METHOD AND DEVICE FOR EXTRACTING AND / OR MULTIPLIVING A TARGET NUCLEAR ACID

Description

[0001] The present invention relates to a method and a device for extracting and / or multiplying or amplifying a target nucleic acid. The invention thus lies in the field of molecular diagnostics and, in particular, in the field of extraction and / or purification and / or amplification of nucleic acids, the latter for example by means of a polymerase chain reaction (PCR). State of the art

[0002] Prior art methods are known in which a polymerase chain reaction is carried out by means of local heating to replicate or amplify a nucleic acid in a reaction solution. Such a method is known in particular from German patent application DE 10 2016 120 124 A1. In this method, heating elements designed as heating wires are functionalized with oligonucleotides, to which the target nucleic acid to be amplified can be bound. For example, the oligonucleotides can be designed as primer oligonucleotides for the polymerase chain reaction, although this is not strictly necessary.

[0003] In order for a target nucleic acid freely dispersed in the reaction solution to bind or hybridize to one of the oligonucleotides functionalized to a heating element, in addition to a suitable chemical environment and a suitable temperature, it is necessary that the target nucleic acid is located in sufficiently close proximity to the oligonucleotide.

[0004] Sufficiently close proximity is also required to extract, for example, a target nucleic acid that is freely present in a sample liquid, by hybridizing it to an extraction nucleic acid that is functionalized to a heating element or another substrate.

[0005] The process of spatially aligning the target nucleic acid and the functional or extraction nucleic acid or primer on the heating elements conventionally follows essentially Brownian motion or undirected diffusion. In prior art methods, Brownian motion or diffusion typically does not allow for the rapid alignment of the target nucleic acid and the functional nucleic acid or primer on the heating elements, which in many preferred embodiments are localized only at discrete locations and, unlike, for example, free primers, are not homogeneously distributed throughout the volume of the sample liquid. This leads to unnecessarily long waiting times in conventional methods until a sufficient quantity of target nucleic acid has reached the functional nucleic acid or primer on the heating elements, especially when the initial concentration of the nucleic acid to be amplified is very low.This can unnecessarily prolong the overall process of nucleic acid detection and characterization. Furthermore, if insufficient time is allowed for a sufficient quantity of target nucleic acids to bind to the functional nucleic acid or primer on the heating elements, no nucleic acid (or too little) may be bound to the functional nucleic acid or primer on the heating elements at the start of the amplification reaction. Consequently, the target nucleic acid may not be detected or characterized (or not reliably detected) in the amplification reaction, even though it was present in the starting liquid that came into contact with the heating elements or the functional nucleic acids or primers on the heating elements.

[0006] The detection or characterization reaction may therefore produce false results, only produce correct results in a small percentage of cases, or produce results unnecessarily late.

[0007] The lower the concentration of the target nucleic acid in the sample liquid and / or the reaction solution, the greater the average distance between the target nucleic acid and a functional nucleic acid or a heating element. Accordingly, at low concentrations of target nucleic acids in the sample liquid and / or the reaction solution, a considerable amount of time may be required until the target nucleic acid is sufficiently hybridized to the oligonucleotides or functional nucleic acids to achieve efficient extraction and / or amplification of the target nucleic acid.

[0008] WO2018073435A1 describes a PCR method in which the reaction volume is heated by the use of less than 20 joules per milliliter of electrical energy.

[0009] WO95 / 25592 describes a process for processing nucleic acids in a reaction mixture on a surface and its immediate surroundings with a controllable temperature, at which the main chamber of the reaction mixture remains essentially isothermal.

[0010] It is therefore the object of the invention to provide a method and a device that increase the extraction and / or amplification efficiency and / or the sensitivity and / or reduce the time required for this. Disclosure of the invention

[0011] In a first aspect, the invention relates to a method for extracting a target nucleic acid from a sample liquid. The method comprises providing a heating device with a heating element in contact with the sample liquid, wherein the heating element is conjugated with at least one functional nucleic acid and wherein the at least one functional nucleic acid is configured to hybridize with the target nucleic acid and bind the target nucleic acid to the heating element. Furthermore, the method comprises generating relative motion between the heating element and the sample liquid and extracting the target nucleic acid from the sample liquid by separating the heating element from the sample liquid.

[0012] In a further aspect, the invention relates to a method for multiplying a target nucleic acid in a reaction solution, comprising providing a heating device with a heating element in contact with the reaction solution, wherein the heating element is conjugated with at least one functional nucleic acid and wherein the at least one functional nucleic acid is designed to hybridize with the target nucleic acid. Furthermore, the method comprises generating relative motion between the heating element and the reaction solution, as well as multiplying the target nucleic acid by means of a polymerase chain reaction in the reaction solution using the heating device.

[0013] In a further aspect, the invention relates to a method for amplifying a target nucleic acid, comprising extracting the target nucleic acid from a sample liquid by providing a heating device with a heating element in contact with the sample liquid, wherein the heating element is conjugated with at least one functional nucleic acid and wherein the at least one functional nucleic acid is configured to hybridize with the target nucleic acid and bind the target nucleic acid to the heating element. The method further comprises amplifying the target nucleic acid extracted from the sample liquid by means of a polymerase chain reaction in a reaction solution using the heating device. The extraction of the target nucleic acid further comprises generating relative motion between the heating element and the sample liquid.Alternatively or additionally, the multiplication of the target nucleic acid also includes generating a relative motion between the heating element and the reaction solution.

[0014] In a further aspect, the invention relates to a device for extracting and / or multiplying a target nucleic acid. The device comprises a heating element, wherein the heating element can be brought into contact with a sample liquid and / or a reaction solution and is conjugated with at least one functional nucleic acid, the at least one functional nucleic acid being designed to hybridize with the target nucleic acid and bind the target nucleic acid to the heating element. Furthermore, the device comprises a movement mechanism designed to generate relative motion between the at least one heating element and the reaction solution and / or the sample liquid when the heating element is in contact with the reaction solution or the sample liquid.

[0015] The invention offers the advantage of facilitating and accelerating the interaction of the target nucleic acid and the functional nucleic acid or heating element. The relative movement between the heating element and the sample liquid or reaction solution effectively increases the volume of the heating element in contact with the target nucleic acid, thereby increasing the probability of the target nucleic acid coming within a sufficiently short distance of a functional nucleic acid to hybridize. In this way, the extraction and / or amplification of the target nucleic acid can be accelerated and / or the sensitivity increased using simple and cost-effective means.

[0016] The invention further offers the advantage that the duration of polymerase chain reactions (PCRs) carried out with local heating, as described above and in DE 10 2016 120 124 A1, can be reduced even further, and / or the efficiency and / or sensitivity can be increased. In particular, the invention offers the advantage that, when using the inventive method for a polymerase chain reaction based on local heating, lower initial concentrations of the target nucleic acid may be sufficient, since the relative motion increases the probability of the target nucleic acids combining with a functional nucleic acid. Thus, the invention can further improve the sensitivity for the detection and amplification of target nucleic acids.

[0017] Furthermore, the invention offers the advantage that the hybridization of the target nucleic acid to a functional nucleic acid is not limited by the diffusion and / or Brownian motion of the target nucleic acid in the sample liquid and / or reaction solution, and thus the sensitivity and speed of the extraction and / or amplification can be increased.

[0018] The sample liquid is preferably a starting liquid containing the target nucleic acid (e.g., sample material containing the target nucleic acid, or sample material in which the target nucleic acid has been (previously) released (e.g., from pathogens and / or cells), or a liquid in which the nucleic acid is already present in a purified state). The sample liquid may preferably also contain or be provided with reagents that promote the hybridization of the target nucleic acid to the functional nucleic acid, extraction nucleic acid, or the primer iodide on the heating element, such as appropriate salts.

[0019] The sample liquid is preferably a liquid that optionally contains the target nucleic acid and also includes other components. In particular, the sample liquid may contain further components that are not to be extracted. These other components may include other nucleic acids, i.e., nucleic acids with a different nucleotide sequence. The other components may also contain impurities of a non-nucleotide nature. In particular, the sample liquid may be a liquid of, for example, human and / or animal and / or plant and / or other organic origin. For example, the sample liquid may contain or consist of blood and / or secretions and / or bodily excretions and / or secretions from mucous membranes and / or saliva and / or interstitial fluid.The sample liquid may preferably have been subjected to one or more treatments prior to extraction in order to at least partially release any nucleic acids contained within it. For example, the sample liquid may have been treated to lyse or disrupt any cells present in it, thereby at least partially releasing the nucleic acids from the cells, so that the nucleic acids are preferably freely present in the sample liquid and are at least partially, or no longer, enclosed in cell nuclei and / or cells. The lyse is preferably carried out in such a way that the released nucleic acids are at least not completely destroyed and, more preferably, remain completely intact.

[0020] In particular, the sample liquid can preferably be configured such that it is not possible to carry out an amplification reaction to replicate the extracted nucleic acid within the sample liquid. For example, the sample liquid may possess physical, chemical, and / or biological properties that preclude the performance of an amplification reaction, such as PCR. For instance, the sample liquid may have a viscosity, pH value, salt concentration, polarity, enzymes, and / or proteases that prevent the amplification reaction from taking place, for example, because the activity of the necessary polymerase enzymes is inhibited or because enzymes such as proteases are present that can degrade the polymerase enzymes.

[0021] Preferably, at least one parameter of the sample liquid can be adjusted to enable hybridization of the target nucleic acid to the functional nucleic acid, given the existing degree of complementarity. For example, the concentration of MgCl₂ in the sample liquid can be increased to allow hybridization even at low complementarity, whereas preferably the concentration of MgCl₂ in the sample liquid can be decreased to allow hybridization only above a certain higher degree of complementarity.

[0022] Preferably, the heating element is brought into contact with the sample liquid such that the nucleic acid to be extracted from the sample liquid binds at least partially to the functional nucleic acid. This can include ensuring that at least at the contact surface between the heating element and the sample liquid, i.e., on the surface of the heating element and / or in its immediate vicinity, hybridization conditions prevail that promote and / or enable hybridization of the nucleic acid to be extracted with the extraction nucleic acid. For example, the hybridization conditions can include a temperature and / or a pH value and / or a salt concentration within a specific range.According to a preferred embodiment, the heating element can be heated such that the required temperature is provided, at least temporarily, in its immediate vicinity to enable the hybridization of the nucleic acid to be extracted with the functional nucleic acid. According to a further preferred embodiment, the heating element and the sample liquid can preferably also be heated as homogeneously as possible, i.e., heated such that the heating elements have the same or nearly the same temperature as the reaction solution, in order to enable effective hybridization of the nucleic acid to be extracted with the functional nucleic acid. This can preferably be achieved by the heating element and / or by an optional additional heating device, preferably located outside the sample liquid, such as a temperature control block.For this purpose, the entire apparatus, which includes the heating elements and the sample liquid, can be heated to a base temperature of, for example, between 35°C and 80°C, and particularly preferably between 40°C and 70°C. Such a base temperature can preferably be set at least temporarily during the extraction. During an optional amplification after the extraction, it is optional to forgo setting the same base temperature and / or to set a different base temperature or global temperature of the reaction solution.

[0023] The reaction solution preferably contains reagents necessary for replication by polymerase chain reaction and can be brought into contact with the heating elements or the functional nucleic acids or primers on the heating elements to enable binding of the target nucleic acid to the functional nucleic acid on the heating elements.

[0024] The reaction solution is preferably a liquid in which the target nucleic acid, in its single-stranded and / or double-stranded form, can persist and / or be stabilized. However, the reaction solution differs from the sample liquid. In other words, the reaction solution is preferably designed such that the target nucleic acid is not damaged by the interaction with the reaction solution. For example, the reaction solution can be an aqueous solution and / or a buffer solution. If amplification of the target nucleic acid is intended after extraction, the reaction solution can preferably be designed to facilitate such amplification.For example, the reaction solution can be formulated as a buffer solution in which PCR can be performed to at least partially amplify the target nucleic acid. The reaction solution is preferably provided in a reaction vessel. The provided reaction solution preferably has a volume of at least 1 µl and not more than 10 ml, more preferably at least 5 µl and not more than 1 ml, and most preferably at least 10 µl and not more than 100 µl.

[0025] In the context of the present invention, the terms "nucleic acid" and "oligonucleotide" encompass not only (deoxy) ribonucleic acids and (deoxy) oligo-ribonucleotides, although the aforementioned are preferred, but also nucleic acids and oligonucleotides containing one or more nucleotide analogs with modifications to their backbone (for example, methylphosphonates, phosphothioates, or peptide nucleic acids (PNA)), in particular to a sugar of the backbone (for example, 2'-O-alkyl derivatives, 3'- and / or 5'-aminoriboses, locked nucleic acids [LNA], hexitol nucleic acids, morpholinos, glycol nucleic acid (GNA), threose nucleic acid (TNA), or tricyclo-DNA; see the article by D. Renneberg and C.J. Leumann, "Watson-Crick base-pairing properties of Tricyclo-DNA", J. Am. Chem. Soc., 2002, vol.124, pages 5993-6002, the relevant content of which is incorporated into the present disclosure by reference) or which contain base analogs, for example, 7-deazapurines or universal bases such as nitroindole or modified natural bases such as N4-ethylcytosine. In one embodiment of the invention, the nucleic acids or oligonucleotides are conjugates or chimeras with non-nucleoside analogs, for example, PNA. In one embodiment of the invention, the nucleic acids or oligonucleotides contain non-nucleoside and / or non-nucleotide units such as spacers, for example, hexaethylene glycol or Cn spacers with n between 3 and 6, at one or more positions. Insofar as the nucleic acids or oligonucleotides contain modifications, these are selected such that hybridization with natural DNA / RNA analytes is possible even with the modification.Preferred modifications influence the melting behavior, preferably the melting temperature, particularly to distinguish hybrids with different degrees of complementarity of their bases (mismatch discrimination). Preferred modifications include LNA, 8-aza-7-deaza purines, 5-propynyl uracil and cytosine, and / or abasic interruptions or modifications in the nucleic acid or in the oligonucleotide. Further modifications within the meaning of the invention are, for example, modifications with biotin and / or thiol and / or sulfur and / or fluorescent donor and fluorescent acceptor molecules.

[0026] The terms target nucleic acid and nucleic acid are used interchangeably throughout this document unless otherwise specified. Extracting the nucleic acid from the sample liquid means that the nucleic acid is at least partially isolated from the sample liquid and preferably can be separated from it. The nucleic acid to be extracted from the sample liquid can also be referred to as the target nucleic acid. In particular, extracting a nucleic acid can thus include or serve to separate the nucleic acid from the sample liquid. The extraction of the nucleic acid can be designed such that only the nucleic acid to be extracted is removed from the sample liquid, or other components of the sample liquid, such as other nucleic acids, are also extracted.Preferably, however, only the nucleic acid to be extracted is extracted from the sample liquid, so that other nucleic acids and other components of the sample liquid are not extracted but remain in the sample liquid. Preferably, after extraction of the nucleic acid, the concentration and / or the number of copies of the extracted nucleic acid in the sample liquid is lower than before extraction, provided that the nucleic acid to be extracted was present in the sample liquid at all before extraction.

[0027] The functional nucleic acid is preferably at least partially complementary to the target nucleic acid. That the functional nucleic acid is at least partially complementary to the target nucleic acid means that the functional nucleic acid and the target nucleic acid can hybridize or bind to each other via at least one base pair. In other words, the functional nucleic acid has at least one base in its sequence that is complementary to at least one base of the target nucleic acid or the nucleic acid to be extracted. Preferably, however, the functional nucleic acid exhibits greater complementarity to the target nucleic acid, i.e., that the base sequence of the functional nucleic acid is preferably complementary to one or more segments of the base sequence of the target nucleic acid not just in one base, but in several, preferably consecutive, bases.More preferably, at least 5, even more preferably at least 10, much more preferably at least 15, and most preferably at least 20 base pairs are arranged consecutively without any intervening bases, complementary to a corresponding sequence of the target nucleic acid. Preferably, at least 1%, more preferably at least 5%, even more preferably at least 10%, more preferably at least 20%, even more preferably at least 30%, much more preferably at least 40%, much more preferably at least 50%, especially preferably at least 60%, very preferably at least 70%, most preferably at least 80%, and most preferably at least 90% of the base sequence of the functional nucleic acid are complementary to a corresponding sequence of the target nucleic acid.According to a particularly preferred embodiment, the extraction nucleic acid can be substantially complementary to a corresponding sequence of the target nucleic acid, i.e., that apart from a few defects, the base sequence of the functional nucleic acid is completely complementary to a corresponding sequence segment of the target nucleic acid. If the functional nucleic acid has several different segments of base sequences, for example, a functional segment intended for hybridization to the target nucleic acid and also a connecting segment, such as a spacer sequence for distancing the functional segment from the heating element, the above-explained statements regarding the complementarity between the functional nucleic acid and the target nucleic acid preferably refer only to the functional segment of the functional nucleic acid.

[0028] A higher degree of complementarity between the functional nucleic acid and the target nucleic acid can offer advantages in terms of selectivity during extraction. For example, a high degree of complementarity between the functional nucleic acid and the target nucleic acid can ensure that essentially only the target nucleic acid can bind to the functional nucleic acid, while binding of other nucleic acids from the sample liquid to the functional nucleic acid is an exception.On the other hand, a low degree of complementarity between the functional nucleic acid and the target nucleic acid can preferably enable the binding of different nucleic acids from the sample liquid to the functional nucleic acid, so that other nucleic acids can also be extracted from the sample liquid and / or the target nucleic acid can be extracted even if the functional nucleic acid has only a low degree of complementarity to it, for example because the base sequence of the target nucleic acid is not sufficiently known and accordingly the functional nucleic acid cannot be exactly matched to the target nucleic acid.

[0029] The fact that the heating element is functionalized with a functional nucleic acid means that the functional nucleic acid is bound to the heating element. This, in turn, means that the functional nucleic acid is mechanically bonded to the heating element, in particular by a chemical and / or electrostatic bond. For example, the functional nucleic acid can be bound to a surface of the heating element by means of one or more thiol and / or sulfur bonds. Preferably, the surface of the heating element is at least partially coated with a material that allows the binding of nucleic acids. For example, a gold-plated surface can be used to bind the extraction nucleic acid and optionally other nucleic acids to the heating element via one or more thiol and / or sulfur bonds.For example, a streptavidin-biotin bond can be used to bind the functional nucleic acid and / or other nucleic acids to the heating element if, preferably beforehand, one of the two partners (streptavidin or biotin) has been bound to the heating element and the functional nucleic acid (preferably at the 5' end) is modified with the other of the two partners and then bound to the heating element via this modification. Other modifications, such as amino or carboxy groups, can also be used to bind the functional nucleic acid to the heating element. For this purpose, the surface of the heating element can be modified, preferably beforehand, with epoxy and / or a metal. Preferably, the bonding occurs such that the 5' end of the functional nucleic acid is bound to the heating element, leaving the 3' end free.This can be particularly advantageous if the extraction nucleic acid is to serve as a primer in an amplification reaction to be carried out after extraction.

[0030] The fact that the heating element is in contact with the sample liquid or reaction solution can mean that the target nucleic acid can bind, at least partially, to the functional nucleic acid. This may require that hybridization conditions prevail, at least partially, at the contact surface between the heating element and the sample liquid or reaction solution—that is, on the surface of the heating element and / or in its immediate vicinity—which promote and / or enable hybridization of the target nucleic acid with the functional nucleic acid. For example, the hybridization conditions may include a temperature and / or pH value and / or a salt concentration within a specific range.According to a preferred embodiment, the heating element can be heated in such a way as to provide, at least temporarily, the required temperature in its immediate vicinity to enable the hybridization of the target nucleic acid with the functional nucleic acid. According to a further preferred embodiment, the heating element and the sample liquid can preferably also be heated as homogeneously as possible, i.e., such that the heating elements have the same or nearly the same temperature as the reaction solution, in order to enable effective hybridization of the nucleic acid to be extracted with the functional nucleic acid. This can preferably be achieved by the heating element and / or by an optional additional heating device, preferably arranged outside the sample liquid.For this purpose, the entire apparatus, which includes the heating elements and the sample liquid, can be heated to a base temperature of, for example, between 35°C and 80°C, and particularly preferably between 40°C and 70°C. Such a base temperature can preferably be set at least temporarily during the extraction. During an optional amplification after the extraction, it is optional to forgo setting the same base temperature and / or to set a different base temperature or global temperature of the reaction solution.

[0031] A polymerase chain reaction (PCR) according to the present invention is a method for amplifying target nucleic acids in which a replication cycle consisting of the steps of denaturation, hybridization, and elongation is repeatedly performed, preferably in this order. In each iteration, the number of nucleic acid molecules, and in particular the target nucleic acids, can be increased (typically doubled in the best case), resulting in an exponential increase in the number of nucleic acid molecules. Hereinafter, a target nucleic acid to be amplified is referred to as the "original." The original is a single strand and can form a double strand together with its complementary strand, which is referred to as the "complement." The original and the complement can be part of a larger nucleic acid.

[0032] In PCR, a copy of the original produced in one run of the amplification cycle can serve as a template for generating a complement in a subsequent run, and a copy of the complement produced can serve as a template for generating an original in a subsequent run. A common term for the amplification product is "amplicon."

[0033] The denaturation step serves to denature a nucleic acid double strand, that is, to separate it into its two single strands. In this step, for example, the original DNA can be separated from its complement. The preferred type of denaturation according to the invention is thermal denaturation (also referred to as "melting"). For this purpose, at least part of the nucleic acid double strand or the entire double strand is exposed to a temperature, referred to as the "denaturation temperature," which causes or at least promotes the separation of the nucleic acid double strands. The preferred denaturation temperature is chosen to be high enough to allow the nucleic acid double strands to be separated. At the same time, the preferred denaturation temperature is chosen to be low enough to prevent significant damage to any DNA polymerase that may also be present in the sample. A typical value for the denaturation temperature is 95°C.

[0034] To facilitate the following explanation of the invention, the term "denaturation step" in the nomenclature of the present invention refers to the step of the process in which the heating device generates heat to warm the reaction volume and thereby cause denaturation of double-stranded nucleic acid molecules. The duration of the denaturation step is therefore the sum of the time during which the heating device generates heat in the cycle of the PCR relevant to the denaturation step. In the case of a heating resistor as the heating device and / or heating element, the duration of the denaturation step is thus the duration of the current flowing through the heating device or heating element to warm the reaction volume and thereby cause denaturation of double-stranded nucleic acid molecules.Since the heating element generates heat in a single pass of the multiplication cycle instead of in several separate time intervals (which, as explained below, can be advantageous), the duration of the denaturation step is the sum of the durations of these intervals. The denaturation step defined in this way specifically excludes heat dissipation due to the heating element's own heat capacity, and also excludes the temperature drop in the part of the reaction volume adjacent to the heating element, even if the temperatures present there are still within the range required for denaturation. This means, in particular, that denaturation can still occur in the process according to the invention even after the denaturation step defined in this way. It also means that the heat dissipated in the denaturation step is generally less than the heat generated in the denaturation step.

[0035] Heating the heating element(s), which are preferably designed as resistive heating elements and particularly preferably as heating wires, can preferably be achieved by means of short electrical pulses with which the heating element(s) are energized. This is particularly preferably done such that only the immediate vicinity of the heating element(s) of the heating device is heated locally for a short time, preferably to carry out the denaturation of the nucleic acid molecules in the reaction volume, while the majority of the reaction volume, i.e., the reaction solution, remains at a base temperature (in this sense, a "global" temperature) at which, in particular, elongation, and preferably also hybridization, can take place.This is preferably achieved by ensuring that the heating duration is so short that the heat field generated in the surrounding reaction volume only spreads a few micrometers, thus creating a heating zone that preferably comprises only a tiny fraction of the reaction volume. In particular, this allows the amount of heat introduced to be so small that no substantial global heating of the reaction volume occurs.

[0036] The "global temperature" within the meaning of the present invention is the average temperature, relative to its volume, of the reaction volume or the reaction solution in which the PCR takes place; that is, the temperature that is established or would be established in the reaction volume after thermalization. "Global warming" is the increase in the global temperature thus defined.

[0037] Furthermore, the invention makes it possible to achieve a situation where, after heating, particularly during the denaturation step, the heat introduced from the heating zone into the rest of the reaction volume causes only a negligible global temperature increase. "Negligible" here means, in particular, that the temperature increase is preferably too small to denature the nucleic acid molecules and, even more preferably, that the temperature increase is too small to disrupt hybridization and elongation.

[0038] The local heating process according to the invention will be explained in more detail below. With the start of the heating pulse, the heating element begins to heat up when an electric current flows through it. This heating element can be configured, for example, as a micro-heating element, such as a heating wire with a diameter of only about 20 micrometers or less. Preferably, the heating element is made of a metallic material and has very high thermal conductivity. It is particularly preferred that the heating element heats up approximately homogeneously over the duration of the heating pulse. At the surface of the heating element, which is in contact with the reaction solution during PCR, the heat is transferred from the heating element to the reaction solution, where it spreads over an increasingly larger volume. The propagation of a heat field in the reaction solution occurs through thermal diffusion, for which the following square root displacement-time law applies: d ≈ D ⋅ t

[0039] Here, d represents the distance a heat front travels along a spatial direction in a reaction solution with thermal diffusivity D after a time t. This distance d is referred to below as the heat diffusion distance. That is, for a particularly preferred typical heating duration of, for example, 100 µs, the heat generated in the heating element can be transferred to the reaction solution with a typical thermal diffusivity (also known as thermal diffusivity) of D ≈ 1.6 · 10⁻⁷ < m² / s by approximately d ≈ 1.6 ⋅ 10 − 7 m 2 / s ⋅ 10 − 4 s ≈ 4 μm diffuse widely. In other words, during this period of 100 µs, the heat generated in the heating element by resistive heating has spread approximately 4 µm into the reaction solution surrounding the heating element.

[0040] Due to the spatial propagation of heat according to the equation above, the amount of heat introduced into the reaction solution by the heating element is distributed over an increasingly larger volume of the reaction solution, so that a mean temperature gradient of ΔT / d (( Δ T / D ⋅ t , where t represents the duration) results in the heat transfer that enables heat transfer.

[0041] This allows, for example, temperature gradients to be achieved that are preferably greater than 1 K / µm, particularly preferably greater than 3 K / µm, and most preferably greater than 5 K / µm, in order to achieve a high degree of localization of the temperature increase. Alternatively or additionally, the temperature gradients are preferably less than 1000 K / µm and particularly preferably less than 300 K / µm. This can be advantageous to avoid thermophoretic effects in the reaction solution.

[0042] A more accurate estimation of the spatial heat propagation during and after the heating pulse for a given geometry of the heating element can be achieved, for example, by finite element methods, such as with commercial solutions like COMSOL, which allow a numerical solution of the heat diffusion equation.

[0043] The portion of the reaction volume or reaction solution into which heat can diffuse during the heating pulse is referred to below as the "heating zone" (HZ). The extent of the heating zone perpendicular to the surface of the heating element can be approximated by the heat diffusion distance defined above.

[0044] The volume of the reaction solution that lies outside the heating zone is referred to below as the "unheated passive volume." For example, for a cylindrical heating element (e.g., a heating wire), the AHZ can be estimated as the volume located at a distance of a heat diffusion distance d from the cylinder surface (i.e., the cylindrical shell with thickness d). If the heating element is, for example, an elongated cylinder with radius r and length I (such as a wire), then the volume of the heating zone can preferably be roughly estimated as: V AHZ ≈ π ⋅ l ⋅ r + d 2 − r 2 .

[0045] Preferably, by appropriately selecting the heating duration, only one or more partial volumes of the reaction solution are significantly heated, which preferably have expansions (measured perpendicular to the surface of the microheater), i.e., heat diffusion distances of preferably 0.05 µm to 200 µm, preferably 0.1 µm to 100 µm, preferably 0.1 µm to 50 µm, particularly preferably 0.1 µm to 25 µm, particularly preferably 0.1 µm to 15 µm, and most preferably 0.1 µm to 10 µm. Preferably, "significant heating" means that the temperature increase at a distance of one heat diffusion distance perpendicular to the surface of the heating element is preferably less than 50 K, more preferably less than 30 K, even more preferably less than 20 K, much more preferably less than 10 K, and most preferably less than 5 K.On the one hand, a sufficient spatial extent of the heated area of ​​the reaction solution perpendicular to the surface of the heating element is intended to ensure that the amplicons forming on the heating element, which typically have a length of 0.02–3 µm (corresponding to approximately 60–10,000 base pairs), are heated and thus denatured as homogeneously as possible. On the other hand, the heat diffusion distance should preferably be sufficiently small to keep the volume ratio of the heated zone to the unheated passive volume low.

[0046] Preferably, the PCR is carried out such that in at least one of the runs of the PCR amplification cycle, the heating device or heating element(s) supply less heat generated in the denaturation step to the reaction volume or reaction solution than CR * 5°C, where CR is the heat capacity of the reaction volume during heating by the heating device, and no time-stable temperature gradient is established over at least 10%, preferably over the entire contact area of ​​the heating device or heating element(s) with the reaction volume during the entire denaturation step.

[0047] A temperature gradient is considered to be "temporally stable" within the meaning of the present invention after a duration t1 following the start of heating by the heating element if the magnitude of its maximum slope at time 2t1 has changed by less than 30% compared to the magnitude of its maximum slope at time t1.

[0048] For determining temporal stability, only the comparison of the magnitudes of the maximum slope is relevant, not whether the heating device or heating element(s) generates heat at time 2t1 or not. Preferably, the magnitude of the slope at time 2t1 has changed by less than 20%, more preferably by less than 15%, more preferably by less than 10%, and most preferably by less than 5% compared to the magnitude of its maximum slope at time t1. The gradient typically has its maximum slope at the surface of the heating element(s).

[0049] The denaturation and preferably also other steps of nucleic acid amplification or PCR can thus take place locally in the immediate vicinity of the heating elements, wherein preferably at least one of the required primers is attached to the heating device or to the heating element or to one of the heating elements (hereinafter referred to as "functionalized") in order to also generate the amplicon there and thus enable denaturation upon local heating. In other words, by functionalizing the heating device, which preferably allows for the localization of PCR steps, in particular hybridization, elongation and / or denaturation, and preferably also the generation of a signal for monitoring the progress of the PCR in the immediate vicinity of the heating device, the heating of the reaction volume can be limited to a fraction of the total reaction volume.

[0050] The combination of a process according to the invention for extracting and / or amplifying a target nucleic acid can thus be combined particularly advantageously with a device for performing PCR based on local heating. A particular advantage arises from the fact that the target nucleic acid is already bound to the heating element(s) by means of the functional nucleic acid(s) and is therefore already located in the heating zone, which can be heated to the denaturation temperature or above by local heating. It is particularly preferred that at least some of the functional nucleic acids also serve as primers for PCR, thereby ensuring that the target nucleic acids bound to the heating element by means of the functional nucleic acids are already hybridized with a primer.

[0051] PCR preferably uses at least two oligonucleotides, referred to as "primers": a forward primer and a reverse primer. The forward primer is complementary to the 3' end of the original, and the reverse primer is complementary to the 3' end of the complement. In the hybridization step (also called the "annealing step"), the forward primer and / or the reverse primer hybridizes to a complementary sequence in the original, complement, or amplicon, respectively. The hybridization step usually takes place at a temperature that induces or at least promotes hybridization of the forward and reverse primers to their complementary sequences in the original, complement, or amplicon, respectively. This temperature is preferably chosen to allow for the most specific hybridization of the primers possible. The hybridization temperature is typically between 50°C and 72°C.One or more of the primers can preferably be formed by the functional nucleic acid bound to the heating element. In the elongation step, the hybridized primers are extended complementarily by a polymerase enzyme. Thus, a complement can be synthesized from the forward primer and an original from the reverse primer. For the purpose of elongation, the polymerase is exposed to a temperature that enables or at least promotes elongation. When using a polymerase from the bacterium Thermus aquaticus (Taq), an elongation temperature of 72 °C is typically used. In some embodiments of the PCR, the hybridization and elongation temperatures are identical, that is, both steps take place at the same temperature (i.e., there are only two temperature stages during the PCR: a combined hybridization and elongation temperature and a denaturation temperature).

[0052] The denaturation temperature corresponds to the temperature at which a nucleic acid double strand is denatured, i.e., at which the nucleic acid double strand is separated into its two single strands. In the denaturation step, for example, the extraction nucleic acid can be separated from the nucleic acid hybridized to it. The preferred type of denaturation according to the invention is thermal denaturation (also referred to as "melting"). For this purpose, at least a portion of the nucleic acid double strand or the entire double strand is exposed to a temperature equal to or higher than the denaturation temperature, which causes or at least promotes the separation of the nucleic acid double strands. The preferred denaturation temperature is chosen to be high enough to allow the nucleic acid double strands to be separated.On the other hand, the preferred denaturation temperature is chosen to be low enough to avoid significant damage to any DNA polymerase that may also be present in the reaction solution. A typical value for the denaturation temperature might be, for example, 95 °C. Heating the heating element to a temperature equal to or greater than the denaturation temperature can preferably offer the advantage that the extracted nucleic acid at least partially detaches from the functional nucleic acid and passes freely into the reaction solution. This can be advantageous, for example, for subsequent amplification of the extracted nucleic acid and / or when the extracted nucleic acid needs to be removed or separated from the heating element.

[0053] Preferably, the relative motion between the heating element and the sample liquid is generated when the heating element is in contact with the sample liquid. Alternatively or additionally, the relative motion between the heating element and the reaction solution is generated, at least partially, during a denaturation step of the polymerase chain reaction. This offers the advantage that hybridization can be particularly promoted by the relative motion.

[0054] Preferably, at least during the generation of relative motion between the heating element and the sample liquid and / or during the generation of relative motion between the heating element and the reaction solution, a temperature suitable for hybridization of the target nucleic acid with the functional nucleic acid is provided, at least temporarily, at least at the location of the functional nucleic acid. This ensures effective hybridization of the target nucleic acid to the functional nucleic acid. Preferably, the temperature is at least 20°C, more preferably at least 30°C, more preferably at least 40°C, much more preferably at least 50°C, and most preferably at least 60°C. Alternatively or additionally, the temperature is not more than 90°C, more preferably not more than 80°C, and most preferably not more than 70°C.This enables a particularly efficient and / or particularly specific hybridization of the target nucleic acid with the functional nucleic acid on the heating elements. In one embodiment, the temperature is preferably selected such that a bond between the target nucleic acid and a primer sequence of the functional nucleic acid on the heating elements is achieved that is as specific and / or as efficient as possible.

[0055] Preferably, heat is supplied, at least in part, by means of the heating element. For example, the heating device and / or the heating element can be designed according to the disclosure in DE 10 2016 120 124 A1. In this way, the amplification of the target nucleic acid can be carried out particularly quickly.

[0056] Preferably, the functional nucleic acid is structured as an oligonucleotide and / or comprises one. Particularly preferably, the functional nucleic acid is structured as an extraction nucleic acid and / or has a capture nucleotide sequence that is at least partially complementary to the nucleotide sequence of the target nucleic acid and is suitable for binding to the target nucleic acid. This promotes the hybridization of the target nucleic acid to the functional nucleic acid.

[0057] Preferably, the functional nucleic acid has a nucleotide sequence that can be used as a primer sequence for the amplification of the target nucleic acid. This offers the advantage that the polymerase chain reaction can be carried out in close proximity to the heating element, which can be particularly advantageous for local heating using the heating element.

[0058] Preferably, the sample liquid and / or the reaction solution contain one or more reagents that promote the hybridization of the target nucleic acid with the functional nucleic acid. This can improve extraction and / or amplification.

[0059] Preferably, the relative motion between the heating element and the sample liquid and / or the reaction solution is achieved at least partially by moving the heating element. For example, moving the heating element can include oscillation and / or vibration. The oscillation and / or vibration of the heating element can preferably be induced by a magnetic field, wherein the magnetic field is preferably generated by an electric current flowing through the heating element and / or by an external magnetic field. For example, this can be caused by electric current pulses and / or time-varying current flowing through the heating elements, e.g., by the magnetic field of the current-carrying conductors of the heating elements interacting with each other. In particular, the Lorentz force can be used to excite the current-carrying heating elements to oscillate and / or vibrate.In this way, mutual attraction and / or repulsion of parts of the heating element(s) can be induced, which can lead to elastic deformation of parts of the heating element(s), causing the heating element(s) to vibrate. The vibration can preferably be induced resonantly or non-resonantly. It can preferably be intensified by placing the heating element(s) in an external magnetic field. The vibration can preferably be intensified by having different distances between adjacent heating elements.

[0060] According to a preferred embodiment, the heating elements are excited to oscillate and / or vibrate by energizing them and arranging them in such a way that they attract and / or repel each other during energization, thereby being set in motion. For example, a plurality of heating elements designed as wires can be arranged parallel to each other in a plane and extend through the reaction vessel. The spacing of the heating elements is preferably selected such that the mutual attraction and / or repulsion force of the heating elements is sufficiently large to set the heating elements into oscillation and / or vibration. It is particularly preferred that the heating elements are arranged relative to each other in such a way that the forces on the heating elements do not cancel each other out during energization. For this purpose, for example, the multiple heating elements can be arranged in pairs.This can be achieved, for example, by varying the distances between the heating elements. Two heating elements can run parallel to each other at close intervals, while pairs of heating elements are spaced further apart to prevent the force acting on each individual element from completely canceling out. In other words, the distances between the individual heating elements can be alternately larger and smaller. This can lead to an asymmetrical and / or anisotropic force acting on the individual heating elements, which can cause them to oscillate and / or vibrate.

[0061] According to other preferred embodiments, one or more external magnets can be provided to achieve and / or increase and / or change the force acting on the energized heating elements.

[0062] Alternatively or additionally, the oscillation and / or vibration of the heating element can be caused, at least partially, by a force applied by a mechanical actuator and / or by sound waves and / or ultrasonic waves. For example, one end of the heating element can be mechanically excited to cause the oscillation and / or vibration. For instance, a mechanical actuator could incorporate one or more piezoelectric actuators and / or one or more vibration motors to cause the one or more heating elements to oscillate and / or vibrate.

[0063] According to a preferred embodiment, for example, one or more piezo actuators and / or one or more vibration motors can be used to excite the reaction vessel to oscillate and / or vibrate, thereby achieving relative movement of the liquid, i.e., the sample liquid and / or the reaction solution, in the respective reaction vessel relative to the at least one heating element. For example, an AC-driven piezo actuator and / or a vibration motor (such as from a mobile phone) and / or a loudspeaker can be used for this purpose, which excite the reaction vessel and / or a sample plate to oscillate and / or vibrate through suitable mechanical contact with one or more reaction vessels. This can preferably be achieved such that either the heating device oscillates along with the reaction and / or the sample liquid or the reaction solution and heating device follow the excitation in some other way (e.g., by moving the sample liquid or the reaction solution).(with a different amplitude and / or phase), so that a relative motion is created.

[0064] According to some preferred embodiments, one or more separate actuators, such as one or more separate piezoelectric actuators, are provided for each reaction vessel. According to other preferred embodiments, one piezoelectric actuator can be provided for several reaction vessels. According to still other preferred embodiments, for example, several actuators can be provided which, in combination, excite several reaction vessels and / or the heating elements and / or liquid contained therein to vibrate and / or oscillate. According to a particularly preferred embodiment, several reaction vessels can be formed in a sample plate, wherein one or more actuators, such as one or more piezoelectric actuators and / or vibration motors, are provided to excite all reaction vessels of the sample plate to vibrate and / or oscillate.The one or more actuators can be arranged, for example, laterally and / or below and / or on top of the sample plate. Preferably, one actuator is provided per reaction chamber or per sample plate.

[0065] Alternatively or additionally, the relative motion can be caused by moving the heating elements relative to the reaction vessel, e.g. by pulling the heating element(s) through the reaction vessel containing the sample liquid or the reaction solution and / or by moving magnetic fields acting on the magnetic heating elements or by sound waves that cause the heating elements to vibrate (for example in the audible range or in the ultrasonic range).

[0066] Preferably, the relative movement between the heating element and the sample liquid and / or the reaction solution is achieved at least partially by moving the sample liquid or the reaction solution.

[0067] Particularly preferably, the movement of the sample liquid and / or the reaction solution is carried out, at least partially, by pumping the sample liquid or the reaction solution in a reaction vessel. This can be done, for example, by pumping the liquid, i.e., the sample liquid or the reaction solution, through the reaction vessel. The reaction vessel can preferably include an additional chamber that can accommodate the portion of the reaction volume that has already been brought into contact with the heating elements. The reaction volume can preferably be brought into contact with the heating elements either once or repeatedly (e.g., by pumping back and forth). The total reaction volume can preferably be larger than the volume that can be brought into contact with the heating elements simultaneously. The pumping can, for example,This is achieved by changing the geometry of part of the reaction vessel, i.e., a flexible membrane or surface that is moved from the outside, thus causing a movement of the reaction solution or sample liquid in the reaction chamber.

[0068] Preferably, the movement of the sample liquid and / or the reaction solution is achieved at least partially by subjecting the sample liquid or the reaction solution to sound waves and / or ultrasound waves. The application of ultrasound and / or sound can, for example, originate from outside the reaction chamber or the reaction vessel and be coupled into the reaction liquid, thereby causing, for example, directed or turbulent flows.

[0069] Preferably, the movement of the sample liquid and / or the reaction solution is carried out at least partially by at least one mechanical actuator. The actuator can preferably be driven externally. The actuator can, for example, comprise magnetic elements such as beads or magnetic stir bars, which are moved in the reaction liquid by an externally applied magnetic field, thus moving the reaction liquid.

[0070] Preferably, the movement of the sample liquid and / or the reaction solution is caused at least partially by convection, e.g. by the targeted introduction of temperature gradients.

[0071] Preferably, the relative motion between the heating element and the sample liquid and / or the reaction solution is achieved at least partially by moving a reaction vessel in which the sample liquid or the reaction solution is arranged. This can include, for example, shaking, centrifuging, rotating, vortexing, tilting, and / or other forms of movement, which preferably result in the heating elements moving differently from the liquid, preferably due to inertia or friction, their material properties, or other effects, thus causing relative motion.

[0072] Naturally, the generation of relative motion can be based on a combination of some or all of the methods described above for generating relative motion.

[0073] Preferably, the heating device has several heating elements. This allows, in particular, a larger contact area between the sample liquid or reaction solution and the heating element to be achieved.

[0074] Preferably, the one or more heating elements are configured as electrical, and in particular as resistive, heating elements and are preferably configured as heating wire(s). The heating elements are particularly preferably configured as described in DE 10 2016 120 124 A1. Preferably, the heating element(s) are each conjugated with a plurality of functional nucleic acids, wherein the functional nucleic acids of the heating element are of the same type or at least partially different types. Particularly preferably, each of the heating elements is conjugated with a plurality of similar functional nucleic acids, and the different heating elements are preferably conjugated with functional nucleic acids that are at least partially different from the functional nucleic acids of the other heating elements. Heating device

[0075] The heating device can consist of one or more heating elements. Alternatively, the heating device can also include further elements, such as electrical supply and / or return leads for electrical current and / or a control device. In any case, within the scope of this invention, the heat provided by the heating device is intended to refer to the heat supplied by the heating element(s) in contact with the reaction solution and / or in contact with the sample liquid, but not any heat generated elsewhere, for example, in or on the control device.

[0076] In a preferred embodiment of the invention, the reaction volume or reaction solution is heated by a heating device with one or more heating elements, wherein, particularly preferably, the heating element or at least one of the heating elements, and especially preferably all heating elements, are electrically contacted. This advantageously makes it possible to supply the heating element with current or voltage. This preferred embodiment of the invention can exploit the fact that electrically contacted heating elements can be operated and controlled particularly easily by an electrical control device. Preferably, the heating element, or at least one of the heating elements, is a device that converts an electric current into heat, for example, by means of its ohmic resistance. This embodiment of the invention can exploit the fact that such heating elements can efficiently convert electrical energy into heat.A preferred heating element is a heating resistor or a Peltier element. With multiple heating elements, these can be connected in series and / or parallel, or partially in series and partially in parallel.

[0077] Preferred heating elements may include a material, such as a sheath or a separating layer, positioned between the heat-generating component of the heating element and the reaction volume. Such a material can be helpful in protecting the heating element, for example, from corrosion or other chemical interactions with the PCR chemistry and / or insulating it electrically (therefore also referred to here as a separating layer), and may, for example, consist of polymers. Preferably, such heating elements and the reaction volume or reaction solution are separated at most by a separating layer with a thickness of less than 500 µm, preferably less than 100 µm, preferably less than 20 µm, preferably less than 5 µm, preferably less than 1 µm, preferably less than 0.2 µm, and preferably less than 0.05 µm.Particularly preferred is a further embodiment in which there is no separating layer between heating elements and the reaction solution or the reaction volume, or in which the thermal properties of the separating layer are selected such that its effect on the heat transfer from the heating device to the reaction volume is negligible.

[0078] It can be advantageous to achieve a uniform temperature across the entire heating element. In heating resistors, this can be achieved, for example, by ensuring a uniform current density and a constant surface area to volume ratio (SAR) in each section or volume of the heating resistor during heating. Advantageously, this is achieved by ensuring a constant conductor cross-section and a constant voltage drop per unit length of conductor throughout the entire heating element. In a preferred embodiment of the invention, multiple heating elements heat the reaction volume in the same way. However, the invention also includes embodiments in which heating elements heat the reaction volume differently, for example, for different durations or to different degrees.The heating elements of the heating device can be the same or different, for example in terms of their length or geometry.

[0079] Preferably, the reaction volume is heated by a heating device comprising one or more heating elements, wherein, particularly preferably, the heating element or at least one of the heating elements, and more preferably all heating elements, are in contact with the reaction volume. In a preferred embodiment of the invention, at least one of the heating elements borders the reaction volume or the reaction solution over its entire surface; more preferably, all heating elements border the reaction volume or the reaction solution over their entire surface. An achievable advantage of this embodiment of the invention is that the reaction volume or the reaction solution can be efficiently heated by the respective heating element in the vicinity of the heating element.This embodiment of the invention also advantageously achieves that, in order to achieve high reaction kinetics (especially the hybridization kinetics of the nucleic acid molecules on primers, which, as described below, are preferably arranged on the heating element), the heating device has the largest possible accessible surface area.

[0080] It is preferred that the heating elements have the highest possible surface area (FOC) to enable the most effective heat transfer to the (immediate) environment, while simultaneously having the smallest possible volume to ensure a low heat capacity of the heating element. According to the invention, preferred embodiments have an FOC for the heating elements that is more than 10³ m⁻¹ (per meter), preferably more than 10⁴ m⁻¹, and particularly preferably more than 5 × 10⁴ m⁻¹. However, an excessively large FOC can, in some cases, lead to very delicate and thus mechanically unstable structures, so it can be advantageous according to the invention to keep the FOC smaller than 10⁹ m⁻¹, preferably smaller than 10⁸ m⁻¹, and in some cases even smaller than 10⁷ m⁻¹.

[0081] For a long wire (length much greater than diameter), the OVV is calculated, for example, as 2 / r, where r is the radius of the wire. For a thin film or foil (thickness much smaller than length and lateral extent), the OVV is calculated as 1 / d, where d is the thickness of the film or foil. According to the invention, preferably for the above embodiments, only the surface area in contact with the reaction volume is considered; preferably, only the volume whose surface(s) are in contact with the reaction volume is considered (that is, for example, supply lines that do not run through the solution are not to be considered as relevant volumes and surfaces according to the invention). The same applies accordingly to the subsequent consideration of the volume fill factor and heat capacity.

[0082] In a preferred embodiment of the invention, the ratio between the surface area of ​​the heating element in contact with the reaction volume and the reaction volume is greater than 0.1 m⁻¹, particularly preferably greater than 1 m⁻¹, particularly preferably greater than 5 m⁻¹, particularly preferably greater than 10 m⁻¹, particularly preferably greater than 20 m⁻¹, particularly preferably greater than 50 m⁻¹, and particularly preferably greater than 100 m⁻¹. With this embodiment of the invention, favorable reaction kinetics can advantageously be achieved by allowing components of the reaction volume to rapidly reach the surface of a heating element by diffusion in a large part of the reaction volume in order to participate in the steps of the nucleic acid amplification process taking place there.In the case of heating elements described below, which are at least partially functionalized on their surface with one of the reactants (for example, a primer), it can also be exploited that a larger surface area means that more reactants are available.

[0083] To prevent the heating element structure from becoming too delicate, or from hindering the movement of nucleic acid molecules and other reactants in the reaction volume by too many surfaces, the ratio of the surface area of ​​the heating element or heating elements to the size of the reaction volume is preferably less than 10⁶ < m⁻¹, particularly preferably less than 10⁵ < m⁻¹, particularly preferably less than 10⁴ < m⁻¹, and most preferably less than 10³ < m⁻¹.

[0084] To minimize the heat supplied to the reaction volume by the heating device during the denaturation step, it can be advantageous to also keep the heat capacity of the heating device or heating element(s) low. This is because the greater the heat capacity of the heating device or heating element(s), the greater the amount of energy required to achieve a certain temperature increase on the surface of the heating elements. The energy supplied to the reaction volume by the heating device during the denaturation step is then distributed throughout the entire reaction volume. The heat capacity of the heating element is calculated as the product of its volume and the specific volumetric heat capacity of the material from which that volume is composed. A key degree of freedom in the design of the heating device is its dimensioning.Therefore, it can be advantageous to keep the volume of the heating device, and in particular the material thickness, as small as possible. It is noteworthy that the heat diffusion distance depends not on the size of the heating device, but solely on the heating duration. In a preferred embodiment of the invention, the volume of all heating elements of the heating device is less than 10%, preferably less than 5%, particularly preferably less than 3%, and most preferably less than 1% of the reaction volume. With this embodiment of the invention, a low heat capacity of the heating device or the heating element(s) can advantageously be achieved by means of a low volume fill factor.

[0085] In a preferred embodiment of the invention, the heating device comprises an arrangement of several heating elements configured as current-carrying conductors and surrounded by the reaction volume or the reaction solution and / or the sample liquid. This advantageously allows the heating device to act at many different locations within the reaction volume. This is particularly beneficial in typical cases where, at the beginning of a PCR, only a very low concentration of nucleic acid molecules to be amplified is present, and the average distance of these molecules to the nearest heating element is therefore large. It can be estimated that a single nucleic acid strand with a length of 100 base pairs takes approximately one time to heat the reaction. t = x²< / D DNA required to move a distance x away from its starting point by diffusion (where D DNA ≈ 10 ~11< m 2< / sIn a preferred embodiment of the invention, the spatial distance of each point in the reaction volume to the nearest heating element is less than 3 mm (millimeters), preferably less than 2 mm, particularly preferably less than 1 mm, particularly preferably less than 0.75 mm, particularly preferably less than 0.5 mm and particularly preferably less than 0.25 mm.

[0086] In one embodiment of the invention, one or all heating elements consist of an electrically conductive metal or metal alloy or another electrically conductive material with low specific electrical resistance, for example carbon, a semiconductor material or a conductive plastic.

[0087] In one embodiment, one or all heating elements consist of only one wire or electrical conductor, or of several wires or electrical conductors. These can be straight, bent, or wound into a coil. Several wires or electrical conductors can be equidistant or unequal in distance from one another, and may or may not cross. Each wire or electrical conductor can have a round, oval, flat, or any other cross-section. A heating element can also simply be a continuous surface, for example, a flat surface coated with metal.

[0088] A particularly preferred embodiment of the heating device is an arrangement, preferably a periodic arrangement, of conductive metallic wires. The wires are particularly preferably aligned parallel to one another. The wires of the array preferably have a diameter between 0.5 and 100 µm (micrometers), particularly preferably between 1 and 50 µm. The wires are preferably spaced between 20 and 1500 µm.

[0089] The wires preferably consist of gold and / or other metals, or they are designed as sheathed wires in which the core is made of a less expensive and more stable material, preferably a metal. Sheathed wires with a stainless steel, molybdenum, or, most preferably, a tungsten core with a sheath of an inert material, preferably gold, are particularly preferred; such wires can advantageously be made very thin (and thus with high tensile strength) due to the high strength of the core, while still allowing the desired chemical properties of the preferably precious metal sheath to be achieved through the sheath material. Sheathed wires with a tungsten core (tungsten advantageously has a significantly higher tensile strength than gold), preferably with a core diameter between 5 and 40 µm and a gold sheath between 0.1 and 2 µm thick, are particularly preferred.

[0090] In another preferred embodiment, metallic foils are used as heating elements, which permeate the reaction volume and are designed as a grid, for example by punching, electroforming, laser or water jet cutting, etching techniques or other processes.

[0091] In a preferred embodiment of the invention, the heating element is applied to a material that is electrically non-conductive or only poorly conductive. Preferred heating elements consist of a metallic film that has been applied to a non-conductive structure by electroplating, chemical processes, PVD, printing, or other methods. The non-conductive structure can, for example, be a very fine injection-molded part (a preferred structure size is less than 300 µm) or produced using a rapid prototyping process. Fabric structures are also suitable as heating elements or carriers for heating elements; in particular, such materials with mesh sizes between 20 µm and 3 mm, and especially preferably between 100 µm and 1.5 mm, can serve as heating elements or as carriers for heating elements.If the fabric structures themselves are conductive, they can advantageously serve as a heating element in their entirety; if they are made of a non-conductive material (for example, a plastic), they can be metallized so that the current flows only through a thin surface layer (typically < 10 µm), resulting in a large surface area. In other words, the wires or fibers of the fabric or mesh have a comparatively large surface area, but only the thin, applied metallic volume is actively heated. For the purposes of the invention, only the part through which the current substantially flows is to be considered the heating element; for example, if a PMMA plastic structure is coated with a gold film, then only the gold film is to be considered the heating element. Functionalizing the heating device.

[0092] In a preferred embodiment of the invention, at least one of the heating elements of the heating device is conjugated with one or more functional nucleic acids, that is, functional nucleic acids are connected to the heating element. Particularly preferably, all heating elements of the heating device are conjugated with functional nucleic acids. This advantageously allows the functional nucleic acids to be heated specifically by the heating device without having to heat the entire reaction volume. If several heating elements are contained in a reaction volume, the heating elements can preferably be conjugated with the same or different functional nucleic acids.

[0093] According to a preferred embodiment, at least some of the functional nucleic acids are configured as extraction nucleic acids. This offers the advantage that the functional nucleic acids can hybridize with target nucleic acids present in the sample liquid and thus bind the target nucleic acids to the heating element. By removing the heating element from the sample liquid, the bound target nucleic acids can then be extracted from the sample liquid.

[0094] In a particularly preferred embodiment of the invention, the heating element(s) are conjugated with functional nucleic acids configured as primers for PCR, wherein the primers are most preferably configured as forward and / or reverse primers for the PCR process. The functional nucleic acids can be configured as extraction nucleic acids or as primers. Alternatively or additionally, some functional nucleic acids can be configured as extraction nucleic acids, while other functional nucleic acids are configured as primers for PCR in the reaction solution.

[0095] In a preferred embodiment of the invention, forward primers, but no reverse primers, and / or reverse primers, but no forward primers, are applied to a heating element or a section thereof. The molecules of the other primer may be freely suspended in the reaction volume. If a separating layer is used between the heat-generating component of the heating device and the reaction volume, the functionalization must be carried out such that the functional nucleic acids are accessible from the reaction solution or from the sample liquid, that is, they are preferably applied to the surface of the heating element.

[0096] In a further preferred embodiment, at least one of the heating elements is conjugated with both forward and reverse primers. In a particularly preferred embodiment, all heating elements of the heating device are conjugated with both forward and reverse primers. With this embodiment of the invention, it can advantageously be achieved that the PCR product of a forward primer only has to travel a short distance to hybridize with the reverse primer of the same heating element, so that hybridization can take place more quickly and therefore the PCR process can be completed more rapidly.

[0097] In a preferred embodiment of the invention, a heating element is provided on its surface with a material that allows the binding of nucleic acids. For example, a gold-plated surface can be used to bind a primer to a heating element via one or more thiol bonds. A streptavidin-biotin bond can also be used to bind a primer to the heating element, preferably if one of the two partners (streptavidin or biotin) has already been bound to the heating element and the primer (at its 5' end) is modified with the other partner and then bound to the heating element via this modification. Other modifications, such as amino or carboxy groups, can also be used to bind primers to the heating element; for this purpose, the surface of the heating element can, preferably beforehand, be modified with epoxy.Preferably, the bonding takes place such that the 5' end of the primer is bound to the heating elements, leaving the 3' end free so that it can be elongated by the polymerase during PCR.

[0098] In the embodiment where both forward and reverse primers are immobilized on a heating element, the distance between the primer molecules of different types can be deliberately chosen such that they have an average distance of, for example, less than 1 nm (nanometer), less than 3 nm, less than 5 nm, less than 15 nm, or less than 50 nm from each other. This embodiment advantageously exploits the fact that, once a forward primer has been elongated on the surface of the heating element, this newly written nucleic acid strand hybridizes, after denaturation, with a corresponding neighboring reverse primer molecule on the surface or with a reverse primer molecule in the vicinity.Since this process takes place on the surface of the heating elements, the local concentrations are extremely high; thus, the new nucleic acid strand does not have to travel several micrometers by diffusion to find a reverse primer molecule because there are many reaction partners in the immediate vicinity - only a few nanometers away (the same applies conversely with elongated reverse primer molecules that find immobilized forward primer molecules in the vicinity).

[0099] In one embodiment, in addition to at least the functional nucleic acid(s), the heating elements also contain filler oligonucleotides and / or filler molecules. These are oligonucleotides or molecules that do not actively participate in the PCR as primers, extraction nucleic acids, fluorescent probes, or target nucleic acids, but merely serve to saturate or passivate the surface in order to prevent non-specific binding (i.e., not through targeted hybridization with primers) of an amplicon or target nucleic acid to the surface of the heating element. Filler oligonucleotides preferably have a length of between 5 and 50 nucleotides, more preferably between 10 and 40 nucleotides, and most preferably between 20 and 30 nucleotides. They can also, in particular, consist of only one type of nucleotide, for example, A30 sequences with 30 adenine bases.Filler molecules can be, for example, biotin or polyethylene glycol, perhaps additionally modified with a functional group such as thiol to immobilize the filler molecules on the heating element surface. Filler molecules can also be, for example, bovine serum albumin.

[0100] In a further preferred embodiment of the method, the oligonucleotides and / or functional nucleic acids on the heating elements have a spacer sequence as a subsequence. The spacer sequence is located on the side of the respective oligonucleotide and / or functional nucleic acid facing the heating element. Thus, the spacer sequence serves as a spacer for the remaining part of the oligonucleotide. In a preferred embodiment, an oligonucleotide contains both a subsequence that functions as a primer and is referred to as the primer sequence, and a subsequence that is a spacer sequence. Because the primer sequences are further separated from the heating elements by the spacer sequences, the nucleic acids to be amplified and the DNA polymerases can advantageously access the primer sequences more easily.

[0101] In a preferred embodiment of the method according to the invention, one or more non-basic (abasic) modifications are located between the spacer sequence and the primer sequence, preventing the polymerase from overwriting the spacer sequence; the relevant content of patent application DE 102013215168 A1 is incorporated by reference into the present disclosure. Such modifications can be, for example, 1',2'-dideoxyribose (dSpacer), triethylene glycol spacers (Spacer 9), or hexaethylene glycol spacers (Spacer 18), which prevent further polymerase activity in the 3' direction. This ensures that the spacer sequence does not serve as a template for the nucleic acid strand synthesized by the polymerase and that the resulting PCR product does not become unnecessarily long.An extended PCR product that also contains the complementary sequence to the spacer sequence would have a significantly increased melting temperature with the oligonucleotides on the nanoparticles and would hybridize unnecessarily unspecifically in subsequent hybridization steps, thus making the entire PCR less specific. Duration of heating

[0102] Preferably, the heat input from the heating device varies during the PCR. Particularly preferably, the heat input from the heating device varies during at least one cycle of the PCR amplification cycle, particularly preferably during at least three, particularly preferably at least 10, particularly preferably at least 20, cycles of the PCR amplification cycle, particularly preferably periodically.

[0103] In a preferred embodiment of the invention, the duration of the heating by the heating device in the denaturation step (hereinafter also referred to as the "heating pulse") is at least one, preferably at least three, particularly preferably at least 10, particularly preferably at least 20, of the cycles of the PCR amplification cycle in the interval between 100 ns (nanoseconds) and 30 ms, particularly preferably between 0.5 µs (microseconds) and 10 ms, particularly preferably in the interval between 1 µs and 5 ms, particularly preferably between 1 µs and 3 ms, particularly preferably between 1 µs and 1 ms, particularly preferably between 1 µs and 800 µs and most particularly preferably in the interval between 1 µs and 500 µs.An achievable advantage of this embodiment of the invention is that the heat, and thus the resulting temperature distribution, can be localized; in other words, the short heating time means that little heat is transferred from the heating element into the solution by thermal diffusion. Simultaneously, this embodiment of the invention ensures that the heating time is not too short to allow sufficient melting or unwinding of the nucleic acid double strands during the local heating period, and / or to allow the two single strands to separate sufficiently from each other by Brownian motion (and / or other forces) during the local heating period to prevent rehybridization.

[0104] In a preferred embodiment of the invention, the duration of the denaturation step constitutes only a small fraction of the total PCR duration. Preferably, the denaturation step, during at least one run of the PCR amplification cycle, more preferably during at least three, more preferably during at least 10, more preferably during at least 20 runs of the PCR amplification cycle, constitutes less than 10%, more preferably less than 5%, more preferably less than 3%, more preferably less than 1%, more preferably less than 0.5%, more preferably less than 0.05%, and more preferably less than 0.01% of the time used for each total run of the PCR amplification cycle. This embodiment of the invention advantageously allows hybridization to occur practically throughout the entire duration of the PCR.Since the polymerase can operate virtually throughout the entire local PCR process, the overall process time can be shortened. Furthermore, the localized and very brief heating process protects the polymerase enzymes and other reactants, preventing them from losing their processivity as quickly.

[0105] In a preferred embodiment of the invention, the duration of the denaturation step is determined during at least one run of the PCR amplification cycle, particularly preferably during at least three, particularly preferably during at least 10, particularly preferably during at least 20, runs of the PCR amplification cycle. t heat shorter than t heαt ≤ ( s 1 · | x |) 2< / D ), where s1 is a scaling factor, | x| the critical distance and D the thermal diffusivity. The scaling factor s1 is preferably s1 = 100, particularly preferably s1 = 10, particularly preferably s1 = 1, particularly preferably s1 = 0.1, particularly preferably s1 = 0.01. The critical distance | x | is the minimum distance from a point on the heating device or heating element to the nearest point on a non-adjacent part of the heating device, for example, to the nearest heating element of the heating device. If parallel wires are used as the heating device, the distance between two wires is the critical distance. If the heating element(s) are constructed from a 2D structure (such as a grid, fabric, honeycomb, etc.), the mesh size or the size of the holes / recesses is the relevant parameter. x|; if the heating element(s) consist of a 3D structure, the average pore size is the relevant parameter | x |

[0106] In an alternative preferred embodiment, the critical distance of periodically arranged heating devices can be determined by Fourier transformation of the spatial structure of the heating device (for example, using a numerical method based on a 3D CAD model of the heating device). For this purpose, the reciprocal of the spatial frequency with the highest absolute value is calculated, which equals the critical distance. (The Fourier transformation can be performed in 3D, or in 1D or 2D along different spatial axes).

[0107] With this embodiment of the invention, it is possible to achieve a heating duration so short that the heat diffusion distance is much smaller than the average distance. xThis ensures that the heat fields of adjacent heating elements, or generally adjacent but non-adjacent parts of the heating device, do not overlap. In particular, scaling factors greater than 1 can be advantageous for very long amplicons, where the unwinding of the two nucleic acid strands takes longer (the time it takes for a nucleic acid double strand to unwind through Brownian motion increases with the fourth power of the length); scaling factors below 1 can be advantageous for optimal heating and cooling dynamics. Electricity storage

[0108] A preferred device according to the invention is designed such that its electrical power consumption does not exceed 50 W, particularly preferably 20 W, particularly preferably 10 W, particularly preferably 3 W, particularly preferably 2.5 W, particularly preferably 1.5 W, or particularly preferably 0.5 W at any time during the PCR. This limitation does not apply to potentially higher power consumption during the switch-on process of the device, such as that which may be caused by technically induced inrush currents. Such increased power consumption is not considered power consumption during the PCR and is therefore not taken into account here.With this embodiment of the invention, it is advantageously possible to operate the device on conventional portable power sources, for example on a motor vehicle battery, on the cigarette lighter of a motor vehicle or on a connection of a PC, a tablet computer or a mobile phone, for example on a USB or an Apple Lightning connector.

[0109] Preferably, the device includes an electrical energy storage device. It is preferably configured such that the electrical energy stored in the electrical energy storage device is greater than 0.1 J / mL, particularly preferably greater than 1 J / mL, particularly preferably greater than 2 J / mL, and particularly preferably greater than 3 J / mL, relative to the capacity of the reaction vessel. Advantageously, the electrical energy storage device can be used to temporarily store the electricity required to meet the varying electricity demand of the heating device, which arises from varying heat input.

[0110] A device according to the invention comprising an electrical energy storage device is preferably configured such that the electrical energy stored in the electrical energy storage device is less than 100 J / mL, particularly preferably less than 50 J / mL, and most preferably less than 30 J / mL, relative to the capacity of the reaction vessel. This embodiment of the invention can take advantage of the fact that the electrical energy storage device can be designed to be small due to particularly efficient heating by the heating element. As a result, the device according to the invention can advantageously be designed to be particularly compact, inexpensive, and portable.

[0111] A preferred energy storage device comprises one or more capacitors, inductors, or batteries, or a combination thereof. In a preferred embodiment of the invention, the storage capacity of the energy storage device is designed such that it can store at least 20%, particularly preferably at least 40%, particularly preferably at least 50%, particularly preferably at least 60%, particularly preferably at least 80%, particularly preferably at least 100%, particularly preferably at least 150%, particularly preferably at least 200%, and particularly preferably at least 300% of the electrical energy required for the denaturation step of one iteration of the PCR amplification cycle.This embodiment of the invention avoids the need for a power source capable of providing the required electrical power for the entire duration of the denaturation step. Instead, the energy storage device can advantageously be charged during the time between denaturation steps, which is typically considerably longer than the duration of the denaturation step itself. This allows the device according to the invention to be equipped with a lower-powered power source, for example, a less powerful power supply.If the electricity storage device provides less than 100% of the energy required for the denaturation step of a PCR replication cycle, it can advantageously be kept very small; however, the remaining energy must then be provided by an additional, appropriately sized power source, for example a power grid connection, during the denaturation step.Values ​​of 100% and above are advantageous because the power source supplying the capacitor(s) can then be kept correspondingly small, and the voltage does not drop due to the heating load; in particular, it is advantageously achievable that a power source of the device according to the invention only needs to be dimensioned so that it is able to provide the amount of energy required for the denaturation step over the duration of a PCR replication cycle, but not during the much shorter denaturation time.

[0112] In a preferred embodiment of the invention, in at least one, preferably at least three, particularly preferably at least 10, particularly preferably at least 20, cycles of the PCR amplification cycle, the ratio between the electrical power consumption of the device and the capacity of the reaction vessel does not exceed 1 W / mL, preferably 0.5 W / mL, particularly preferably 0.25 W / mL, particularly preferably 0.1 W / mL at any time during the PCR. This limitation does not apply to potentially higher power consumption during the switch-on process of the device, such as that which may be caused by technically induced inrush currents. Such increased power consumption is not considered power consumption during the PCR and is therefore not taken into account here.

[0113] In a preferred embodiment of the invention, the electricity storage device is designed to hold the energy for the denaturation steps of at least 5, particularly preferably at least 10, particularly preferably at least 20, particularly preferably at least 40, particularly preferably at least 100 iterations of the PCT replication cycle. This advantageously allows the creation of a device, particularly a portable device, that can perform one or even several complete polymerase chain reactions independently of another power source.

[0114] Preferred capacitors are high-capacitance capacitors, preferably electrolytic capacitors or supercapacitors, especially preferably each with a low ESR value. Such capacitors are readily available on the market at low cost and are easy to dimension. For example, the following equation can be used to determine the required capacitor type: Q = 1 2 CU 2 or C = 2 ⋅ Q U 2 It has been calculated that to provide 1 J (joule) of electrical energy (which, according to one embodiment, would suffice for the denaturation step of a reaction volume of 1 mL with virtually lossless conversion of the electrical energy into heat), a capacitor with a capacitance of 2222 µF (microfarads) would be sufficient at a voltage U of 30 V. However, the capacitor would then be completely discharged at the end of the heating pulse, so in practice the use of a capacitor with at least 1.5 times the capacitance is recommended unless the power source can supply a significant portion of the current.

[0115] In a preferred energy storage device according to the invention, the capacitance of the capacitor or, in the case of several capacitors, the sum of the capacitances of these several capacitors is greater than 100 µF, particularly preferably greater than 200 µF, particularly preferably greater than 500 µF, particularly preferably greater than 1 mF (millifarad), and particularly preferably greater than 1.5 mF. In a preferred energy storage device according to the invention, the ratio between the capacitance of the capacitor or, in the case of several capacitors, the sum of the capacitances of these several capacitors and the size of the reaction volume is greater than 0.01 mF / mL (millifarad per milliliter), particularly preferably greater than 0.1 mF / mL, particularly preferably greater than 1 mF / µL, particularly preferably greater than 5 mF / mL, and particularly preferably greater than 10 mF / mL.With this embodiment of the invention, it is advantageous to be able to temporarily store enough energy to achieve sufficient heating of the heating element in the denaturation step.

[0116] Particularly preferred batteries are high-current batteries or accumulators, especially lithium-polymer batteries, lithium-ion batteries, or lithium iron phosphate batteries. In one embodiment of the invention, the battery(ies) is / are used in combination with one or more capacitors. In another embodiment, the battery(ies), particularly preferably lithium iron phosphate batteries, which are characterized by an advantageously low internal resistance, is / are used without the additional use of a capacitor. According to the invention, it can be advantageous if the connecting leads between the capacitor(s) and / or batteries and the heating element have the shortest possible length in order to reduce disruptive inductances and ohmic resistances of the connecting leads. reaction vessel

[0117] A preferred device for nucleic acid amplification comprises at least one reaction vessel for receiving the reaction volume or the reaction solution and / or the sample liquid. The reaction vessel for the method according to the invention can be a classic PCR reaction vessel such as PCR tubes or arrays of PCR tubes (such as so-called 8-strips) or multiwell plates, but also, for example, flat plates or other shapes that can be filled. The heating device or heating element(s) can be introduced into the reaction vessels during the production process (for example, injection molding) (for example, wires that penetrate the walls of multiwell plates or PCR tubes) or added after the production process (such as wires in the form of coils that can be suspended in the individual wells of a multiwell plate).

[0118] The heating device is preferably integrated into a sample carrier and / or sample plate that can accommodate the heating device and the reaction volume, such that the heating device is particularly accessible to target nucleic acids in the sample liquid and / or the reaction solution. The sample carrier and / or sample plate, in particular, allows for electrical contact with the heating device and enables a tight and leak-proof containment of the sample liquid and / or the reaction solution. For this purpose, a portion of the heating device and / or the leads to the heating device is preferably embedded in the sample carrier or sample plate, e.g., by overmolding the heating device in an injection molding process or by a layered bonded structure as described in DE 10 2016 120 124 B.In particular, the heating device according to the invention can preferably also be integrated into a micro- or macrofluidic cartridge (e.g., for point-of-care analysis), which, through the methods according to the invention, optionally in combination with conventional methods, enables a partial or complete integration of a molecular diagnostic or DNA analytical detection process. In a particularly preferred embodiment, for example, the relative movement between the reaction solution or sample liquid and the heating device on a partially or fully integrated cartridge can be achieved by moving the reaction solution back and forth on the cartridge (e.g., by pumping). This can be accomplished, for example, by actuating a bellow and / or blister on a cartridge using an external actuator, causing the liquid to move within the reaction vessels / volume in this way, while the rigid heating device preferably remains stationary. Control device

[0119] A preferred device according to the invention comprises a control device that supplies the heating device with electric current to heat the reaction volume. The control device is preferably designed such that in at least one, preferably in at least three, particularly preferably in at least 10, particularly preferably in at least 20, of the cycles of the PCR amplification cycle, the ratio between the electrical energy used in the denaturation step for heating the reaction volume and the capacity of the reaction vessel is less than 40 J / mL (millijoules per milliliter), particularly preferably less than 20 J / mL, particularly preferably less than 10 J / mL, particularly preferably less than 3 J / mL.

[0120] In a preferred device according to the invention, the control device is designed such that at least one heating element of the heating device has a dimension of more than 1.5 µm in at least one direction. Particularly preferably, each heating element of the heating device has a dimension of more than 1.5 µm in at least one, and more preferably in two, directions. The dimension can, for example, be the length or diameter of an elongated heating element. A preferred elongated heating element has a diameter of at least 1 µm, more preferably at least 2 µm, and more preferably at least 5 µm. A preferred elongated heating element has a length of at least 0.1 mm, more preferably at least 1 mm, and more preferably at least 2 mm.In a mesh- or honeycomb-shaped heating element, the dimension can, for example, also be the thickness (meaning the dimension of the struts perpendicular to the surface of the mesh or honeycomb) or the diameter of the struts. Preferred struts have a thickness or diameter of at least 1 µm, particularly preferably at least 5 µm, and particularly preferably at least 10 µm.

[0121] The preferred control device is configured to allow or increase the current flow through the heating element at the beginning of the denaturation step—or at the beginning of each time interval of the denaturation step if the denaturation step consists of several separate time intervals—and to prevent or decrease the current flow after the denaturation step—or after the end of each time interval of the denaturation step—in order to generate a current pulse. The current pulse can be converted into a heating pulse within the heating element. The preferred control device includes a current source, which in turn may include, for example, a power supply, one or more batteries or accumulators, or a fuel cell. The preferred control device includes one or more capacitors.The preferred control device comprises a switch that can, preferably with a selectable duration, turn the current flow from the power source through the heating device on and off. Suitable switches include MOSFETs, SSRs, very fast relays, and transistors. The control device may include one or more pulse or frequency generators, DACs, or microcontrollers for timing control.

[0122] It is understood that the features mentioned above and those to be explained below can be used not only in the combination specified in each case, but also in other combinations or on their own, without departing from the scope of the present invention.

[0123] The invention is schematically illustrated with reference to exemplary embodiments in the drawings and is described below with reference to the drawings. Character description

[0124] Figures 1A and 1B show a schematic representation of a heating element according to a preferred embodiment.

[0125] The Figures 2A and 2B The figures show schematic and simplified cross-sections of preferred embodiments of a device for extracting a nucleic acid.

[0126] Figur 2C shows a sample plate according to a preferred embodiment.

[0127] 2D Figure Figure 1 schematically shows a device for extracting a nucleic acid according to a further preferred embodiment.

[0128] The Figure 3A and 3B Figure 1 schematically shows a preferred embodiment of a sample plate when used for the extraction and / or amplification of a target nucleic acid.

[0129] Figure 4 shows the results of experiment 1 in a bar chart.

[0130] Figure 5 The results of experiment 2 are shown in a bar chart.

[0131] Figur 1AFigure 1 shows a schematic representation of a heating element 10 according to a first preferred embodiment. The heating element 10 is designed as a wire or heating wire 12, the surface of which is functionalized with several functional nucleic acids 14. It should be noted that the heating element 10 is shown only schematically and an actual heating element 10 may have different dimensions and / or shapes, and in particular a different length-to-diameter ratio. The functional nucleic acids 14 are formed as oligonucleotides and have at least a partial nucleotide sequence that is at least partially complementary to the nucleotide sequence of at least a portion of the target nucleic acid 22 to be extracted from a sample liquid. For example, the functional nucleic acids 14 can be bound to the surface of the heating element 10 by means of a thiol and / or sulfur bond.Preferably, the heating element 10 has a surface that promotes the binding of the extraction nucleic acids 14 to the heating element 10 or to the wire 12. For example, the heating element 10 or the wire 12 can be made of a precious metal, such as gold, and / or have its surface at least partially coated with gold to promote reliable binding of the extraction nucleic acids 14 to the heating element 10.

[0132] The heating element 10 has a power supply 16 by means of which the heating element 10 can be supplied with electrical voltage and / or electrical current to heat the heating element 10 and to locally heat the immediate surroundings of the heating element 10, i.e., the heated wire 12. Furthermore, if required, the entire reaction solution surrounding the heating element 10 can also be heated globally, i.e., completely. For example, by closing the switch 18, an electrical voltage supplied by the voltage source 20 can be applied to the heating element 10, causing an electric current to flow through the heating element 10 in a controllable manner and to heat it resistively. For example, the current can be supplied in pulsed form to achieve the sharpest possible temperature gradient in a reaction solution in the immediate vicinity of the heating element, both temporally and / or spatially.

[0133] For the extraction of the target nucleic acid 22 from a sample liquid, the heating element 10 can be at least partially covered with the sample liquid. For the amplification of the target nucleic acid 22 in a reaction solution, the heating element 10 can be brought into contact with the reaction solution, as described in DE 10 2016 120 124 A1. For example, the heating element 10 can be at least partially immersed in the sample liquid or reaction solution and / or covered with the sample liquid or reaction solution. If the nucleic acid 22 to be extracted is present in the sample liquid or reaction solution and preferably is free, i.e., unbound, a single strand of the nucleic acid 22 can attach to a functional nucleic acid 14 and hybridize with it, provided that the latter is not already bound by another nucleic acid. Figur 1B The heating element is shown Figur 1Awith nucleic acids 22 bound to them, which were extracted from a sample liquid. The nucleic acids 22 form at least partial double strands with the extraction nucleic acids 14. According to a preferred embodiment, the heating element 10 can be used to provide a temperature suitable for hybridization of the nucleic acid 22 with the extraction nucleic acid 14 in the immediate vicinity of the heating element 10, for example, to improve and / or accelerate the hybridization.

[0134] If the target nucleic acid 22 is bound or hybridized to the heating element 10 via the functional nucleic acids 14, the heating element 10, along with the nucleic acids 22, can be separated from the sample liquid, with the nucleic acids 22 remaining attached to the heating element 10. For example, the heating element 10 can be removed from the sample liquid if it has been immersed in it, and / or the sample liquid can be poured off and / or aspirated. One or more washing cycles can also be performed to remove any residues of the sample liquid that may have settled on the heating element 10 as completely as possible. However, the washing cycles must be selected with regard to the washing reagents or solutions and / or the procedure itself in such a way that the nucleic acids 22 remain at least partially bound to the heating element 10 via the functional nucleic acids 14 even after the washing cycles.

[0135] Figur 2AFigure 1 schematically and in a simplified form shows the cross-section of an embodiment of a device 24 for extracting and / or amplifying a nucleic acid 22, which has several reaction vessels 28 and in which the heating elements 10 are formed by sections of a wire 12 extending through the several reaction vessels 28 and connected to a voltage source 20. The wire is functionalized with functional nucleic acids 14, each of which serves both as an extraction nucleic acid and as a primer for an amplification reaction. The wire 12 passes through several separate reaction vessels 28 in the form of sample liquid chambers (also referred to as "wells") in a sample plate 34, which is located between a two-part temperature control block 36 that serves as an external heating device. The wire 12 thus forms its own heating device or one or more heating elements in each of the reaction vessels 28.The temperature control block 36 serves to bring and maintain the reaction volumes in the reaction vessels 28 at the hybridization / elongation temperature. For example, the temperature control block 36 can be configured as a heating block and / or a cooling block. To bring the heating elements 10 into contact with and / or separate them from the sample liquid and / or the reaction solution, the sample liquid 26 or the reaction solution can be added to or drawn from the reaction vessels 28.

[0136] In the embodiment shown here, an excitation light source (in this case, a light-emitting diode 38 with an optical low-pass filter) for exciting a dye in the respective reaction volume is located in the lower part of the temperature control block 36 below each reaction vessel 28. In the upper part of the temperature control block 36, a photodiode 40 is located above each sample liquid chamber as a light sensor for detecting the fluorescence of the excited dye in the respective reaction volume (with an optical high-pass filter that transmits the fluorescence light). These can be used, for example, to detect the amplified nucleic acid 22 using suitable dyes, such as intercalating dyes and / or TaqMan probes. The signals from the light sensors can be read out, for example, with an analog-to-digital converter, allowing the temporal evolution of the fluorescence signal to be observed.In particular, the fluorescence light can preferably be recorded in real time during the PCR process as a function of the PCR cycles, in order to enable real-time PCR.

[0137] Furthermore, the device 24 includes a movement device 100, which is configured to move the heating element relative to the sample liquid or relative to the reaction solution. This is achieved by appropriately energizing the heating element 10, preferably in conjunction with an optional external magnetic field (not shown) and / or with the magnetic field generated by other energized heating elements. The appropriate energizing causes the current flow through the heating element to generate a magnetic field, which interacts with the external magnetic field and results in movement of the heating element relative to the sample liquid or relative to the reaction solution.

[0138] Figur 2BFigure 24 schematically and in a simplified form shows the cross-section of a device 24 for extracting a nucleic acid 22 according to a further preferred embodiment, which differs from the embodiment of the Figur 2AThis differs in that the heating elements 10 are designed as coils made from sections of a wire 12 connected to a voltage source 20. The heating elements 10, in the form of wire 12 wound into coils, are in contact with the reaction volume in the respective reaction vessel 28. Unlike the figure shown, they are preferably completely surrounded by the reaction solution or the sample liquid. In this embodiment, the reaction vessels 28 are designed as several separate sample liquid chambers in the form of reaction tubes, which are located in a temperature control block 36 to bring and maintain the reaction volumes at the hybridization / elongation temperature.In the embodiment shown here, a light-emitting diode 38 is located in the lower part of the temperature control block 36 below each sample liquid chamber as an excitation light source for exciting a dye in the reaction volume, and a photodiode 40 is located above each sample liquid chamber as a light sensor for detecting the fluorescence of the excited dye in the reaction volume.

[0139] Furthermore, the device 24 has a movement device 200. This is designed to act upon the sample liquid or reaction solution located in the reaction vessels 28 with sound waves and / or ultrasound waves and in this way to move it relative to the heating elements 10.

[0140] Figur 2CFigure 1 schematically shows components from which a sample plate of a device 24 for extracting and / or multiplying a nucleic acid 22 according to a preferred embodiment with wire heating elements 10 can be created. The heating elements 10 are sections of a gold-plated sheathed wire 12 with a diameter of 25 µm (24.8 µm tungsten core with an approximately 100 nm gold sheath, LUMA-METALL AB, Kalmar, Sweden). This wire is wound around an acrylic glass plate 42 with a thickness of 0.5 mm (center plate, shown in lighter shades). The acrylic glass plate 42 has seven openings (6 mm x 6 mm) through which the reaction vessels 28 or sample liquid chambers (wells) are formed.The winding of the wire 12 creates two parallel layers of 25 parallel heating elements 10 each in each reaction vessel 28 (these are only visible when the device is assembled). (A different number of heating elements, typically between 10 and 75 per layer, can also be advantageous.) The two layers of heating elements 10 are spaced 0.7 mm apart by the plate, and the heating elements 10 within a layer are spaced approximately 0.24 mm apart. Using double-sided adhesive films 44 (shown in dark, 100-250 µm thick VHB adhesive tape from 3M) with corresponding cutouts for the sample liquid chambers, two further acrylic glass plates 46 (thickness of the lower plate 0.5 mm and thickness of the upper plate 3 mm) with identical openings are adhered to the wrapped plate 42 from both sides and pressed together according to the manufacturer's instructions for the adhesive tape 44. From below, the wells or reaction vessels are, for example,The sample plate 46 is sealed with a thin film 48 (shown in light, Adhesive PCR Foil Seal, 4titute), which is adhered to the lower acrylic glass plate 46. This creates a sample plate with seven wells, through which parallel wires 12 act as heating elements 10. The wires 12 are connected to each other at the two outer ends of the sample plate (i.e., all wires / heating elements are connected in parallel) and electrically contacted. This allows current pulses to be sent serially through the heating elements in all wells or reaction vessels 28. The openings of the sample plate (shown here at the top) can then be sealed with a thin film 50 (shown in light). According to this preferred embodiment, the sample plates have a width of 20 mm and a length of 90 mm (so that the voltage of the heating pulses is essentially applied over a length of approximately 90 mm).(96 mm drop, taking into account the 3 mm overhang of the wires 12 at the ends of the sample plate, which is required for contacting). Typically, this results in a total electrical resistance of approximately 250 milliohms over the length of the sample plate (with 50 wires connected in parallel).

[0141] 2D Figure schematically shows a device 24 for extracting a nucleic acid according to a further preferred embodiment, which in many aspects of the device 24 consists of Figur 2B This corresponds to the device. However, there is a difference in that the device 24 according to 2D FigureThe device comprises a motion unit 300, which is designed as a vibration device. The motion unit 300 is mounted laterally on the temperature control block 36 and, according to the illustrated embodiment, includes two vibration elements, such as piezoelectric actuators, which are arranged in direct mechanical contact with the temperature control block 36. The motion unit 300 is configured to excite the temperature control block 36 and, via it, the reaction vessels 28, to oscillations and / or vibrations such that the sample liquid 500 or reaction solution 400 arranged in the reaction vessels 28 and / or the heating elements 10 arranged in the reaction vessels 28 are excited to oscillate and / or vibrate. The motion unit 300 may preferably include further elements, which, for example, can serve to supply energy to and / or control and / or regulate the vibration elements.

[0142] According to other preferred embodiments, the motion device or the vibration device or the vibration elements can, for example, be located below the temperature control block 36 and / or on top of the temperature control block 36 and / or on the reaction vessels 28. According to another embodiment, the motion device 300 can have only one vibration element or a separate vibration element for each reaction vessel 28.

[0143] Fig. 3A Figure 1 shows a schematic representation of a preferred embodiment of the invention. According to this embodiment, a sample plate, as shown in Figure 2, is used. Figur 2C shown, used, which includes several reaction vessels 28, used.

[0144] The sample plate is designed in such a way as, for example, in Figur 2CAs illustrated and explained, the sample plate is pivotable by means of a movement device (not shown), particularly during the incubation period (together with the heating block), by an angle of preferably + / -10°, more preferably + / -20°, more preferably + / -30°, more preferably + / -40°, more preferably + / -50°, more preferably + / -60°, more preferably + / -70°, more preferably + / -80°, more preferably + / -90°, and more preferably more than + / -90°, at a frequency of preferably 1 time per minute, more preferably 3 times per minute, more preferably 10 times per minute, more preferably 20 times per minute, more preferably 30 times per minute, more preferably 60 times per minute, about preferably one axis of symmetry of the sample plate, more preferably two axes of symmetry of the sample plate, and more preferably three axes of symmetry of the sample plate.so that the reaction solution sloshes back and forth in the reaction chambers, thereby inducing relative motion between heating elements (preferably wires) and the reaction solution / sample liquid. This makes it possible to achieve positive real-time PCR curves in the subsequent amplification reaction according to DE 10 2016 120 124.3 at low concentrations (e.g., less than preferably 1000, or preferably 10, or preferably 10, or preferably 5 copies) of the nucleic acid to be amplified, even at higher percentages. According to the invention, this is attributed to the fact that more binding / capture / hybridization events of nucleic acids to the functionalized heating elements are caused by the externally induced relative motion between the heating elements and the reaction or sample liquid.

[0145] In the lower area of ​​the Figur 3AAn enlarged, schematic representation of the heating elements 10, which pass through the reaction vessels 28 and are connected to functional nucleic acids 14 and target nucleic acids 22, is shown.

[0146] In Figur 3B The tilting motion caused by the moving device is carried out in accordance with the Figur 3AThe preferred embodiment shown during hybridization according to one exemplary embodiment is explained in more detail below, without being limited to it. The sample plate, whose reaction chambers 28 are filled with the reaction solution 400 or with the sample liquid 500, is placed in the device 24 and heated from below at 56 °C and from above at 63 °C by a heating block. The entire device containing the sample plate is then moved for five minutes as follows: At a frequency of 20 times per minute, the entire device is tilted by an angle of 100° from +90° along the longitudinal axis 2000 of the sample plate and returned to its initial position. From the initial position, it is then tilted by an angle of 100° from -90° along the longitudinal axis 2000 of the sample plate and subsequently returned to its initial position.After the entire apparatus has been moved in this manner for five minutes, the sample plate is removed from the apparatus 24 and the sample plate is moved at room temperature for a further two minutes at a frequency of 20 times per minute as described above.

[0147] The lower sketch shows the movement of the reaction solution during a +90° tilting motion (without returning to the starting position).

[0148] In the lower area of ​​the Figur 3B Furthermore, a reaction vessel or chamber 28, including the heating elements 10 and the reaction solution, is shown in three different tilting positions a, b, and c. Due to the tilting movement of the sample plate, the reaction solution 400 or sample liquid 500 sloshes back and forth in the reaction chamber 28, thereby causing a relative movement between the heating elements 10 and the reaction solution 400 or sample liquid 500.

[0149] The following are examples of experiments carried out with preferred embodiments of the invention, without, however, limiting the invention to these examples.

[0150] In particular, the experiments shown below demonstrate that a relative movement of the liquid, i.e. the sample liquid or the reaction solution, and the heating elements causes an increase in the binding efficiency of the target nucleic acid to the functional nucleic acids on the heating elements. Experiment 1 - Relative motion using ultrasound

[0151] In this experiment, the relative motion between the liquid (i.e., the sample liquid and / or the reaction solution) and the heating elements is generated by applying ultrasound to the liquid, and the target nucleic acids bound to the functional nucleic acids are determined. This is then compared with a control measurement in which no ultrasound was applied, but otherwise an identical measurement was performed.

[0152] The reaction vessels are provided as reaction plates with multiple reaction chambers and, as described in patent application DE 10 2016 120 124 A1, are equipped with wires as local heating elements. In the present experiment, there are 20 gold-coated wires, each 6 mm long, per reaction chamber or reaction vessel. The heating elements used here are wires with a core diameter of 14.6 µm made of tungsten and coated with 200 nm gold (LUMA METALL, Sweden). They are spaced 0.076 mm apart. The heating elements extend approximately 0.7 mm above the bottom of the reaction vessel, which has a base area of ​​6 mm x 6 mm. When filled with 60 µl of sample liquid, the vessel is filled to a height of approximately 1.7 mm (above the bottom). The heating elements run continuously through several adjacent sample chambers or reaction vessels.The reaction vessels have a total length of 10cm in the entire sample carrier (but only 6mm per sample chamber or reaction vessel).

[0153] The functionalization of the functional nucleic acids onto the gold-coated wires (heating elements) was carried out as described in DE 10 2016 120 124 A1. Briefly, the functionalization solution contains 100 nM functional nucleic acid and 100 mM MgCl₂ in phosphate buffer. 50 µl of this solution was used in each reaction vessel and incubated overnight at 4°C. This functionalization solution was removed from the reaction vessels the following day, and the vessels were then washed three times with sufficient water. Afterward, the free surface of the heating elements was saturated with 3% plasma solution for 10 minutes at room temperature to prevent non-specific binding of the target nucleic acid to the gold surface of the heating elements. The excess plasma solution was washed out three times with sufficient water.

[0154] For the hybridization of the target nucleic acid to the functional nucleic acid, the target nucleic acid (extracted genomic DNA from MRSA (methicillin-resistant Staphylococcus aureus)) was mixed with hybridization buffer (commercially available AL buffer from QUIAGEN, final concentration 25%). 60 µl of the hybridization buffer with the target nucleic acid was pipetted into the reaction vessels and tightly sealed with a pressure-sensitive film (5000 copies of genomic DNA per reaction vessel) so that all heating elements inside the reaction vessels were (completely) in contact with the solution.

[0155] The reaction vessels were then submerged to the bottom of an ultrasonic bath (type UMD030, manufacturer EUMAX, 260W total power) and sonicated for 10 minutes at 25°C, creating relative motion between the liquid in the reaction vessels and the heating elements. The reaction vessels were then removed from the ultrasonic bath, and the solution consisting of hybridization buffer and unbound target was quickly pipetted out or withdrawn after removing the foil. The reaction vessels were then washed three times with wash buffer (based on 9 mM MgCl₂ and 10 mM Tris, pH: 8) at room temperature.

[0156] Subsequently, all heating elements were cut out of the reaction vessels and transferred to a PCR tube using tweezers. These heating elements were then covered with sufficient PCR master mix. The PCR master mix contained specific primers and probes for the target nucleic acid, a DNA polymerase, dNTPs, and the usual components of a classic real-time PCR mix. The subsequent qPCR was performed in a LightCycer instrument (ROCHE) to determine the amount of target nucleic acid that had previously bound to the functional nucleic acid and the heating elements.

[0157] As a reference or comparative measurement, another reaction plate and / or reaction vessels were used, which were otherwise treated identically to the previous measurement, except that instead of 10 minutes in an ultrasonic bath, they were incubated for only 10 minutes at room temperature without movement, thus without any induced relative motion between the liquid and the heating elements. In these reaction vessels, it was found that only approximately 2% of the 5000 copies of genomic DNA per reaction vessel (target nucleic acid) bound to the functional nucleic acids on the heating elements, whereas in the reaction vessels treated in an ultrasonic bath to induce relative motion, approximately 19% of the 5000 copies of genomic DNA per reaction vessel (target nucleic acid) bound to the functional nucleic acid on the heating elements.

[0158] The results are shown graphically in the bar chart. Figure 4The graph shows the percentage of the target nucleic acid bound to the functional nucleic acids on the y-axis. The left bar represents the results of the comparison measurement without ultrasound and shows a percentage of approximately 2% bound target nucleic acids. The right bar shows the result of the measurement in which relative movement was induced by ultrasound. Here, the percentage is significantly higher at approximately 19% than in the comparison measurement.

[0159] It was thus demonstrated that the extraction efficiency could be increased by approximately a factor of 10. Accordingly, it can be expected that the sensitivity of such a device and / or method for the extraction and / or amplification and / or detection of a target nucleic acid can also be improved by at least a factor of 10, compared to conventional designs without relative motion. Experiment 2 - Relative motion using oscillating heating elements

[0160] In this experiment, similar preparations were made as described above in relation to Experiment 1. However, unlike Experiment 1, the number of heating elements (wires) per reaction chamber was increased from 20 to 75, while the spacing remained unchanged. The functionalization solution contained 500 nM functional nucleic acid and 500 mM MgCl₂ in phosphate buffer. 50 µl of this solution was used per reaction vessel and incubated for only 10 minutes at room temperature. Furthermore, only 500 copies of genomic DNA were used per reaction vessel instead of 5000.

[0161] An alternating voltage (rectangular shape, 2 V peak-to-peak, offset 1 V, duty cycle 50%, frequency 4.5 kHz) was applied for three minutes to the ends of the wires or heating elements that passed through the sample holder and thus through the reaction vessels. The voltage was applied over the entire 10 cm length of the heating elements or wires. The reaction plate and the reaction vessels themselves were kept at room temperature. Neodymium-iron-boron (NdFeB, N42) permanent magnets (approximately 5 mm in diameter and 8 mm high) were positioned above and below each reaction vessel. The distance between the magnet above the reaction chamber and the corresponding magnet below was approximately 5 mm. While the pulsating DC voltage was applied, an audible hum was heard, which is considered an indication of vibration of the wires or heating elements in the reaction vessels and thus of movement of the heating elements.The humming was particularly amplified by the external permanent magnets, as it became quieter when the magnets were removed for testing purposes. As current flows through the heating elements, magnetic fields are generated around the heating elements or wires. These fields cause a repulsion between the heating elements or wires (especially for the wires located at the edge, which therefore have few or no adjacent wires), as well as an interaction with the external magnetic field according to the Lorentz force, which acts on current-carrying conductors in a magnetic field. Different orientations of the magnetic field can preferentially induce movement of the current-carrying wires along different directions. Subsequently, after removing the foil, the solution of hybridization buffer and unbound target nucleic acid was pipetted from the reaction chambers.The reaction chambers were then washed three times with wash buffer (based on 9mM MgCl2 and 10mM Tris pH: 8) at room temperature.

[0162] Subsequently, all heating elements were cut out of each reaction vessel and transferred with tweezers into a PCR tube for quantification of the DNA on the heating elements using a conventional qPCR thermocycler (Roche LightCycler). These heating elements were then covered with sufficient PCR master mix in the PCR tubes. The PCR master mix contains the target-specific primers and sample nucleic acids, a DNA polymerase, dNTPs, and the usual components of a classic real-time PCR mix. The subsequent qPCR was performed in a LightCycler instrument (Roche) to determine the amount of target nucleic acid that had previously bound to the functional nucleic acid.

[0163] As a reference or comparative measurement, another reaction plate and / or reaction vessels were used, which were treated identically to the previous measurement. However, instead of three minutes with voltage applied to induce vibration, they were incubated for only three minutes without movement or vibration at room temperature. In this reaction plate, only approximately 3% of the 500 copies of genomic DNA (target nucleic acid) per reaction chamber bound to the functional nucleic acid on the wires. In contrast, in the reaction plate with the reaction vessels whose heating elements were subjected to pulsed DC voltage to induce vibration, approximately 25% of the 500 copies of genomic DNA (target nucleic acid) per reaction vessel bound to the functional nucleic acid on the heating elements.

[0164] The results are shown graphically in the bar chart. Figure 5The graph shows the percentage of target nucleic acid bound to functional nucleic acids on the y-axis. The left bar represents the results of the comparative measurement without excitation of the heating elements using electrical voltage, showing a bound target nucleic acid content of approximately 3%. The right bar shows the result of the measurement in which the heating elements were excited to vibrate using pulsating DC voltage, thereby inducing relative motion between the heating elements and the liquid. Here, the bound target nucleic acid content is significantly higher at approximately 25% than in the comparative measurement.

[0165] It was thus demonstrated that the extraction efficiency could be increased by more than a factor of 8. Accordingly, it can be expected that the sensitivity of such a device and / or method for the extraction and / or amplification and / or detection of a target nucleic acid can also be improved by at least a factor of 8, compared to conventional designs without relative motion.

[0166] In both experiments, a functional nucleic acid with a sequence specific to MRSA at the 3' end was used (the functions of the other elements can be found in publication DE 10 2016 120 124 A1: 5'Thiol - AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA [Seq. ID 1] / iSp9 / AAATGATTATGGCTCAGGTACTGC [Seq. ID 2]

[0167] A primer / probe set, also specific for MRSA, was used as the primer for the qPCR in the LightCycler: Forward primer: AAATGATTATGGCTCAGGTACTGC [Seq. ID 3] Reverse primer: TGAAGATGTGCTTACAAGTGCTA [Seq. ID 4] Taqman probe: 5'FAM-TCCACCCTCAAACAGGTGAATTAT [Seq. ID 5]-3'BHQ1 iSp9 corresponds to the abasic modification Spacer9. 5'FAM corresponds to Fluorescein Amidites. 3'BHQ1 corresponds to Black Hole Quencher-1 Reference sign

[0168] 10 Heating element 12 Heating wire 14 Functional nucleic acid 16 Power supply 18 Switch 20 Voltage source 22 Target nucleic acid 24 Device for extracting / amplifying a nucleic acid 28 Reaction vessel 34 Sample plate 36 Temperature block 38 Light-emitting diode 40 Photodiode 42 Acrylic glass plate 44 Adhesive tape 46 Acrylic glass plate 48 Thin film 50 Thin film 100 motion device 200 motion device 300 motion device 400 reaction solution 500 sample liquid 1000 (swivel) angle 2000 Longitudinal axis of the sample plate

Claims

1. Method for extracting a target nucleic acid (22) from a sample fluid (500), comprising the steps of: - providing a heating device having a heating element (10) in contact with the sample liquid (500), wherein the heating element (10) is conjugated with at least one functional nucleic acid (14) and wherein the at least one functional nucleic acid (14) is designed to hybridize with the target nucleic acid (22) and to bind the target nucleic acid (22) to the heating element (10); - generating a relative movement between the heating element (10) and the sample liquid (500); - extracting the target nucleic acid (22) from the sample liquid (500) by separating the heating element (10) from the sample liquid (500).

2. Method for reproducing a target nucleic acid (22), comprising the steps of: - extracting the target nucleic acid (22) from a sample liquid (500) by providing a heating device having a heating element (10) in contact with the sample liquid (500), wherein the heating element (10) is conjugated with at least one functional nucleic acid (14) and wherein the at least one functional nucleic acid (14) is designed to hybridize with the target nucleic acid (22) and to bind the target nucleic acid (22) to the heating element (10); - reproducing the target nucleic acid (22) extracted from the sample liquid (500) by means of a polymerase chain reaction in a reaction solution (400) using the heating device; wherein extracting the target nucleic acid (22) further comprises generating a relative movement between the heating element (10) and the sample liquid (500) and separating the heating element (10) from the sample liquid (500).

3. Method according to claim 2, wherein reproducing the target nucleic acid (22) further comprises generating a relative movement between the heating element (10) and the reaction solution (400).

4. Method according to any of the preceding claims, wherein the relative movement between the heating element (10) and the sample liquid (500) is generated when the heating element (10) is in contact with the sample liquid (500), and / or wherein the relative movement between the heating element (10) and the reaction solution (400) is generated at least partially during a denaturation step of the polymerase chain reaction.

5. Method according to any of the preceding claims, wherein at least during the generation of the relative movement between the heating element (10) and the sample liquid (500) and / or during the generation of the relative movement between the heating element (10) and the reaction solution (400), a temperature suitable for the hybridization of the target nucleic acid (22) with the functional nucleic acid (14) is at least temporarily provided at least at the location of the functional nucleic acid (14), and wherein the temperature is at least 20°C, preferably at least 30°C, more preferably at least 40°C, much more preferably at least 50°C and most preferably at least 60°C, and / or the temperature is no more than 90°C, preferably no more than 80°C, most preferably no more than 70°C, and wherein heat for providing the temperature is optionally at least partially provided by means of the heating element (10).

6. Method according to any of the preceding claims, wherein the functional nucleic acid (14) is designed as an extraction nucleic acid and / or has a capture nucleotide sequence which is at least partially complementary to the nucleotide sequence of the target nucleic acid (22) and is suitable for binding to the target nucleic acid (22).

7. Method according to any of the preceding claims, wherein the functional nucleic acid (14) has a nucleotide sequence which can be used as a primer sequence for the reproduction of the target nucleic acid (22).

8. Method according to any of the preceding claims, wherein the relative movement between the heating element (10) and the sample liquid (500) and / or the reaction solution (400) is at least partially carried out by moving the heating element (10).

9. Method according to claim 8, wherein the movement of the heating element (10) comprises oscillating and / or vibrating the heating element (10), and wherein the oscillating and / or vibrating of the heating element (10) is optionally caused by means of a magnetic field, wherein the magnetic field is preferably generated by an electric current flow in the heating element (10) and / or by an external magnetic field.

10. Method according to claim 9, wherein the oscillation and / or vibration of the heating element (10) is caused at least partially by a force applied by a mechanical actuator and / or by sound waves and / or ultrasonic waves.

11. Method according to any of the preceding claims, wherein the one or more heating elements (10) are designed as electrical and in particular as resistive heating elements (10) and are preferably designed as heating wire (12) or heating wires (12), and wherein the heating device optionally has a plurality of heating elements (10).

12. Method according to any of the preceding claims, wherein the heating element (10) is conjugated with a plurality of functional nucleic acids (14), wherein the functional nucleic acids (14) of the heating element (10) are of the same type or at least partially of different types.

13. Method according to claim 11, wherein each of the heating elements (10) is conjugated with a plurality of functional nucleic acids (14) of the same type, and the different heating elements (10) are preferably conjugated with functional nucleic acids (14) that are at least partially different from the functional nucleic acids (14) of the other heating elements (10).

14. Apparatus (24) for extracting and / or reproducing a target nucleic acid (22), the apparatus comprising: - a heating device having a heating element (10), wherein the heating element (10) can be brought into contact with a sample liquid (500) and / or with a reaction solution (400) and is conjugated with at least one functional nucleic acid (14), wherein the at least one functional nucleic acid (14) is designed to hybridize with the target nucleic acid (22) and to bind the target nucleic acid (22) to the heating element; and - a movement device (100, 200, 300) which is designed to generate a relative movement between the at least one heating element (10) and the reaction solution (400) and / or the sample liquid (500) when the heating element (10) is in contact with the reaction solution (400) or the sample liquid (500); wherein the apparatus (24) is designed to separate the heating element (10) from the sample liquid (500) and, as a result, extract the target nucleic acid (22) from the sample liquid (500).

15. Apparatus (24) according to claim 14, wherein the heating element (10) is designed as an electrical, and in particular as a resistive, heating element and is preferably designed as a heating wire (12), and wherein the heating device preferably has a control unit, by means of which the one heating element (10) or the plurality of heating elements (10) can be heated.

16. Apparatus (24) according to either claim 14 or claim 15, wherein the movement device (100, 200, 300) is designed to move the at least one heating element (10) relative to the sample liquid (500) and / or to the reaction solution (400), and wherein the movement device (100, 200, 300) preferably has at least one mechanical actuator for moving the at least one heating element (10) and / or a control unit for generating electrical current pulses and / or voltage pulses for energizing the at least one heating element (10).

17. Apparatus (24) according to any of claims 14 to 16, wherein the movement device (100, 200, 300) is designed to at least partially move the sample liquid (500) and / or the reaction solution (400), and wherein the movement device (100, 200, 300) preferably has at least one pump and / or a sound wave generator and / or an ultrasonic wave generator and / or an externally drivable actuator and / or a driver for an externally drivable actuator, in order to at least partially move the sample liquid (500) and / or the reaction solution (400).

18. Apparatus (24) according to any of claims 14 to 17, wherein the movement device (100, 200, 300) is designed to at least partially move a reaction vessel (28) in which the sample liquid (500) and / or the reaction solution (400) can be arranged, and wherein the movement device (100, 200, 300) preferably has at least one actuator for shaking and / or centrifuging and / or rotating and / or pivoting and / or vortexing and / or tilting the reaction vessel (28).