2. The first strategy is based on a mutation of one residue in each of the four anchors. The second strategy aims to mutate at least two residues in each anchor. The third strategy aims to mutate up to four residues in the same anchor. Each of these strategies underwent virtual screening, combining the results of single-point mutations and analyzing all possible combinations. This process yielded 1,563,852, 2,607,142, and 137,541 candidates for the first, second, and third strategies, respectively. A score was calculated for each candidate by combining the results of single-point mutations. The Pareto optimal solution was then determined to select the combination with high stability and reduced affinity.

[0080] Table 2. Predicted affinity and stability of the selected mutations for experimental validation.

[0081] 1.9 Generating hyperimmune serum in mice immunized with selected mutant S protein This experiment used four groups of 10 female Balb / c mice aged approximately 8-10 weeks. The mice were administered the drug twice via intramuscular (IM) injection on days 0 and 21 of the study. Each time, the Balb / c mice received 25 µL of AddaVax. TM Immunization with squalene-based oil-in-water adjuvant (catalog code: vac-adx-10, InvivoGen) and 5 µg of recombinant proteins (WT, mut2S-MK, mut4S-LMKG, and mut4S-QMKK) diluted in PBS to a final volume of 50 µL. On day 35, all animals underwent blood collection for serum processing. Terminal blood samples were collected by drawing blood from anesthetized animals using isoflurane. Sacrifice was performed via cervical dislocation. The target volume for terminal blood collection was approximately 800 µl. Serum was obtained from whole blood placed in test tubes by centrifugation. All serum samples were stored in vials at -20°C before use.

[0082] 2.0 Serum virus neutralization test against SARS-CoV-2 Neutralization tests of wild-type SARS-CoV-2 real virus were conducted in a Biosafety Level 3 (BSL3) laboratory at Toscana Life Sciences, Siena, Italy. BSL3 laboratories are approved by certified biosafety professionals and are inspected annually by local authorities. Humoral immune responses were assessed through virus neutralization tests, with mouse serum tested in a cytopathic effect-based neutralization assay (CPE-MN). Briefly, serum samples were heat-inactivated at 56°C for 30 minutes; then, starting at a 1:10 ratio, two-fold serial dilutions were mixed with an equal volume of virus solution containing 100 times the half-maximum tissue culture infectious dose (100 TCID). 50 The SARS-CoV-2 virus was incubated at 37°C and 5% CO2 for 1 hour. The mixture was then added to the wells of a 96-well plate containing a sub-confluent VeroE6 cell monolayer. The plate was incubated for 3 days in a humidified environment at 37°C and 5% CO2, and CPE was then examined by two independent operators using an inverted optical microscope. Four human serum samples from seropositive individuals were used as positive controls in the experiment. All samples were technically triplicated.

[0083] Viral serum neutralization results showed that all tested sera exhibited neutralizing activity against the SARS-CoV-2 strain (collected from Wuhan). Figure 6This indicates that despite the introduction of mutations, the mut 2S-MK, mut 4S-LMKG, and mut 4S-QMKK S proteins can still induce a strong and robust antibody-neutralizing response against the virus, comparable to the WT spike protein.

[0084] 2.1 Identification, expression, and purification of the second-round mutant SARS-CoV-2 S protein A second round of selection was conducted from the 30 newly identified sequences (Table 2), choosing the candidate sequences with the highest affinity from each of the three different strategies for further in vitro analysis (Table 3). These ten S proteins were expressed and purified as described in paragraph 1.5 above. The purified proteins were stored at -80°C until use.

[0085] Table 3. Predicted affinity and stability of the mutant S protein selected in the second round for experimental verification.

[0086] 2.2 ELISA assay to assess the second-round mutation of the S protein As described in paragraph 1.6 above, ELISA assays were performed using the second-round mutated SARS-CoV-2 S-protein. After blocking, 3 μg / mL hACE2 diluted in sample buffer was added to the plate at 25 μl / well.

[0087] Figure 7 The results of the mutant SARS-CoV-2 S-protein binding to hACE2 are shown. Compared with the wild-type SARS-CoV-2 S-protein, all mutant SARS-CoV-2 S-proteins showed complete loss of binding abrogation to the hACE2 receptor.

[0088] Sequence list in the instruction manual >SEQ ID NO:1 - SARS-CoV-2 spike protein

[0089] SEQ ID No:46 – Forward Primer CAGAGAGCATCGTACGATTTCCAAAC SEQ ID No:47 – Reverse primer GGTATTGGTCCCGGGGGTGATCACAG Declaration made pursuant to Article 170bis In accordance with Article 170bis of the Italian Industrial Property Code, the applicant of this patent application declares that, with respect to the biological materials containing microorganisms or genetically modified organisms used in the aforementioned patent application, the applicant has complied with the obligations stipulated by national or community regulations, particularly the provisions concerning these amendments mentioned in Article 6 of Legislative Decree No. 206 of April 12, 2001 and Article 10 of Legislative Decree No. 224 of July 8, 2003.

Claims

1. An immunogenic polypeptide comprising or composed of a receptor-binding domain (RBD) of the SARS-CoV-2 spike protein, wherein one or more residues at positions 417, 449, 477, 487, 489, 493, 494, 500, 502, and 505 of the receptor-binding domain (RBD) are mutated, wherein the positions are numbered according to SEQ ID NO:

1.

2. The immunogenic polypeptide according to claim 1, wherein, The receptor-binding domain (RBD) has one or more of the following mutations: K417A, K417L, K417Q, Y449K, Y449N, Y449W, Y449M, S477Q, S477Y, S477N, N487M, N487G, N487A, N487I, N487P, N487S, N487K, N487L, Y489K, Y489V, Y489R, Q493Y, Q493A, Q493W, Q493I, S494I, T500V, T500I, G502T, G502I, G502A, G502S, G502F, Y505K, Y505Q, and Y505G.

3. The immunogenic polypeptide according to claim 1 or 2, wherein the receptor-binding domain (RBD) has one of the following mutant groups: (1) N487M and Y505K; or (2) K417A, N487M and Y505K; or (3) N487G, Y489K and Y505K; or (4) N487M, Y489K, Y505K; or (5) K417L, N487M, Y489K and Y505K; or (6) K417Q, N487M, Y489K and Y505K; or (7) K417L, N487M, Y489K and Y505G; or (8) S477Q, N487P and Y489V; or (9) S477Q, N487P and Y489R; or (10) S477Q, N487G and Y489V; or (11) S477Q, N487S and Y489V; or (12) S477Q, N487K and Y489V; or (13) S477Q, N487G and Y489R; or (14) S477Q, N487K and Y489R; or (15) S477Q, N487S and Y489R; or (16) S477Q, N487M and Y489R; or (17) S477Q, N487I and Y489R; or (18) S477Q, N487P, T500V and G502T; or (19) S477Q, N487P, T500I and G502T; or (20) S477Q, N487P, T500V and G502I; or (21) S477Q, N487P, T500I and G502I; or (22) S477Q, N487P, Q493Y and S494I; or (23) S477Q, N487P, Q493A and S494I; or (24) S477Q, N487P, Q493W and S494I; or (25) Q493Y, S494I, T500V and G502I; or (26) S477Y, N487L, T500V and G502A; or (27) Q493W, S494I, T500V, and G502I; or (28) N487P, Q493Y, Y449K and G502T; or (29) N487P, Q493Y, Y449K and Y505Q; or (30) N487P, Q493A, Y449N and G502T; or (31) N487P, Q493W, Y449W and Y505Q; or (32) N487P, Q493Y, Y449N and T500I; or (33) N487A, Q493W, Y449M and G502S; or (34) N487G, Q493W, Y449N and T500V; or (35) S477N, Q493Y, Y449N and G502F; or (36) N487M, Q493W, Y449W and T500I; or (37) N487I, Q493I, Y449W and T500I.

4. The immunogenic polypeptide according to any one of claims 1 to 3, wherein the immunogenic polypeptide comprises or consists of sequences selected from the following: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:

45.

5. An isolated nucleic acid molecule comprising a nucleotide sequence encoding an immunogenic polypeptide according to any one of claims 1 to 4.

6. The isolated nucleic acid molecule according to claim 5, wherein the nucleic acid molecule is a DNA or mRNA sequence.

7. A vector comprising a nucleic acid molecule according to claim 5 or 6, wherein the vector optionally comprises an expression control sequence operatively linked to the nucleic acid molecule, preferably the vector being selected from RNA viral vectors, DNA viral vectors, plasmid viral vectors, adenovirus vectors, adeno-associated virus vectors, herpesvirus vectors, and retroviral vectors.

8. The use of the immunogenic polypeptide according to any one of claims 1 to 4, or the nucleic acid molecule according to claim 5 or 6, or the carrier according to claim 7, for the prevention and / or treatment of SARS-CoV-2 infection or disease or condition caused by such infection, particularly COVID-19 disease.

9. An immunogenic composition comprising an immunogenic polypeptide according to any one of claims 1 to 4, or a nucleic acid molecule according to claim 5 or 6, or a carrier according to claim 7, and optionally one or more adjuvants and / or excipients.

10. The immunogenic composition according to claim 9, for the prevention and / or treatment of SARS-CoV-2 infection or disease or condition caused by such infection, particularly COVID-19 disease.

Images