Methods and compositions for producing stem cell-derived dopaminergic cells for use in the treatment of neurodegenerative diseases
Patent Information
- Application Number
- DE602016092650
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2016-02-25
- Filing Date
- 2016-04-08
- Publication Date
- 2025-06-25
- Estimated Expiration
- 2036-04-08
AI Technical Summary
Current methods for producing dopaminergic cells from human pluripotent stem cells face challenges in achieving standardized, GMP-grade production with reliable markers for predicting maturation and functionality, leading to variable outcomes in grafts for neurodegenerative diseases like Parkinson's disease.
A method involving culturing pluripotent stem cells on laminin-111 substrates with specific cell culture mediums and patterning factors, followed by identification and isolation of dopaminergic progenitors using markers like OTX2, FOXA2, and LMX1A/B, and excluding markers such as EPHA3 and FEZF1, to achieve caudalized dopaminergic progenitors with high graft success.
This approach enhances the production of dopaminergic cells with predictable functionality, reducing the need for lengthy in vivo studies and ensuring consistent therapeutic efficacy in treating neurodegenerative diseases.
Description
TECHNICAL FIELD
[0001] The present invention relates to a method of producing caudalised ventral mesencephalon progenitor cells.BACKGROUND
[0002] This application incorporates by reference the material in the ASCII text file named "Seq_List_LCTI_200040USP3_ST25.txt", which was created on February 10, 2016, and has a file size of 8,781 bytes.
[0003] The present disclosure relates to methods for producing certain desired dopaminergic cells from human pluripotent stem cells (hESCs) and for predicting their phenotypic maturation after transplantation to the brain based on molecular markers. These dopaminergic cells can then be used in stem cell based therapies such as for treating neurodegenerative diseases including Parkinson's disease. Also disclosed are kits for practicing the methods. Very generally, the stem cells are cultured on a substrate of laminin-111 (or other recombinantly produced laminins) and exposed to a variety of cell culture mediums to produce the dopaminergic cells with much higher efficiency than previously attained.
[0004] Laminins are a family of heterotrimeric glycoproteins that reside primarily in the basal lamina. They function via binding interactions with neighboring cell receptors on the one side and by binding to other laminin molecules or other matrix proteins such as collagens, nidogens or proteoglycans. The laminin molecules are also important signaling molecules that can strongly influence cellular behavior and function. Laminins are important in both maintaining cell / tissue phenotype, as well as in promoting cell growth and differentiation in tissue repair and development.
[0005] Laminins are large, multi-domain proteins, with a common structural organization. A laminin protein molecule comprises one α-chain subunit, one β-chain subunit, and one γ-chain subunit, all joined together in a trimer through a coiled-coil domain. The twelve known laminin subunit chains can form at least 15 trimeric laminin types in native tissues. Within the trimeric laminin structures are identifiable domains that possess binding activity towards other laminin and basal lamina molecules, and membrane-bound receptors. FIG. 1 shows the three laminin chain subunits separately. For example, domains VI, IVb, and IVa form globular structures, and domains V, Illb, and IIIa (which contain cysteine-rich EGF-like elements) form rod-like structures. Domains I and II of the three chains participate in the formation of a triple-stranded coiled-coil structure (the long arm).
[0006] There exist five different alpha chains, three beta chains and three gamma chains that in human tissues have been found in at least fifteen different combinations. These molecules are termed laminin-1 to laminin-15 based on their historical discovery, but an alternative nomenclature describes the isoforms based on their chain composition, e.g. laminin-111 (laminin-1) that contains alpha-1, beta-1 and gamma-1 chains. Four structurally defined family groups of laminins have been identified. The first group of five identified laminin molecules all share the β1 and γ1 chains, and vary by their α-chain composition (α1 to α5 chain). The second group of five identified laminin molecules, including laminin-521, all share the β2 and γ1 chain, and again vary by their α-chain composition. The third group of identified laminin molecules has one identified member, laminin-332, with a chain composition of α3β3γ2. The fourth group of identified laminin molecules has one identified member, laminin-213, with the newly identified γ3 chain (α2β1γ3).
[0007] Human embryonic stem (hES) cells hold promise for the development of regenerative medicine for a variety of diseases, such as spinal cord and cardiac injuries, type I diabetes and neurodegenerative disorders like Parkinson's Disease. A stem cell is an undifferentiated cell from which specialized cells are subsequently derived. Embryonic stem cells possess extensive self-renewal capacity and pluripotency with the potential to differentiate into cells of all three germ layers. They are useful for therapeutic purposes and may provide unlimited sources of cells for tissue replacement therapies, drug screening, functional genomics and proteomics.
[0008] Stem cell based therapies and treatments for neurodegenerative diseases are expected to reach clinical trials soon. However, a major hurdle remains in generating standardized good manufacturing practices (GMP)-grade human pluripotent stem (hPS) cell-based progenitors that upon transplantation will mature and function in the adult brain. As cells are transplanted as immature progenitors and full maturation into functionally integrated neurons requires 6 months or longer in vivo, transplanted cells cannot be assessed for functionality prior to transplantation, and there is a lack of markers that reliably predict yield and maturation of the immature progenitors.
[0009] As a surrogate for markers predicting functional properties, the field has relied upon assessing transplanted progenitors by expression of genes and proteins developmentally linked to the generation of certain neuronal subtypes. Since it is uncertain if these markers are predictive of terminal differentiation and functional maturation, the progenitors must therefore be taken through lengthy in vivo functional assessment in order to control for batch-to-batch variation and therapeutic efficacy. This can pose a significant hurdle for the generation of cells for larger cohorts of patients and for launching a standardized stem cell product to the clinic.
[0010] To reduce the in vivo studies needed to be performed during the cell developmental process, it will thus be necessary to identify a validated set of markers that can predict the in vivo performance of the stem cell product prior to transplantation. Being able to predict an in vivo graft outcome at the progenitor stage may also lead to the production of standardized cell products from variable input sources, such as from patient-derived cells or hPS cell banks with HLA-haplotyped donors.
[0011] Parkinson's disease is a particularly interesting target for stem cell based therapies due to the relatively focal degeneration of a specific type of mesencephalic dopamine (mesDA) neuron. Proof-of-concept that cell replacement therapy for Parkinson's disease can be successful has been obtained in a number of clinical trials using fetal cells.
[0012] Recent developments have resulted in a better understanding of the developmental and cellular ontogeny of mesDA neurons from the floor plate of the ventral mesencephalon, and this knowledge has materialized into research grade differentiation protocols that result in the formation of ventral mesencephalon progenitors from hPS cells. In contrast to older protocols, these dopaminergic neurons of ventral mesencephalon origin have been shown to survive, mature, and acquire appropriate functional properties in animal models of Parkinson's disease. Moreover, grafts generated from these protocols do not result in cell overgrowths or tumor formation, thus making them suitable candidate cells for stem cell replacement therapies.
[0013] Kirkeby et al, "Generating regionalized neuronal cells from pluripotency, a step-by-step protocol", Vol. 6, DOI: 10.3389 / fncel.2012.00064, 03 January 2013 (2013-01-03), page 1-4, XP002763176 relates to a method for neural differentiation of human pluripotent stem cells involving dual SMAD inhibition.
[0014] In a further publication, Agnete Kirkeby et al, "Generation of Regionally Specified Neural Progenitors and Functional Neurons from Human Embryonic Stem Cells under Defined Conditions", CELL REPORTS, Vol. 1, No. 6, 01 June 2012 (2012-06-01), page 703-714, XP055201858 a similar method for obtaining neural progenitors is described, including obtaining dopaminergic cells for the treatment of Parkinson's disease.
[0015] Daisuke Doi et al, "Isolation of Human Induced Pluripotent Stem Cell-Derived Dopaminergic Progenitors by Cell Sorting for Successful Transplantation", STEM CELL REPORTS, Vol. 2, No. 3, 01 March 2014 (2014-03-01), page 337-350, XP055155184 describes isolation of human induced pluripotent stem cell-derived dopaminergic progenitors by Corin-based cell sorting for transplantation.
[0016] WO 2008120218 relates to a method for inducing neural differentiation by culturing pluripotent stem cells.
[0017] WO 2015034012 describes a kit for producing a dopamine production neural precursor from a pluripotent stem cell.
[0018] WO 2011156331 relates to embryonic stem cells differentiated into dopaminergic cells.
[0019] In current ventral mesencephalon differentiation protocols, mesencephalic floor plate markers LMX1A, FOXA2, OTX2, and CORIN are commonly used to confirm the mesDA identity of progenitors in vitro prior to grafting, but a new study has revealed that these and several other commonly used ventral mesencephalon markers are also co-expressed in diencephalic progenitors of the subthalamic nucleus. Thus, they appear to be suboptimal markers in protocols for the generation of enriched mesDA neurons, as they are clearly not specific to the mesDA domain.
[0020] For the purposes of regenerative medicine and for modeling human neural cells, there is a desire to develop methods that allow derivation and culturing of pluripotent stem cells under chemically defined, xeno-free, pathogen-free, and for reproducible differentiation of these cells into neural cells with regenerative capacity. Desirably, such methods should provide large quantities of such differentiated cells. Further, it would be desirable to develop methods for predicting successful graft outcomes of transplanted progenitors in an animal model.BRIEF DESCRIPTION
[0021] The invention is set out in the appended set of claims.
[0022] The present disclosure provides methods for producing certain stem cell derived desired dopaminergic cells as well as methods for evaluating their functionality after transplantation. These dopaminergic cells can then be used in stem cell based therapies such as for treating neurodegenerative diseases including Parkinson's disease. In further aspects, the present disclosure provides a kit for producing dopaminergic cells from embryonic stem cells.
[0023] The present disclosure also provides methods for culturing certain desired stem cells in monolayer cultures which facilitates cellular homogeneity, removal of the stem cells from a cell culture plate or other cellular support in single cell suspension, and replating stem cells in single cell suspension for passaging and expansion in significant dilutions that enable expansion of stem cell cultures and large scale production of such cells.
[0024] In some aspects, the disclosure describes the plating of pluripotent stem cells on a substrate of Laminin-111 or Laminin-121, and culturing the cells using several different cell culture mediums to obtain dopaminergic cells, particularly caudalized dopaminergic progenitor cells. The cells may be passaged with EDTA prior to plating.
[0025] In various embodiments, as many as six different cell culture mediums can be used. In others, only three or four different mediums need to be used.
[0026] The stem cells can be cultured in a primary medium comprising N2 medium (N2M), a TGF-β inhibitor, noggin, sonic hedgehog protein, and a GSK3 inhibitor. A ROCK inhibitor may be added to the medium for the first 24-72 hours
[0027] The primary medium may then be removed and a secondary medium is added, the secondary medium comprising N2 medium and a fibroblast growth factor (FGF). The FGF can be FGF8b. The secondary medium may be added about 156 hours to about 228 hours after the plating.
[0028] The secondary medium can then be removed and the stem cells replated. The replating can occur about 252 hours to about 276 hours after the plating.
[0029] The replating can occur using a tertiary medium that comprises a B27 medium, a ROCK inhibitor, the FGF, a brain derived neurotrophic factor (BDNF), and ascorbic acid.
[0030] The stem cells may then be cultured in a quaternary medium, the quaternary medium comprising a B27 medium, the FGF, a brain derived neurotrophic factor (BDNF), and ascorbic acid. The stem cells can be cultured in the quaternary medium until about 372 hours to about 396 hours after the original plating (not the replating). Put another way, the replated stem cells are cultured in the quaternary medium for a time period of about 108 hours to about 132 hours.
[0031] In some other embodiments, the first medium includes a neural induction medium (NIM) or an N2 medium, a ROCK inhibitor, a TGFβ inhibitor, a GSK3 inhibitor, and optionally a sonic hedgehog protein and a noggin protein.
[0032] According to some embodiments, the second medium includes (i) NIM or an N2 medium; a TGF-β inhibitor, and a GSK3 inhibitor, and optionally a sonic hedgehog protein and a noggin protein. The second medium does not contain the ROCK inhibitor of the first medium. The second medium may be added about 36 hours to about 60 hours after plating.
[0033] According to some other embodiments, the third medium comprises a neural proliferation medium (NPM) and a TGF-β inhibitor; and optionally the GSK3 inhibitor and sonic hedgehog protein. The third medium may be added about 84 hours to about 108 hours after the first plating, and can be renewed about 156 hours to about 180 hours after the first plating. The third medium may be removed after about 156 hours to about 228 hours after the first plating.
[0034] In further embodiments, the fourth medium comprises (i) a neural proliferation medium (NPM) or an N2 medium; and (ii) a fibroblast growth factor (FGF). The fourth medium may be added about 156 hours to about 228 hours after the first plating. The fourth medium may be removed after about 36 hours to about 108 hours exposure, i.e. about 252 hours to about 276 hours after the original plating. The cells are then replated on a second plate coated with laminin-111, laminin-121, laminin-521, laminin-421, or laminin-511.
[0035] A fifth medium may be used that comprises a B27 medium; a brain derived neurotrophic factor (BDNF); ascorbic acid (AA); a glial cell line-derived neurotrophic factor (GDNF); and a fibroblast growth factor (FGF). The fifth medium can be renewed about 324 hours to about 348 hours after the original plating. After about 14 days to 16 days, i.e. about 336 hours to about 384 hours, the progenitor cells are obtained. If additional time is desired, a sixth cell culture medium can be used that comprises a B27 medium; a brain derived neurotrophic factor (BDNF); ascorbic acid (AA); a glial cell line-derived neurotrophic factor (GDNF), a cAMP agonist (e.g. dibutyryl-cAMP) and a gamma-secretase inhibitor (DAPT); and does not contain a fibroblast growth factor (FGF).
[0036] Also disclosed herein are methods for providing caudalized dopaminergic progenitor cells with a high probability of successful graft outcome, comprising: plating embryonic stem cells on a first substrate coated with laminin-111, laminin-121, laminin-521, laminin-421, or laminin-511 to produce dopaminergic progenitor cells; identifying dopaminergic progenitor cells that express caudal ventral midbrain markers; and isolating the identified dopaminergic progenitor cells from the other dopaminergic progenitor cells on the substrate to obtain the caudalized dopaminergic progenitor cells with a high probability of successful graft outcome.
[0037] The methods may further comprise grafting the caudalized dopaminergic progenitor cells into a brain of a mammal. The mammal can be a human. This grafting can be performed for the treatment of a neurodegenerative disease, such as Parkinson's disease.
[0038] The step of identifying ventral midbrain progenitors can be defined by co-expression of OTX2, FOXA2 and LMX1A / B. The step of identifying dopaminergic progenitor cells within the ventral midbrain domain can be performed by identifying cells that express high levels of EN1, SPRY1, WNT1, CNPY1, PAX8, ETV5, PAX5, FGF8, SP5, or TLE4. More particularly, the step of identifying dopaminergic cells can be performed by identifying cells that express high levels of EN1, SPRY1, PAX8, CNPY1, and ETV5.
[0039] The step of identifying dopaminergic progenitor cells within ventral midbrain cultures can further include excluding cells that express high levels of EPHA3, FEZF1, WNT7B, BARHL1, BARHL2, FOXG1, SIX3, HOXA2, GBX2, or PAX6 and by identifying cells that express only low to intermediate levels of CORIN and FOXP2.
[0040] The present disclosure also describes a kit for producing dopaminergic cells in vitro. The kit includes: a cell culture plate with a coating of laminin-111, laminin-121, laminin-521, laminin-421, or laminin-511; a cell culture medium; a GSK3 inhibitor; sonic hedgehog protein; a ROCK inhibitor; a TGF-β inhibitor; a fibroblast growth factor (FGF); a brain derived neurotrophic factor (BDNF); and ascorbic acid (AA).
[0041] These and other non-limiting characteristics of the disclosure are more particularly disclosed below.BRIEF DESCRIPTION OF THE DRAWINGS
[0042] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0043] The following is a brief description of the drawings, which are presented for the purposes of illustrating the exemplary embodiments disclosed herein and not for the purposes of limiting the same. FIG. 1 shows the structural motifs of laminin alpha (α), beta (β), and gamma (y) chains. The N-terminal, internal, and C-terminal globular domains are depicted as white ovals. The coiled-coil forming domains (I and II) are shown as white rectangles. The rod-like structures (domains V, Illb, and IIIa) are depicted as grey rectangles. FIG. 2 is a graphic representation of some methods of the present disclosure, identifying specific ingredients and when they are applied to the stem cells to achieve the desired effect. This is a GMP-suitable differentiation protocol. FIG. 3 is another graphic presentation of other methods of the present disclosure, in which alternative cell culture media (NIM and NPM) are used. NDM medium in this figure is equivalent to B27M FIGS. 4A-4G are a set images and graphs illustrating that batches of ventral mesencephalic-patterned hESCs give variable outcomes, which are not correlated with common mesDA markers. Thirty-three (33) groups of rats were subjected to one-sided dopaminergic lesions with 6-OHDA were grafted with 28 different batches of VM-patterned hESCs. All grafts were derived from H9 cells. FIG. 4A is a set of images taken from selected animals after in vivo maturation. The brains were stained for TH (tyrosine hydroxylase) content, revealing varied outcomes of the grafts. FIG. 4B is a quantification of dopaminergic (DA) cell yield in individual animals across 33 batches. The y-axis is the number of TH+ cells per 100,000 cells transplanted, and runs from 0 to 20,000 in intervals of 4,000, then from 30,000 to 50,000 in intervals of 20,000 at the top. FIG. 4C is a quantification of graft volume in individual animals across 33 animal groups based on HuNu+ immunostainings. The y-axis is the graft volume in cubic millimeters per 100,000 cells transplanted, and runs from 0 to 7 in intervals of 1. FIG. 4D is a quantification of DA cell density (i.e. total TH+ cell number per mm 3< graft volume) in grafts from individual animals across 33 groups. The y-axis runs from 0 to 15,000 in intervals of 3,000. For FIGS. 4B-4D, cell content was normalized to 100,000 grafted cells, and horizontal bars indicate means for each batch. FIG. 4E is a schematic summary of the study of Example 6. FIG. 4F is a graphic representation of gene expression of FOXA2, LMX1A and CORIN in the transplanted cell population on day 16 (day of transplantation) plotted versus the mean TH+ cell content (i.e. DA yield) in each graft experiment. For the LMX1A graph, the y-axis runs from 0 to 6,000 in intervals of 2,000, and the x-axis runs from 0 to 10,000 in intervals of 2,500. Spearman correlation: R= 0.15, p= 0.50. For the FOXA2 graph, the y-axis runs from 0 to 1,500 in intervals of 500, and the x-axis runs from 0 to 10,000 in intervals of 2,500. Spearman correlation: R= -0.38, p= 0.08. For the CORIN graph, the y-axis runs from 0 to 15,000 in intervals of 5,000, and the x-axis runs from 0 to 10,000 in intervals of 2,500. Spearman correlation: R= -0.17, p= 0.37. FIG. 4G is a graphic representation of the gene expression of TH, NURR1 and AADC in the transplanted cell population on day 16 (day of transplantation) plotted versus the mean TH+ cell content (i.e. DA yield) in each graft experiment. Results from Spearman correlation analysis (ventral mesencephalic cells only) are given as R and p-values in each graph and tendencies of correlation are shown by linear regression lines. For the TH graph, the y-axis runs from 0 to 8,000 in intervals of 2,000, and the x-axis runs from 0 to 8,000 in intervals of 2,000. Spearman correlation: R= -0.18, p= 0.53. For the NURR1 graph, the y-axis runs from 0 to 4,000 in intervals of 1,000, and the x-axis runs from 0 to 8,000 in intervals of 2,000. Spearman correlation: R= 0.11, p= 0.70. For the AADC graph, the y-axis runs from 0 to 600 in intervals of 200, and the x-axis runs from 0 to 8,000 in intervals of 2,000. Spearman correlation: R= 0.31, p= 0.28. FIGS. 5A-5I are a set of images and graphs indicating that RNA sequencing analysis of transplanted cells reveals positive correlation between graft TH+ content and markers of the midbrain-hindbrain border (MHB). All grafts were derived from H9 cells. FIG. 5A is a graphical representation of DA yield divided into DA-high and DA-low groups at 6 weeks and >16 weeks. Only experiments with relevant day 16 RNA samples were categorized as either high or low. Dopaminergic function of the grafts was assessed in grafts with long-term maturation (>16 weeks) through amphetamine induced rotation ("-" indicates lack of functional recovery, "+" indicates functional recovery, ND indicates not determined). The y-axis is the number of TH+ cells per 100,000 cells grafted, and runs from 0 to 10,000 in intervals of 5,000. FIG. 5B is a PCA plot of results from RNA sequencing analysis of day 16 cell samples from a revealed clustering of DA-low and DA-high samples on the PC4 axis. FIG. 5C is a list of results from Deseq2 analysis of RNA sequencing data from the DA-high versus DA-low cell samples (see boxed data points in FIG. 5I below). The list shows the 12 genes with highest log2 fold change (log2 FC) and with a p-value of <0.001. FIG. 5D is a graph of EN1 mRNA levels and FIG. 5E is a graph of PAX8 mRNA levels, both measured by qRT-PCR in day 16 transplanted cell batches. For the EN1 graph, the y-axis runs from 0 to 15,000 in intervals of 5,000, and the x-axis runs from 0 to 8,000 in intervals of 2,000. For the PAX8 graph, the y-axis runs from 0 to 150 in intervals of 50, and the x-axis runs from 0 to 8,000 in intervals of 2,000. For both FIGS. 5D-5E, Spearman correlation analysis is given as R and p-values in each graph and correlations are visualized with linear regression lines. FIG. 5F is a graphical summary of RNA sequencing correlation analysis showing positive correlations between TH+ content, graft volume and TH+ density and RNA levels of MHB genes and common ventral mesencephalic markers. Positive correlation is defined by Spearman correlation analysis with p<0.05. Genes verified by qRT-PCR are shown in bold. FIG. 5G is a graphical representation of a Spearman distance analysis of RNA levels in cell batches, showing co-regulation of MHB genes, whereas FOXP2, FOXA2, LMX1B, CORIN, LMX1A, and OTX2 are uncoupled or negatively coupled to the MHB genes cluster. FIG. 5H shows five representative images of TH+ neurons from different cell batches with high expression of predictive markers revealing mature morphology of the grafted cells. Scale bar: 50 µm. FIG. 5I is a graphical analysis of predictive markers following the Deseq2 analysis of RNA sequencing data from DA-high and DA-low cell samples. Markers were plotted based on log2 fold change compared to mean of normalized counts. The box in this figure shows the genes listed in FIG. 5C above. FIGS. 6A-6F are a set of images and graphs indicating that ventral mesencephalic-patterned hESC cultures contain cells of diencephalic STN fates. FIG. 6A is a set of three graphs showing negative correlation between RNA levels of the diencephalic markers FEZF1, WNT7B, and EPHA3 in transplanted cells (day 16) and TH+ content in grafts. For the FEZF1 graph, the y-axis runs from 0 to 8 in intervals of 2, and the x-axis runs from 0 to 10,000 in intervals of 2,500. R= -0.63, p= 0.015. For the WNT7B graph, the y-axis runs from 0 to 0.6 in intervals of 0.2, and the x-axis runs from 0 to 10,000 in intervals of 2,500. Spearman correlation: R= -0.54, p= 0.024. For the EPHA3 graph, the y-axis runs from 0 to 20 in intervals of 5, and the x-axis runs from 0 to 10,000 in intervals of 2,500. Spearman correlation: R= -0.63, p= 0.015. FIG. 6B is a set of images of immunostainings of ventral mesencephalic-patterned hESC cultures (day 16) revealing the presence of STN domain fates (BARHL1+ / FOXA2+ and PITX2+ / LMX1A / B+ cells). FIG. 6C is a schematic overview of expression domains in the diencephalic STN region and in lateral midbrain domains. FIG. 6D is a set of confocal images of an 18 week old graft showing the presence of BARHL1+ / PITX2+ and BARHL1+ / PITX2- cells. FIG. 6E is a set of example images of BARHL1+ cell content in grafts derived from cell batches with low (left) or high (right) BARHL1 RNA levels at the day of transplantation. FIG. 6F is a set of graphical representations showing positive correlations between BARHL1 and BARHL2 RNA levels at the time of transplantation (qRT-PCR) and the number of BARHL1+ cells in the mature grafts. For the BARHL1 graph, the y-axis runs from 0 to 1500 in intervals of 500, and the x-axis runs from 0 to 15,000 in intervals of 5,000. Spearman correlation: R= 0.89, p= 0.03. For the BARHL2 graph, the y-axis runs from 0 to 5000 in intervals of 1000, and the x-axis runs from 0 to 15,000 in intervals of 5,000. Spearman correlation: R= 0.89, p= 0.03. For FIGS. 6A and 6F, results from Spearman correlation analysis are given as R and p-values in each graph, and correlations are visualized with linear regression lines. FIG. 6G is a set of eight images of immunostainings of ventral mesencephalic-patterned hESC cultures (day 42, similar to FIG. 6B), showing the terminal in vitro differentiation of cultures with STN fates. FIGS. 7A-7I are a set of images and graphs indicating that timed delivery of FGF8 to hESCs causes cell fates to switch from diencephalic to caudal ventral mesencephalic progenitors. In vitro studies used data from both H9 and RC17 lines. FIG. 7A is a graphical representation of mRNA levels of FOXG1, SIX3, GBX2, and HOXA2 following qRT-PCR analysis (day 10) after differentiating hESCs treated with FGF8b from days 0-9. For the FOXG1 graph, the y-axis runs from 0 to 800 in intervals of 200. For the SIX3 graph, the y-axis runs from 0 to 1000 in intervals of 200. For the GBX2 graph, the y-axis runs from 0 to 150 in intervals of 50. For the HOXA2 graph, the y-axis runs from 0 to 300 in intervals of 100. For all four graphs, the x-axis indicates the amount of FGF8b, and is either 0, 100, or 300 ng / mL. FIG. 7B is a set of four immunostaining images (day 16) revealing patches of PITX2+ and NKX2.1+ cells and patches of LMX1- cells in cultures treated with FGF8b from d0-9. FIG. 7C is a set of nine immunostaining images illustrating that LMX1+ / FOXA2+ ventral mesencephalic phenotype is maintained in cultures treated with FGF8b from day 7-16 or 9-16. FIG. 7D is a set of six immunostaining images illustrating that day 16 cultures treated with FGF8b from day 9-16 have decreased levels of BARHL1+ and FOXA2 cells. FIG. 7E is a set of six immunostaining images illustrating that day 16 cultures treated with FGF8b from day 9-16 have decreased levels of PITX2 but increased levels of EN1 cells. FIG. 7F is a graphical quantification of FIGS. 7D-7E. The y-axis runs from 0 to 100% in intervals of 20. FIG. 7G is a graphical representation of mRNA levels at day 16 of FOXA2, LMX1A, OTX2, and EN1 following PCR analysis. The labels on the y-axis are, from bottom to top, 1, 4, 16, 64, 256, and 1024. FIG. 7H is a FACS plots of control and FGF8b-treated ventral mesencephalic-patterned cultures (day 16) showing unchanged percentages of FOXA2+ progenitors. For VM, the values are 94.6 ± 2.7% (mean ± SEM). For VM+FGF8, the values are 95.4 ± 1.3%. For control, the values are 0.3 ± 0.2%, n=3. FIG. 7I is a FACS plot of control and FGF8b-treated ventral mesencephalic-patterned cultures (day 16) showing decreased percentages of CORIN+ progenitors. For VM, the values are 52.9 ± 4.5%. For VM+FGF8, the values are 28.1 ± 1.8%. For control, the value is 0.0%, n=3. FIGS. 8A-8K are a set of images and graphs indicating that differentiation of hESCs on a GMP-compatible laminin-matrix produces high yield and purity of ventral mesencephalic progenitors. RC17 cells were used. FIG. 8A is a set of seven images illustrating neural differentiation of hESCs on different laminin subtypes. FIG. 8B is a pair of images exhibiting how the culturing of hESCs on LN-111 in pluripotency medium resulted in detachment and formation of spheres, whereas pluripotent cells efficiently attached to the LN-521 matrix. FIG. 8C is a graph comparing the use of LN-111 coated substrates to LN-121 coated substrates, showing the yield of dopaminergic cells is about equal on either substrate. FIG. 8D is a set of four images illustrating that seeding of low density hESCs on LN-111 matrix in supplemented N2 medium resulted in confluent neuralized cultures after 7 days of differentiation. FIG. 8E is a graph of the downregulation of OCT4 and NANOG mRNA levels across three days of differentiation on LN-111. The y-axis runs from 0.0 to 1.0 in intervals of 0.2, and the x-axis runs from 0 to 3 in intervals of 1. FIG. 8F is a graph of cell yield across different combinations of basic medium (DMEM / F12+Neurobasal with N2 supplement, N2 supplement, B27 supplement, and DMEM / F12+). The y-axis is cell count in millions on day 11, and runs from 0 to 200 in intervals of 50. FIG. 8G is a graphical comparison of cell yield from research-grade EB-based protocol with the cell yield from the GMP-adapted LN-111 protocol shown in FIG. 2. The y-axis is cell count in millions, and runs from 0 to 500 in intervals of 100. FIGS. 8H-8K exhibit that terminal maturation (day 45) of ventral mesencephalic progenitors generated by the GMP protocol of FIG. 2 resulted in electrophysiologically active neurons. FIG. 8H is a graph showing representative trace of action potentials induced with depolarizing current injections. FIG. 8I is a graph illustrating that some ventral mesencephalic cells showed spontaneous post-synaptic currents indicative of synaptic integration in the dish. FIG. 8J is a graphical example of rebound depolarization after brief membrane depolarization characteristic of dopaminergic phenotype. FIG. 8K is an inset showing respective trace from FIG. 8J on an expanded scale. FIGS. 9A-9E is a set of images and graphs indicating that differentiation of hESCs from GMP-compatible protocol produces ventral mesencephalic cell batches with reproducibly high expression of predictive markers from the caudal ventral mesencephalon. FIG. 9A is a set of three immunostained images taken of cultures differentiated according to the GMP protocol, showing a very high overlap of LMX1A / FOXA2. FIG. 9B is a set of two FACS plots of OTX2 / FOXA2 double-labelling by flow cytometry with mean(%)±SEM of replicate experiments (n=3). For both plots, the y-axis (OTX2-APC) is logarithmic, with the bottom value being 10 0< , and proceeding through 10 1< , 10 2< , 10 3< , 10 4< , 10 5< , 10 6< , and 10 7< . The x-axis (FOXA2-PE) is also logarithmic, with the leftmost value being 10 0< , and proceeding through 10 2< , 10 4< , and 10 6< . FIG. 9C is a graphical representation of gene expression levels in human ESCs differentiated according to either research-grade embryoid body protocol or GMP-grade LN-111 protocol. Differentiations towards ventral forebrain (vFB) and ventral hindbrain (vHB) were included as controls. Values are color-coded and normalized to sample with highest expression for each gene (= 1000). FIGS. 9D-9E are 10 representative images of additional grafts from batches containing high levels of caudal VM markers. The images of FIG. 9D are of grafted H9 cells, and FIG. 9E shows RC17 cells, both generated via the GMP-grade protocol. FIG. 10 is a graphical representation of behavioral recovery in an animal model of Parkinson's Disease. Rats subjected to unilateral 6-OHDA lesions were assessed for amphetamine-induced rotations before and after transplantation with RC17 cells differentiated according to the LN-111 GMP protocol. One group of animals (mesDA RC17, green dots) was transplanted with cells differentiated in the presence of FGF8b from day 9-16 to yield caudalised VM cells of the mesencephalic dopamine (mesDA) domain. This group exhibited functional recovery as evidenced by reversal and overcompensation (by week 22) of amphetamine-induced rotations. The other group (STN RC17, red dots) was transplanted with cells differentiated in the absence of FGF8b to yield rostral VM cells of the STN domain. In contrast to the mesDA group, the STN group did not exhibit functional recovery of amphetamine-induced rotations. DETAILED DESCRIPTION
[0044] A more complete understanding of the compositions and methods disclosed herein can be obtained by reference to the accompanying drawings. These figures are merely schematic representations based on convenience and the ease of demonstrating the present disclosure, and are, therefore, not intended to define or limit the scope of the exemplary embodiments.
[0045] Although specific terms are used in the following description for the sake of clarity, these terms are intended to refer only to the particular structure of the embodiments selected for illustration in the drawings, and are not intended to define or limit the scope of the disclosure. In the drawings and the following description below, it is to be understood that like numeric designations refer to components of like function.
[0046] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.
[0047] As used in the specification and in the claims, the term "comprising" may include the embodiments "consisting of" and "consisting essentially of." The terms "comprise(s)," "include(s)," "having," "has," "can," "contain(s)," and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that require the presence of the named ingredients / steps and permit the presence of other ingredients / steps. However, such description should be construed as also describing compositions or processes as "consisting of" and "consisting essentially of" the enumerated ingredients / steps, which allows the presence of only the named ingredients / steps, along with any impurities that might result therefrom, and excludes other ingredients / steps.
[0048] Numerical values in the specification and claims of this application should be understood to include numerical values which are the same when reduced to the same number of significant figures and numerical values which differ from the stated value by less than the experimental error of conventional measurement technique of the type described in the present application to determine the value.
[0049] All ranges disclosed herein are inclusive of the recited endpoint and independently combinable (for example, the range of "from 2 to 10" is inclusive of the endpoints, 2 and 10, and all the intermediate values).
[0050] The term "about" can be used to include any numerical value that can vary without changing the basic function of that value. When used with a range, "about" also discloses the range defined by the absolute values of the two endpoints, e.g. "about 2 to about 4" also discloses the range "from 2 to 4." The term "about" may refer to plus or minus 10% of the indicated number.
[0051] Several well-known references that may be relevant to the present disclosure include: Molecular Cloning: A Laboratory Manual (Sambrook, et al., 1989, Cold Spring Harbor Laboratory Press), Gene Expression Technology (Methods in Enzymology, Vol. 185, edited by D. Goeddel, 1991. Academic Press, San Diego, Calif.), "Guide to Protein Purification" in Methods in Enzymology (M. P. Deutshcer, ed., (1990) Academic Press, Inc.); PCR Protocols: A Guide to Methods and Applications (Innis, et al. 1990. Academic Press, San Diego, Calif.), Culture of Animal Cells: A Manual of Basic Technique, Second Ed. (R. I. Freshney. 1987. Liss, Inc. New York, N.Y.), Gene Transfer and Expression Protocols, pp. 109-128, ed. E. J. Murray, The Humana Press Inc., Clifton, N.J.), or the Ambion 1998 Catalog (Ambion, Austin, Tex.).
[0052] As used herein, the term "laminin-521" refers to the protein formed by joining α5, β2 and γ1 chains together. The term should be construed as encompassing both recombinant laminin-521 and heterotrimeric laminin-521 from naturally occurring sources.
[0053] As used herein, the term "laminin-111" refers to the protein formed by joining α1, β1 and γ1 chains together. The term should be construed as encompassing both recombinant laminin-111 and heterotrimeric laminin-111 from naturally occurring sources.
[0054] As used herein, the term "laminin-121" refers to the protein formed by joining α1, β2 and γ1 chains together. The term should be construed as encompassing both recombinant laminin-121 and heterotrimeric laminin-121 from naturally occurring sources.
[0055] As used herein, the term "laminin-421" refers to the protein formed by joining α4, β2 and γ1 chains together. The term should be construed as encompassing both recombinant laminin-421 and heterotrimeric laminin-421 from naturally occurring sources.
[0056] As used herein, the term "laminin-511" refers to the protein formed by joining α5, β1 and γ1 chains together. The term should be construed as encompassing both recombinant laminin-511 and heterotrimeric laminin-511 from naturally occurring sources.
[0057] The term "intact" refers to the protein being composed of all of the domains of the α-chain, β-chain, and γ-chain, with the three chains being joined together to form the heterotrimeric structure. The protein is not broken down into separate chains, fragments, or functional domains. The term "chain" refers to the entirety of the alpha, beta, or gamma chain of the laminin protein. The term "fragment" refers to any protein fragment which contains one, two, or three functional domains that possesses binding activity to another molecule or receptor. However, a chain should not be considered a fragment because each chain possesses more than three such domains. Similarly, an intact laminin protein should not be considered a fragment. Examples of functional domains include Domains I, II, III, IV, V, VI, and the G domain.
[0058] As used herein, the term "self-renewal" refers to the ability of the stem cell to go through numerous cycles of cell division and remain undifferentiated (i.e. pluripotent). Pluripotency itself refers to the ability of the stem cell to differentiate into any cell type. The term "proliferation" refers to the ability of the stem cell to divide. Survival refers to the ability of the stem cell to live, whether differentiated or undifferentiated, and does not require the stem cell to maintain its ability to divide or to differentiate.
[0059] The abbreviation "DA" refers to dopamine. It is generally used herein to refer to cells that can produce dopamine or to cells that can give rise to dopamine-producing cells.
[0060] The combination of the laminin substrate with the cell culture medium of the present disclosure results in a cell culture system that provides clinical grade dopaminergic cells. Particularly the method discloses more dopaminergic cells
[0061] The present disclosure relates to more efficient methods of culturing stem cells to obtain differentiated neural cells for regenerative therapies. In particular, a laminin is used as a matrix / substrate for pluripotent stem cells, resulting in more differentiated cells than cultures containing alternative matrices. Only one laminin may be used as the matrix / substrate, or the matrix / substrate can include specific laminins, which are laminin-111 (LN-111), LN-121, LN-521, LN-421, or LN-511. Laminin-111 can normally be found in the epithelia and dermal papillae, endothelial cells, pancreas, peripheral nerves, and placenta.
[0062] The present disclosure also relates to different cell culture mediums that are used to provide nutrition to cells, particularly stem cells. In this regard, stem cells typically require two things to be cultured: (1) a substrate or coating that provides a structural support for the stem cell; and (2) a cell culture medium to provide nutrition to the stem cell. The substrate or coating (1) is generally placed on, for example, a petri dish or some other container. Application of different cell culture mediums at appropriate time intervals in combination with a laminin-111 substrate result in a larger number of differentiated neural cells that produce dopamine (i.e. dopaminergic cells).
[0063] The stem cells that can be used with the methods and materials disclosed herein can be induced pluripotent stem cells, embryonic stem cells, adult stem cells, fetal stem cells, amniotic stem cells, and generally any pluripotent stem cell.
[0064] The methods can be modified to obtain neural cells of many different phenotypes. These neural cells can be used for stem cell based therapies, including being transplanted and grafted into the brain of a mammalian patient to treat various neurodegenerative diseases. In the absence of patterning factors, neural cells of a telencephalic fate are obtained. Rostro-caudal and dorsal-central patterning of neural progenitors can be controlled by a dose-dependent addition of patterning factors. These methods are described with reference to FIG. 2, which provides a timeline and a listing of the various ingredients in the cell culture mediums disclosed herein. As seen here, pluripotent stem cells are seeded on plates coated with laminin-111 and are cultured over a period of 16 days. The culturing media may contain various combinations of medium, differentiation factors, and patterning factors administered at specific intervals over a 16-25 day period.
[0065] Initially, four different cell culture mediums are illustrated, which are modified by the addition of differentiation factors and / or patterning factors to arrive at multiple different cell culture mediums. Those four mediums are referred to herein as neural induction medium (NIM), N2 medium (N2M), neural proliferation medium (NPM), and B27 medium (B27M).
[0066] The NIM, N2M, NPM, and B27M are made from a set of common ingredients. These common ingredients include DMEM / F12 medium, which is commercially available from Invitrogen (catalog nos. 10565 and 21331). DMEM / F12 generally contains the following ingredients listed in Table 1: Table 1.DMEM / F12 Ingredients Concentration (ng / mL) Glycine187.5L-Alanine44.5L-Arqinine hydrochloride1475L-Asparagine-H 2 O75L-Aspartic acid66.5L-Cysteine hydrochloride-H 2 O175.6L-Cystine 2HCl312.9L-Glutamic Acid73.5L-Glutamine3650L-Histidine hydrochloride-H 2 O314.8L-Isoleucine544.7L-Leucine590.5L-Lysine hydrochloride912.5L-Methionine172.4L-Phenylalanine354.8L-Proline172.5L-Serine262.5L-Threonine534.5L-Tryptophan90.2L-Tyrosine disodium salt dihydrate557.9L-Valine528.5Biotin0.035Choline chloride89.8D-Calcium pantothenate22.4Folic Acid26.5Niacinamide20.2Pyridoxine hydrochloride20Riboflavin2.19Thiamine hydrochloride21.7Vitamin B 12 6.8i-Inositol126Calcium Chloride (CaCl 2 ) (anhyd.)1166Cupric sulfate (CuSO 4 -5H 2 O)0.013Ferric Nitrate (Fe(NO 3 ) 3 -9H 2 O)0.5Ferric sulfate (FeSO 4 -7H 2 O)4.17Magnesium Chloride (anhydrous)286.4Magnesium Sulfate (MgSO 4 ) (anhyd.)488.4Potassium Chloride (KCl)3118Sodium Bicarbonate (NaHCO 3 )24380Sodium Chloride (NaCl)69955Sodium Phosphate dibasic (Na 2 HPO 4 ) anhydrous710.2Sodium Phosphate monobasic (NaH 2 PO 4 -H 2 O)625Zinc sulfate (ZnSO 4 -7H 2 O)4.32D-Glucose (Dextrose)31510Hypoxanthine Na23.9Linoleic Acid0.42Lipoic Acid1.05Phenol Red81Putrescine 2HCl0.81Sodium Pyruvate550Thymidine3.65
[0067] Another common ingredient is Neurobasal medium, which is commercially available as MACS neuro medium from Miltenyi (catalog no. 130-093-570) or from Life Technologies (catalog no. 13712-01). N2 supplement is commercially available from Life Technologies (catalog no. A13707-01) in 100X concentration. B27 supplement without vitamin A can be obtained from Life Technologies (catalog no. 12587-010) or as MACS NeuroBrew-21 from Miltenyi (catalog no. 130-097-263).
[0068] The NIM, N2M, NPM, and B27M mediums are made by mixing parts by volume of these common ingredients with other additives.
[0069] The neural induction medium (NIM) is formed from 1 part by volume (pbv) of a 50:50 mixture of DMEM / F12: Neurobasal; 1 part of 1X N2 supplement (1:100); and 1 part of 1X B27 supplement (1:50); with addition of 2 mM L-glutamine and optionally 0.2% penicillin / streptavidin if needed.
[0070] The N2 medium (N2M) is formed from 1 part by volume (pbv) of a 50:50 mixture of DMEM / F12: Neurobasal; and 1 part of 1X N2 supplement; with addition of 2 mM L-glutamine and optionally 0.2% penicillin / streptavidin if needed. In comparison to the NIM, the N2M does not contain B27 supplement at all.
[0071] The neural proliferation medium (NPM) is formed from 1 part of the 50:50 mixture of DMEM / F12: Neurobasal; 1 part of 0.5X N2 supplement (1:200); and optionally 1 part of 0.5X B27 supplement (1:100); with addition of 2 mM L-glutamine and optionally 0.2% penicillin / streptavidin if needed. The N2 and B27 supplements are more diluted in the NPM compared to the NIM and the B27M. When B27 is present, this may be referred to as NPM-B.
[0072] The B27 medium (B27M) is formed from 1 part of Neurobasal medium; and 1 part of 1X B27 supplement (1:50); with addition of 2 mM L-glutamine and optionally 0.2% penicillin / streptavidin if needed. The B27M does not contain N2 supplement at all.
[0073] The differentiation factors used in the present disclosure include a TGFβ inhibitor; recombinant human noggin; a brain derived neurotrophic factor (BDNF); ascorbic acid (AA); a glial cell line-derived neurotrophic factor (GDNF); a cyclic adenosine monophosphate (cAMP) such as dibutyryl-cyclic adenosine monophosphate (db-cAMP); and a gamma-secretase inhibitor such as DAPT. In particular embodiments, the TGFβ inhibitor is SB431542 (CAS# 301836-41-9). Noggin can be obtained from R&D Systems (catalog no. 6057-GMP) or Miltenyi (catalog no. 130-103-456). BDNF (catalog no. 130-096-286) and GDNF (catalog no. 130-098-449) can be obtained from Miltenyi.
[0074] The patterning factors used in the present disclosure include a GSK3 inhibitor, fibroblast growth factor (FGF), and sonic hedgehog protein. In particular embodiments, the GSK3 inhibitor is CHIR99021 (CAS# 252917-06-9). In other particular embodiments, the fibroblast growth factor is FGF8b. In yet other embodiments, the particular sonic hedgehog protein is SHH-C24II.
[0075] In particular embodiments, a ROCK inhibitor may be used for certain portions of the methods. The ROCK inhibitor may be Y27632 (CAS# 129830-38-2). Noggin protein and a gamma-secretase, such as DAPT, can also be used.
[0076] Next, prior to differentiation, cells may be maintained on Cellstart or laminin-521 in StemPro medium or iPSBrew (catalog number 130-104-368). The cells may also be passaged with EDTA 4 to 6 days before initiation of differentiation. Healthy pluripotent stem cells should be used.
[0077] Referring now to FIG. 2 and FIG. 3, the differentiation protocol begins on Day 0, and continues for 16 days. After 16 days, the cells can be prepared for transplantation. On Day 0, the pluripotent stem cells are plated onto a substrate of laminin-111, LN-121, LN-521, LN-421, and / or LN-511. The substrate may consist entirely of laminin-111, entirely of LN-121, or be a combination of LN-111 and LN-121, or a combination of the other named laminins as well. The substrate may also include other basal factors. In particular embodiments, the laminin(s) consists of intact laminin, i.e. containing the entirety of all three chains. It is also contemplated that the substrate could consist of fragments of the specified laminin(s) in other particular embodiments. The stem cells can be plated at a density of about 10,000 cells per cm 2< .
[0078] At least two different protocols / methods for differentiating the stem cells on the laminin-coated substrate during this 16-25 day period are contemplated herein. One protocol is illustrated in FIG. 2, and the other protocol is illustrated in FIG. 3.
[0079] In the protocol of FIG. 2, four different cell culture mediums are applied to the stem cells. The composition of those four cell culture mediums is now described. These cell culture mediums are referred to herein as a primary cell culture medium, a secondary cell culture medium, a tertiary cell culture medium, and a quaternary cell culture medium.
[0080] The primary cell culture medium comprises the N2M, a TGF-β inhibitor; and a GSK3 inhibitor. No B27 supplement is present. In particular embodiments, the primary cell culture medium consists of these listed ingredients. The TGF-β inhibitor is present in a concentration of about 5 µM to about 15 µM, and in particular about 10 µM. In specific embodiments, the TGF-β inhibitor is SB431542. The GSK3 inhibitor is present in a concentration of about 0.2 µM or greater. In specific embodiments, the GSK3 inhibitor is CHIR99021. In some embodiments, the primary cell culture medium further comprises a sonic hedgehog (SHH) protein, such as SHH-C24II. When present, the SHH protein is present in an amount of at least 50 ng / ml, including about 100 ng / ml to about 400 ng / ml, and in particular about 200 ng / ml. Noggin may also be present in an amount of about 50 ng / ml to about 150 ng / ml, and in particular about 100 ng / ml. Noggin also acts as a TGF-β inhibitor. In additional particular embodiments, the primary cell culture medium consists of these listed ingredients (including the SHH and the noggin). A ROCK inhibitor is present in the medium for the first 24 hours to 72 hours after plating. In specific embodiments the ROCK inhibitor is Y-27632. The ROCK inhibitor is present at a concentration of about 5 µM to about 15 µM, and in particular about 10 µM. If desired, the primary cell culture medium containing the ROCK inhibitor ("primary-A") can be considered a different medium from the primary cell culture medium that does not contain the ROCK inhibitor ("primary-B").
[0081] The secondary cell culture medium comprises the N2M and a fibroblast growth factor (FGF). In particular embodiments, the secondary cell culture medium consists of these listed ingredients. No B27 supplement is present. The FGF is present in an amount of about 50 ng / ml to about 150 ng / ml, and in particular about 100 ng / ml. In particular embodiments, the fibroblast growth factor is FGF8b.
[0082] The tertiary cell culture medium comprises the B27M, a ROCK inhibitor, a fibroblast growth factor (FGF), a brain derived neurotrophic factor (BDNF), and ascorbic acid (AA), and optionally a glial cell-line derived neurotrophic factor (GDNF). Please note that B27 is present in this medium, but N2 is not present. In particular embodiments, the tertiary cell culture medium consists of these listed ingredients. The FGF is present in an amount of about 50 ng / ml to about 150 ng / ml, and in particular about 100 ng / ml. In particular embodiments, the fibroblast growth factor is FGF8b. The BDNF is present in an amount of about 5 ng / ml to about 30 ng / ml, and in particular about 20 ng / ml. The AA is present in a concentration of about 0.1 mM to about 0.5 mM, and in particular about 0.2 mM. The ROCK inhibitor is present in a concentration of about 5 µM to about 15 µM, and in particular about 10 µM. The GDNF can be present in an amount of about 2 ng / ml to about 20 ng / ml, and in particular about 10 ng / ml, but is usually excluded.
[0083] The quaternary cell culture medium comprises the B27M, a fibroblast growth factor (FGF), a brain derived neurotrophic factor (BDNF), and ascorbic acid (AA), and optionally a glial cell-line derived neurotrophic factor (GDNF). Please note that B27 is present in this medium, but N2 is not present. In particular embodiments, the quaternary cell culture medium consists of these listed ingredients. The FGF is present in an amount of about 50 ng / ml to about 150 ng / ml, and in particular about 100 ng / ml. In particular embodiments, the fibroblast growth factor is FGF8b. The BDNF is present in an amount of about 5 ng / ml to about 30 ng / ml, and in particular about 20 ng / ml. The AA is present in a concentration of about 0.1 mM to about 0.5 mM, and in particular about 0.2 mM. The GDNF can be present in an amount of about 2 ng / ml to about 20 ng / ml, and in particular about 10 ng / ml, but is usually excluded. The quaternary cell culture medium is generally identical to the tertiary cell culture medium, but does not contain ROCK inhibitor.
[0084] Next, the differentiation protocol of FIG. 2 is described. The stem cells can be plated at a density of about 10,000 cells per cm 2< . After the stem cells are originally plated on the laminin-coated substrate (as described above), the primary cell culture medium is applied for a period of about 156 hours to about 228 hours (i.e. about 7 days to about 9 days). The primary cell culture can be periodically renewed. The primary cell culture medium is then removed, and the secondary cell culture medium is added to the substrate.
[0085] In this regard, the secondary cell culture medium contains FGF, and different amounts of the FGF and timing of the FGF addition (i.e. 7-9 days) can control the rostral-caudal patterning of the resulting cells. The secondary cell culture medium is then removed about 252 hours to about 276 hours after the original plating (i.e. about 11 days). Put another way, the cells are exposed to the secondary cell culture medium for a period of about 36 hours to about 60 hours (i.e. about 2 to 4 days).
[0086] The cells are then replated through dissociation to single cells, and exposed to the tertiary cell culture medium which contains the ROCK inhibitor. The cell density at replating may be about 0.5 million cells per cm 2< to about 1 million cells per cm 2< . It is contemplated that the tertiary cell culture medium is used for only a short period of time, i.e. about 48 hours or less, during the replating. The cells are then exposed to the quaternary cell culture medium until about 324 hours to about 396 hours (i.e. about 14-16 days) after the original plating. Put another way, the cells are exposed to the quaternary cell culture medium for a period of about 108 hours to about 132 hours (i.e. about 5 days). After about 14-16 days, the cell density may be as high as about 1.78 million cells per cm 2< . After about 16 days to about 25 days, the neural cells are ready for cryopreservation or transplantation. The identity of the desired cells can be verified by expression of desired markers, as described further herein.
[0087] Referring now to FIG. 3, six different cell culture mediums are applied to the stem cells and the laminin-coated substrate during this 25-day period. The composition of those six cell culture mediums are now described.
[0088] The first cell culture medium comprises the NIM or the N2M; a ROCK inhibitor; a TGFβ inhibitor; and a GSK3 inhibitor. In particular embodiments, the first cell culture medium consists of these listed ingredients. The various additives may be any combination of the specific additives previously described above. The ROCK inhibitor is present in a concentration of about 5 µM to about 15 µM, and in particular about 10 µM. The TGFβ inhibitor is present in a concentration of about 5 µM to about 15 µM, and in particular about 10 µM. The GSK3 inhibitor is present in a concentration of about 0.2 µM or greater. As will be explained further herein, the amount / concentration of the GSK3 inhibitor will affect the type of neural cell that is obtained. In some embodiments, the first cell culture medium further comprises a sonic hedgehog (SHH) protein. When present, the SHH protein is present in an amount of at least 50 ng / ml, including about 100 ng / ml to about 300 ng / ml, and in particular about 200 ng / ml. Noggin may also be present in an amount of about 50 ng / ml to about 150 ng / ml, and in particular about 100 ng / ml. Noggin also acts as a TGFβ inhibitor. In additional particular embodiments, the first cell culture medium consists of these listed ingredients (including the SHH and the noggin).
[0089] The second cell culture medium comprises the NIM or the N2M; a TGFβ inhibitor; and a GSK3 inhibitor; but does not contain the ROCK inhibitor that was present in the first cell culture medium. In particular embodiments, the second cell culture medium consists of these listed ingredients. The amounts of these additives are as described above. In some embodiments, the second cell culture medium further comprises a sonic hedgehog (SHH) protein. When present, the SHH protein is present in an amount of at least 50 ng / ml, including about 100 ng / ml to about 300 ng / ml, and in particular about 200 ng / ml. Noggin may also be present in an amount of about 100 ng / ml to about 300 ng / ml in this second cell culture medium, and in particular about 200 ng / ml. In particular embodiments, the second cell culture medium consists of these listed ingredients (including the SHH and the noggin).
[0090] The third cell culture medium comprises (i) the NPM or the N2M; and (ii) a TGFβ inhibitor. The TGFβ inhibitor is present in a concentration of about 5 µM to about 15 µM, and in particular about 10 µM. Noggin may also be present in an amount of about 50 ng / ml to about 150 ng / ml, and in particular about 100 ng / ml. In some embodiments, the third cell culture medium further comprises a GSK3 inhibitor and SHH protein. When present, the GSK3 inhibitor is present in a concentration of about 0.2 µM or greater. When present, the SHH protein is present in an amount of at least 50 ng / ml, including about 100 ng / ml to about 300 ng / ml, and in particular about 200 ng / ml. In particular embodiments, the third cell culture medium consists of the NPM or N2M, TGFβ inhibitor, GSK3 inhibitor, and SHH protein.
[0091] The fourth cell culture medium comprises (i) the NPM or the N2M; and (ii) a FGF. The FGF is present in an amount of about 50 ng / ml to about 150 ng / ml, and in particular about 100 ng / ml.
[0092] The fifth cell culture medium comprises the B27M; a brain derived neurotrophic factor (BDNF); ascorbic acid (AA); a glial cell line-derived neurotrophic factor (GDNF); and a FGF. In particular embodiments, the fifth cell culture medium consists of these listed ingredients. The BDNF is present in an amount of about 5 ng / ml to about 30 ng / ml, and in particular about 20 ng / ml. The AA is present in a concentration of about 0.1 mM to about 0.5 mM, and in particular about 0.2 mM. The GDNF is present in an amount of about 2 ng / ml to about 20 ng / ml, and in particular about 10 ng / ml. The FGF is present in an amount of about 50 ng / ml to about 150 ng / ml, and in particular about 100 ng / ml.
[0093] The sixth cell culture medium can be used for neuronal maturation; and comprises the B27M; a BDNF; ascorbic acid (AA); a GDNF; db-cAMP; and a gamma-secretase. In particular embodiments, the sixth cell culture medium consists of these listed ingredients. The BDNF is present in an amount of about 5 ng / ml to about 30 ng / ml, and in particular about 20 ng / ml. The AA is present in a concentration of about 0.1 mM to about 0.5 mM, and in particular about 0.2 mM. The GDNF is present in an amount of about 2 ng / ml to about 20 ng / ml, and in particular about 10 ng / ml. The db-cAMP is present in a concentration of about 200 µM to about 800 mM, and in particular about 500 µM. The gamma-secretase is present in a concentration of about 0.1 µM to about 5 µM, and in particular about 1 µM.
[0094] After the stem cells are originally plated on the laminin-coated substrate, the first cell culture medium is applied for a period of about 36 hours to about 60 hours, and in particular for about 48 hours (i.e. 2 days). The first cell culture medium is then removed, and the second cell culture medium is added to the substrate. The second cell culture medium is removed about 84 hours to about 108 hours after the original plating (i.e. about day 4), and is replaced with the third cell culture medium. The third cell culture medium can be renewed about 156 hours to about 180 hours after the original plating. The third cell culture medium is then removed about 156 hours to about 228 hours after the original plating (i.e. about 7-9 days after original plating).
[0095] In this regard, rostro-caudal patterning of the resulting cells can be controlled by dose-dependent addition of the GSK3 inhibitor during this initial period using the first through third cell culture mediums. In some embodiments, 0.2 µM to 0.4 µM of the GSK3 inhibitor are used in these cell culture mediums for diencephalic fates. In other embodiments, 0.6 µM to 0.8 µM of the GSK3 inhibitor may be used for mesencephalic fates. In yet other embodiments, 1 µM to 2 µM of the GSK3 inhibitor may be used for anterior rhomencephalic fates. In yet further embodiments more than 4 µM of the GSK3 inhibitor may be used for posterior rhomencephalic fates.
[0096] Similarly, dorso-ventral patterning of neural progenitors can be controlled by dose-dependent addition of the SHH protein. In some embodiments, if no SHH protein is added to the culture, the cells will be enriched for alar plate fates. In other embodiments, about 50 ng / ml to about 150 ng / mL SHH protein may be added to enrich for basal plate fates. In yet other embodiments, more than 200 ng / mL SHH protein may be added to enrich for floor plate fates. To enrich for roof plate fates, no TGFβ inhibitor or noggin should be present in the third cell culture medium (applied about Day 4). This allows for activation of bone morphogenic protein (BMP).
[0097] In some embodiments, purmorphamine and SHH protein may be added to the second and third cell culture mediums to obtain more potent ventralization. The purmorphamine should be present in a concentration of about 0.1 µM to about 1 µM, and in particular about 0.5 mM.
[0098] Continuing on, the third cell culture medium is substituted with the fourth cell culture medium after about 156 hours to about 228 hours after the original plating. As discussed above, the amount and timing of the FGF in the fourth cell culture medium can control rostral-caudal patterning of the progenitor cells. The fourth cell culture medium is then removed about 252 hours to about 276 hours after the original plating (i.e. about 11 days after original plating). At this time, the cells may be replated on a second laminin-coated substrate, and the fifth cell culture medium is applied. The cells are cultured in the fifth cell culture medium until about 324 hours to about 396 hours after the original plating (i.e. about day 14-16). The fifth cell culture medium may be renewed about 324 hours to about 348 hours after the original plating as well.
[0099] After about 14-16 days, the identity of the cells of these processes using the first through fifth cell culture mediums can be verified by expression of regional markers including FOXG1, OTX2, LMX1A, FOXA2, and HOXA2. After about 16 days to about 25 days, the neural cells are ready for cryopreservation or transplantation. If the cells are being used for longer-term studies that need mature neuronal phenotypes, they can be cultured in the sixth cell culture medium. The resulting neural cells are obtained in a large quantity.
[0100] The cell culture media of FIG. 2 and FIG. 3 can be compared to each other. The primary cell culture medium of FIG. 2 is similar to the second cell culture medium of FIG. 3. The secondary cell culture medium of FIG. 2 is similar to the fourth cell culture medium of FIG. 3. The quaternary cell culture medium of FIG. 2 (B27M) is similar to the fifth cell culture medium of FIG. 3 (NDM).
[0101] The following examples are for purposes of further illustrating the present disclosure. The examples are merely illustrative and are not intended to limit devices made in accordance with the disclosure to the materials, conditions, or process parameters set forth therein.EXAMPLES Coating Plates with Laminin-111
[0102] Prior to initiating differentiation, about 1 µg / cm 2< Laminin-111 in PBS and Ca 2+< / Mg 2+< (total volume 300 µL) was coated onto a 24 well plate. For a few wells, laminin-111 and PBS were mixed directly into the wells. The plate was shaken to ensure homogenous coating. The plate was then covered with parafilm and left at 4°C for about 1 to about 7 days before use.Dilution of CHIR99021
[0103] 10 mM CHIR99021 stock in DMSO was prepared. The stock was distributed between aliquots (5-10 µL per vial) and stored at -20 °C. The aliquots can be thawed up to three times before discarding.
[0104] For use in culturing, CHIR99021 was diluted 1:100 in N2M to yield a 100 µM solution prior to adding to the cell culture medium.EXAMPLE 1 Materials and Methods
[0105] Neural induction medium (NIM), Y-27632 (10 µM), SB431542 (10 µM) and noggin (100 ng / mL) were combined to create a differentiation medium. Approximately 250 µL of medium was needed per cm 2< of differentiation. For patterning to ventral mesencephalic fates, 0.6 to 1.0 µM CHIR99021 and 200 ng / mL Shh-C24II was added to the medium.
[0106] Colonies appeared pluripotent and any differentiated colonies were removed from the culture before initiating differentiation. StemMACS iPSBrew medium was aspirated and cells washed once in PBS. EDTA (0.5 mM) was added to the cells and the cells incubated at room temperature for about 7 minutes. The plate was rocked occasionally to ensure the cells were submerged in EDTA.
[0107] 10 mL wash medium (DMEM / F12 with 0.1% albumin or other medium similar to growth medium) was prepared in a 15 mL tube. EDTA was removed and 1 mL wash medium was transferred to the plate.
[0108] Colonies were immediately pipetted off the dish with a pipette and triturated to yield homogenous sizes while avoiding dissociation to single cells. The colonies were then transferred to the 15 mL tube with the wash medium. The cell suspension was mixed and 1 mL suspension was transferred to a 1.5 mL tube for counting. The tube was spun at 400 x g for 5 minutes.
[0109] Medium from the 1.5 mL tube was aspirated and cells resuspended in 100 µL accutase. The cells were left in an incubator for 7 minutes to yield a single cell suspension. 900 µL wash medium was added to the 1.5 mL tube and cells dissociated with the pipette. Cells were then counted to estimate the total number of cells in suspension. Approximately 10,000 cells / cm 2< were required to initiate differentiation and transferred from suspension to a new tube before being spun down at 400 x g for 5 minutes.
[0110] The wash medium was aspirated and re-suspended in a mixed differentiation medium of NIM, Y-27632 (10 µM), SB431542 (10 µM), noggin (100 ng / ml), CHIR99021 (0.7 µM) and SHH-C24II (200 ng / ml) to yield a cell suspension of 50,000 cells / mL. Laminin-111 was aspirated from the coated plate and the cell suspension seeded onto the coated plate with 10,000 cells / cm 2< (approximately 250 µL medium per cm 2< ). The plate was thoroughly shaken and swirled to yield homogenous cell plating.
[0111] After about 48 hours (Day 2), the medium was changed to new neural induction medium (NIM) with SB431542 (10 µM) and noggin (100 ng / mL). For patterning to ventral mesencephalic fates, 0.6 to 1.0 µM CHIR99021 and 200 ng / mL SHH-C24II were added to the medium. The same volume of differentiation medium was used as the volume used to initiate differentiation.
[0112] After about 48 hours (i.e., about 96 hours from plating, Day 4), the medium was changed to neural proliferation medium (NPM) with SB431542 (10 µM) and noggin (100 ng / mL). For patterning to ventral mesencephalic fates, 0.6 to 1.0 µM CHIR99021 and 200 ng / mL Shh-C24II were added to the medium. Approximately 350 µL medium was added per cm 2< .
[0113] After about 72 hours (i.e., about 168 hours from plating, Day 7), the medium was refreshed with NPM with SB431542 (10 µM) and noggin (100 ng / mL). For patterning to ventral mesencephalic fates, 0.6 to 1.0 µM CHIR99021 and 200 ng / mL Shh-C24II were added to the medium. Approximately 350 µL medium was added per cm 2< .
[0114] After about 48 hours (i.e., about 216 hours from plating, Day 9), the medium was changed to NPM with fibroblast growth factor (FGF8b) (100 ng / mL). Approximately 500 µL medium was added per cm 2< .
[0115] After about 48 hours (i.e., about 264 hours from plating, Day 11), the cells were replated onto a new 12 well laminin-111 coated plate. Cells were washed twice with PBS and shaken in the plate to remove all dead and floating cells. Approximately 300 µL accutase was added to each well. Cells were left in the incubator for 10 minutes and rocked occasionally to ensure that the cells were submerged in accutase.
[0116] A 15 mL tube was prepared with 10 mL NPM. After 10 minutes, the cells were dissociated with a 1 mL pipette to yield a single cell suspension and transferred to the 15 mL tube containing NPM. Cells were spun down at 400 x g for 5 minutes. The medium was then aspirated and the cell pellet transferred and resuspended in 1 mL NPM in a 1.5 mL tube. 10 µL cell suspension was removed for counting. The suspension was diluted 1:10 - 1:50. While counting, cells were spun down at 400 x g for 5 minutes.
[0117] The medium was aspirated and cells resuspended to a density of 1.7 million cells / mL in B27 medium (B27M), brain derived neurotrophic factor (BDNF) (20 ng / mL), ascorbic acid (AA) (0.2 mM), glial cell line-derived neurotrophic factor (GDNF) (10 ng / mL) and FGF8b (100 ng / mL). Laminin-111 was aspirated from the coated plates and cells seeded onto the plate at a density of 800,000 cells / cm 2< . The plate was thoroughly shaken and swirled to yield homogenous plating of the cells before incubation.
[0118] After 72 hours (i.e., about 336 hours after plating, Day 14), medium on the cells was refreshed with B27M, BDNF (20 ng / mL), AA (0.2 mM), GDNF (10 ng / mL), and FGF8b (100 ng / mL). Approximately 500 µL medium was added per cm 2< .
[0119] After 48 hours (i.e., about 384 hours after plating, Day 16), the cells were ready for cryopreservation and / or transplantation.Validation of Progenitor Cell Phenotype
[0120] Parallel plates of cells were kept in B27M with BDNF, ascorbic acid, and FGF8b until day 14 (i.e. 336 hours after plating) and then harvested for RNA analysis or fixed for immunocytochemistry. On day 14, the regional identities of the cells were clearly identified by their expressions of regional markers such as FOXG1, OTX2, LMX1A, FOXA2, and HOXA2.EXAMPLE 2 Materials and Methods
[0121] The same materials and protocol disclosed in Example 1 are used for 24 well plates with the following alterations:
[0122] Plates were coated with laminin-111 (1 µg / cm 2< ) in PBS and Ca 2+< / Mg 2+< (700 µL / cm 2< ). For seeding the cell suspension onto the laminin-111 coated plates, approximately 250 µL was required per cm 2< (500 µL / well). To initiate differentiation, for 6 wells of a 24 well plate, 120,000 cells in total were needed.
[0123] At the 96 hour and 168 hour marks after plating, approximately 600 µL medium was added to each well. At the 216 hour mark after plating, approximately 700 µL medium was added to each well.
[0124] Some cell lines required the addition of 10 µM Y-27632 to the medium to survive replating. During replating, approximately 150 µL accutase was added to each well. At the 336 hour mark, approximately 700 µL medium was added per well.EXAMPLE 3 Preparation of Cells for Transplantation (Day 16-25)
[0125] The same materials and protocol disclosed in Examples 1 and 2 are used.
[0126] Cells were maintained in B27M, BAG (BDNF+AA+GDNF), and FGF8b until the day of transplantation without any further manipulations. Medium was refreshed every 2-3 days. Cells were most suitable for transplantation on day 16 but could be transplanted up until day 26. Cells for transplantation did not receive DAPT or db-cAMP in the medium, as this would result in premature neuronal maturation and increased cell death upon dissociation.EXAMPLE 4 Long-Term Terminal Neuronal Maturation
[0127] The same materials and protocol disclosed in Examples 1 and 2 are used.
[0128] Cells for long-term studies of mature neuronal phenotype were replated again between days 16 and 25 to avoid too high densities of cultures and detachment of cells. Cells were kept in B27M and BAG (without db-cAMP and DAPT) until the day of replating. Replating was performed using the same procedure as used on Day 11 (i.e., 264 hours after first plating), and cells were kept in B27M, BDNF (20 ng / mL), GDNF (10 ng / mL), ascorbic acid (0.2 mM), db-cAMP (500 µM), and DAPT (1 µM) after replating.
[0129] Replating at later timepoints should be avoided due to stress on mature neuronal cells. At late stages of differentiation, neurons may begin to detach from the plate. This can be attenuated by adding laminin and fibronectin (FN) to the cell culture medium. Mature dopaminergic phenotypes only start to appear from Day 45 and onwards.EXAMPLE 5
[0130] Over the past 6 years, over 500 rats were intracerebrally transplanted with 31 different batches of hES cell-derived mesDA progenitors at various different research sites. An overview of the graft experiment plan is reflected in Tables 2-3 below. For graft site: Str. = striatum, SN = substantia nigra. For rat host strain, SD = Sprague-Dawley, LH = Lister-hooded, At = Athymic Crl:NIH-Foxn1rnu. For immunosuppression, Ciclo = daily intraperitoneal injections of ciclosporin (10 mg / kg), starting the day before transplantation. Table 2.Batch # Graft Survival Animals (n analysed / n grafted ) Graft Site Rat host strain Immunosuppression # Grafted Cells Avg. Yield (TH+ cells / 100,000 grafted) 16 weeks7 / 7Str.SDCiclo3 x 10 5< 371126 weeks8 / 8Str.SDCiclo3 x 10 5< 461636 weeks7 / 7Str.SDCiclo3 x 10 5< 866046 weeks7 / 7Str.SDCiclo3 x 10 5< 559758 weeks7 / 10Str.SDCiclo3 x 10 5< 19876624 weeks6 / 6Str.AT-3 x 10 5< 9260716 weeks14 / 15Str.LHCiclo3 x 10 5< 273824 weeks4 / 9SNAT-1 x 10 5< 381124 weeks9 / 16Str.LHCiclo3 x 10 5< 2661224 weeks8 / 8SNAT-1 x 10 5< 400713A: 6 weeks3 / 4Str.SDCiclo2 x 10 5< 212B: 6 weeks3 / 4Str.SDCiclo2 x 10 5< 176146 weeks5 / 6Str.SDCiclo2 x 10 5< 170166 weeks4 / 4Str.SDCiclo1.5 x 10 5< 10521724 weeks10 / 10Str.AT-3 x 10 5< 219818A: 4 weeks4 / 4Str.SDCiclo3 x 10 5< 581B: 16 weeks5 / 8Str.SDCiclo3 x 10 5< 101119A: 4 weeks3 / 4Str.SDCiclo3 x 10 5< 36B: 16 weeks7 / 8Str.SDCiclo3 x 10 5< 261206 weeks4 / 4Str.SDCiclo1.5 x 10 5< 755216 weeks4 / 4Str.SDCiclo1.5 x 10 5< 1322A: 18 weeks4 / 4Str.SDCiclo2 x 10 5< 6868B: 24 weeks6 / 6Str.AT-3 x 10 5< 582223A: 18 weeks3 / 4Str.SDCiclo2 x 10 5< 4141B: 24 weeks5 / 5Str.AT-3 x 10 5< 3549246 weeks2 / 2Str.SDCiclo4 x 10 5< 92518 weeks4 / 4Str.SDCiclo4 x 10 5< 7.52616 weeks5 / 7Str.SDCiclo2.4 x 10 5< 9632716 weeks5 / 8Str.SDCiclo2.4 x 10 5< 39702816 weeks3 / 7Str.SDCiclo2.4 x 10 5< 11172918 weeks5 / 5Str.SDCiclo1.5 x 10 5< 70543018 weeks4 / 4SNSDCiclo0.75 x 10 5< 44843120 weeks9 / 9Str.LHCiclo3.4 x 10 5< 5200 Table 3. Batch # Avg. Vol. / 100,000 (mm 3< ) Avg. TH+ / Vol. (mm 3< ) Included in DeSeq2+PCA Included in FIG. 7D and 7EIncluded in FIG. 6G110083790DA-high211413972DA-high323943579DA-high413664001DA-high544134479628973335DA-high700742861DA-low8NDNDXX1101182425DA-low12NDND1300742485DA-low00541583DA-low1400494080DA-low161606658X1705377387DA-highX1800855936DA-lowXX01445894DA-lowX190028923DA-lowXX00574772DA-lowX2002943791X2100265272213803573XX18203536XX2308724754DA-highX08813999DA-high240043345DA-lowX250016580DA-lowX2608561822X2708284461DA-highX2802084869X2916404509DA-highXX3015322911DA-highXX3114303787X
[0131] In all experiments, the scheme of which is illustrated in FIG. 4E, hESCs were differentiated for 16 days in vitro, and various different batches of ventral mesencephalic-patterned hESCs were grafted into rats subjected to unilateral dopaminergic lesions with 6-OHDA. FIG. 4A is set of photographs of the grafts after the cells matured in vivo, and the brains were stained with TH. Although all ventral mesencephalon-patterned cell batches were routinely assessed for high expression of ventral mesencephalon markers LMX1A, FOXA2, and OTX2 prior to grating, the in vivo outcome with respect to graft size and number of dopamine neurons varied between experiments.
[0132] To determine the level of batch-to-batch variability from these experiments, the total number of TH+ neurons of each animal per 100,000 cells grafted (DA yield) was quantified, which is graphically illustrated in FIG. 4B, and the graft size was based on HuNu+ cell volume (mm 3< ) following immunostaining. The graphical representation of graft volume is seen in FIG. 4C. For all quantifications, values were reported per 100,000 cells grafted. This permitted estimation of DA densities (TH+ / mm 3< ) for all grafts, which are represented in FIG. 4D. These quantitative assessments revealed considerable inter-experimental variability.
[0133] To determine what degree commonly used mesDA progenitor marks in vitro predicted TH+ content in grafts after maturation in vivo, RNA samples were collected from each individual cell batch enumerated above (all containing high levels of FOXA2 / LMX1A co-expressing cells) at the day of transplantation and analyzed. RNA samples from the same cells replated were also analyzed after further in vitro maturation.
[0134] FIG. 4F is a set of graphs indicating the mean TH+ cell content in each graft experiment plotted versus gene expression of FOXA2, LMX1A, and CORIN in the transplanted cell population on day 16 (i.e. day of transplantation). Similarly, FIG. 4G is also a set of graphs representing transplanted cell population on day 16, but the graphs indicate the gene expression of TH, NURR1, and AADC. Results from a Spearman correlation (ventral mesencephalon cells only) are given as R and p-values in each graph, and the tendencies of correlation are shown by linear regression lines.
[0135] It was found that expression of commonly used mesDA markers FOXA2, LMX1A, and CORIN was required for dopaminergic differentiation of the grafts. However, FOXA2 and LMX1A expression levels at the time-point of transplantation did not correlate significantly with DA yield in the grafts, suggesting that within the FOXA2 / LMX1A co-expressing cells, additional markers are needed to predict the in vivo outcome.
[0136] FIGS. 4F and 4G represent an assessment of whether extended in vitro maturation of the progenitors into neurons reflected their corresponding in vivo maturation in the grafts. In further experiments where the cells used for grafting had also been subjected to parallel terminal differentiation in vitro for 39-45 days (instead of only 16 days), it was found that the expression levels of DA markers TH, NURR1, and AADC did not show any statistically significant correlation to DA yield after transplantation.EXAMPLE 6
[0137] To enable an unbiased search for potential markers which correlate positively with DA yield after transplantation (i.e. successful graft outcome), global gene expression profiling was performed of cell samples collected at the day of transplantation using RNA sequencing.
[0138] For unbiased gene expression analysis, graft experiments were divided into DA-high and DA-low groups based on the total number of TH+ cells in the grafts. A graphical comparison of the TH+ content between batches is shown in FIG. 5A. Dopaminergic function of the grafts was assessed in grafts with longterm maturation (i.e. longer than 16 weeks) through amphetamine induced rotation or PET imaging. A "-" symbol indicates a lack of functional recovery, a "+" symbol indicates functional recovery, and "ND" indicates "not determined.
[0139] Importantly, all longterm grafts with lack of functional recovery were located in the DA-low group, whereas the DA-high group contained cells with therapeutic potential able to mediate functional recovery.
[0140] To see if the DA-high and DA-low cell batches could be identified by distinct gene expression profiles, an unbiased principal component analysis (PCA) was performed on all the selected day 16 RNA sequencing samples. As shown in FIG. 5B, a clustering of the DA-high samples was observed positive PC1 axis, which contained genes such as FGF8, PAX5, EN2, and CNPY1, all of which have been shown to be important for midbrain-hindbrain boundary (MHB) formation.
[0141] As there were clearly distinct expression profiles between the two groups, a Deseq2 analysis was conducted to identify all differentially expressed genes between the DA-high and DA-low samples. FIG. 5I is a graphical analysis of predictive markers following the Deseq2 analysis of RNA sequencing data from DA-high and DA-low cell samples. Markers were plotted based on log2 fold change compared to mean of normalized counts. From the top 12 ranked genes appearing from this analysis, again a high representation was found of genes expressed in the caudal ventral mesencephalon and MHB regions to be positively associated with DA yield in vivo, i.e. PAX5, FGF8, SPRY1, EN1, EN2, SP5, ETV4, CNPY1, TLE4, and ETV5. These expression profiles are reflected in FIG. 5C. These 12 genes are those with the highest fold change and with a p-value of <0.001.
[0142] To assess the predictive value of these selected markers, a direct Spearman correlation analysis was conducted between graft outcomes (i.e. TH+ content) to the RNA expression levels of selected genes from the PCA and Deseq2 analyses. FIGS. 5D-5E specifically show the results from the Spearman correlation analysis for EN1 and PAX8. Results from the Spearman correlation analysis were given as R and p-values, and correlations were visualized with linear regression lines. To validate the RNA sequencing dataset, a subset of gene correlations was assessed using qRT-PCR, including 4 additional graft experiments, which are represented as FIG. 5E specifically.
[0143] A summary of the RNA sequencing correlation analysis between TH+ content, graft volume, and DA density and RNA levels of MHB genes and common ventral mesencephalon markers is shown in FIG. 5F. The schematic only shows positive correlations defined by the Spearman correlation analysis with p < 0.05. Genes verified by qRT-PCR are shown in bold.
[0144] These correlations were compared to the correlations of commonly used ventral mesencephalon markers (i.e., LMX1A, LMX1B, FOXA2, FOXP2, CORIN, and OTX2).
[0145] The analyses showed that most of the caudal ventral mesencephalon markers identified by DeSeq2 showed positive correlation with graft size and total TH content of the grafts, as shown in FIG. 5G. FIG. 5G in particular is a graphical representation of a Spearman distance analysis of RNA levels in cell batches, showing co-regulation of MHB genes. Markers EN1, SPRY1, WNT1, ETV5, and CNPY1 correlated positively with DA density (TH+ / mm 3< ). These contrasted to the broader and more widely expressed ventral mesencephalon markers FOXA2, LMX1A, CORIN, FOXP1, and FOXP2, which by several analyses showed negative correlations to both graft size and total DA yield, indicating they may be uncoupled or negatively coupled to the MHB genes cluster. LMX1A and OTX2 showed positive correlations only to DA density but not to DA yield of the grafts.
[0146] To investigate whether the genes identified in the RNA sequencing analysis formed part of a co-regulated gene network, a Spearman correlation analysis was performed of the expression values for each candidate gene towards others in 29 batches of ventral mesencephalon-patterned cells. As seen in FIG. 5G, all of the MHB genes associated with high DA yield showed a pattern of co-regulation. In particular, the MHB markers SPRY1 and ETV4 / 5 and the caudal ventral mesencephalon markers EN1 and CNPY1 clustered in the analysis, suggesting a strong co-regulation between the genes. However, LMX1A and OTX2 showed little or no positive co-regulation with these genes. CORIN, LMX1B, FOXA2, and FOXP2 were negatively correlated with several of the caudal genes, indicating that these commonly used markers are not specifically associated with a caudal ventral mesencephalon phenotype and that they may be expressed at higher levels in the more rostral domains of the ventral mesencephalon. Other ventral mesencephalon markers reported to be involved in mesDA neurogenesis, namely MSX1, SOX6, and PBX1, did not show any correlations to DA density of the grafts when analyzed in d16 ventral mesencephalon-patterned progenitors. FIG. 5H is a set of five representative images of TH+ neurons from different cell batches with high expression of predictive markers, revealing the mature morphology of the grafted cells.EXAMPLE 7
[0147] Using RNA sequencing expression values, a strong negative correlation was found between the diencephalic markers FEZF1, WNT7B, and EPHA3 and DA yield in grafts at day 16, as shown in FIG. 6A. This correlation led to an investigation of whether some batches of ventral mesencephalon-patterned hESCs contained BARHL1 +< and PITX2 +< STN progenitors were derived from the anterior LMX1A +< / FOXA2 +< domain.
[0148] Both BARHL1 +< and PITX2 +< were detected in the differentiated cell batches on day 16. FIG. 6B is a set of images following immunostaining of ventral mesencephalic-patterned hES cell cultures at day 16, revealing the presence of STN domain fates (i.e. BARHL1 +< / FOXA2 +< and PITX2 +< / LMX1 +< cells). FIG. 6C is a schematic overview of expression domains of PITX2 and BARHL1 in the diencephalic STN region and in lateral midbrain domains. FIG. 6G shows the cell cultures of FIG. 6B at day 42 of differentiation.
[0149] As depicted in FIGS. 6B-6C, the BARHL1 +< cells could have been either FOXA2 +< or FOXA2 -< , indicating the presence of both diencephalic floorplate cells as well as lateral cell populations in the differentiated progenitor batches. It was further found that FOXA2 +< / BARHL1 +< / MAP2 +< neurons and PITX2 +< / LMX1A / B +< cells were present in the terminally differentiated hES cell cultures, indicating the differentiation of these progenitors into STN fates.
[0150] FIG. 6D is a set of images following confocal imaging of 18 week old grafts. In animals grafted with ventral mesencephalon-patterned cells, variable presence of BARHL1 +< cells was detected, and these cells would have been either PITX2 +< (indicating ventral diencephalic STN fates) or PITX2 -< (indicating other lateral fates). Example images of BARHL1 +< cell content in grafts derived from cell batches with low or high BARHL1 RNA levels at the day of transplantation are shown in FIG. 6E.
[0151] To investigate if these markers could be used to predict the amount of non-dopaminergic lateral and rostro-ventral contaminating cells in the grafts, the numbers of BARHL1 +< cells were quantified in several of the graft experiments. Correlation analysis showed that the density of BARHL1 +< cells in the grafts positively correlated with the expression levels of BARHL1 and BARHL2 in vitro in the differentiated cell batches at the day of transplantation, as shown in FIGS. 6D and 6F. Results from the Spearman correlation analysis are given as R and p-values in each graph, and correlations are visualized with linear regression lines.
[0152] These results implied that BARHL1 and BARHL2 in progenitor cultures could be used as markers for identifying and quantifying several commonly occurring contaminating populations in ventral mesencephalon-patterned hESCs both in vitro and in vivo.EXAMPLE 8
[0153] Given the variable outcome of ventral mesencephalon-patterned hES cell progenitors, it was next investigated if the patterning in differentiation protocol could be optimized toward the caudal dopaminergic domain of the ventral mesencephalon (because markers of this domain correlated with high DA yield in vivo). Cells located in the caudal ventral mesencephalon are in proximity to the MHB, and studies in the mouse and chick models have shown that the development of mesDA progenitors in this region depends on the activity of FGF8, a growth factor that is secreted from the MHB. In addition, high expression of FGF8 was found to correlate to the DA-high group in the gene expression analyses as seen in FIG. 5C above.
[0154] FIG. 7A is a set of graphs created following a qRT-PCR analysis at day 10 of differentiating hESCs treated with exogenous FGF8b during ventral mesencephalon patterning from days 0-9. The analysis shows induction of forebrain and hindbrain markers in ventral diencephalic (CHIR = 0.4 µM) or ventral mesencephalic (CHIR = 0.8 µM) cultures.
[0155] It was found that the addition of FGF8b to the differentiation medium together with SHH and GSK3i to activate canonical WNT signaling during the early phase of neural induction and patterning (day 0-9) induced significant upregulation of forebrain markers FOXG1 and SIX3 in diencephalic-patterned cultures and of hindbrain markers HOXA2 and GBX2 in mesencephalic-patterned cultures. This indicated that early patterning with FGF8b caused contamination of cultures with several non-ventral mesencephalon progenitor fates. FIG. 7B is a set of images following immunostaining at day 16, revealing patches of PITX2 +< and NKX2.1 +< cells and patches of LMX1A- cells in cultures treated with FGF8b from days 0-9.
[0156] In contrast, the FOXA2 +< / LMX1A +< phenotype of the cells was maintained, as shown in FIG. 7C, if FGF8b was added to the cells after initial patterning towards ventral mesencephalon was completed (from day 7-16 or 9-16).
[0157] FIGS. 7D-7F correspond to day 16 cultures treated with FGF8b. The addition of 100 ng / mL FGF8b caused caudalisation of the ventral mesencephalon progenitors when the cultures were treated with FGF8b from day 9-16. As shown in the immunostaining images of FIG. 7D-7E, the results of which were quantified in FIG. 7F, BARHL1 +< and PITX2 +< levels were both decreased. However, whereas control ventral mesencephalon cultures were completely devoid of EN1 expression, EN1 +< progenitors and EN1 mRNA were abundant in cultures treated with FGF8b from day 9-16. FIG. 7E is a set of images showing the immunostaining of EN1, while FIG. 7G graphically represents mRNA levels of FOXA2, LMX1A, OTX2, and EN1 following qRT-PCR analysis.
[0158] In summation, treatment with FGF8b from day 9-16 further caused a significant decrease in the percentage of BARHL1+ / FOXA2+ and PITX2+ STN progenitors, which is illustrated in FIGS. 7D-7F. This decrease indicated that late addition of FGF8b to cultures shifted progenitor fates from anterior ventral mesencephalon and STN fates toward caudal ventral mesencephalon mesDA progenitor fates.
[0159] Flow cytometry analysis, exhibited as FACS plots in FIGS. 7H-7I, showed that although addition of FGF8b from day 9-16 did not affect the percentage of FOXA2 +< progenitors, there was a 47% decrease in the number of CORIN +< progenitors. This was in accordance with the negative correlations found for CORIN in the RNA sequencing analyses associated with FIGS. 5F-5G and indicates that CORIN expression both at the protein and mRNA level is more strongly associated with a rostral ventral mesencephalic / diencephalic fate rather than a caudal mesDA progenitor fate.Reference example 9
[0160] To develop a GMP-compatible differentiation protocol for high and reproducible yield of caudilised mesDA ventral mesencephalon progenitors that would result in good graft outcome, a fully GMP-derived hES cell line RC17 from Roslin cells (hPS Creg #RCe021-A) was used. Previous research grade ventral mesencephalon differentiation protocols have implemented steps of embryoid body (EB) formation or culturing on Matrigel, both of which pose problems in GMP adaptation due to difficulties in reproducibility and the content of undefined animal-derived component, respectively.
[0161] Seven different full-length laminin subtypes were tested, and it was found that four of them (LN-111, LN-421, LN-511, and LN-521) efficiently supported adherent differentiation of ventral mesencephalon progenitors from day 0-11 of the protocol. This is illustrated in FIG. 8A, which is a set of images revealing the best attachment and yield of neural cells across the seven tested laminin subtypes. Relative to a standard yield of 100%, LN-111 yielded 170%, LN-421 yielded 294%, LN-511 yielded 223%, and LN-521 yielded 208%. RC17 cells were differentiated according to the methods described herein, but on plates that were coated with laminin-121 instead of laminin-111. FIG. 8C compares the yields, and the yields are about equal to each other, i.e. LN-121 works about as well as LN-111 as a substrate.
[0162] In contrast to LN-511 and LN-521, which efficiently support growth of hPSCs, it was found that when undifferentiated hESCs were plated onto LN-111 in pluripotency medium (iPS brew), the cells formed spheres after 4 days of culturing, that easily detached from the culture dish, as shown in the images of FIG. 8B. When the same number of cells was plated onto LN-111 in B27 medium, the cultures remained adherent and grew to confluency after 7 days of differentiation while showing rapid downregulation of pluripotency markers. FIG. 8D is a set of images taken at Days 0, 2, 4, and 7, exhibiting the seeding of low density hESCs on LN-111 matrix in B27 medium resulted in confluent neuralized cultures, while FIG. 8E is a graphical illustration of the pluripotency markers' mRNA levels decreasing over three days of differentiation. This indicated that LN-111 selectively supported the growth of neural cells but not pluripotent stem cells, which is in agreement with its broad expression in the developing brain.
[0163] Next, different combinations of GMP-compatible basal medium was tested with the aim of optimizing the total yield and purity of ventral mesencephalon progenitors. It was found that the differentiation in a basal medium of NeuroBasal +DMEM / F12 with N2 supplement but without B27 supplement from day 0-11 produced the highest yield of cells on day 11. FIG. 8F is a graphical representation of the cell yield across the different media.
[0164] To ensure accurate caudalisation of the ventral mesencephalon progenitors, 100 ng / mL of FGF8b was added to the cells from day 9-16 of differentiation. For full GMP compatibility, all growth factors and chemicals in the protocol were switched to those enumerated in Table 4 below. Table 4.Reagent Supplier Cat. No. For Differentiation iPS brewMiltenyi130-104-368LN-521BioLaminaLN-521LN-511BioLaminaLN-111DPBS+Ca+Mg (CTS)LTA12858-01EDTALT15575-020PBS - / - CTSLTA12856-01DMEM:F12LT21331-020Neurobasal CTSLTA13712-01N2 supplement CTSLTA13707-01B27 supplement w / o vitamin ALT12587-010L GlutamineLT25030-081AccutaseGMPInnov. Cell TechAccutaseGMPSB431542Miltenyi130-105-336CHIR99021 in 10 mM solutionMiltenyi130-106-539Y-27632 dihydrochlorideMiltenyi130-103-922Noggin GMPR&D6057-GMPBDNF GMPR&D248-GMPSHH C24II premium gradeMiltenyi130-095-727Ascorbic acidTocris4055FGF8b premium gradeMiltenyi130-095-740For Transplantation HBSS (no Ca / Mg, no phenol red)LT14175-046Pulmozyme (dornase alpha)Roche11899
[0165] As illustrated in FIG. 2, the GMP-compatible protocol consisted of plating approximately 1 x 10 6< hESCs on a substrate containing LN-111, which were then cultured with N2 medium, SB431542, Noggin, Shh-C24II, and CHIR 99021 on days 0-9. The first culture was then removed and the plated cells were exposed to N2 medium and FGF8b on days 9-11, resulting in progenitors. The progenitor cells were then replated onto three separate plates at 0.8 x 10 6< / cm 2< with a ROCK inhibitor (Y-27632). On days 11-16, the Y-27632 was removed and each plate was cultured in B27, FGF8b, BDNF, and ascorbic acid to result in cells covering an area of approximately 1.78±0.13 x 10 6< / cm 3< . This final yield was more than 40 times higher than the yield obtained with the original EB-based research grade differentiation protocol.
[0166] Based on these numbers, it was extrapolated that more than 380 million transplantable progenitor cells could be produced in 16 days when starting from 1 million undifferentiated hESCs. FIG. 8G is a graphical illustration of the counted cells from the EB-based protocol compared to the counted cells from the GMP / LN-111 protocol.
[0167] After terminally differentiating these progenitors in vitro, patch-clamp electrophysiology was performed on hESC differentiated to a ventral mesencephalon fate at day 45 post-differentiation. Cells grown on coverslips were submerged in a continuously flowing Krebs solution (119 mM NaCl, 2.5 mM KCI, 1.3 mM MgSO 4 , 2.5 mM CaCl 2 , 25 mM Glucose and 26 mM NaHCO 3 ) gassed with 95% O 2 - 5% CO 2 at 28°C. Recordings were made with a Multiclamp 700B amplifier (Molecular Devices), using borosilicate glass pipettes (3-7 MOhm) filled with 122.5 mM potassium gluconate, 12.5 mM KCI, 0.2 mM EGTA, 10 mM Hepes, 2 mM MgATP, 0.3 mM Na 3 GTP and 8 mM NaCl adjusted to pH 7.3 with KOH. Data was acquired with pClamp 10.2 (Molecular Devices); current was filtered at 0.1 kHz and digitized at 2kHz. Cells with neuronal morphology with round cell body were selected for whole-cell patch clamp. Resting membrane potentials were monitored immediately after breaking-in in current-clamp mode. Thereafter, cells were kept at a membrane potential of -60mV to -80mV, and 500ms currents were injected from -20pA to +90pA with 10pA increments to induce action potentials. For rebound depolarizations the cells were injected with a train of small currents of 20 pA to induce action potentials. Spontaneous post-synaptic currents were recorded at resting membrane potentials using the same internal solution.
[0168] It was verified that the cells gave rise to neurons which evoked action potentials when assessed by patch clamp electrophysiology (11 / 11). In the mature fraction of neurons (resting membrane potential < -40 mV), 4 out of 7 cells further showed rebound action potentials after brief depolarization, which is characteristic of midbrain dopamine neurons in vitro. FIG. 8H is representative of the trace of action potentials induced with depolarizing current injections. FIG. 8I is a graph illustrating that some ventral mesencephalon cells showed spontaneous post-synaptic currents indicative of synaptic integration in the dish. FIG. 8J is an example of rebound depolarization after brief membrane depolarization characteristic of a dopaminergic phenotype. FIG. 8K is an inset from FIG. 8J showing a respective trace on an expanded scale.Reference example 10
[0169] To validate that the new protocol of FIG. 3 gave rise to pure populations of ventral mesencephalon progenitors, cultures were stained for FOXA2 and LMX1A / B, and high co-localisation of the two proteins was found. FIG. 9A is a set of photographs after immunostaining the progenitors, illustrating that the cultures differentiated showed a very high overlap of LMX1A / FOXA2. FIG. 9B is a set of graphs following flow cytometry analysis, indicating the cultures contained on average 95% OTX2 +< / FOXA2 +< progenitors on day 16 of differentiation.
[0170] To monitor batch-to-batch variations predictive of in vivo outcome, a qRT-PCR panel was designed implementing the new key predictive markers (EN1, SPRY1, PAX8, CNPY1, and ETV5). Human embryonic stem cells were differentiated according to the GMP protocol of Example 10, and then assessed on day 16 of differentiation for correct rostro-caudal ventral mesencephalon patterning as well as markers to monitor for the presence of any contaminating forebrain (FOXG1), hindbrain (HOXA2), or lateral (PAX6) cell populations. The specificities of all primers used in the panel were verified in samples of sub-dissected human fetal tissue enumerated in Table 5 below. Table 5.Gene Full Gene Name Primer Sequence (fwd / rev) AADCDDC (DOPA decarboxylase)GGGGACCACAACATGCTGCTCC (SEQ ID NO: 1)AATGCACTGCCTGCGTAGGCTG (SEQ ID NO: 2)ACTBBeta-actinCCTTGCACATGCCGGAG (SEQ ID NO: 3)GCACAGAGCCTCGCCTT (SEQ ID NO: 4)BARHL1BarH-like homeobox 1GTACCAGAACCGCAGGACTAAA (SEQ ID NO: 5)AGAAATAAGGCGACGGGAACAT (SEQ ID NO: 6)BARHL2BarH-like homeobox 2GGAGATTACGAGTAGCCGTGAG (SEQ ID NO: 7)AAGCTACGCTCCAGTTGATTGA (SEQ ID NO: 8)CORINCorin, serin peptidaseCATATCTCCATCGCCTCAGTTG (SEQ ID NO: 9)GGCAGGAGTCCATGACTGT (SEQ ID NO: 10)CNPY1Canopy FGF signaling regulator 1TTGGCCTCTCAAACACCATTCT (SEQ ID NO: 11)GAGCGAAACAAAACGCAATCAC (SEQ ID NO: 12)EN1Engrailed 1CGTGGCTTACTCCCCATTTA (SEQ ID NO: 13)TCTCGCTGTCTCTCCCTCTC (SEQ ID NO: 14)ETV5Ets Variant 5TCATCCTACATGAGAGGGGGTT (SEQ ID NO: 15)GACTTTGCCTTCCAGTCTCTCA (SEQ ID NO: 16)FOXA2Forkhead box A2CCGTTCTCCATCAACAACCT (SEQ ID NO: 17)GGGGTAGTGCATCACCTGTT (SEQ ID NO: 18)FOXG1Forkhead box G1 (BG1)TGGCCCATGTCGCCCTTCCT (SEQ ID NO: 19)GCCGACGTGGTGCCGTTGTA (SEQ ID NO: 20)FOXP2Forkhead box P2ATGAGCACTCTAAGCAGCCAAT (SEQ ID NO: 21)GTTGCAGATGCAGCAGTTCTAC (SEQ ID NO: 22)GAPDHGlyceraldehyde-3-phosphate dehydrogenaseTTGAGGTCAATGAAGGGGTC (SEQ ID NO: 23)GAAGGTGAAGGTCGGAGTCA (SEQ ID NO: 24)GBX2Gastrulation brain homeobox 2GTTCCCGCCGTCGCTGATGAT (SEQ ID NO: 25)GCCGGTGTAGACGAAATGGCCG (SEQ ID NO: 26)HOXA2Homeobox A2CGTCGCTCGCTGAGTGCCTG (SEQ ID NO: 27)TGTCGAGTGTGAAAGCGTCGAGG (SEQ ID NO: 28)LMX1APrimers spanning 3' UTR of LMX1ACGCATCGTTTCTTCTCCTCT (SEQ ID NO: 29)CAGACAGACTTGGGGCTCAC (SEQ ID NO: 30)LMX1BLIM homeobox transcription factor bCTTAACCAGCCTCAGCGACT (SEQ ID NO: 31)TCAGGAGGCGAAGTAGGAAC (SEQ ID NO: 32)NKX2.1NK2 homeobox 1AGGGCGGGGCACAGATTGGA (SEQ ID NO: 33)GCTGGCAGAGTGTGCCCAGA (SEQ ID NO: 34)NURR1NR4a2CAGGCGTTTTCGAGGAAAT (SEQ ID NO: 35)GAGACGCGGAGAACTCCTAA (SEQ ID NO: 36)OCT4POU5F1TCTCCAGGTTGCCTCTCACT (SEQ ID NO: 37)GTGGAGGAAGCTGACAACAA (SEQ ID NO: 38)OTX2Orthodenticle homeobox 2ACAAGTGGCCAATTCACTCC (SEQ ID NO: 39)GAGGTGGACAAGGGATCTGA (SEQ ID NO: 40)PAX8Paired box 8ATAGCTGCCGACTAAGCATTGA (SEQ ID NO: 41)ATCCGTGCGAAGGTGCTTT (SEQ ID NO: 42)PITX3Paired-like homeodomain 3GGAGGTGTACCCCGGCTACTCG (SEQ ID NO: 43)GAAGCCAGAGGCCCCACGTTGA (SEQ ID NO: 44)SHHSonic hedgehogCCAATTACAACCCCGACATC (SEQ ID NO: 45)AGTTTCACTCCTGGCCACTG (SEQ ID NO: 46)SIM1Single-minded homolog 1AAAGGGGGCCAAATCCCGGC (SEQ ID NO: 47)TCCGCCCCACTGGCTGTCAT (SEQ ID NO: 48)SIX3SIX homeobox 3ACCGGCCTCACTCCCACACA (SEQ ID NO: 49)CGCTCGGTCCAATGGCCTGG (SEQ ID NO: 50)SOX1SRY (sex determining region Y)-box 1GGGAAAACGGGCAAAATAAT (SEQ ID NO: 51)TTTTGCGTTCACATCGGTTA (SEQ ID NO: 52)SPRY1Sprouty 1GCCCTGGATAAGGAACAGCTAC (SEQ ID NO: 53)GCCGAAATGCCTAATGCAAAGA (SEQ ID NO: 54)THTyrosine hydroxylaseCGGGCTTCTCGGACCAGGTGTA (SEQ ID NO: 55)CTCCTCGGCGGTGTACTCCACA (SEQ ID NO: 56)WNT1Wingless-type MMTV integration site family, member 1GAGCCACGAGTTTGGATGTT (SEQ ID NO: 57)TGCAGGGAGAAAGGAGAGAA (SEQ ID NO: 58)
[0171] To assess the reproducibility and accuracy of the new GMP protocol compared to the research-grade protocol, 34 research grade and 43 GMP ventral mesencephalic batches were analyzed using the designed qRT-PCR panel.
[0172] FIG. 9C is an image of comparing hESCs differentiated according to the two protocols. The hESCs were assessed for RNA expression on day 16 of differentiation. Differentiations toward ventral forebrain (vFB) and ventral hindbrain (vHB) were included as controls. Values were color-coded and normalized to the sample with the highest gene expression for each gene.
[0173] While all batches of cells had very robust expression of OTX1, OTX2, LMX1A, LMX1B, and FOXA2, there was considerable variation in the expression of caudal ventral mesencephalon markers PAX8, EN1, SPRY1, and ETV5 between batches generated with the research-grade protocol. The research grade cell batches generally tended to fall into two categories: (i) cell batches with high levels of EN1, PAX8, ETV5, SPRY1, and HOXA2; or (ii) cell batches with low levels of EN1, PAX8, ETV5, SPRY1, and HOXA2, while only very few batches contained high levels of caudal ventral mesencephalon markers (EN1, PAX8, ETV5, SPRY1) in the absence of HOXA2 expression.
[0174] These expression patterns indicated that the presence of hindbrain cells (HOXA2 +< ) was necessary for induction of a full caudal ventral mesencephalic identity in the cultures generated by the research grade protocol, since the absence of hindbrain cells yielded cultures with a predominantly rostral ventral mesencephalic identity. In contrast, implementation of the new GMP protocol yielded batches of cells which were more homogenous and which did not contain high levels of HOXA2 contamination.
[0175] Addition of FGF8b to the GMP protocol (day 9-16) caused robustly induced high-level expression of caudal ventral mesencephalon markers (EN1, PAX8, ETV5, and SPRY1), which had been shown to be predictive of DA yield concomitantly with a reduction in the expression of markers negatively correlated with high DA yield (CORIN and FOXP2). This caudalisation took place in the absence of HOXA2 contamination. When assessing grafts from two clinically relevant cell lines (H9 and RC17) differentiated according to the GMP protocol of Example 10, it was found that both lines generated neuron rich grafts with a high number of TH-expressing cells. FIG. 9D (H9) and FIG. 9E (RC17) are representative images of grafts from batches containing high levels of caudal ventral mesencephalon markers. These cells densely innervated the host striatum (see those labeled with D" and E") and expressed mature mesDA markers. The protocol had decreased hindbrain contamination and increased expression of caudal ventral mesencephalon markers, which were predictive of a good graft outcome.Reference example 11
[0176] To determine if the GMP protocol yielded cells with functional dopaminergic activity in vivo and if the anterior versus caudal VM phenotypes were truly predictive of in vivo efficacy, the cells were assessed by transplantation to an animal model of Parkinson's Disease. Two groups of rats subjected to unilateral 6-OHDA lesions were assessed for amphetamine-induced rotations before and after intrastriatal transplantation with VM-patterned RC17 cells differentiated according to the LN-111 GMP protocol (protocol in Fig. 2). One group of animals (mesDA RC17) received cells differentiated in the presence of FGF8b from day 9-16 to yield caudal VM mesDA progenitors expressing high levels of predictive markers EN1, CNPY1, SPRY1, ETV5 and PAX8 as shown in Fig 9C. As exhibited in FIG. 10, this group of animals exhibited functional recovery as evidenced by reversal and overcompensation (by week 22) of amphetamine-induced rotations. A decrease in rotations is equivalent to behavioral recovery, as the lesions cause rotation in the rats. If the graft is functional, the rotational behavior is abolished. In contrast, animals receiving cells differentiated in the absence of FGF8b to yield rostral VM cells of the STN domain (STN RC17 group) did not exhibit functional recovery of amphetamine-induced rotations. These STN-patterned cells expressed high levels of general VM markers but low levels of predictive caudal VM markers, thereby validating the power of the caudal VM markers for predicting in vivo outcome in animal models of Parkinson's Disease.DISCUSSION
[0177] Pre-clinical evaluation of cells and their in vivo performance is pertinent because for disorders of the central nervous system, transplantation is performed with immature progenitor cells that undergo terminal differentiation and maturation after transplantation in vivo. Transplanted progenitors only become functional after several months in vivo. This complicates the assessment of the therapeutic potential of the cells prior to grafting. It is thus desirable to be able to predict the in vivo maturation of grafted cells based on in vitro characteristics of the progenitors prior to grafting.
[0178] It was found that in vitro differentiation into TH+ neurons does not correlate with the formation of TH+ neurons in vivo. It was also found that although FOXA2, LMX1A and CORIN, which are commonly used to identify mesDA progenitors during development and in stem cell cultures, are necessary for dopamine differentiation after transplantation, they are not sufficient to predict yield or functionality of the cells in vivo. This highlights the need to validate markers that can predict functional maturation of the cell in vivo, rather than relying solely on markers expressed in the differentiating progenitors of a specific cell lineage.
[0179] When applying an unbiased approach to identifying predictive markers of successful graft outcome, it was found that markers expressed by midbrain cells close to the MHB (i.e. EN1, ETV5, CNPY1, PAX8 and SPRY1) correlated with a successful graft outcome, while markers expressed in the diencephalic domain, such as EPHA3, showed a negative correlation with graft outcome. These findings are in line with a recent study in the mouse model showing a remarkably close relationship between mesDA and STN neuronal lineages. Whereas many key transcription factors, including LMX1A, LMX1B, CORIN, FOXA1, FOXA2, FOXP1, FOXP2, MSX1, NURR1, and PBX1, are shared by both lineages, only the mesDA lineage is identified by expression of EN1 and CNPY1, which are restricted to the caudal part of the ventral mesencephalon.
[0180] Based on analyzing these markers, it was confirmed that the ventral mesencephalic-patterned cultures contained both STN and mesDA progenitors and that their relative proportion in each batch likely contributed to the observed, but previously unexplained, variation in in vivo outcome when progenitors defined only by high co-expression of LMX1A, FOXA2 and OTX2 were transplanted.
[0181] Fine tuning the patterning to enrich for dopaminergic progenitors was achieved via timed, exogenous delivery of FGF8b at the progenitor stage of differentiation. This, as well as a number of adjustments, allowed the generation of a full GMP differentiation protocol for the production of mesDA progenitors. Key to this GMP protocol is the use of LN-111, a physiologically relevant extracellular matrix component that is normally expressed in the developing brain and which was found to support attachment of differentiating neural progenitors but not pluripotent stem cells.
[0182] From post-mortem brain analysis of Parkinson's Disease patients transplanted with human fetal ventral mesencephalic tissue, it was determined that grafts containing approximately 100,000 transplanted TH+ neurons are associated with significant clinical benefit in patients. Using the laminin-based GMP protocol, the number of mesDA progenitors obtained per hESC at start of differentiation was greatly increased compared to the research grade protocol, and resulted in graft outcomes matching the best differentiations from the research grade protocol. Given an average yield of about 5000 to 6000 mature DA neurons per 100,000 transplanted progenitors from cell batches high in the predictive markers, manual production of cells for several hundred patients can be achievable even in small GMP labs without the need for automated culture systems. The protocol presented here omits many of the large-scale production issues associated with other stem cell therapies going into a clinic.
[0183] Further, the in vivo efficacy of the GMP protocol as well as the predictive powers of the newly identified markers listed above were verified in Example 11 and FIG. 10. A decrease in rotations was considered equivalent to behavioral recovery, as the dopaminergic 6-OHDA lesions caused animals to rotate. A graft was considered functional if it abolished the rotational behavior down to or below the baseline of 0.
[0184] The global gene profiling of a large number of cell batches that have been transplanted into a rat model allowed the establishment of a panel of markers to much more precisely predict a successful graft outcome at the progenitor stage in vitro. The ability to better predict graft outcome will accelerate the progression of stem cells towards clinical use and can be used for batch-to-batch comparability as well as to compare the cells grafted in different clinical trials. In the long term, a better prediction of in vivo maturation and functional properties of the cells already at the progenitor level will facilitate the use of autologous or individually matched cells for transplantation.
[0185] It will be appreciated that variants of the above-disclosed and other features and functions, or alternatives thereof, may be combined into many other different systems or applications. Various presently unforeseen or unanticipated alternatives, modifications, variations or improvements therein may be subsequently made by those skilled in the art which are also intended to be encompassed by the following claims.
Claims
1. A method for inducing production of caudalised ventral mesencephalon progenitor cells, comprising: plating embryonic stem cells onto a substrate containing laminin-111, wherein said stem cells are cultured in cell culture mediums to produce said caudalised ventral mesencephalon progenitor cells, wherein said caudalised ventral mesencephalon progenitor cells express high levels of EN1, SPRY1, WNT1, CNPY1, PAX8, ETV5, PAX5, FGF8, SP5, or TLE4, wherein the stem cells are cultured in a primary medium comprising N2 medium, a TGF-β inhibitor, noggin, sonic hedgehog protein, and a GSK3 inhibitor, and which does not contain B27 supplement, wherein the primary medium is removed and a secondary medium is added, the secondary medium comprising N2 medium and a fibroblast growth factor (FGF), and which does not contain B27 supplement, wherein the FGF is FGF8b, wherein the substrate consists of intact laminin or fragments of the laminin, wherein the secondary medium is added 156 hours to 228 hours after the plating, wherein the secondary medium is removed and the stem cells are replated, wherein the replating occurs 252 hours to 276 hours after the plating, wherein the replating occurs using a tertiary medium that comprises a B27 medium, a ROCK inhibitor, the FGF, a brain derived neurotrophic factor (BDNF), and ascorbic acid, and / or wherein the stem cells are then cultured in a quaternary medium, the quaternary medium comprising a B27 medium, the FGF, a brain derived neurotrophic factor (BDNF), and ascorbic acid.
2. The method of claim 1, wherein the stem cells are cultured in the quaternary medium until 324 hours to 396 hours after the plating, or wherein the stem cells are cultured in the quaternary medium for a time period of 108 hours to 132 hours.