Method for generating new gene in organism and use thereof

EP4334452A4Pending Publication Date: 2025-06-18QINGDAO KINGAGROOT CHEM COMPOUNDS CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2022798612
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-05-02
Filing Date
2022-04-29
Publication Date
2025-06-18

Smart Images

  • Figure 1_WO2022233271A1
    Figure 1_WO2022233271A1
  • Figure 2_WO2022233271A1
    Figure 2_WO2022233271A1
  • Figure 3_WO2022233271A1
    Figure 3_WO2022233271A1
Patent Text Reader

Abstract

Provided is a method for creating a new gene in an organism in the absence of an artificial DNA template, and a use thereof. The method comprises simultaneously generating DNA breaks at two or more different specific sites in the organism's genome, wherein the specific sites are genomic sites capable of separating different gene elements or different protein domains, and the DNA breaks are ligated to each other through non-homologous end joining (NHEJ) or homologous repair to generate a new combination of the different gene elements or different protein domains that is different from the original genome sequence, thereby creating a new gene. The new gene can change the growth, development, resistance, yield and other traits of the organism.
Need to check novelty before this filing date? Find Prior Art

Description

Method for generating new gene in organism and use thereofTechnical Field

[0001] The present invention relates to the technical fields of genetic engineering and bioinformatics, and in particular, a method for creating a new gene in an organism in the absence of an artificial DNA template, and use thereof.

[0002] Background Art

[0003] Generally speaking, a complete gene expression cassette in an organism comprises a promoter, 5' untranslated region (5' UTR) , coding region (CDS) or non-coding RNA region (Non-coding RNA) , 3' untranslated region (3'UTR) , a terminator and many other elements. Non-coding RNA can perform its biological functions at the RNA level, including rRNA, tRNA, snRNA, snoRNA and microRNA. The CDS region contains exons and introns. After the transcribed RNA is translated into a protein, the amino acids of different segments usually form different domains. The specific domains determine the intracellular localization and function of the protein (such as nuclear localization signal, chloroplast leading peptide, mitochondrial leading peptide, DNA binding domain, transcription activation domain, enzyme catalytic center, etc. ) . For non-coding RNA, different segments also have different functions. When one or several elements of a gene change, a new gene will be formed, which may have new functions. For example, an inversion event of a 1.7Mb chromosome fragment occurred upstream of the PpOFP1 gene of flat peach may result in a new promoter, which will significantly increase the expression of PpOFP1 in peach fruit with flat shape in the S2 stage of fruit development as compared to that in peach fruit with round shape, thereby inhibit the vertical development of peach fruit and result in the flat shape phenotype in flat peach (Zhou et al. 2018. A 1.7-Mb chromosomal inversion downstream of a PpOFP1 gene is responsible for flat fruit shape in peach. Plant Biotechnol. J. DOI: 10.1111 / pbi. 13455) .

[0004] The natural generation of new genes in biological genomes requires a long evolutionary process. According to the research work, the molecular mechanisms for the generation of new genes include exon rearrangement, gene duplication, retrotransposition, and integration of movable elements (transposons, retrotransposons) , horizontal gene transfer, gene fusion splitting, de novo origination, and many other mechanisms, and new genes may be retained in species under the action of natural selection through the derivation and functional evolution. The relatively young new genes that have been identified in fruit flies, Arabidopsis thaliana, and primates have a history of hundreds of thousands to millions of years according to a calculation (Long et al. 2012. The origin and evolution of new genes. Methods Mol Biol. DOI: 10.1007 / 978-1-61779-585-5_7) . Therefore, in the field of genetic engineering and biological breeding, taking plants as an example, if it is desired to introduce a new gene into a plant (even if all the gene elements of the new gene are derived from different genes of the species itself) , it can only be achieved through the transgenic technology. That is, the elements from different genes are assembled together in vitro to form a new gene, which is then transferred into the plant through transgenic technology. It is characterized in that the assembly of new gene needs to be carried out in vitro, resulting in transgenic crops.

[0005] The gene editing tools represented by CRISPR / Cas9 and the like can efficiently and  accurately generate double-strand breaks (DSB) at specific sites in the genome of an organism, and then the double-strand breaks (DSB) are repaired through the cell’s own non-homologous end repair or homologous recombination mechanisms, thereby generating site-specific mutations. The current applications of the gene editing technique mainly focus on the editing of the internal elements of a single gene, mostly the editing of a CDS exon region. Editing an exon usually results in frameshift mutations in the gene, leading to the function loss of the gene. For this reason, the gene editing tools such as CRISPR / Cas9 are also known as gene knockout (i.e., gene destruction) tools. In addition to the CDS region, the promoter, 5'UTR and other regions can also be knocked out to affect the expression level of a gene. These methods all mutate existing genes without generating new genes, so it is difficult to meet some needs in production. For example, for most genes, the existing gene editing technology is difficult to achieve the up-regulation of gene expression, and it is also difficult to change the subcellular localization of a protein or change the functional domain of protein. There are also reports in the literature of inserting a promoter or enhancer sequence upstream of an existing gene to change the expression pattern of the gene so as to produce new traits (Lu et al. 2020. Targeted, efficient sequence insertion and replacement in rice. Nat Biotechnol. DOI: 10.1038 / s41587-020-0581-5) , but this method requires the provision of foreign DNA templates, so strict regulatory procedures similar to genetically modified crops apply, and the application is restricted.

[0006] Summary of the Invention

[0007] In order to solve the above-mentioned problems in the prior art, the present invention provides a method for creating a new gene in an organism in the absence of an artificial DNA template by simultaneously generating two or more DNA double-strand breaks at a combination of specific sites in the organism's genome, and use thereof.

[0008] In one aspect, the present invention provides a method for creating a new gene in an organism, comprising the following steps:

[0009] simultaneously generating DNA breaks at two or more different specific sites in the organism’s genome, wherein the specific sites are genomic sites capable of separating different genetic elements or different protein domains, ligating the DNA breaks to each other by a non-homologous end joining (NHEJ) or homologous repair, generating a new combination of the different gene elements or different protein domains that is different from the original genome sequence, thereby creating the new gene.

[0010] In another aspect, the present invention provides a method for in vivo creation of new genes that can be stably inherited in an organism, characterized by comprising the following steps:

[0011] (1) simultaneously generating double-stranded DNA breaks at two or more different specific sites in the organism’s genome, wherein the specific sites are capable of separating different gene elements or different protein domains, and the DNA breaks are then ligated to each other by a non-homologous end joining (NHEJ) or homologous repair, generating a new combination or assemble of the different gene elements or different protein domains derived from the original genomic sequence, thereby the new gene is generated;

[0012] in a specific embodiment, it also includes (2) designing primer pairs that can specifically detect the above-mentioned new combination or assemble, then cells or tissues containing the new genes can be screened out by PCR test, and the characteristic sequences of new  combinations of gene elements can be determined by sequencing; and

[0013] (3) cultivating the above-screened cells or tissues to obtain T0 generation organisms, and perform PCR tests and sequencing on the organisms for two consecutive generations including the T0 generation and its bred T1 or at least three consecutive generations to select the organisms containing the above-mentioned characteristic sequence of new combination of gene elements, namely, a new gene that can be stably inherited has been created in the organism;

[0014] optionally, it also includes (4) testing the biological traits or phenotypes related to the function of the new gene, to determine the genotype that can bring beneficial traits to the organism, and to obtain a new functional gene that can be stably inherited.

[0015] In a specific embodiment, in the step (1) , DNA breaks are simultaneously generated at two different specific sites in the genome of the organism, wherein one site is the genomic locus between the promoter region and the coding region of a gene, meanwhile, the other site is between the promoter region and the coding region of another gene with different expression patterns, resulting in a new combination of the promoter of one gene and the coding region of the other gene that has a different expression pattern; preferably, a combination of the strong promoter and the gene of interest is eventually produced.

[0016] In another specific embodiment, in the step (1) , DNA breaks are simultaneously generated at three different specific sites in the genome of the organism, the three specific sites include two genomic sites whose combination capable of cutting off the promoter region of a highly expressed gene and the third genomic site between the coding region and the promoter region of the gene of interest that has a different expression pattern; or a genomic site between the promoter region and the coding region of a highly expressed gene and another two genomic sites whose combination capable of cutting off the coding region fragment of the gene of interest that has a different expression pattern; then through gene editing at the above-mentioned sites, translocation editing events can be generated, in which the strong promoter fragment that is inserted upstream of the coding region of the gene of interest, or the coding region fragment of the gene of interest is inserted the downstream of the promoter of another highly expressed gene, finally, the combination of the promoter of one gene and the coding region of the other gene of interest with different expression patterns is generated.

[0017] In a specific embodiment, the "two or more different specific sites" may be located on the same chromosome or on different chromosomes. When they locate on the same chromosome, the chromosome fragment resulting from the DNA breaks simultaneously occurring at two specific sites may be deleted, inversed or replicating doubled after repair; when they locate on different chromosomes, the DNA breaks generated at two specific sites may be ligated to each other after repair to produce a crossover event of the chromosome arms. These events can be identified and screened by PCR sequencing with specifically designed primers.

[0018] In a specific embodiment, the "two or more different specific sites" may be specific sites on  at least two different genes, or may be at least two different specific sites on the same gene.

[0019] In a specific embodiment, the transcription directions of the "at least two different genes" may be the same or different (opposite or toward each other) .

[0020] The "gene elements" comprise a promoter, a 5' untranslated region (5'UTR) , a coding region (CDS) or non-coding RNA region (Non-coding RNA) , a 3' untranslated region (3'UTR) and a terminator of the gene.

[0021] In a specific embodiment, the combination of different gene elements refers to a combination of the promoter of one of the two genes with different expression patterns and the CDS or non-coding RNA region of the other gene.

[0022] In another specific embodiment, the combination of different gene elements refers to a combination of a region from the promoter to the 5'UTR of one of two genes with different expression patterns and the CDS or non-coding RNA region of the other gene.

[0023] In a specific embodiment, the "different expression patterns" refer to different levels of gene expression.

[0024] In another specific embodiment, the "different expression patterns" refer to different tissue-specific of gene expression.

[0025] In another specific embodiment, the "different expression patterns" refer to different developmental stage-specificities of gene expression.

[0026] In another specific embodiment, the combination of different gene elements is a combination of adjacent gene elements within the same gene.

[0027] The "protein domains" refer to a DNA fragment corresponding to a specific functional domain of a protein; it includes but is not limited to nuclear localization signal, chloroplast leading peptide, mitochondrial leading peptide, phosphorylation site, methylation site, transmembrane domain, DNA binding domain, transcription activation domain, receptor activation domain, enzyme catalytic center, etc.

[0028] In a specific embodiment, the combination of different protein domains refers to a combination of a localization signal region of one of two protein coding genes with different subcellular localizations and a mature protein coding region of the other gene.

[0029] In a specific embodiment, the "different subcellular locations" include, but are not limited to, a nuclear location, a cytoplasmic location, a cell membrane location, a chloroplast location, a mitochondrial location, or an endoplasmic reticulum membrane location.

[0030] In another specific embodiment, the combination of different protein domains refers to a combination of two protein domains with different biological functions.

[0031] In a specific embodiment, the "different biological functions" include, but are not limited to, recognition of specific DNA or RNA conserved sequence, activation of gene expression, binding to protein ligand, binding to small molecule signal, ion binding, or specific enzymatic reaction.

[0032] In another specific embodiment, the combination of different protein domains refers to a combination of adjacent protein domains in the same gene.

[0033] In another specific embodiment, the combination of gene elements and protein domains refers to a combination of protein domains and adjacent promoters, 5'UTR, 3'UTR or terminators in the same gene.

[0034] Specifically, the exchange of promoters of different genes can be achieved by inversion of  chromosome fragments: when two genes located on the same chromosome have different directions, DNA breaks can be generated at specific sites between the promoter and CDS of each of the two genes, the region between the breaks can be inverted, thereby the promoters of these two genes would be exchanged, and two new genes would be generated at both ends of the inverted chromosome segment. The different directions of the two genes may be that their 5' ends are internal, namely both genes are in opposite directions, or their 5' ends are external, namely both genes are towards each other. Where the genes are in opposite directions, the promoters of the genes would be inverted, as shown in Scheme 1 of Figure 2; where the genes are towards each other, the CDS regions of the genes would be inverted, as shown in Scheme 1 of Figure 4. The inverted region can be as short as less than 10kb in length, with no other genes therebetween; or the inverted region can be very long, reaching up to 300kb-3Mb, andcontaining hundreds of genes.

[0035] It is also possible to create a new gene by doubling a chromosome fragment: where two genes located on the same chromosome are in the same direction, DNA breaks can be generated in specific sites between the promoter and CDS of each of the two genes, the region between the breaks can be doubled by duplication, and a new gene would be created at the junction of the doubled segment by fusing the promoter of the downstream gene to the CDS region of the upstream gene, as shown in Figure 1 Scheme 1 and Figure 3. The length of the doubled region can be in the range of 500bp to 5Mb, which can be very short with no other genes therebetween, or can be very long to contain hundreds of genes. Although this method will induce point mutations in the regions between the promoters and the CDS region of the original two genes, such small-scale point mutations generally have little effect on the properties of the gene expression, while the new genes created by promoter replacement will have new properties of expression. Or alternatively, DNA breaks can be generated at specific positions on both sides of a protein domain of a same gene, and the region between the breaks can be doubled by duplication, thereby creating a new gene with doubled specific functional domains.

[0036] The present invention also provides a new gene obtainable by the present method.

[0037] Compared with the original genes, the new gene may have different promoter and therefore have expression characteristics in terms of tissues or intensities or developmental stages, or have new amino acid sequences.

[0038] The "new amino acid sequence" can either be a fusion of the whole or partial coding regions of two or more gene, or a doubling of a partial protein coding region of the same gene.

[0039] The present invention further provides use of the gene in conferring or improving a resistance / tolerance trait or growth advantage trait in an organism.

[0040] In a specific embodiment, in the combination of different gene elements, one element is a plant endogenous strong promoter or the region from a strong promoter to 5’UTR, and the other is the HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST, SPS, cellulose synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein phosphatase or lycopene cyclase gene coding region of the same plant.

[0041] In a specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the plant endogenous wild-type HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST, SPS,  cellulose synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein phosphatase or lycopene cyclasegenes gene.

[0042] In a specific embodiment, the present invention also provides use of the new gene in the improvement of the resistance or tolerance to a corresponding inhibition of HPPD, inhibition of EPSPS, inhibition of PPO, inhibition of ALS, inhibition of ACCase, inhibition of GS, inhibition of PDS, inhibition of DHPS, inhibition of DXPS, inhibition of HST, inhibition of SPS, inhibition of cellulose synthesis, inhibition of VLCFAS, inhibition of fatty acid thioesterase, inhibition of serine threonine protein phosphatase or inhibition of lycopene cyclase herbicide in a plant cell, a plant tissue, a plant part or a plant.

[0043] In another specific embodiment, in the combination of different gene elements, one element is an endogenous strong promoter or the region from a strong promoter to 5’UTR of the organism, and the other is a gene coding region of any one of the P450 family in the same organism.

[0044] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the corresponding endogenous wild-type P450 gene of the organism.

[0045] In another specific embodiment, the present invention also provides use of the new gene in enhancing biological detoxification capability, stress tolerance or secondary metabolic ability.

[0046] In another specific embodiment, the said P450 gene is rice OsCYP81A gene or maize ZmCYP81A9 gene.

[0047] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the rice endogenous OsCYP81A6 gene or corn endogenous ZmCYP81A9 gene, respectively.

[0048] In another specific embodiment, the present invention also provides use of the new gene in the improvement of the resistance or tolerance of rice or corn to a herbicide.

[0049] In another specific embodiment, in the combination of different gene elements, one element is a maize endogenous strong promoter or the region from a strong promoter to 5’UTR, and the other is the coding region of maize gene ZMM28 (Zm00001d022088) , ZmKNR6 or ZmBAM1d.

[0050] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the plant endogenous wild-type ZMM28 gene, ZmKNR6 gene or ZmBAM1d gene, respectively.

[0051] In another specific embodiment, the present invention also provides use of the new gene in the improvement of maize yield.

[0052] In another specific embodiment, in the combination of different gene elements, one element is a rice endogenous strong promoter or the region from a strong promoter to 5’UTR, and the other is the coding region of rice gene COLD1 or OsCPK24.

[0053] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the rice endogenous wild-type COLD1 gene or OsCPK24, respectively.

[0054] In another specific embodiment, the present invention also provides use of the new gene in the improvement of cold tolerance in rice.

[0055] In another specific embodiment, in the combination of different gene elements, one element  is an endogenous strong promoter or the region from a strong promoter to 5’UTR of the organism, and the other is a gene coding region of any one of the ATP-binding cassette (ABC) transporter family in the same organism.

[0056] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the corresponding endogenous wild-type ATP-binding cassette (ABC) transporter gene of the organism.

[0057] In another specific embodiment, the present invention also provides use of the new gene in enhancing biological detoxification capability or stress tolerance.

[0058] In another specific embodiment, in the combination of different gene elements, one element is a plant endogenous strong promoter or the region from a strong promoter to 5’UTR of the plant, and the other is a gene coding region of any one of the NAC transcription factor family in the same plant.

[0059] In another specific embodiment, the said NAC transcription factor family gene is OsNAC045, OsNAC67, ZmSNAC1, OsNAC006, OsNAC42, OsSNAC1 or OsSNAC2.

[0060] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the corresponding plant endogenous wild-type NAC transcription factor family gene.

[0061] In another specific embodiment, the present invention also provides use of the new gene in enhancing plant stress tolerance or plant yield.

[0062] In another specific embodiment, in the combination of different gene elements, one element is a plant endogenous strong promoter or the region from a strong promoter to 5’UTR, and the other is the gene coding region of any one of MYB, MADS, DREB and bZIP transcription factor family in the same plant.

[0063] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the corresponding plant endogenous wild-type MYB transcription factor gene, MADS transcription factor family gene, DREB transcription factor family gene coding region or bZIP transcription factor family gene, respectively.

[0064] In another specific embodiment, the present invention also provides the use of new gene in enhancing plant stress tolerance or regulating plant growth and development.

[0065] In another specific embodiment, in the combination of different gene elements, one element is the promoter of any one of overexpression or tissue-specific expression rice genes listed in Table A, and the other is the protein coding region or the non-coding RNA region of another gene that is different from the selected promoter corresponding to the rice gene.

[0066] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the expression pattern of the new gene is changed relative to the selected protein coding region or the non-coding RNA region of the rice endogenous gene.

[0067] In another specific embodiment, the present invention also provides the use of new gene in regulating the growth and development of rice.

[0068] In another specific embodiment, in the combination of different gene elements, one element is a protein coding region or non-coding RNA region selected from any one of the biological functional genes listed in Table B to K, and the other is the promoter region of another gene that is different from the selected functional gene of the biological genome corresponding to the selected gene.

[0069] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the expression pattern of the new gene is changed relative to the selected functional gene.

[0070] In another specific embodiment, the present invention also provides use of the new gene in regulating the growth and development of organism.

[0071] In another specific embodiment, in the combination of different gene elements, one element is an endogenous strong promoter or the region from a strong promoter to 5’UTR of the organism, and the other is a gene coding region of any one of the GST (glutathione-s-transferases) family in the same organism.

[0072] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the corresponding endogenous GST (glutathione-s-transferases) family gene of the organism.

[0073] In another specific embodiment, the present invention also provides use of the new gene in enhancing biological detoxification capability or stress tolerance.

[0074] In another specific embodiment, the said GST family gene is wheat GST Cla47 (AY064480.1) gene, wheat GST 19E50 (AY064481.1) , wheat GST28E45 (AY479764.1) , maize ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI, maize GSTIII, maize GSTIV, maize GST5 or maize GST7 gene.

[0075] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the endogenous wheat GST Cla47 (AY064480.1) gene, wheat GST 19E50 (AY064481.1) , wheat GST28E45 (AY479764.1) , maize ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI, maize GSTIII, maize GSTIV, maize GST5 or maize GST7 gene, respectively.

[0076] In another specific embodiment, the present invention also provides use of the new gene in the improvement of the resistance or tolerance of wheat or maize to a herbicide.

[0077] In another specific embodiment, in the combination of different gene elements, one element is a rice endogenous strong promoter or the region from a strong promoter to 5’UTR of the organism, and the other is the coding region of any one of gene protein in rice GIF1 (Os04g0413500) , NOG1 (Os01g075220) , LAIR (Os02g0154100) , OSA1 (Os03g0689300) , OsNRT1.1A (Os08g0155400) , OsNRT2.3B (Os01g0704100) , OsRac1 (Os01g0229400) , OsNRT2.1 (Os02g0112100) , OsGIF1 (Os03g0733600) , OsNAC9 (Os03g0815100) , CPB1 / D11 / GNS4 (Os04g0469800) , miR1432 (Os04g0436100) , OsNLP4 (Os09g0549450) , RAG2 (Os07g0214300) , LRK1 (Os02g0154200) , OsNHX1 (Os07t0666900) , GW6  (Os06g0623700) , WG7 (Os07g0669800) , D11 / OsBZR1 (Os04g0469800, Os07g0580500) , OsAAP6 (Os07g0134000) , OsLSK1 (Os01g0669100) , IPA1 (Os08g0509600) , SMG11 (Os01g0197100) , CYP72A31 (Os01g0602200) , SNAC1 (Os03g0815100) , ZBED (Os01g0547200) , OsSta2 (Os02g0655200) , OsASR5 (Os11g0167800) , OsCPK4 (Os02g03410) , OsDjA9 (Os06g0116800) , EUI (Os05g0482400) , JMJ705 (Os01g67970) , WRKY45 (Os05t0322900) , OsRSR1 (Os05g0121600) , OsRLCK5 (Os01g0114100) , APIP4 (Os01g0124200) , OsPAL6 (Os04t0518400) , OsPAL8 (Os11g0708900) , TPS46 (Os08t0168000) , OsERF3 (Os01g58420) and OsYSL15 (Os02g0650300) .

[0078] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the corresponding endogenous gene.

[0079] In another specific embodiment, the present invention also provides use of the new gene in rice breeding.

[0080] In another specific embodiment, in the combination of different gene elements, one element is a fish endogenous strong promoter, and the other is a gene coding region of GH1 (growth hormone 1) in the selected fish.

[0081] In another specific embodiment, the present invention also provides a fish endogenous high expression GH1 gene obtainable by the method.

[0082] In another specific embodiment, the present invention also provides use of the fish endogenous high expression GH1 gene in fish breeding.

[0083] In another specific embodiment, in the combination of different protein domains, one element is a wheat endogenous protein chloroplast localization signal domain, and the other is a wheat mature protein coding region of cytoplasmic localization phosphoglucose isomerase (PGIc) .

[0084] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the new gene locates the phosphoglucose isomerase gene relative to the coding cytoplasm and its mature protein is located in the chloroplast.

[0085] In another specific embodiment, the present invention also provides use of the new gene in the improvement of wheat yield.

[0086] In another specific embodiment, in the combination of different protein domains, one element is a rice protein chloroplast localization signal domain (CTP) , and the other is the mature protein coding region of OsGLO3, OsOXO3 or OsCATC.

[0087] In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the mature protein of the new gene is located in chloroplast different from OsGLO3, OsOXO3 or OsCATC.

[0088] In another specific embodiment, the present invention also provides use of the new gene in improving the photosynthetic efficiency of rice.

[0089] In another specific embodiment, the present invention also provides a chloroplast  localized protein OsCACT, the nucleotide encoding the protein has a sequence selected from the group consisting of:

[0090] (1) the nucleic acid sequence as shown in SEQ ID NO: 28, or a portion thereof or a complementary sequence thereof;

[0091] (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or

[0092] (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

[0093] In another specific embodiment, the present invention also provides a hloroplast localized protein OsGLO3, the nucleotide encoding the protein has a sequence selected from the group consisting of:

[0094] (1) the nucleic acid sequence as shown in SEQ ID NO: 29, or a portion thereof or a complementary sequence thereof;

[0095] (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or

[0096] (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

[0097] In another specific embodiment, the present invention also provides use of the protein in improving the photosynthetic efficiency of rice.

[0098] The present invention further provides a composition, which comprises:

[0099] (a) the promoter of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene;

[0100] (b) a region between the promoter and the 5' untranslated region of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene;

[0101] (c) a localization signal region of one of the two protein coding genes with different subcellular localizations and a mature protein coding region of the other gene;

[0102] (d) gene coding regions of protein domains with different biological functions derived from two genes with different functions;

[0103] wherein, the composition is non-naturally occurring, and is directly connected on the biological chromosome and can be inherited stably.

[0104] In a specific embodiment, the "different expression patterns" refers to different levels of gene expression.

[0105] In another specific embodiment, the "different expression patterns" refers to different tissue-specific of gene expression.

[0106] In another specific embodiment, the "different expression patterns" refers to different developmental stage-specificities of gene expression.

[0107] In a specific embodiment, the "different subcellular locations" include, but are not limited to, nuclear location, cytoplasmic location, cell membrane location, chloroplast location, mitochondrial location, or endoplasmic reticulum membrane location.

[0108] In a specific embodiment, the "different biological functions" include, but are not limited to,  recognition of specific DNA or RNA conserved sequence, activation of gene expression, binding to protein ligand, binding to small molecule signal, ion binding, or specific enzymatic reaction.

[0109] In a specific embodiment, the composition is fused in vivo.

[0110] The present invention also provides an editing method for regulating the gene expression level of a target endogenous gene in an organism, which is independent of an exogenous DNA donor fragment, which comprises the following steps:

[0111] simultaneously generating DNA breaks separately at selected sites between the promoter and the coding region of each of the target endogenous gene and an optional endogenous inducible or tissue-specific expression gene with a desired expression pattern; ligating the DNA breaks to each other by means of non-homologous end joining (NHEJ) or homologous repair, thereby generating an in vivo fusion of the coding region of the target endogenous gene and the optional inducible or tissue-specific expression promoter to form a new gene with expected expression patterns.

[0112] In a specific embodiment, the target endogenous gene and the optional endogenous inducible or tissue-specific expression gene with a desired expression pattern are located on the same chromosome or on different chromosomes.

[0113] In a specific embodiment, the target endogenous gene is yeast ERG9 gene, the endogenous inducible expression gene is HXT1 gene, and the inducible expression promoter is HXT1 in response to glucose concentration.

[0114] The present invention also provides a yeast endogenous inducible ERG9 gene obtainable by the editing method.

[0115] The present invention also provides use of the yeast endogenous inducible ERG9 gene in synthetic biology.

[0116] In particular, the present invention also provides an editing method of increasing the expression level of a target endogenous gene in an organism independent of an exogenous DNA donor fragment, which comprises the following steps: simultaneously generating DNA breaks at specific sites between the promoter and the CDS of each of the target endogenous gene and an optional endogenous highly-expressing gene; ligating the DNA breaks to each other via non-homologous end joining (NHEJ) or homologous repair to form an in vivo fusion of the coding region of the target endogenous gene and the optional strong endogenous promoter, thereby creating a new highly-expressing endogenous gene. This method is named as an editing method for knocking-up an endogenous gene.

[0117] In a specific embodiment, the target endogenous gene and the optional highly-expressing endogenous gene are located on the same chromosome.

[0118] In another specific embodiment, the target endogenous gene and the optional highly-expressing endogenous gene are located on different chromosomes.

[0119] In another aspect, the present invention provides an editing method for knocking up the expression of an endogenous HPPD gene in a plant, comprising fusing the coding region of the HPPD gene with a strong plant endogenous promoter in vivo to form a new highly-expressing  plant endogenous HPPD gene. That is, simultaneously generating DNA breaks at specific sites between the promoter and the CDS of each of the HPPD gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway to form an in vivo fusion of the coding region of the HPPD gene and the optional endogenous strong promoter, thereby creating a new highly-expressing HPPD gene. In rice, the strong promoter is preferably a promoter of the ubiquitin2 gene.

[0120] The present invention also provides a highly-expressing plant endogenous HPPD gene obtainable by the above editing method.

[0121] The present invention also provides a highly-expressing rice endogenous HPPD gene which has a sequence selected from the group consisting of:

[0122] (1) a nucleic acid sequence as shown in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 27 or a portion thereof or a complementary sequence thereof;

[0123] (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or

[0124] (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

[0125] In another aspect, the present invention provides an editing method for knocking up the expression of an endogenous EPSPS gene in a plant, which comprises fusing the coding region of an EPSPS gene with a strong plant endogenous promoter in vivo to form a new highly-expressing plant endogenous EPSPS gene. That is, simultaneously generating DNA breaks at specific sites between the promoter and the CDS of each of the EPSPS gene and an optional highly-expressing endogenous gene, ligating the DNA breaks to each other through an intracellular repair pathway to form an in vivo fusion of the coding region of the EPSPS gene and the optional strong endogenous promoter, thereby creating a new highly-expressing EPSPS gene. In rice, the strong promoter is preferably a promoter of the TKT gene.

[0126] The present invention also provides a highly-expressing plant endogenous EPSPS gene obtainable by the above editing method.

[0127] The present invention also provides a highly-expressing rice endogenous EPSPS gene which has a sequence selected from the group consisting of:

[0128] (1) the nucleic acid sequence as shown in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO: 14 or a partial sequence thereof or a complementary sequence thereof;

[0129] (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or

[0130] (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

[0131] In another aspect, the present invention provides an editing method for knocking up the expression of an endogenous PPO (PPOX) gene in a plant, which comprises fusing the coding region of the PPO gene with a strong plant endogenous promoter in vivo to form a new highly-expressing plant endogenous PPO gene. That is, simultaneously generating DNA breaks at specific sites between the promoter and the CDS of each of the PPO gene and an optional highly-expressing endogenous gene, ligating the DNA breaks to each other through an  intracellular repair pathway to form an in vivo fusion of the coding region of the PPO gene and the optional strong endogenous promoter, thereby creating a new highly-expressing PPO gene. In rice, the strong promoter is preferably a promoter of the CP12 gene. In Arabidopsis thaliana, the strong promoter is preferably a promoter of the ubiquitin10 gene.

[0132] The present invention also provides a highly-expressing plant endogenous PPO gene obtainable by the above editing method.

[0133] The present invention also provides a highly-expressing rice endogenous PPO1 gene having a sequence selected from the group consisting of:

[0134] (1) the nucleic acid sequence as shown in SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26 or a partial sequence thereof or a complementary sequence thereof;

[0135] (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or

[0136] (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

[0137] The present invention also provides a highly-expressing rice endogenous PPO2 gene, which has a sequence selected from the group consisting of:

[0138] (1) the nucleic acid sequence as shown in SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46 or SEQ ID NO: 47, or a portion thereof or a complementary sequence thereof;

[0139] (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or

[0140] (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

[0141] The present invention also provides a highly-expressing maize endogenous PPO2 gene, which has a sequence selected from the group consisting of:

[0142] (1) the nucleic acid sequence as shown in SEQ ID NO: 48 or SEQ ID NO: 49, or a portion thereof or a complementary sequence thereof;

[0143] (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or

[0144] (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

[0145] The present invention also provides a highly-expressing wheat endogenous PPO2 gene, which has a sequence selected from the group consisting of:

[0146] (1) the nucleic acid sequence as shown in SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55 or SEQ ID NO: 56, or a portion thereof or a complementary sequence thereof;

[0147] (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at  least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or

[0148] (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

[0149] The present invention also provides a highly-expressing oilseed rape endogenous PPO2 gene, which has a sequence selected from the group consisting of:

[0150] (1) the nucleic acid sequence as shown in SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60 or SEQ ID NO: 61, or a portion thereof or a complementary sequence thereof;

[0151] (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or

[0152] (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

[0153] The present invention also provides use of the gene in the improvement of the resistance or tolerance to a corresponding inhibitory herbicide in a plant cell, a plant tissue, a plant part or a plant.

[0154] The present invention also provides a plant or a progeny derived therefrom regenerated from the plant cell which comprises the gene.

[0155] The present invention also provides a method for producing a plant with an increased resistance or tolerance to an herbicide, which comprises regenerating the plant cell which comprises the gene into a plant or a progeny derived therefrom.

[0156] In a specific embodiment, the plant with increased herbicide resistance or tolerance is a non-transgenic line obtainable by crossing a plant regenerated from the plant host cell of the invention with a wild-type plant to remove the exogenous transgenic component through genetic segregation.

[0157] The present invention also provides a herbicide-resistant rice, which comprises one or a combination of two or more of the rice new gene, highly-expressing rice endogenous HPPD gene, highly-expressing rice endogenous EPSPS gene, highly-expressing rice endogenous PPO1 gene, and highly-expressing rice endogenous PPO2 gene.

[0158] In a specific embodiment, the herbicide-resistant rice is non-transgenic.

[0159] The present invention also provides a maize, wheat or oilseed rape resistant to a herbicide, which comprises one or a combination of two or more of the maize new gene, the wheat or maize new gene, the highly-expressing maize PPO2 gene, the highly-expressing wheat PPO2 gene, and the highly-expressing oilseed rape PPO2 gene.

[0160] In a specific embodiment, the maize, wheat or oilseed rape is non-transgenic.

[0161] The present invention also provides a method for controlling a weed in a cultivation site of a plant, wherein the plant is selected from the group consisting of the plant, a plant prepared by the method, the rice, or the maize, wheat or oilseed rape, wherein the method comprises applying to the cultivation site one or more corresponding inhibitory herbicides in an amount for effectively controlling the weed.

[0162] The present invention also provides an editing method for knocking up the expression of an endogenous WAK gene in a plant, characterized in that it comprises fusing the coding region of the WAK gene with a strong endogenous promoter of a plant in vivo to form a new highly-expressing plant endogenous WAK gene. That is, simultaneously generating DNA  breaks respectively in selected specific sites between the promoter and the coding region of each of the WAK gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the WAK gene and the optional strong endogenous promoter to form a new highly-expressing WAK gene.

[0163] The present invention also provides a highly-expressing plant endogenous WAK gene obtainable by the editing method.

[0164] The present invention also provides a highly-expressing rice WAK gene, which has a sequence selected from the group consisting of:

[0165] (1) the nucleic acid sequence as shown in SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67 or SEQ ID NO: 68, or a portion thereof or a complementary sequence thereof;

[0166] (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or

[0167] (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

[0168] The present invention also provides an editing method for knocking up the expression of an endogenous CNGC gene in a plant, characterized in that it comprises fusing the coding region of the CNGC gene with a strong endogenous promoter of a plant in vivo to form a new highly-expressing plant endogenous CNGC gene. That is, simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the CNGC gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the CNGC gene and the optional strong endogenous promoter to form a new highly-expressing CNGC gene.

[0169] The present invention also provides a highly-expressing plant endogenous CNGC gene obtainable by the editing method.

[0170] The present invention also provides a highly-expressing rice CNGC gene, which has a sequence selected from the group consisting of:

[0171] (1) the nucleic acid sequence as shown inSEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 or SEQ ID NO: 72, or a portion thereof or a complementary sequence thereof;

[0172] (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or

[0173] (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

[0174] The present invention also provides use of the gene in conferring or improving a resistance to rice blast in rice.

[0175] The present invention also provides a rice resistant to rice blast, which comprises one or a combination of two or more of the highly-expressing rice WAK gene, and the highly-expressing rice CNGC gene.

[0176] Preferably the rice is non-transgenic.

[0177] The present invention also provides an editing method for knocking up the expression of an endogenous GH1 gene in a fish, characterized in that it comprises fusing the coding region of the GH1 gene with a strong endogenous promoter of a fish in vivo to form a new highly-expressing fish endogenous GH1 gene. That is, simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the GH1 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the GH1gene and the optional strong endogenous promoter to form a new highly-expressing GH1 gene; the strong promoter is preferably the corresponding fish ColIA1a (Collagen type I alpha 1a) gene promoter, RPS15A (ribosomal protein S15a) gene promoter, Actin promoter or DDX5 [DEAD (Asp-Glu-Ala-Asp) box helicase 5] gene promoter.

[0178] The present invention also provides a highly-expressing fish endogenous GH1 gene obtainable by the editing method.

[0179] The present invention also provides use of the highly-expressing fish endogenous GH1 gene in fish breeding.

[0180] The present invention also providesan editing method for knocking up the expression of an endogenous IGF2 (Insulin-like growth factor 2) gene in a pig, characterized in that it comprises fusing the coding region of the IGF2 gene with a strong endogenous promoter of a pig in vivo to form a new highly-expressing pig endogenous IGF2 gene. That is, simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the IGF2 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the IGF2 gene and the optional strong endogenous promoter to form a new highly-expressing IGF2 gene; the strong promoter is preferably one of the pig TNNI2 and TNNT3 gene promoter.

[0181] The present invention also provides a highly-expressing pig endogenous IGF2 gene obtainable by the editing method.

[0182] The present invention also provides use of the highly-expressing pig endogenous IGF2 gene in pig breeding.

[0183] The present invention also provides an editing method for knocking up the expression of an endogenous IGF1 (Insulin-like growth factor 1) gene in a chicken embryo fibroblast, characterized in that it comprises fusing the coding region of the IGF1 gene with a strong endogenous promoter of a chicken in vivo to form a new highly-expressing chicken endogenous IGF1 gene. That is, simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the IGF1 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the IGF1 gene and the optional strong endogenous promoter to form a new highly-expressing IGF1 gene; the strong promoter is preferably chicken MYBPC1 (myosin  binding protein C) gene promoter.

[0184] The present invention also provides a highly-expressing chicken endogenous IGF1 gene obtainable by the editing method.

[0185] The present invention also provides use of the highly-expressing chicken endogenous IGF1 gene in chicken breeding.

[0186] The present invention also provides an editing method for knocking up the expression of an endogenous EPO (Erythropoietin) gene in an animal cell, characterized in that it comprises fusing the coding region of the EPO gene with a strong endogenous promoter of an animal in vivo to form a new highly-expressingendogenous EPO gene. That is, simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the EPO gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the EPO gene and the optional strong endogenous promoter to form a new highly-expressing EPO gene.

[0187] The present invention also provides a highly-expressing animal endogenous EPO gene obtainable by the editing method.

[0188] The present invention also provides use of the highly-expressing animal endogenous EPO gene in animal breeding.

[0189] The present invention also provides an editing method for knocking up the expression of an endogenous p53 gene in an animal cell, characterized in that it comprises fusing the coding region of the p53 gene with a strong endogenous promoter of an animal in vivo to form a new highly-expressingendogenous p53 gene. That is, simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the p53 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the p53 gene and the optional strong endogenous promoter to form a new highly-expressing p53 gene.

[0190] The present invention also provides a highly-expressing animal endogenous p53 gene obtainable by the editing method.

[0191] The present invention also provides use of the highly-expressing animal endogenous p53 gene in animal breeding or cancer prevention.

[0192] In a specific embodiment, the "DNA breaks" are produced by delivering a nuclease with targeting property into a cell of the organism to contact with the specific sites of the genomic DNA. There is no essential difference between this type of DNA breaks and the DNA breaks produced by traditional techniques (such as radiation or chemical mutagenesis) .

[0193] In a specific embodiment, the "nuclease with targeting property" is selected from Meganuclease, Zinc finger nuclease (ZFN) , TALEN and the CRISPR / Cas system.

[0194] Among them, the CRISPR / Cas system can generate two or more DNA double-strand breaks at different sites in the genome through two or more leading RNAs targeting different sequences; by separately designing the ZFN protein or TALEN protein in two or more specific site  sequences, the Zinc finger nuclease and TALEN systems can simultaneously generate DNA double-strand breaks at two or more sites. When two breaks are located on the same chromosome, repair results such as deletion, inversion and doubling may occur; and when two breaks are located on two different chromosomes, crossover of chromosomal arms may occur. The deletion, inversion, doubling and exchange of chromosome segments at two DNA breaks can recombine different gene elements or protein domains, thereby creating a new functional gene.

[0195] In a specific embodiment, the said CRISPR / Cas system is Cas9 nuclease system or Cas12 nuclease system.

[0196] In a specific embodiment, the "nuclease with targeting property" exists in the form of DNA.

[0197] In another specific embodiment, the "nuclease with targeting property" exists in the form of mRNA or protein, rather than the form of DNA.

[0198] In a specific embodiment, the method for delivering the nucleases with targeting property into the cell is selected from a group consisting of: 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electric shock transformation; 4) microinjection; 5) gene gun bombardment; 6) Agrobacterium-mediated transformation; 7) viral vector-mediated transformation method; or 8) nanomagnetic bead mediated transformation method.

[0199] The present invention also provides a DNA containing the gene.

[0200] The present invention also provides a protein encoded by the gene, or biologically active fragment thereof.

[0201] The present invention also provides a recombinant expression vector, which comprises the gene and a promoter operably linked thereto.

[0202] The present invention also provides an expression cassette containing the gene.

[0203] The present invention also provides a host cell, which comprises the expression cassette.

[0204] The present invention further provides an organism regenerated from the host cell.

[0205] In the research work of the inventors, it was found that in cells simultaneously undergoing dual-target or multi-target gene editing, a certain proportion of the ends of DNA double-strand breaks at different targets were spontaneously ligated to each other, resulting in events of deletion, inversion or duplication-doubling of the fragments between the targets on the same chromosome, and / or the exchange of chromosome fragments between targets on different chromosomes. It has been reported in the literature that this phenomenon commonly exists in plants and animals (Puchta et al. 2020. Changing local recombination patterns in Arabidopsis by CRISPR / Cas mediated chromosome engineering. Nat Commun. DOI: 10.1038 / s41467-020-18277-z; Li et al. 2015. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR / Cas9. J Mol Cell Biol. DOI: 10.1093 / jmcb / mjv016) .

[0206] The present inventors surprisingly discovered that, by inducing DNA double-strand breaks in a combination of gene editing targets near specific elements of a gene of interest, causing spontaneous repair ligation, directed combination of different gene elements can be achieved at the genome level without the need to provide a foreign DNA template, it is possible to produce therefrom a new functional gene. This strategy greatly accelerates the creation of new genes and has great potential in animal and plant breeding and gene function research.

[0207] Detailed description of invention

[0208] In the present invention, unless otherwise specified, the scientific and technical terms used  herein have the meanings commonly understood by those skilled in the art. In addition, protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology related terms and laboratory procedures used herein are all terms and routine procedures widely used in the corresponding fields. For example, the standard recombinant DNA and molecular cloning techniques used in the present invention are well known to those skilled in the art and are fully described in the following documents: Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989. For a better understanding of the present invention, definitions and explanations of related terms are provided below.

[0209] The term "genome" as used herein refers to all complements of genetic material (genes and non-coding sequences) present in each cell or virus or organelle of an organism, and / or complete genome inherited from a parent as a unit (haploid) .

[0210] Table A lists some of the ubiquitously-expressed genes and tissue-specific expressed genes in rice. Generally, in production applications, a DNA sequence within 3 kb upstream of the start codon of ubiquitously-expressed genes or tissue-specific genes is used as the promoter region and the 5' non-coding region, where the promoter region of ubiquitously expressed genes is used as a representative of strong promoters, and the promoter region of tissue-specifically expressed genes is used as a representative of tissue-specific promoters. It is known that ubiquitously-expressed genes and tissue-specific genes in other species similar to rice can be found in public databases such as NCBI (https:  / / www. ncbi. nlm. nih. gov) , JGI (https:  / / jgi. doe) . gov / ) .

[0211] Table A: The ubiquitously-expressed genes and tissue-specific expressed genes in rice.

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218] Table B lists some functional genes that have been reported to be related to plant metabolites. Up-regulated expression of these genes or specific expression in fruits, leaves and other organs may enhance the economic value of such plants.

[0219] Table B: Genes related to secondary metabolites of plants.

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229] Table C lists the important functional genes in oilseed rape. The combination of such genes with those endogenous promoters of oilseed rape can be used to create non-transgenic endogenous high-expression new genes or tissue-specific expression genes by applying the method in the present invention to bring about more application scenarios for breeding. There are also a large number of genes with reported functions in rice, corn, wheat, soybeans and other species. For those functional genes or non-coding RNAs that need to be up-regulated to realize competitive advantages for crops, their combinations with known strong expression promoters are available for creating customized new genes with new expression patterns as per needed by using the method in the present invention.

[0230] Table C: Important functional genes in oilseed rape

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238] Table D lists important functional genes in some horticulture crops. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain.

[0239] Table D: Important functional genes in horticulture crops

[0240]

[0241]

[0242]

[0243]

[0244]

[0245]

[0246]

[0247]

[0248]

[0249]

[0250]

[0251] Table E lists the representative functional genes in soybean. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain, and can be utilized in soybean breeding program.

[0252] Table E: Important functional genes in soybean

[0253]

[0254]

[0255]

[0256]

[0257]

[0258]

[0259] Table F lists the representative functional genes in corn. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain, and can be utilized in corn breeding program.

[0260] Table F: Important functional genes in corn

[0261]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267]

[0268]

[0269]

[0270]

[0271]

[0272]

[0273]

[0274]

[0275]

[0276]

[0277] Table G lists the representative functional genes in barley. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain, and can be utilized in barley breeding program.

[0278] Table G: Important functional genes in barley

[0279]

[0280]

[0281] Table H lists the representative functional genes in rice. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain, and can be utilized in rice breeding program.

[0282] Table H: Important functional genes in rice

[0283]

[0284]

[0285]

[0286]

[0287]

[0288]

[0289]

[0290]

[0291]

[0292]

[0293]

[0294]

[0295]

[0296]

[0297]

[0298]

[0299]

[0300]

[0301]

[0302]

[0303]

[0304]

[0305]

[0306]

[0307]

[0308]

[0309]

[0310]

[0311]

[0312]

[0313]

[0314]

[0315]

[0316]

[0317]

[0318] Table I lists the representative functional genes in wheat. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain, and can be utilized in wheat breeding program.

[0319] Table I: Important functional genes in wheat

[0320]

[0321]

[0322]

[0323]

[0324]

[0325]

[0326]

[0327]

[0328]

[0329] Table J lists some representative functional genes in tomato.

[0330] Table J: Important functional genes in in tomato

[0331]

[0332]

[0333]

[0334] Table K lists some representative functional genes in potato and sweet potato.

[0335] Table K: Important functional genes in potato and sweetpotato

[0336]

[0337]

[0338]

[0339]

[0340] Table L: List of herbicide resistance genes

[0341]

[0342]

[0343]

[0344] "The expression level of a new gene is upregulated" in the present invention means that the expression level of a new gene relative to the endogenous wild-type gene of the corresponding organism is increased, preferably the expression level is increased by at least 0.5 times, at least 1 time, at least 2 times, at least 3 times, at least 4 times or at least 5 times.

[0345] The term "gene editing" refers to strategies and techniques for targeted specific modification of any genetic information or genome of living organisms. Therefore, the term includes editing of gene coding regions, but also includes editing of regions other than gene coding regions of the genome. It also includes editing or modifying other genetic information of nuclei (if present) and cells.

[0346] The term "CRISPR / Cas nuclease" may be a CRISPR-based nuclease or a nucleic acid sequence encoding the same, including but not limited to: 1) Cas9, including SpCas9, ScCas9, SaCas9, xCas9, VRER-Cas9, EQR-Cas9, SpG-Cas9, SpRY-Cas9, SpCas9-NG, NG-Cas9, NGA-Cas9 (VQR) , etc.; 2) Cas12, including LbCpf1, FnCpf1, AsCpf1, MAD7, etc., or any variant or derivative of the aforementioned CRISPR-based nuclease; preferably, wherein the at least one CRISPR-based nuclease comprises a mutation compared to the corresponding wild-type sequence, so that the obtained CRISPR-based nuclease recognizes a different PAM sequence. As used herein, "CRISPR-based nuclease" is any nuclease that has been identified in a naturally occurring CRISPR system, which is subsequently isolated from its natural background, and has preferably been modified or combined into a recombinant construct of interest, suitable as a tool for targeted genome engineering. As long as the original wild-type CRISPR-based nuclease provides DNA recognition, i.e., binding properties, any CRISPR-based nuclease can be used and  optionally reprogrammed or otherwise mutated so as to be suitable for various embodiments of the invention.

[0347] The term "CRISPR" refers to a sequence-specific genetic manipulation technique that relies on clustered regularly interspaced short palindromic repeats, which is different from RNA interference that regulates gene expression at the transcriptional level.

[0348] "Cas9 nuclease" and "Cas9" are used interchangeably herein, and refer to RNA-guided nuclease comprising Cas9 protein or fragment thereof (for example, a protein containing the active DNA cleavage domain of Cas9 and / or the gRNA binding domain of Cas9) . Cas9 is a component of the CRISPR / Cas (clustered regularly interspaced short palindrome repeats and associated systems) genome editing system. It can target and cut DNA target sequences under the guidance of guide RNA to form DNA double-strand breaks (DSB) .

[0349] "Cas protein" or "Cas polypeptide" refers to a polypeptide encoded by Cas (CRISPR-associated) gene. Cas protein includes Cas endonuclease. Cas protein can be a bacterial or archaeal protein. For example, the types I to III CRISPR Cas proteins herein generally originate from prokaryotes; the type I and type III Cas proteins can be derived from bacteria or archaea species, and the type II Cas protein (i.e., Cas9) can be derived from bacterial species. “Cas proteins” include Cas9 protein, Cpf1 protein, C2c1 protein, C2c2 protein, C2c3 protein, Cas3, Cas3-HD, Cas5, Cas7, Cas8, Cas10, Cas12a, Cas12b, or a combination or complex thereof.

[0350] "Cas9 variant" or "Cas9 endonuclease variant" refers to a variant of the parent Cas9 endonuclease, wherein when associated with crRNA and tracRNA or with sgRNA, the Cas9 endonuclease variant retains the abilities of recognizing, binding to all or part of a DNA target sequence and optionally unwinding all or part of a DNA target sequence, nicking all or part of a DNA target sequence, or cutting all or part of a DNA target sequence. The Cas9 endonuclease variants include the Cas9 endonuclease variants described herein, wherein the Cas9 endonuclease variants are different from the parent Cas9 endonuclease in the following manner: the Cas9 endonuclease variants (when complexed with gRNA to form a polynucleotide-directed endonuclease complex capable of modifying a target site) have at least one improved property, such as, but not limited to, increased transformation efficiency, increased DNA editing efficiency, decreased off-target cutting, or any combination thereof, as compared to the parent Cas9 endonuclease (complexed with the same gRNA to form a polynucleotide-guided endonuclease complex capable of modifying the same target site) .

[0351] The Cas9 endonuclease variants described herein include variants that can bind to and nick double-stranded DNA target sites when associated with crRNA and tracrRNA or with sgRNA, while the parent Cas endonuclease can bind to the target site and result in double strand break (cleavage) when associated with crRNA and tracrRNA or with sgRNA.

[0352] "Guide RNA" and "gRNA" are used interchangeably herein, and refer to a guide RNA sequence used to target a specific gene for correction using CRISPR technology, which usually consists of crRNA and tracrRNA molecules that are partially complementary to form a complex, wherein crRNA contains a sequence that has sufficient complementarity with the target sequence so to hybridize with the target sequence and direct the CRISPR complex (Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. However, it is known in the  art that a single guide RNA (sgRNA) can be designed, which contains both the properties of crRNA and tracrRNA.

[0353] The terms "single guide RNA" and "sgRNA" are used interchangeably herein, and refer to the synthetic fusion of two RNA molecules, which comprises a fusion of a crRNA (CRISPR RNA) of a variable targeting domain (linked to a tracr pairing sequence hybridized to tracrRNA) and a tracrRNA (trans-activating CRISPR RNA) . The sgRNA may comprise crRNA or crRNA fragments and tracrRNA or tracrRNA fragments of the type II CRISPR / Cas system that can form a complex with the type II Cas endonuclease, wherein the guide RNA / Cas endonuclease complex can guide the Cas endonuclease to a DNA target site so that the Cas endonuclease can recognize, optionally bind to the DNA target site, and optionally nick the DNA target site or cut (introduce a single-strand or double-strand break) the DNA target site.

[0354] In certain embodiments, the guide RNA (s) and Cas9 can be delivered to a cell as a ribonucleoprotein (RNP) complex. RNP is composed of purified Cas9 protein complexed with gRNA, and it is well known in the art that RNP can be effectively delivered to many types of cells, including but not limited to stem cells and immune cells (Addgene, Cambridge, MA, Mirus Bio LLC, Madison, WI) .

[0355] The protospacer adjacent motif (PAM) herein refers to a short nucleotide sequence adjacent to a (targeted) target sequence (prespacer) recognized by the gRNA / Cas endonuclease system. If the target DNA sequence is not adjacent to an appropriate PAM sequence, the Cas endonuclease may not be able to successfully recognize the target DNA sequence. The sequence and length of PAM herein can be different depending on the Cas protein or Cas protein complex in use. The PAM sequence can be of any length, but is typically in length of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides.

[0356] Cytochrome P450enzyme system (CYP) is discovered as a protein that can be bound to CO. In 1958, Klingenberg discovered this pigment protein in rat liver microsomes. Cytochrome P450was so named because of its maximum absorption value at 450nm wavelength when combined with CO in its reduced state. As the largest superfamily of oxidoreductases, P450 is widely distributed in the vast majority of organisms, including but not limited to animals, plants, fungi, bacteria, archaea and viruses. Cytochrome P450 enzymes include those reviewed in the following literature: Van Bogaert et al, 2011, FEBS J. 278 (2) : 206-221, or Urlacherand Girhard, 2011, Trends in Biotechnology 30 (1) : 26-36, or the following websites: http:  / / drnelson. uthsc. edu / CytochromeP450. html and http:  / / p450. riceblast. snu. ac. kr / index. php? a=view. Its naming is based on the English abbreviation CYP (Cytochrome P450) with numbers + letters + numbers, respectively representing the family, subfamily and individual enzymes.

[0357] For some embodiments, the said cytochrome P450s include but not limited to the following as per list:

[0358]

[0359] For some embodiments, the rice cytochrome P450s include but not limited to the following as per list:

[0360] MSU / TIGR locus IDCYP nameLOC_Os01g08800CYP96D1LOC_Os01g08810CYP96E1LOC_Os01g10040CYP90D2v1LOC_Os01g10040CYP90D2V2LOC_Os01g11270CYP710A5LOC_Os01g11280CYP710A6LOC_Os01g11300CYP710A7LOC_Os01g11340CYP710A8LOC_Os01g12740CYP71T1LOC_Os01g12750CYP71T2LOC_Os01g12760CYP71T3LOC_Os01g12770CYP71T4LOC_Os01g24780CYP709D1LOC_Os01g24810CYP89D1LOC_Os01g27890CYP71K1LOC_Os01g29150CYP734A6LOC_Os01g36294CYP71C19PLOC_Os01g38110CYP76M14LOC_Os01g41800CYP72A31PLOC_Os01g41810CYP72A32LOC_Os01g41820CYP72A33LOC_Os01g43700CYP72A17v1LOC_Os01g43700CYP72A17v2

[0361] LOC_Os01g43710CYP72A18LOC_Os01g43740CYP72A20LOC_Os01g43750CYP72A21LOC_Os01g43760CYP72A22LOC_Os01g43774CYP72A23LOC_Os01g43844CYP72A24LOC_Os01g43851CYP72A25LOC_Os01g50490CYP706C2LOC_Os01g50530CYP711A2LOC_Os01g50580CYP711A3LOC_Os01g50590CYP711A4LOC_Os01g52790CYP72A35LOC_Os01g58950CYP94D13LOC_Os01g58960CYP94D12LOC_Os01g58970CYP94D11LOC_Os01g58990CYP94D10LOC_Os01g59000CYP94D9LOC_Os01g59020CYP94D7LOC_Os01g59050CYP94D6LOC_Os01g60450CYP73A35PLOC_Os01g63540CYP86A9LOC_Os01g63930CYP94C3v1LOC_Os01g63930CYP94C3v2LOC_Os01g72260CYP94E2LOC_Os01g72270CYP94E1LOC_Os01g72740CYP71AA3LOC_Os01g72760CYP71AA2LOC_Os02g01890CYP89E1LOC_Os02g02000CYP74F1LOC_Os02g02230CYP51H5LOC_Os02g07680CYP97B4v1LOC_Os02g07680CYP97B4v2LOC_Os02g07680CYP97B4v3LOC_Os02g07680CYP97B4v4LOC_Os02g07680CYP97B4v5LOC_Os02g09190CYP71X12LOC_Os02g09200CYP71X11LOC_Os02g09220CYP71X10LOC_Os02g09240CYP71X8LOC_Os02g09250CYP71X7LOC_Os02g09290CYP71X4LOC_Os02g09310CYP71X3LOC_Os02g09320CYP71X2LOC_Os02g09330CYP71X1PLOC_Os02g09390CYP71K3LOC_Os02g09400CYP71K4LOC_Os02g09410CYP71K5LOC_Os02g11020CYP734A2LOC_Os02g12540CYP71V5LOC_Os02g12550CYP71V4LOC_Os02g12680CYP74E1

[0362] LOC_Os02g12690CYP74E2LOC_Os02g12890CYP711A5v1LOC_Os02g12890CYP711A5v2LOC_Os02g17760CYP71U3LOC_Os02g21810CYP51H4LOC_Os02g26770CYP73A40LOC_Os02g26810CYP73A39LOC_Os02g29720CYP76N1PLOC_Os02g29960CYP92A15LOC_Os02g30080CYP81L5LOC_Os02g30090CYP81L4LOC_Os02g30100CYP81L3LOC_Os02g30110CYP81L2LOC_Os02g32770CYP71Z5LOC_Os02g36030CYP76M5LOC_Os02g36070CYP76M8LOC_Os02g36110CYP76M17LOC_Os02g36150CYP71Z6LOC_Os02g36190CYP71Z7LOC_Os02g36280CYP76M6LOC_Os02g38290CYP86E1v1LOC_Os02g38290CYP86E1v2LOC_Os02g38930CYP71X13PLOC_Os02g38940CYP71X14LOC_Os02g44654CYP86A10v1LOC_Os02g44654CYP86A10v2LOC_Os02g45280CYP87A5LOC_Os02g47470CYP707A5v1LOC_Os02g47470CYP707A5v2LOC_Os02g47470CYP707A5v3LOC_Os02g57290CYP97A4v1LOC_Os02g57290CYP97A4v2LOC_Os02g57290CYP97A4v3LOC_Os02g57290CYP97A4v4LOC_Os02g57810CYP715B1LOC_Os03g02180CYP84A6LOC_Os03g04190CYP78A17LOC_Os03g04530CYP96B6LOC_Os03g04630CYP96B2LOC_Os03g04640CYP96B9LOC_Os03g04650CYP96B3LOC_Os03g04660CYP96B5LOC_Os03g04680CYP96B4LOC_Os03g07250CYP704B2LOC_Os03g12260CYP94D15LOC_Os03g12500CYP74A5LOC_Os03g12660CYP90B2LOC_Os03g14400CYP76H4LOC_Os03g14420CYP76H5LOC_Os03g14560CYP76Q1LOC_Os03g21400CYP714B2

[0363] LOC_Os03g25150CYP75A11LOC_Os03g25480CYP709E1LOC_Os03g25490CYP709E2Pv1LOC_Os03g25490CYP709E2Pv2LOC_Os03g30420CYP78A12LOC_Os03g37080CYP71E6PLOC_Os03g37290CYP79A7LOC_Os03g39540CYP71AC3PLOC_Os03g39650CYP71W1LOC_Os03g39690CYP71W3LOC_Os03g39760CYP71W4LOC_Os03g40540CYP85A1LOC_Os03g40600CYP78A14LOC_Os03g44740CYP92C21LOC_Os03g45619CYP87C2v1LOC_Os03g45619CYP87C2v2LOC_Os03g55240CYP81A6LOC_Os03g55260CYP81A8LOC_Os03g55800CYP74A4LOC_Os03g61980CYP733A1LOC_Os03g63310CYP71E4LOC_Os04g01140CYP93G1v1LOC_Os04g01140CYP93G1v2LOC_Os04g03870CYP723A2LOC_Os04g03890CYP723A3LOC_Os04g08824CYP79A10LOC_Os04g08828CYP79A9LOC_Os04g09430CYP79A9PLOC_Os04g09920CYP99A3LOC_Os04g10160CYP99A2LOC_Os04g18380CYP81M1LOC_Os04g27020CYP71Z1LOC_Os04g33370CYP77A18LOC_Os04g39430CYP724B1LOC_Os04g40460CYP71S2LOC_Os04g40470CYP71S1LOC_Os04g47250CYP86A11LOC_Os04g48170CYP87A6LOC_Os04g48200CYP87B4LOC_Os04g48210CYP87A4v1LOC_Os04g48210CYP87A4v2LOC_Os04g48460CYP704A3LOC_Os05g01120CYP722B1LOC_Os05g08850CYP96D2LOC_Os05g11130CYP90D3LOC_Os05g12040CYP51G3LOC_Os05g25640CYP73A38LOC_Os05g30890CYP72A34LOC_Os05g31740CYP94E3LOC_Os05g33590CYP721B2LOC_Os05g33600CYP721B1

[0364] LOC_Os05g34325CYP51H6LOC_Os05g34330CYP51H7PLOC_Os05g34380CYP51H8LOC_Os05g35010CYP71AD1LOC_Os05g37250CYP94C4LOC_Os05g40384CYP714D1LOC_Os05g41440CYP98A4v1LOC_Os05g41440CYP98A4v2LOC_Os05g43910CYP71R1LOC_Os06g01250CYP93G2LOC_Os06g02019CYP88A5LOC_Os06g03930CYP704A4LOC_Os06g09210CYP709C10LOC_Os06g09220CYP709C11LOC_Os06g15680CYP71R2PLOC_Os06g19070CYP76Q2LOC_Os06g22020CYP71C20LOC_Os06g22340CYP89C1LOC_Os06g24180CYP84A7LOC_Os06g30179CYP71AB3LOC_Os06g30500CYP71AB2LOC_Os06g30640CYP76M9LOC_Os06g36920CYP711A6LOC_Os06g37224CYP701A9LOC_Os06g37300CYP701A8LOC_Os06g37330CYP701A19LOC_Os06g37364CYP701A6v1LOC_Os06g37364CYP701A6v2LOC_Os06g37364CYP701A6v3LOC_Os06g39780CYP76M7LOC_Os06g39880CYP734A4LOC_Os06g41070CYP93F1LOC_Os06g42610CYP89B12PLOC_Os06g43304CYP71Y7LOC_Os06g43320CYP71Y6LOC_Os06g43350CYP71Y5LOC_Os06g43370CYP71Y4LOC_Os06g43384CYP71Y3LOC_Os06g43410CYP71Y1PLOC_Os06g43420CYP71K10LOC_Os06g43430CYP71K9LOC_Os06g43440CYP71K8LOC_Os06g43480CYP71K7PLOC_Os06g43490CYP71K6LOC_Os06g43520CYP71AF1LOC_Os06g45960CYP71AC2LOC_Os06g46680CYP77B2LOC_Os07g11739CYP71Z2LOC_Os07g11870CYP71Z21LOC_Os07g11970CYP71Z22LOC_Os07g19130CYP71Q2

[0365] LOC_Os07g19210CYP71Q1LOC_Os07g23570CYP709C9LOC_Os07g23710CYP709C12PLOC_Os07g26870CYP89G1LOC_Os07g28160CYP51H1LOC_Os07g29960CYP87B5LOC_Os07g33440CYP728B3LOC_Os07g33480CYP728C9v1LOC_Os07g33480CYP728C9v2LOC_Os07g33540CYP728C7LOC_Os07g33550CYP728C5LOC_Os07g33560CYP728C4LOC_Os07g33580CYP728C3LOC_Os07g33610CYP728C1v1LOC_Os07g33610CYP728C1v2LOC_Os07g33620CYP728B1LOC_Os07g37970CYP51H9LOC_Os07g37980CYP51G4PLOC_Os07g41240CYP78A13LOC_Os07g44110CYP709C8LOC_Os07g44130CYP709C6LOC_Os07g44140CYP709C5LOC_Os07g45000CYP727A1LOC_Os07g45290CYP734A5LOC_Os07g48330CYP714B1LOC_Os08g01450CYP71C12LOC_Os08g01470CYP71C13PLOC_Os08g01490CYP71C17LOC_Os08g01510CYP71C15LOC_Os08g01520CYP71C16LOC_Os08g03682CYP703A3LOC_Os08g05610CYP89C8PLOC_Os08g05620CYP89C9LOC_Os08g12990CYP76H11LOC_Os08g16260CYP96B8LOC_Os08g16430CYP96B7LOC_Os08g33300CYP735A3LOC_Os08g35510CYP92A12LOC_Os08g36310CYP76M1LOC_Os08g36860CYP707A6LOC_Os08g39640CYP76M11PLOC_Os08g39660CYP76M10LOC_Os08g39694CYP76M4Pv1LOC_Os08g39694CYP76M4Pv2LOC_Os08g39694CYP76M4Pv3LOC_Os08g39730CYP76M2LOC_Os08g43390CYP78A15LOC_Os08g43440CYP706C1LOC_Os09g08920CYP92A13LOC_Os09g08990CYP92A14LOC_Os09g10340CYP71V2

[0366] LOC_Os09g21260CYP728A1LOC_Os09g23820CYP735A4LOC_Os09g26940CYP92A11LOC_Os09g26960CYP92A9LOC_Os09g26970CYP92A8LOC_Os09g26980CYP92A7LOC_Os09g27500CYP76L1LOC_Os09g27510CYP76K1LOC_Os09g28390CYP707A37LOC_Os09g35940CYP78A16LOC_Os09g36070CYP71T8LOC_Os09g36080CYP71AK2LOC_Os10g05020CYP89B11LOC_Os10g05490CYP76P1LOC_Os10g08319CYP76H9LOC_Os10g08474CYP76H8LOC_Os10g08540CYP76H6LOC_Os10g09090CYP76V1LOC_Os10g09160CYP71AB1LOC_Os10g16974CYP75B11LOC_Os10g17260CYP75B3LOC_Os10g21050CYP76P3LOC_Os10g23130CYP729A2LOC_Os10g23180CYP729A1v1LOC_Os10g23180CYP729A1v2LOC_Os10g26340CYP78A11LOC_Os10g30380CYP71Z3LOC_Os10g30390CYP71Z4LOC_Os10g30410CYP71Z8LOC_Os10g34480CYP86B3LOC_Os10g36740CYP89F1LOC_Os10g36848CYP84A5LOC_Os10g36960CYP89B10LOC_Os10g36980CYP89B9LOC_Os10g37020CYP89B8PLOC_Os10g37034CYP89B7PLOC_Os10g37050CYP89B6LOC_Os10g37070CYP89B5PLOC_Os10g37100CYP89B4LOC_Os10g37110CYP89B3LOC_Os10g37120CYP89B2LOC_Os10g37160CYP89B1LOC_Os10g38090CYP704A7LOC_Os10g38110CYP704A5v1LOC_Os10g38110CYP704A5v2LOC_Os10g38120CYP704A6LOC_Os10g39930CYP97C2v1LOC_Os10g39930CYP97C2v2LOC_Os11g02710CYP714C16PLOC_Os11g04290CYP94D5LOC_Os11g04310CYP94D4

[0367] LOC_Os11g04710CYP90A3LOC_Os11g05380CYP94C2LOC_Os11g18570CYP87B1LOC_Os11g27730CYP71C32LOC_Os11g28060CYP71C33LOC_Os11g29290CYP94B4LOC_Os11g29720CYP78D1LOC_Os11g32240CYP51G1LOC_Os11g41680CYP71K11LOC_Os11g41710CYP71K12LOC_Os12g02630CYP714C1LOC_Os12g02640CYP714C2LOC_Os12g04100CYP94D63LOC_Os12g04110CYP94D64LOC_Os12g04480CYP90A19LOC_Os12g05440CYP94C79LOC_Os12g09500CYP76P2LOC_Os12g09790CYP76M13LOC_Os12g16720CYP71P1LOC_Os12g18820CYP87C5PLOC_Os12g25660CYP94B5LOC_Os12g32850CYP71E5LOC_Os12g39240CYP81N1LOC_Os12g39300CYP81N1PLOC_Os12g39310CYP81P1LOC_Os12g44290CYP71V3

[0368] As used herein, ATP-binding cassette (ABC) transporter family are a family of membrane transporter proteins that regulate the transport of a wide variety of pharmacological agents, potentially toxic drugs, and xenobiotics, as well as anions. ABC transporters are homologous membrane proteins that bind and use cellular adenosine triphosphate (ATP) for their specific activities. And the ATP-binding cassette (ABC) transporter proteins comprise a large family of prokaryotic and eukaryotic membrane proteins involved in the energy-dependent transport of a wide range of substrates across membranes (Higgins, C.F. et al., Ann. Rev. Cell Biol., 8: 67-113 (1992) ) . In eukaryotes, ABC transport proteins typically consist of four domains that include two conserved ATP-binding domains and two transmembrane domains (Hyde et al., Nature, 346: 362-5 (1990) ) .

[0369] As used herein, NAC transcription factors are unique transcription factors in plants and are numerous and widely distributed in terrestrial plants. They constitute one of the largest transcription factor families and play an important role in multiple growth development and stress response processes. Wherein, NAC is an acronym derived from the names of the three genes first described as containing a NAC domain, namely NAM (no apical meristem) , ATAF1, 2 and CUC2 (cup-shaped cotyledon) .

[0370] As used herein, wherein, the Myb gene was found to encode a transcription factor  (Biedenkapp H., et al., 1988, Nature, 335: 835-837) , represent a family comprising many related genes, and exist in a wide variety of species, including yeast, nematodes, insects and plants, as well as vertebrates (Masaki Iwabuchi and Kazuo Shinozaki, Shokubutsu genomu kinou no dainamizumu: tensha inshi ni yoru hatsugen seigyo (Dynamism of Plant Genome functions: Expression control by transcriptional factor) , Springer Japan, 2001) . Plant transcription factor MYB (v-myb avian myeloblastosis viral oncogene homolog) is a type of transcription factor discovered in recent years that is related to the regulation of plant growth and development, physiological metabolism, cell morphology and pattern formation and other physiological processes. It is ubiquitous in plants and is also one of the largest transcription families in plants, MYB transcription factors play an important role in plant metabolism and regulation. Most MYB proteins contain a Myb domain composed of amino acid residues at the N-terminus. According to the structural characteristics of this highly conserved domain, MYB transcription factors can be divided into four categories: 1R-MYB / MYB-related; R2R3-MYB; 3R-MYB; 4R-MYB (4 repetitions of R1 / R2) . MYB transcription factors have a variety of biological functions and are widely involved in the growth and development of plant roots, stems, leaves, and flowers. At the same time, the MYB gene family also responds to abiotic stress processes such as drought, salinity, and cold damage. In addition, MYB transcription factors are also closely related to the quality of certain cash crops.

[0371] As used herein, the family of MADS transcription factors that play critical roles in diverse developmental process in plants including flower and seed development (Minster, et al., 2002; Parenicova, et al., 2003) . MADS protein is composed of domains such as MADS (M) , Intervening (I) , Keratin 2 like (K) and C2 terminal (C) , which belong to domain proteins.

[0372] As used herein, the DREB (dehydration responsive element binding protein) type transcription factor is a subfamily of the AP2 / EREBP (APETALA2 / an ethylene-responsive element binding protein) transcription factor family. It has a conserved AP2 domain and can specifically combine with DRE cis-acting elements in the promoter region of stress resistance genes to regulate the expression of a series of downstream stress response genes under conditions of low temperature, drought, saline-alkali and so on. It is a key regulatory factor in stress adaptation.

[0373] As used herein, the bZIP (basic region / leucine zipper) family of transcription factors comprises the simplest motif that nature uses for targeting specific DNA sites: a pair of short α-helices that recognize the DNA major groove with sequence-specificity and high affinity (Struhl, K., Ann. Rev. Biochem., 1989, 58, 1051; Landschulz, W.H., et al., Science, 1988, 240, 1759-1764) .

[0374] As used herein, plant bZIP transcription factors are a class of proteins that are widely  distributed in eukaryotes and relatively conserved. Its basic region is highly conserved and contains about 20 amino acid residues. According to the difference in the structure of bZIP, it can be divided into 10 subfamilies The transcription factors of different subgroups perform different functions, mainly including the expression of plant seed storage genes, the regulation of plant growth and development, light signal transduction, disease prevention, stress response and ABA sensitivity and other signal responses.

[0375] As used herein, Glutathione-S-Transferases (GSTs) family are a large family of enzymes ubiquitously expressed in animals, plants and microorganism. It is a superfamily of enzymes that are encoded by multiple genes and have multiple functions. They are combined with harmful heterologous substances or oxidation products through glutathione to promote the metabolism, regional isolation or elimination of such substances, and involved in cellular defense against a broad spectrum of cytotoxic agents (see Gate and Tew, Expert Opin. Ther. Targets 5: 477, 2001) . Over 400 different GST sequences have been identified and based on their genetic characteristics and substrate specificity can be classified in four different classes α, μ, π, and θ (see Mannervik et al., Biochem. J. 282: 305, 1992) . Each allelic variant encoded at the same gene locus is distinguished by a letter. According to the homology and gene structure characteristics of plant proteins, the GST family is divided into 8 subfamilies: F (Phi) , U (Tau) , T (Theta) , Z (Zeta) , L (Lambda) , DHAR, EF1Bγ and TCHQD . The F and U families are unique to plants. Compared with other subfamilies, they have the most members and the most abundant content. Soluble GST is mainly distributed in the cytoplasm, a few in chloroplasts and microbodies, and a small amount in the nucleus and apoplasts. Plant GST was first discovered in corn (Zea mays L. ) , and subsequently found in plants such as Arabidopsis thaliana, soybean (Glycinemax) , rice (Oryza sativa L. ) , and tobacco (Nicotiana tabacum L. ) .

[0376] As used herein, the term "organism" includes animals, plants, fungi, bacteria, and the like.

[0377] As used herein, the term "host cell" includes plant cells, animal cells, fungal cells, bacterial cells, and the like.

[0378] In the present invention, the term “animal” includes any member of the animal kingdom, for example, invertebrates and vertebrates. Invertebrates include but not limited to protozoa (such as amoeba) , helminthes, molluscs (such as escargots, snails, freshwater mussels, oysters and devilfishes) , arthropods (such as insects, spiders, and crabs) , etc.; vertebrates include but not limited to fishes (such as zebrafish, salmon, crucian carp, carp or tilapia and other edible economic fish that can be raised artificially) , amphibians (such as frogs, toads and newts) , reptiles (such as snakes, lizards, iguanas, turtles and crocodiles) , birds (such as chickens, geese, ducks, turkeys, ostriches, quails, pheasants, parrots, finches, hawks, eagles, kites, vultures, harriers, ospreys, owls, crows, guinea fowls, pigeons, emus and cassowaries) , mammals (such as humans, non-human primates (such as lemurs, tarsier, monkeys, apes and orangutans) , pigs, cattle, sheep, horses, camels, rabbits, kangaroos, deer, polar bears, canines (such as dogs, wolves, foxes and  jackals) , felines (such as lions, tigers, cheetahs, lynxes and cats) and rodents (such as mice, rats, hamsters and guinea pigs) ] etc. The term "non-human" does not include humans.

[0379] The term “animal” also includes individual animals at every developmental stage (including newborn, embryo, and fetus stage) .

[0380] The term “fungus” refers to any member of eukaryotic organisms generated by saprophytic and parasitic spores. Generally, they are filamentous organisms and previously they are classified as chlorophyll deficiency plants, including but not limited to basidiomycotina, deuteromycotina, ascomycotina, mastigomycotina, zygomycotina, etc. However, it should be understood that the fungal classification is constantly evolving, and as a result, the specific definition of the fungal kingdom might be adjusted in the future. The macro-fungi can be divided into four categories: edible fungi, medicinal fungi, poisonous fungi and fungi with unknown uses. Most of the edible fungi and medicinal fungi belong to basidiomycotina, for example, Tremella fuciformis, Phlogiotis helvelloides, Tremella aurantialba, Auricularia auricular, Auricularia polytricha, Auricularia delicate, Auricularia messenterica, Auricularia rugosissima, Calocera cornea, Fistulina hepatica, Poria cocos, Grifola frondosa, Grifola umbellate, Ganoderma applanatum, Coriolus versicolor, Ganoderma capense, Ganoderma lucifum, Ganoderma cochlear, Ganoderma lobatum, Ganoderma tsugae, Ganderma sinense, Polyporus rhinoceros, Omphalia lapidescens, Phellinus baumii, Cryptoporus volvatus, Pycnoporus cinnabarinus, Fuscoporus obliqus, Sparassis crispa, Hericium erinaceus, Thelephora vialis, Ramaria flava, Ramaria botrytoides, Ramaria stricta, Ramaria botrytis, Clavicorona pyxidata, Clavulina cinerea, Cantharellus cibarius, Hydnum repandum, Lycoperdon perlatum, Lycoperdon Polymorphum, Lycoperdon pusllum, Lycoperdon aurantium, Lycoperdon flavidum, Lycoperdon poleroderma, Lycoperdon verrucosum, Boletus albidus, Boletus aereus, Boletus rubellus, Suillus grevillea, Suillus granulatus, Suillus luteus, Fistulina hepatica, Russula integra, Russula alutacea, Russula zoeteus, Russula Viresceu, Pleurotus citrinopileatus, Pleurotus ostreatus, Pleurotus sapidus, Pleurotus ferulae, Pleurotus abalonus, Pleurotus cornucopiae, Pleurotus cystidiosus, Pleurotus djamor, Pleurotus salmoneostramineus, Pleurotus eryngii (DC. ex Fr. ) Quel. var. eryngii, Pleurotus eryngii (DC. ex Fr. ) Quel. var. ferulae Lanzi, Pleurotus nebrodensis, Pleurotus ostreatus, Pleurotus florida, Pleurotus pulmonarius, Pleurotus tuber-regium, Hohenbuchelia serotine, Agaricus bisporus, Agaricus arvensis, Agaricus blazei, Tricholoma matsutake, Tricholoma gambosum, Tricholoma conglobatum, Tricholoma album, Tricholoma mongolicum, Armillaria mellea, Armillariella ventricosa, Armillariella mucida, Armillariella tabescens, Collybia radicata, Collybia radicata (Relh. ex Fr. ) Quel. var. furfuracea PK., Marasmius androsaceus, Termitomyces albuminosus, Tricholoma giganteum, Hypsizigus marmoreus, Lepista sordida, Lyophyllum ulmarium, Lyophyllum shimeji, Flammulina velutipes, Cortinarius armillatus, Amanita caesarea, Amanita caesarea (Scop. ex Fr. ) Pers. ex Schw. var. alba Gill, Amanita strobiliformis, Amanita vaginata, Volvariella volvacea, Pholiota adiposa, Pholiot squarrosa, Pholiot mutabilis, Pholiota  nameko, Stropharia rugoso-annulata, Coprinus sterquilinus, Coprinus fuscesceus, Coprinus atramentarius, Coprinus comatus, Coprinus ovatus, Dictyophora indusiata, Dictyophora duplicate, Dictyophora echino-volvata, Schizphylhls commne, Agrocybe cylindracea, Lentinus edodes; some are Ascomycotina, for example, Morchella esculenta, Cordyceps sinensis, Cordyceps militaris, Claviceps purpurea, Cordyceps sobolifera, Engleromyces geotzii, Podostroma yunnansis, Shiraia bambusiicola, Hypocrella bambusea, Xylaria nigripes, Tuber spp..

[0381] In the present invention, the “plant” should be understood to mean any differentiated multicellular organism capable of performing photosynthesis, in particular monocotyledonous or dicotyledonous plants, for example, (1) food crops: Oryza spp., like Oryza sativa, Oryza latifolia, Oryza sativa, Oryza glaberrima; Triticum spp., like Triticum aestivum, T. Turgidumssp. durum; Hordeum spp., like Hordeum vulgare, Hordeum arizonicum; Secale cereale; Avena spp., like Avena sativa, Avena fatua, Avena byzantine, Avena fatua var. sativa, Avena hybrida; Echinochloa spp., like Pennisetum glaucum, Sorghum, Sorghum bicolor, Sorghum vulgare, Triticale, Zea mays or Maize, Millet, Rice, Foxtail millet, Proso millet, Sorghum bicolor, Panicum, Fagopyrum spp., Panicum miliaceum, Setaria italica, Zizania palustris, Eragrostis tef, Panicum miliaceum, Eleusine coracana; (2) legume crops: Glycine spp. like Glycine max, Soja hispida, Soja max, Vicia spp., Vigna spp., Pisum spp., field bean, Lupinus spp., Vicia, Tamarindus indica, Lens culinaris, Lathyrus spp., Lablab, broad bean, mung bean, red bean, chickpea; (3) oil crops: Arachis hypogaea, Arachis spp, Sesamum spp., Helianthus spp. like Helianthus annuus, Elaeis like Eiaeis guineensis, Elaeis oleifera, soybean, Brassicanapus, Brassica oleracea, Sesamum orientale, Brassica juncea, Oilseed rape, Camellia oleifera, oil palm, olive, castor-oil plant, Brassica napus L., canola; (4) fiber crops: Agave sisalana, Gossypium spp. like Gossypium, Gossypium barbadense, Gossypium hirsutum, Hibiscus cannabinus, Agave sisalana, Musa textilis Nee, Linum usitatissimum, Corchorus capsularis L, Boehmeria nivea (L. ) , Cannabis sativa, Cannabis sativa; (5) fruit crops: Ziziphus spp., Cucumis spp., Passiflora edulis, Vitis spp., Vaccinium spp., Pyrus communis, Prunus spp., Psidium spp., Punica granatum, Malus spp., Citrullus lanatus, Citrus spp., Ficus carica, Fortunella spp., Fragaria spp., Crataegus spp., Diospyros spp., Eugenia unifora, Eriobotrya japonica, Dimocarpus longan, Carica papaya, Cocos spp., Averrhoa carambola, Actinidia spp., Prunus amygdalus, Musa spp. (musa acuminate) , Persea spp. (Persea Americana) , Psidium guajava, Mammea Americana, Mangifera indica, Canarium album (Oleaeuropaea) , Caricapapaya, Cocos nucifera, Malpighia emarginata, Manilkara zapota, Ananas comosus, Annona spp., Citrus reticulate (Citrus spp. ) , Artocarpus spp., Litchi chinensis, Ribes spp., Rubus spp., pear, peach, apricot, plum, red bayberry, lemon, kumquat, durian, orange, strawberry, blueberry, hami melon, muskmelon, date palm, walnut tree, cherry tree; (6) rhizome crops: Manihot spp., Ipomoea batatas, Colocasia esculenta, tuber mustard, Allium cepa (onion) , eleocharis tuberose (water chestnut) , Cyperus rotundus, Rhizoma dioscoreae; (7) vegetable crops: Spinacia spp., Phaseolus spp., Lactuca sativa, Momordica spp, Petroselinum crispum, Capsicum spp., Solanum spp. (such as Solanum tuberosum, Solanum integrifolium, Solanum lycopersicum) , Lycopersicon spp. (such as Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme) , Macrotyloma spp., Kale, Luffa acutangula,  lentil, okra, onion, potato, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, carrot, cauliflower, celery, collard greens, squash, Benincasa hispida, Asparagus officinalis, Apium graveolens, Amaranthus spp., Allium spp., Abelmoschus spp., Cichorium endivia, Cucurbita spp., Coriandrum sativum, B. carinata, Rapbanus sativus, Brassica spp. (such as Brassica napus, Brassica rapa ssp., canola, oilseed rape, turnip rape, turnip rape, leaf mustard, cabbage, black mustard, canola (rapeseed) , Brussels sprout, Solanaceae (eggplant) , Capsicum annuum (sweet pepper) , cucumber, luffa, Chinese cabbage, rape, cabbage, calabash, Chinese chives, lotus, lotus root, lettuce; (8) flower crops: Tropaeolum minus, Tropaeolum majus, Canna indica, Opuntia spp., Tagetes spp., Cymbidium (orchid) , Crinum asiaticum L., Clivia, Hippeastrum rutilum, Rosa rugosa, Rosa Chinensis, Jasminum sambac, Tulipa gesneriana L., Cerasus sp., Pharbitis nil (L. ) Choisy, Calendula officinalis L., Nelumbo sp., Bellis perennis L., Dianthus caryophyllus, Petunia hybrida, Tulipa gesneriana L., Lilium brownie, Prunus mume, Narcissus tazetta L., Jasminum nudiflorum Lindl., Primula malacoides, Daphne odora, Camellia japonica, Michelia alba, Magnolia liliiflora, Viburnum macrocephalum, Clivia miniata, Malus spectabilis, Paeonia suffruticosa, Paeonia lactiflora, Syzygium aromaticum, Rhododendron simsii, Rhododendron hybridum, Michelia figo (Lour. ) Spreng., Cercis chinensis, Kerria japonica, Weigela florida, Fructus forsythiae, Jasminum mesnyi, Parochetus communis, Cyclamen persicum Mill., Phalaenophsis hybrid, Dendrobium nobile, Hyacinthus orientalis, Iris tectorum Maxim, Zantedeschia aethiopica, Calendula officinalis, Hippeastrum rutilum, Begonia semperflorenshybr, Fuchsia hybrida, Begonia maculataRaddi, Geranium, Epipremnum aureum; (9) medicinal crops: Carthamus tinctorius, Mentha spp., Rheum rhabarbarum, Crocus sativus, Lycium chinense, Polygonatum odoratum, Polygonatum Kingianum, Anemarrhena asphodeloides Bunge, Radix ophiopogonis, Fritillaria cirrhosa, Curcuma aromatica, Amomum villosum Lour., Polygonum multiflorum, Rheum officinale, Glycyrrhiza uralensis Fisch, Astragalus membranaceus, Panax ginseng, Panax notoginseng, Acanthopanax gracilistylus, Angelica sinensis, Ligusticum wallichii, Bupleurum sinenses DC., Datura stramonium Linn., Datura metel L., Mentha haplocalyx, Leonurus sibiricus L., Agastache rugosus, Scutellaria baicalensis, Prunella vulgaris L., Pyrethrum carneum, Ginkgo biloba L., Cinchona ledgeriana, Hevea brasiliensis (wild) , Medicago sativa Linn, Piper Nigrum L., Radix Isatidis, Atractylodes macrocephala Koidz; (10) raw material crops: Hevea brasiliensis, Ricinus communis, Vernicia fordii, Morus alba L., Hops Humulus lupulus, Betula, Alnus cremastogyne Burk., Rhus verniciflua stokes; (11) pasture crops: Agropyron spp., Trifolium spp., Miscanthus sinensis, Pennisetum sp., Phalaris arundinacea, Panicum virgatum, prairiegrasses, Indiangrass, Big bluestem grass, Phleum pratense, turf, cyperaceae (Kobresia pygmaea, Carex pediformis, Carex humilis) , Medicago sativa Linn, Phleum pratense L., Medicago sativa, Melilotus suavcolen, Astragalus sinicus, Crotalaria juncea, Sesbania cannabina, Azolla imbircata, Eichhornia crassipes, Amorpha fruticosa, Lupinus micranthus, Trifolium, Astragalus adsurgens pall, Pistia stratiotes linn, Alternanthera philoxeroides, Lolium; (12) sugar crops: Saccharum spp., Beta vulgaris; (13) beverage crops: Camellia sinensis, Camellia Sinensis, tea, Coffee (Coffea spp. ) , Theobroma cacao, Humulus lupulus Linn.; (14) lawn plants: Ammophila arenaria, Poa spp. (Poa pratensis (bluegrass) ) , Agrostis spp. (Agrostis matsumurae, Agrostis palustris) , Lolium spp. (Lolium) , Festuca spp. (Festuca ovina L. ) , Zoysia spp. (Zoysiajaponica) , Cynodon spp. (Cynodon dactylon / bermudagrass) , Stenotaphrum secunda tum  (Stenotaphrum secundatum) , Paspalum spp., Eremochloa ophiuroides (centipedegrass) , Axonopus spp. (carpetweed) , Bouteloua dactyloides (buffalograss) , Bouteloua var. spp. (Bouteloua gracilis) , Digitaria sanguinalis, Cyperusrotundus, Kyllingabrevifolia, Cyperusamuricus, Erigeron canadensis, Hydrocotylesibthorpioides, Kummerowiastriata, Euphorbia humifusa, Viola arvensis, Carex rigescens, Carex heterostachya, turf; (15) tree crops: Pinus spp., Salix spp., Acer spp., Hibiscus spp., Eucalyptus spp., Ginkgo biloba, Bambusa sp., Populus spp., Prosopis spp., Quercus spp., Phoenix spp., Fagus spp., Ceiba pentandra, Cinnamomum spp., Corchorus spp., Phragmites australis, Physalis spp., Desmodium spp., Populus, Hedera helix, Populus tomentosa Carr, Viburnum odoratissinum, Ginkgo biloba L., Quercus, Ailanthus altissima, Schima superba, Ilex pur-purea, Platanus acerifolia, ligustrum lucidum, Buxus megistophylla Levl., Dahurian larch, Acacia mearnsii, Pinus massoniana, Pinus khasys, Pinus yunnanensis, Pinus finlaysoniana, Pinus tabuliformis, Pinus koraiensis, Juglans nigra, Citrus limon, Platanus acerifolia, Syzygium jambos, Davidia involucrate, Bombax malabarica L., Ceiba pentandra (L. ) , Bauhinia blakeana, Albizia saman, Albizzia julibrissin, Erythrina corallodendron, Erythrina indica, Magnolia gradiflora, Cycas revolute, Lagerstroemia indica, coniferous, macrophanerophytes, Frutex; (16) nut crops: Bertholletia excelsea, Castanea spp., Corylus spp., Carya spp., Juglans spp., Pistacia vera, Anacardium occidentale, Macadamia (Macadamia integrifolia) , Carya illinoensis Koch, Macadamia, Pistachio, Badam, other plants that produce nuts; (17) others: arabidopsis thaliana, Bra chiaria eruciformis, Cenchrus echinatus, Setaria faberi, eleusine indica, Cadaba farinose, algae, Carex elata, ornamental plants, Carissa macrocarpa, Cynara spp., Daucus carota, Dioscorea spp., Erianthus sp., Festuca arundinacea, Hemerocallis fulva, Lotus spp., Luzula sylvatica, Medicago sativa, Melilotus spp., Morus nigra, Nicotiana spp., Olea spp., Ornithopus spp., Pastinaca sativa, Sambucus spp., Sinapis sp., Syzygium spp., Tripsacum dactyloides, Triticosecale rimpaui, Viola odorata, and the like.

[0382] In a specific embodiment, the plant is selected from rice, maize, wheat, soybean, sunflower, sorghum, rape, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco, cassava, potato, sweet potato, Chinese cabbage, cabbage, cucumber, Chinese rose, Scindapsus aureus, watermelon, melon, strawberry, blueberry, grape, apple, citrus, peach, pear, banana, etc.

[0383] As used herein, the term "plant" includes a whole plant and any progeny, cell, tissue or part of plant. The term "plant part" includes any part of a plant, including, for example, but not limited to: seed (including mature seed, immature embryo without seed coat, and immature seed) ; plant cutting; plant cell; plant cell culture; plant organ (e.g., pollen, embryo, flower, fruit, bud, leaf, root, stem, and related explant) . Plant tissue or plant organ can be seed, callus tissue, or any other plant cell population organized into a structural or functional unit. Some plant cells or tissue cultures can regenerate a plant that has the physiological and morphological characteristics of the plant from which the cell or tissue is derived, and can regenerate a plant that has substantially the same genotype as the plant. In contrast, some plant cells cannot regenerate plants. The regenerable cells in plant cells or tissue cultures can be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silks, flowers, kernels, ears, cobs, husks, or stems.

[0384] The plant parts comprise harvestable parts and parts that can be used to propagate offspring plants. The plant parts that can be used for propagation include, for example, but not limited to: seeds, fruits, cuttings, seedlings, tubers and rootstocks. The harvestable parts of plants can be any  of useful parts of plants, including, for example, but not limited to: flowers, pollen, seedlings, tubers, leaves, stems, fruits, seeds and roots.

[0385] The plant cells are the structural and physiological units of plants. As used herein, the plant cells include protoplasts and protoplasts with partial cell walls. The plant cells may be in a form of isolated single cells or cell aggregates (e.g., loose callus and cultured cells) , and may be part of higher order tissue units (e.g., plant tissues, plant organs, and intact plants) . Therefore, the plant cells can be protoplasts, gamete-producing cells, or cells or collection of cells capable of regenerating a whole plant. Therefore, in the embodiments herein, a seed containing a plurality of plant cells and capable of regenerating into a whole plant is considered as a "plant part" .

[0386] As used herein, the term "protoplast" refers to a plant cell whose cell wall is completely or partially removed and whose lipid bilayer membrane is exposed. Typically, the protoplast is an isolated plant cell without cell wall, which has the potential to regenerate a cell culture or a whole plant.

[0387] The plant "offspring" includes any subsequent generations of the plant.

[0388] The terms "inhibitory herbicide tolerance" and "inhibitory herbicide resistance" can be used interchangeably, and both refer to tolerance andresistance to an inhibitory herbicide . "Improvement in tolerance to inhibitory herbicide " and "improvement in resistance to inhibitory herbicide" mean that the tolerance or resistance to the inhibitory herbicide is improved as compared to a plant containing the wild-type gene.

[0389] Generally, if the herbicidal compounds as described herein, which can be employed in the context of the present invention are capable of forming geometrical isomers, for example E / Z isomers, it is possible to use both, the pure isomers and mixtures thereof, in the compositions according to the invention. If the herbicidal compounds as described herein have one or more centers of chirality and, as a consequence, are present as enantiomers or diastereomers, it is possible to use both, the pure enantiomers and diastereomers and their mixtures, in the compositions according to the invention. If the herbicidal compounds as described herein have ionizable functional groups, they can also be employed in the form of their agriculturally acceptable salts. Suitable are, in general, the salts of those cations and the acid addition salts of those acids whose cations and anions, respectively, have no adverse effect on the activity of the active compounds. Preferred cations are the ions of the alkali metals, preferably of lithium, sodium and potassium, of the alkaline earth metals, preferably of calcium and magnesium, and of the transition metals, preferably of manganese, copper, zinc and iron, further ammonium and substituted ammonium in which one to four hydrogen atoms are replaced by C1-C4-alkyl, hydroxy-C1-C4-alkyl, C1-C4-alkoxy-C1-C4-alkyl, hydroxy-C1-C4-alkoxy-C1-C4-alkyl, phenyl or benzyl, preferably ammonium, methylammonium, isopropylammonium, dimethylammonium, diisopropylammonium, trimethylammonium, heptylammonium, dodecylammonium, tetradecylammonium, tetramethylammonium, tetraethylammonium, tetrabutylammonium, 2-hydroxyethylammonium (olamine salt) , 2- (2-hydroxyeth-1 -oxy) eth-1-ylammonium (diglycolamine salt) , di (2-hydroxyeth-1-yl) ammonium (diolamine salt) , tris (2-hydroxyethyl) ammonium (trolamine salt) , tris (2-hydroxypropyl) ammonium,  benzyltrimethylammonium, benzyltriethylammonium, Ν, Ν, Ν-trimethylethanolammonium (choline salt) , furthermore phosphonium ions, sulfonium ions, preferably tri (C1-C4-alkyl) sulfonium, such as tri-methylsulfonium, and sulfoxonium ions, preferably tri (C1-C4-alkyl) sulfoxonium, and finally the salts of polybasic amines such as N, N-bis- (3-aminopropyl) methylamine and diethylenetri amine. Anions of useful acid addition salts are primarily chloride, bromide, fluoride, iodide, hydrogensulfate, methylsulfate, sulfate, dihydrogenphosphate, hydrogenphosphate, nitrate, bi-carbonate, carbonate, hexafluorosilicate, hexafluorophosphate, benzoate and also the anions of C1-C4-alkanoic acids, preferably formate, acetate, propionate and butyrate.

[0390] The herbicidal compounds as described herein having a carboxyl group can be employed in the form of the acid, in the form of an agriculturally suitable salt as mentioned above or else in the form of an agriculturally acceptable derivative, for example as amides, such as mono-and di-C1-C6-alkylamides or arylamides, as esters, for example as allyl esters, propargyl esters, C1-C10-alkyl esters, alkoxyalkyl esters, tefuryl ( (tetra-hydrofuran-2-yl) methyl) esters and also as thioesters, for example as C1-C10-alkylthio esters. Preferred mono-and di-C1-C6-alkylamides are the methyl and the dimethylamides. Preferred arylamides are, for example, the anilides and the 2-chloroanilides. Preferred alkyl esters are, for example, the methyl, ethyl, propyl, isopropyl, butyl, isobutyl, pentyl, mexyl (1-methyl hexyl) , meptyl (1-methylheptyl) , heptyl, octyl or isooctyl (2-ethylhexyl) esters. Preferred C1-C4-alkoxy-C1-C4-alkyl esters are the straight-chain or branched C1-C4-alkoxy ethyl esters, for example the 2-methoxyethyl, 2-ethoxyethyl, 2-butoxyethyl (butotyl) , 2-butoxypropyl or 3-butoxypropyl ester. An example of a straight-chain or branched C1-C6-alkylthio ester is the ethylthio ester.

[0391] (1) Inhibition of HPPD (Hydroxyphenyl Pyruvate Dioxygenase) : a substance that has herbicidal activity per se or a substance that is used in combination with other herbicides and / or additives which can change its effect, and the substance can act by inhibiting HPPD. Substances which are capable of producing herbicidal activity by inhibiting HPPD are well known in the art, including but not limited to the following types:

[0392] 1) triketones, e.g., sulcotrione (CAS NO.: 99105-77-8) , mesotrione (CAS NO.: 104206-82-8) , bicyclopyrone (CAS NO.: 352010-68-5) , tembotrione (CAS NO.: 335104-84-2) , tefuryltrione (CAS NO.: 473278-76-1) , benzobicyclon (CAS NO.: 156963-66-5) ;

[0393] 2) diketonitriles, e.g., 2-cyano-3-cyclopropyl-1- (2-methylsulfonyl-4-trifluoromethylphenyl) propane-1, 3-dione (CAS NO.: 143701-75-1) , 2-cyano-3-cyclopropyl-1- (2-methylsulfonyl-3, 4-dichlorophenyl) propane-1, 3-dione (CAS NO.: 212829-55-5) , 2-cyano-1- [4- (methylsulfonyl) -2-trifluoromethylphenyl] -3- (1-methyl cycloprop-yl) propane-1, 3-dione (CAS NO.: 143659-52-3) ;

[0394] 3) isoxazoles, e.g., isoxaflutole (CAS NO.: 141112-29-0) , isoxachlortole (CAS NO.: 141112-06-3) , clomazone (CAS NO.: 81777-89-1) ;

[0395] 4) pyrazoles, e.g., topramezone (CAS NO.: 210631-68-8) ; pyrasulfotole (CAS NO.: 365400-11-9) , pyrazoxyfen (CAS NO.: 71561-11-0) ; pyrazolate (CAS NO.: 58011-68-0) , benzofenap (CAS NO.: 82692-44-2) , bipyrazone (CAS NO.: 1622908-18-2) , tolpyralate (CAS NO.: 1101132-67-5) , fenpyrazone (CAS NO.: 1992017-55-6) , cypyrafluone (CAS NO.: 1855929-45-1) , tripyrasulfone (CAS NO.: 1911613-97-2) ;

[0396] 5) benzophenons;

[0397] 6) others: lancotrione (CAS NO.: 1486617-21-3) , fenquinotrione (CAS NO.: 1342891-70-6) , fufengcao’an (CAS NO: 2421252-30-2) ;

[0398] and those mentioned in patent CN105264069A.

[0399] (2) Inhibition of EPSPS (Enolpyruvyl Shikimate Phosphate Synthase) : e.g., sulphosate, Glyphosate, glyphosate-isopropylammonium, and glyphosate-trimesium.

[0400] (3) Inhibition of PPO (Protoporphyrinogen Oxidase) can be divided into pyrimidinediones, diphenyl-ethers, phenylpyrazoles, N-phenylphthalimides, thiadiazoles, oxadiazoles, triazolinones, oxazolidinedionesand other herbicides with different chemical structures.

[0401] In an exemplary embodiment, pyrimidinediones herbicides include but not limited to butafenacil (CAS NO: 134605-64-4) , saflufenacil (CAS NO: 372137-35-4) , benzfendizone (CAS NO: 158755-95-4) , tiafenacil (CAS NO: 1220411-29-9) , ethyl [3- [2-chloro-4-fluoro-5- (1-methyl-6-trifluoromethyl -2, 4-dioxo-1, 2, 3, 4-tetrahydropyrimidin-3-yl) phenoxy] -2-pyridyloxy] acetate (Epyrifenacil, CAS NO: 353292-31-6) , 1 -Methyl-6-thfluoromethyl-3- (2, 2, 7-thfluoro-3-oxo-4-prop-2-ynyl -3, 4-dihydro-2H-benzo [1, 4] oxazin-6-yl) -1H-pyrimidine-2, 4-dione (CAS NO: 1304113-05-0) , 3- [7-Chloro-5-fluoro-2- (trifluoromethyl) -1 H-benzimidazol-4-yl] -1 -methyl-6- (trifluoromethyl) -1 H-pyrimidine-2, 4-dione (CAS NO: 212754-02-4) , flupropacil (CAS NO: 120890-70-2) , uracil containing isoxazoline disclosed in CN105753853A (for example, the compound ) , uracil pyridines disclosed in WO2017 / 202768 and uracils disclosed in WO2018 / 019842;

[0402] Diphenyl-ethers herbicides include but not limited to fomesafen (CAS NO: 72178-02-0) , oxyfluorfen (CAS NO: 42874-03-3) , aclonifen (CAS NO: 74070-46-5) , ethoxyfen-ethyl (CAS NO: 131086-42-5) , lactofen (CAS NO: 77501-63-4) , chlomethoxyfen (CAS NO: 32861-85-1) , chlornitrofen (CAS NO: 1836-77-7) , fluoroglycofen-ethyl (CAS NO: 77501-90-7) , Acifluorfen or Acifluorfen sodium (CAS NO: 50594-66-6 or 62476-59-9) , Bifenox (CAS NO: 42576-02-3) , ethoxyfen (CAS NO: 188634-90-4) , fluoronitrofen (CAS NO: 13738-63-1) , furyloxyfen (CAS NO: 80020-41-3) , nitrofluorfen (CAS NO: 42874-01-1) , and halosafen (CAS NO: 77227-69-1) ;

[0403] Phenylpyrazoles herbicides include but not limited to pyraflufen-ethyl (CAS NO: 129630-19-9) , and fluazolate (CAS NO: 174514-07-9) ;

[0404] N-phenylphthalimides herbicides include but not limited to flumioxazin (CAS NO: 103361-09-7) , cinidonethyl (CAS NO: 142891-20-1) , Flumipropyn (CAS NO: 84478-52-4) , and flumiclorac-pentyl (CAS NO: 87546-18-7) ;

[0405] Thiadiazoles herbicides include but not limited tofluthiacet-methyl (CAS NO: 117337-19-6) , fluthiacet (CAS NO: 149253-65-6) , and thidiazimin (CAS NO: 123249-43-4) ;

[0406] Oxadiazoles herbicides include but not limited to Oxadiargyl (CAS NO: 39807-15-3) , and Oxadiazon (CAS NO: 19666-30-9) ;

[0407] Triazolinones herbicidesinclude but not limited to carfentrazone (CAS NO: 128621-72-7) , carfentrazone-ethyl (CAS NO: 128639-02-1) , sulfentrazone (CAS NO: 122836-35-5) , azafenidin (CAS NO: 68049-83-2) , and bencarbazone (CAS NO: 173980-17-1) ;

[0408] Oxazolidinediones herbicides include but not limited to pentoxazone (CAS NO: 110956-75-7) ;

[0409] Other herbicides include but not limited to pyraclonil (CAS NO: 158353-15-2) , flufenpyr-ethyl (CAS NO: 188489-07-8) , profluazol (CAS NO: 190314-43-3) , trifludimoxazin (CAS NO: 1258836-72-4) , N-ethyl-3-2, 6-dichloro-4-t fluoromethylphenoxy) -5-methyl-1 H-pyrazole-1-carboxamide (CAS NO: 452098-92-9) , N-tetrahydrofurfuryl-3- (2, 6-dichloro-4-trifluoromethylphenoxy) -5-methyl-1 H-pyrazole-1-carboxamide (CAS NO: 915396-43-9) , N-ethyl-3- (2-chloro-6-fluoro-4-trifluoromethylphenoxy) -5-methyl -1H-pyrazole-1-carboxamide (CAS NO: 452099-05-7) , N-tetrahydrofurfuryl-3- (2-chloro-6-fluoro-4-trifluoromethylphenoxy) -5-methyl-1 H-pyrazole-1-carboxamide (CAS NO: 452100-03-7) , 3- [7-fluoro-3-oxo-4- (prop-2-ynyl) -3, 4-dihydro-2H-benzo [1, 4] oxazin-6-yl] -1, 5-dimethyl-6-thioxo - [1, 3, 5] triazinan-2, 4-dione (CAS NO: 451484-50-7) , 2- (2, 2, 7-Trifluoro-3-oxo-4-prop-2-ynyl-3, 4-dihydro-2H-benzo [1, 4] oxazin-6-yl) -4, 5, 6, 7-tetrahydro -isoindole-1, 3-dione (CAS NO: 1300118-96-0) , methyl (E) -4- [2-chloro-5- [4-chloro-5- (difluoromethoxy) -1H-methyl-pyrazol-3-yl] -4-fluoro-phenoxy] -3-methoxy-but-2-enoate (CAS NO: 948893-00-3) , phenylpyridines disclosed in WO2016 / 120116, benzoxazinone derivatives disclosed in EP09163242.2, and compounds represented by general formula I  (See patent CN202011462769.7) ;

[0410] In another exemplary embodiment, Q represents

[0411] Y represents halogen, halo C1-C6 alkyl or cyano;

[0412] Z represents halogen

[0413] M represents CH or N;

[0414] X represents -CX1X2- (C1-C6 alkyl) n-, - (C1-C6 alkyl) -CX1X2- (C1-C6 alkyl) n-or - (CH2) r-; n represents 0 or 1; r represents an integer of 2 or more;

[0415] X1, X2 each independently represent H, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halo C1-C6 alkyl, halo C2-C6 alkenyl, halo C2-C6 alkynyl, C3-C6 cycloalkyl, C3-C6 cycloalkyl C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylthio, hydroxy C1-C6 alkyl, C1-C6 alkoxy C1-C6 alkyl, phenyl or benzyl;

[0416] X3, X4 each independently represent O or S;

[0417] W represents hydroxy, C1-C6 alkoxy, C2-C6 alkenyloxy, C2-C6 alkynyloxy, halo C1-C6 alkoxy, halo C2-C6 alkenyloxy, halo C2-C6 alkynyloxy, C3-C6 cycloalkyloxy, phenyloxy, sulfhydryl, C1-C6 alkylthio, C2-C6 alkenylthio, C2-C6 alkynylthio, halo C1-C6 alkylthio, halo C2-C6 alkenylthio, halo C2-C6 alkynylthio, C3-C6 cycloalkylthio, phenylthio, amino or C1-C6 alkylamino.

[0418] In another exemplary embodiment, the compound represented by the general formula I is selected from compound A: Q represents Y represents chlorine; Z represents fluorine; M represents CH; X represents -C*X1X2- (C1-C6 alkyl) n- (C*is the chiral center, R configuration) , n represents 0; X1 represents hydrogen; X2 represents methyl; X3 and X4 each independently represent O; W represents methoxy.

[0419] 4) Inhibition of ALS (Acetolactate Synthase) including but not limited to the following herbicides or their mixtures:

[0420] (1) sulfonylureas such as amidosulfuron, azimsulfuron, bensulfuron, bensulfuron-methyl, chlorimuron, chlorimuron-ethyl, chlorsulfuron, cinosulfuron, cyclosulfamuron, ethametsulfuron, ethametsulfuron-methyl, ethoxysulfuron, flazasulfuron, flucetosulfuron, flupyrsulfuron, flupyrsulfuron-methyl-sodium, foramsulfuron, halosulfuron, halosulfuron-methyl, imazosulfuron, iodosulfuron, iodosulfuron-methyl-sodium, iofensulfuron, iofensulfuron-sodium, mesosulfuron, metazosulfuron, metsulfuron, metsulfuron-methyl, nicosulfuron, orthosulfamuron, oxasulfuron, primisulfuron, primisulfuron-methyl, propyrisulfuron, prosulfuron, pyrazosulfuron, pyrazosulfuron-ethyl, rimsulfuron, sulfometuron, sulfometuron-methyl, sulfosulfuron, thifensulfuron, thifensulfuron-methyl, triasulfuron, tribenuron, tribenuron-methyl, trifloxysulfuron, trifloxysulfuron-sodium, triflusulfuron, triflusulfuron-methyl and tritosulfuron;

[0421] (2) imidazolinones such as imazamethabenz, imazamethabenz-methyl, imazamox, imazapic, imazapyr, imazaquin and imazethapyr;

[0422] (3) triazolopyrimidine herbicides and sulfonanilides such as cloransulam, cloransulam-methyl, diclosulam, flumetsulam, florasulam, metosulam, penoxsulam, pyroxsulam, pyrimisulfan and triafamone;

[0423] (4) pyrimidinylbenzoates such as bispyribac, bispyribac-sodium, pyribenzoxim, pyriftalid, pyriminobac, pyriminobac-methyl, pyrithiobac, pyrithiobac-sodium, 4- [ [ [2- [ (4, 6-dimethoxy-2-pyrimidinyl) oxy] phenyl] methyl] amino] -benzoic acid-1 -methylethyl ester (CAS NO.: 420138-41 -6) , 4- [ [ [2- [ (4, 6-dimethoxy-2-pyrimidinyl) oxy] phenyl] methyl] amino] -benzoic acid propyl ester (CAS NO.: 420138-40-5) , N- (4-bromophenyl) -2- [ (4, 6-dimethoxy-2-pyrimidinyl) oxy] benzenemethanamine (CAS NO.: 420138-01 -8) ;

[0424] (5) sulfonylaminocarbonyl-triazolinone herbicides such as flucarbazone, flucarbazone-sodium, propoxycarbazone, propoxycarbazone-sodium, thiencarbazone and thiencarbazone-methyl;

[0425] 5) Inhibition of ACCase (Acetyl CoA Carboxylas) : Fenthiaprop, alloxydim, alloxydim-sodium, butroxydim, clethodim, clodinafop, clodinafop-propargyl, cycloxydim, cyhalofop, cyhalofop-butyl, diclofop, diclofop-methyl, fenoxaprop, fenoxaprop-ethyl, fenoxaprop-P, fenoxaprop-P-ethyl, fluazifop, fluazifop-butyl, fluazifop-P, fluazifop-P-butyl, haloxyfop, haloxyfop-methyl, haloxyfop-P, haloxyfop-P-methyl, metamifop, pinoxaden, profoxydim, propaquizafop, quizalofop, quizalofop-ethyl, quizalofop-tefuryl, quizalofop-P, quizalofop-P-ethyl, quizalofop-P-tefuryl, sethoxydim, tepraloxydim, tralkoxydim, 4- (4'-Chloro-4-cyclopropyl-2'-fluoro [1, 1'-biphenyl] -3-yl) -5-hydroxy-2, 2, 6, 6-tetramethyl-2H-pyran-3 (6H) -one (CAS NO. 1312337-72-6) ; 4- (2', 4'-Dichloro-4-cyclopropyl [1, 1'-biphenyl] -3-yl) -5-hydroxy-2, 2, 6, 6-tetramethyl-2H-pyran-3 (6H) -one (CAS NO.: 1312337-45-3) ;  4- (4'-Chloro-4-ethyl-2'-fluoro [1, 1'-biphenyl] -3-yl) -5-hydroxy-2, 2, 6, 6-tetramethyl -2H-pyran-3 (6H) -one (CAS NO.: 1033757-93-5) ; 4- (2', 4'-Dichloro-4-ethyl [1, 1'-biphenyl] -3-yl) -2, 2, 6, 6-tetramethyl-2H-pyran-3, 5 (4H, 6H) -dione (CAS NO.: 1312340-84-3) ; 5- (Acetyloxy) -4- (4'-chloro-4-cyclopropyl-2'-fluoro [1, 1'-biphenyl] -3-yl) -3, 6-dihydro-2, 2, 6, 6-tetramethyl-2H-pyran-3-one (CAS NO.: 1312337-48-6) ; 5- (Acetyloxy) -4- (2′, 4'-dichloro-4-cyclopropyl- [1, 1'-biphenyl] -3-yl) -3, 6-dihydro -2,2, 6, 6-tetramethyl-2H-pyran-3-one; 5- (Acetyloxy) -4- (4'-chloro-4-ethyl-2'-fluoro [1, 1'-biphenyl] -3-yl) -3, 6-dihydro-2, 2, 6, 6-tetramethyl-2H-pyran-3-one (CAS NO.: 1312340-82-1) ; 5- (Acetyloxy) -4- (2', 4'-dichloro -4-ethyl [1, 1'-biphenyl] -3-yl) -3, 6-dihydro-2, 2, 6, 6-tetramethyl-2H-pyran-3-one (CAS NO.: 1033760-55-2) ; 4- (4'-Chloro -4-cyclopropyl-2'-fluoro [1, 1'-biphenyl] -3-yl) -5, 6-dihydro-2, 2, 6, 6-tetramethyl-5-oxo-

[0426] '2H-pyran-3-yl carbonic acid methyl ester (CAS NO.: 1312337-51-1) ; 4- (2, 4'-Dichloro-4-cyclopropyl- [1, 1'-biphenyl] -3-yl) -5, 6-dihydro-2, 2, 6, 6-tetramethyl-5-oxo -2H-pyran-3-yl carbonic acid methyl ester; 4- (4'-Chloro-4-ethyl-2'-fluoro [1,1'-biphenyl] -3-yl) -5, 6-dihydro-2, 2, 6, 6-tetramethyl-5-oxo-2H-pyran-3-yl carbonic acid methyl ester (CAS NO.: 1312340-83-2) ; 4- (2', 4'-Dichloro-4-ethyl [1, 1'-biphenyl] -3-yl) -5, 6-dihydro-2, 2, 6, 6-tetramethyl-5-oxo-2H-pyran-3-yl carbonic acid methyl ester (CAS NO.: 1033760-58-5) .

[0427] (6) Inhibition of GS (Glutamine Synthetase) : e.g., Bialaphos / bilanafos, Bilanaphos-natrium, Glufosinate-ammonium, Glufosinate, and glufosinate-P.

[0428] (7) Inhibition of PDS (Phytoene Desaturase) : e.g., flurochloridone, flurtamone, beflubutamid, norflurazon, fluridone, Diflufenican, Picolinafen, and 4- (3-trifluoromethylphenoxy) -2- (4-trifluoromethylphenyl) pyrimidine (CAS NO: 180608-33-7) .

[0429] (8) Inhibition of DHPS (Dihydropteroate Synthase) : e.g., Asulam.

[0430] (9) Inhibition of DXPS (Deoxy-D-Xyulose Phosphate Synthase) : e.g., Bixlozone, and Clomazone.

[0431] (10) Inhibition of HST (Homogentisate Solanesyltransferase) : e.g., Cyclopyrimorate.

[0432] (11) Inhibition of SPS (Solanesyl Diphosphate Synthase) : e.g., Aclonifen.

[0433] (12) Inhibition of Cellulose Synthesis: e.g., Indaziflam, Triaziflam, Chlorthiamid, Dichlobenil, Isoxaben, Flupoxam, 1-cyclohexyl-5-pentafluorphenyloxy-14- [1, 2, 4, 6] thiatriazin-3-ylamine (CAS NO: 175899-01-1) , and the azines disclosed in CN109688807A.

[0434] (13) Inhibition of VLCFAS (Very Long-Chain Fatty Acid Synthesis) include but not limited to the following types:

[0435] 1) α-Chloroacetamides: e.g., acetochlor, alachlor, butachlor, dimethachlor, dimethenamid, dimethenamid-P, metazachlor, metolachlor, metolachlor-S, pethoxamid, pretilachlor, propachlor, propisochlor, and thenylchlor;

[0436] 2) α-Oxyacetamides: e.g., flufenacet, and mefenacet;

[0437] 3) α-Thioacetamides: e.g., anilofos, and piperophos;

[0438] 4) Azolyl-carboxamides: e.g., cafenstrole, fentrazamide, and ipfencarbazone;

[0439] 5) Benzofuranes: e.g., Benfuresate, and Ethofumesate;

[0440] 6) Isoxazolines: e.g., fenoxasulfone, and pyroxasulfone;

[0441] 7) Oxiranes: e.g., Indanofan, and Tridiphane;

[0442] 8) Thiocarbamates: e.g.,

[0443] Cycloate, Dimepiperate, EPTC, Esprocarb, Molinate, Orbencarb, Prosulfocarb, Thiobencarb / Be nthiocarb, Tri-allate, Vernolate, and isoxazoline compounds of the formulae II. 1, II. 2, II. 3, II. 4, II. 5, II. 6, II. 7, II. 8 and II. 9, and other isoxazoline compounds mentioned in patent WO 2006 / 024820, WO 2006 / 037945, WO 2007 / 071900, WO 2007 / 096576, etc..

[0444]

[0445] (14) Inhibition of fatty acid thioesterase: e.g., Cinmethylin, and Methiozolin;

[0446] (15) Inhibition of serine threonine protein phosphatase: e.g., Endothall.

[0447] (16) Inhibition of lycopene cyclase: e.g., Amitrole.

[0448] The term "wild-type" refers to a nucleic acid molecule or protein that can be found in nature.

[0449] In the present invention, the term "cultivation site" comprises a site where the plant of the present invention is cultivated, such as soil, and also comprises, for example, plant seeds, plant seedlings and grown plants. The term "weed-controlling effective amount" refers to an amount of herbicide that is sufficient to affect the growth or development of the target weed, for example, to prevent or inhibit the growth or development of the target weed, or to kill the weed. Advantageously, the weed-controlling effective amount does not significantly affect the growth  and / or development of the plant seeds, plant seedlings or plants of the present invention. Those skilled in the art can determine such weed-controlling effective amount through routine experiments.

[0450] The term "gene" comprises a nucleic acid fragment expressing a functional molecule (such as, but not limited to, specific protein) , including regulatory sequences before (5' non-coding sequences) and after (3' non-coding sequences) a coding sequence.

[0451] The DNA sequence that "encodes" a specific RNA is a DNA nucleic acid sequence that can be transcribed into RNA. The DNA polynucleotides can encode a RNA (mRNA) that can be translated into a protein, or the DNA polynucleotides can encode a RNA that cannot be translated into a protein (for example, tRNA, rRNA, or DNA-targeting RNA; which are also known as "non-coding" RNA or "ncRNA" ) .

[0452] The terms "polypeptide" , "peptide" and "protein" are used interchangeably in the present invention, and refer to a polymer of amino acid residues. The terms are applied to amino acid polymers in which one or more amino acid residues are artificially chemical analogs of corresponding and naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The terms "polypeptide" , "peptide" , "amino acid sequence" and "protein" may also include their modification forms, including but not limited to glycosylation, lipid linkage, sulfation, γ-carboxylation of glutamic acid residue, hydroxylation and ADP-ribosylation.

[0453] The term "biologically active fragment" refers to a fragment that has one or more amino acid residues deleted from the N and / or C-terminus of a protein while still retaining its functional activity.

[0454] The terms "polynucleotide" and "nucleic acid" are used interchangeably and comprise DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

[0455] The terms "nucleotide sequence" and "nucleic acid sequence" both refer to the sequence of bases in DNA or RNA.

[0456] Those of ordinary skill in the art can easily use known methods, such as directed evolution and point mutation methods, to mutate the DNA fragments as shown in SEQ ID No. 9 to SEQ ID No. 17 of the present invention. Those artificially modified nucleotidesequences that have at least 75%identity to any one of the foregoing sequences of the present invention and exhibit the same function are considered as derivatives of the nucleotide sequence of the present invention and equivalent to the sequences of the present invention.

[0457] The term "identity" refers to the sequence similarity to a natural nucleic acid sequence. Sequence identity can be evaluated by observation or computer software. Using a computer sequence alignment software, the identity between two or more sequences can be expressed as a percentage (%) , which can be used to evaluate the identity between related sequences. "Partial sequence" means at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%or 95%of a given sequence.

[0458] The stringent condition may be as follows: hybridizing at 50℃ in a mixed solution of 7%sodium dodecyl sulfate (SDS) , 0.5M NaPO4, and 1 mM EDTA, and washing at 50℃ in 2× SSC and 0.1%SDS; or alternatively: hybridizing at 50℃ in a mixed solution of 7%SDS, 0.5M NaPO4 and 1mM EDTA, and washing at 50℃ in 1× SSC and 0.1%SDS; or alternatively: hybridizing at 50℃ in a mixed solution of 7%SDS, 0.5M NaPO4 and 1mM EDTA, and washing  at 50℃ in 0.5× SSC and 0.1%SDS; or alternatively: hybridizing at 50℃ in a mixed solution of 7%SDS, 0.5M NaPO4 and 1mM EDTA, and washing at 50℃ in 0.1× SSC and 0.1%SDS; or alternatively: hybridizing at 50℃ in a mixed solution of 7%SDS, 0.5M NaPO4 and 1mM EDTA, and washing at 65℃ in 0.1× SSC and 0.1%SDS; or alternatively: hybridizing at 65℃ in a solution of 6× SSC, 0.5%SDS, and then membrane washing with 2× SSC, 0.1%SDS and 1×SSC, 0.1%SDS each once; or alternatively: hybridizing and membrane washing twice in a solution of 2× SSC, 0.1%SDS at 68℃, 5 min each time, and then hybridizing and membranewashing twice in a solution of 0.5× SSC, 0.1%SDS at 68℃, 15min each time; or alternatively: hybridizing and membrane washing in a solution of 0.1× SSPE (or 0.1× SSC) , 0.1%SDS at 65℃.

[0459] As used in the present invention, "expression cassette" , "expression vector" and "expression construct" refer to a vector such as a recombinant vector suitable for expression of a nucleotide sequence of interest in a plant. The term "expression" refers to the production of a functional product. For example, the expression of a nucleotide sequence may refer to the transcription of the nucleotide sequence (such as transcription to generate mRNA or functional RNA) and / or the translation of RNA into a precursor or mature protein.

[0460] The "expression construct" of the present invention can be a linear nucleic acid fragment, a circular plasmid, a viral vector, or, in some embodiments, can be an RNA (such as mRNA) that can be translated.

[0461] The "expression construct" of the present invention may comprise regulatory sequences and nucleotide sequences of interest from different sources, or regulatory sequences and nucleotide sequences of interest from the same source but arranged in a way different from those normally occurring in nature.

[0462] The "highly-expressing gene" in the present invention refers to a gene whose expression level is higher than that of a common gene in a specific tissue.

[0463] The terms "recombinant expression vector" or "DNA construct" are used interchangeably herein and refer to a DNA molecule comprising a vector and at least one insert. Recombinant expression vectors are usually produced for the purpose of expression and / or propagation of the insert or for the construction of other recombinant nucleotide sequences. The insert may be operably or may be inoperably linked to a promoter sequence and may be operably or may be inoperably linked to a DNA regulatory sequence.

[0464] The terms "regulatory sequence" and "regulatory element" can be used interchangeably and refer to a nucleotide sequence that is located at the upstream (5' non-coding sequence) , middle or downstream (3' non-coding sequence) of a coding sequence, and affects the transcription, RNA processing, stability or translation of a related coding sequence. Plant expression regulatory elements refer to nucleotide sequences that can control the transcription, RNA processing or stability or translation of a nucleotide sequence of interest in plants.

[0465] The regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyA recognition sequences.

[0466] The term "promoter" refers to a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment. In some embodiments of the present invention, the promoter is a promoter capable of controlling gene transcription in plant cells, regardless of  whether it is derived from plant cells. The promoter can be a constitutive promoter or a tissue-specific promoter or a developmentally regulated promoter or an inducible promoter.

[0467] The term "strong promoter" is a well-known and widely used term in the art. Many strong promoters are known in the art or can be identified by routine experiments. The activity of the strong promoter is higher than the activity of the promoter operatively linked to the nucleic acid molecule to be overexpressed in a wild-type organism, for example, a promoter with an activity higher than the promoter of an endogenous gene. Preferably, the activity of the strong promoter is higher by about 2%, 5%, 8%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, 1000%or more than 1000%than the activity of the promoter operably linked to the nucleic acid molecule to be overexpressed in the wild-type organism. Those skilled in the art know how to measure the activity of apromoter and compare the activities of different promoters.

[0468] The term "constitutive promoter" refers to a promoter that will generally cause gene expression in most cell types in most cases. "Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably, and refer to a promoter that is mainly but not necessarily exclusively expressed in a tissue or organ, and also expressed in a specific cell or cell type. "Developmentally regulated promoter" refers to a promoter whose activity is determined by a developmental event. "Inducible promoter" responds to an endogenous or exogenous stimulus (environment, hormone, chemical signal, etc. ) to selectively express an operably linked DNA sequence.

[0469] As used herein, the term "operably linked" refers to a connection of a regulatory element (for example, but not limited to, promoter sequence, transcription termination sequence, etc. ) to a nucleic acid sequence (for example, a coding sequence or open reading frame) such that the transcription of the nucleotide sequence is controlled and regulated by the transcription regulatory element. The techniques for operably linking regulatory element region to nucleic acid molecule are known in the art.

[0470] The "introducing" a nucleic acid molecule (such as a plasmid, linear nucleic acid fragment, RNA, etc. ) or protein into a plant refers to transforming a cell of the plant with the nucleic acid or protein so that the nucleic acid or protein can function in the plant cell. The term "transformation" used in the present invention comprises stable transformation and transient transformation.

[0471] The term "stable transformation" refers to that the introduction of an exogenous nucleotide sequence into a plant genome results in a stable inheritance of the exogenous gene. Once stably transformed, the exogenous nucleic acid sequence is stably integrated into the genome of the plant and any successive generations thereof.

[0472] The term "transient transformation" refers to that the introduction of a nucleic acid molecule or protein into a plant cell to perform function does not result in a stable inheritance of the foreign gene. In transient transformation, the exogenous nucleic acid sequence is not integrated into the genome of the plant.

[0473] Changing the expression of endogenous genes in organisms includes two aspects: intensity and spatial-temporal characteristics. The change of intensity includes the increase (knock-up) , decrease (knock-down) and / or shut off the expression of the gene (knock-out) ; the spatial-temporal specificity includes temporal (growth and development stage) specificity and  spatial (tissue) specificity, as well as inducibility. In addition, it includes changing the targeting of a protein, for example, changing the feature of cytoplasmic localization of a protein into a feature of chloroplast localization or nuclear localization.

[0474] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described.

[0475] All publications and patents cited in this description are incorporated herein by reference as if each individual publication or patent is exactly and individually indicated to be incorporated by reference, and is incorporated herein by reference to disclose and describe methods and / or materials related to the publications cited. The citation of any publication which it was published before the filing date should not be interpreted as an admission that the present invention is not eligible to precede the publication of the existing invention. In addition, the publication date provided may be different from the actual publication date, which may require independent verification.

[0476] Unless specifically stated or implied, as used herein, the terms "a" , "a / an" and "the" mean "at least one. " All patents, patent applications, and publications mentioned or cited herein are incorporated herein by reference in their entirety, with the same degree of citation as if they were individually cited.

[0477] The present invention has the following advantageous technical effects:

[0478] The present invention comprehensively uses the information of the following two different professional fields to develop a method for directly creating new genes in organisms, completely changing the conventional use of the original gene editing tools (i.e., knocking out genes) , realizing a new use thereof for creating new genes, in particular, realizing an editing method for knocking up endogenous genes by using gene editing technology to increase the expression of target genes. The first is the information in the field of gene editing, that is, when two or more different target sites and Cas9 simultaneously target the genome or organism, different situations such as deletion, inversion, doubling or inversion-doubling may occur. The second is the information in the field of genomics, that is, the information about location and distance of different genes in the genome, and specific locations, directions and functions of different elements (promoter, 5'UTR, coding region (CDS) , different domain regions, terminator, etc. ) in genes, and expression specificity of different genes, etc. By combining the information in these two different fields, breaks are induced at specific sites of two or more different genes or at two or more specific sites within a single gene (specific sites can be determined in the field of genomics) , a new combination of different gene elements or functional domains can be formed through deletion, inversion, doubling, and inversion-doubling or chromosome arm exchange, etc. (the specific situations would be provided in the field of gene editing) , thereby specifically creating a new gene in the organism.

[0479] The new genes created by the present invention are formed by the fusion or recombination of different elements of two or more genes under the action of the spontaneous DNA repair mechanism in the organism to change the expression intensity, spatial-temporal specificity,  special functional domains and the like of the original gene without an exogenous transgene or synthetic gene elements. Because the new gene has the fusion of two or more different gene elements, this greatly expands the scope of gene mutation, and will produce more abundant and diverse functions, thus it has a wide range of application prospects. At the same time, these new genes are not linked to the gene editing vectors, so the vector elements can be removed through genetic segregation, and thereby resulting in non-transgenic biological materials containing the new genes for animal and plant breeding. Alternatively, non-integrated transient editing can be performed by delivery of mRNA or ribonucleic acid protein complex (RNP) to create non-genetically modified biological materials containing the new genes. This process is non-transgenic and the resultant edited materials would contain no transgene as well. In theory and in fact, these new genes can also be obtained through traditional breeding techniques (such as radiation or chemical mutagenesis) . The difference is that the screening with traditional techniques requires the creation of libraries containing a huge number of random mutants and thus it is time-consuming and costly to screen new functional genes. While in the present invention, new functional genes can be created through bioinformatics analysis combined with gene editing technology, the breeding duration can be greatly shortened. The method of the present invention is not obliged to the current regulations on gene editing organisms in many countries.

[0480] In addition, the new gene creation technology of the present invention can be used to change many traits in organisms, including the growth, development, resistance, yield, etc., and has great application value. The new genes created may have new regulatory elements (such as promoters) , which will change the expression intensity and and / or spatial-temporal characteristics of the original genes, or will have new amino acid sequences and thus have new functions. Taking crops as an example, changing the expression of specific genes can increase the resistance of crops to noxious organisms such as pests and weeds and abiotic stresses such as drought, waterlogging, and salinity, and can also increase yield and improve quality. Taking fish as an example, changing the expression characteristics of growth hormone in fish can significantly change its growth and development speed.

[0481] Brief Description of Drawings

[0482] Figure 1 shows a schematic diagram of creating a new HPPD gene in rice.

[0483] Figure 2 shows a schematic diagram of creating a new EPSPS gene in rice.

[0484] Figure 3 shows a schematic diagram of creating a new PPOX gene in Arabidopsis thaliana.

[0485] Figure 4 shows a schematic diagram of creating a new PPOX gene in rice.

[0486] Figure 5 shows the sequencing results for the HPPD-duplication Scheme tested with rice protoplast.

[0487] Figure 6 shows the map of the Agrobacterium transformation vector pQY2091 for rice.

[0488] Figure 7 shows the electrophoresis results of the PCR products for the detection of new gene fragments in pQY2091 transformed hygromycin resistant rice callus. The arrow indicates the PCR band of the new gene created by the fusion ofthe promoter of the UBI2 gene with the coding region of the HPPD. The numbers are the numbers of the different callus samples. M represents DNA Marker, and the band sizes are 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 2500bp, 5000bp, 7500bp in order.

[0489] Figure 8 shows the electrophoresis results of the PCR products for the detection of new gene fragments in pQY2091 transformed rice T0 seedlings. The arrow indicates the PCR band of the new gene created by the fusion of the promoter of the UBI2 gene with the coding region of the HPPD. The numbers are the serial numbers of the different T0 seedlings. M represents DNA Marker, and the band sizes are sequentially 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 2500bp, 5000bp, 7500bp.

[0490] Figure 9 shows the test results for the resistance to Bipyrazone of the QY2091 T0 generation of the HPPD gene doubling strain. In the same flowerpot, the wild-type Jinjing 818 is on the left, and the HPPD doubling strain is on the right.

[0491] Figure 10 shows the relative expression levels of the HPPD and UBI2 genes in the QY2091 T0 generation of the HPPD gene doubling strain. 818CK1 and 818CK3 represent two control plants of the wild-type Jinjing 818; 13M and 20M represent the primary tiller leaf samples of the QY2091-13 and the QY2091-20 T0 plants; 13L and 20L represent the secondary tiller leaf samples of the QY2091-13 and the QY2091-20 T0 plants used in the herbicide resistance test.

[0492] Figure 11 shows a schematic diagram of the possible genotypes of QY2091 T1 generation and the binding sites of the molecular detection primers.

[0493] Figure 12 shows the comparison of the sequencing results detecting the HPPD doubling and the predicted doubled sequences for QY2091-13 and QY2091-20.

[0494] Figure 13 shows the results of the herbicide resistance test for the T1 generation of the QY2091 HPPD doubling strain at the seedling stage.

[0495] Figure 14 shows a schematic diagram of the types of the possible editing event of rice PPO1 gene chromosome fragment inversion and the binding sites of molecular detection primers.

[0496] Figure 15 shows the sequencing results of the EPSPS-inversion detection.

[0497] Figure 16 shows the map of the rice Agrobacterium transformation vector pQY2234.

[0498] Figure 17 shows the electrophoresis results of the PCR products for the detection of new gene fragments of hygromycin resistant rice callus transformed with pQY2234. The arrow indicates the PCR band of the new gene created by the fusion ofthe promoter of the CP12 genewith the coding region of the PPO1. The numbers are the serial numbers of different callus samples. M represents DNA Marker, and the band sizes are sequentially 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 2500bp, 5000bp, 7500bp.

[0499] Figure 18 shows the resistance test results of the PPO1 gene inversion strain to Compound A of the QY2234 T0 generation. Under the same treatment dose, the left flowerpot is the wild-type Huaidao No. 5 control, and the right is the PPO1 inversion strain.

[0500] Figure 19 shows the relative expression levels of PPO1 and CP12 genes in the QY2234 T0 generation PPO1 inversion strain. H5CK1 and H5CK2 represent two wild-type Huaidao No. 5 control plants; 252M, 304M and 329M represent the primary tiller leaf samples of QY2234-252, QY2234-304 and QY2234-329 T0 plants; 252L, 304L and 329L represent secondary tiller leaf samples.

[0501] Figure 20 shows the comparison of the sequencing result of the PPO1 inversion with the predicted inversion sequence in the Huaidao 5 background.

[0502] Figure 21 shows the comparison of the sequencing result of the PPO1 inversion with the predicted inversion sequence in the Jinjing 818 background.

[0503] Figure 22 shows the herbicide resistance test results for the T1 generation of the QY2234 PPO1 inversion strain at seedling stage.

[0504] Figure 23 Duplication created a new GH1 gene cassette in zebrafish embryos. The GH1 gene is the growth hormone gene in zebrafish. Col1A1a is collagen type I alpha 1a gene. Col1A1a-GH1 fusion was the new gene cassette as a result of the duplication. DNA template used for PCR amplification in the Control group (CK) was extracted from young zebrafish without microinjection. DNA template used for PCR amplification in theTreatment group (RNP treat) was DNA sample extracted from young zebrafish after microinjection.

[0505] Figure 24 PPO1 inversion event lines were tested for herbicide resistance in the field at T1 generation of QY2234 rice plants. WT is wild-type Jinjing 818.5#and 42#represent samples from the PPO1 inversion event lines of QY2234 / 818-5 and QY2234 / 818-42, respectively. The herbicide tested was PPO inhibitor compound A.

[0506] Figure 25 shows the Western Blot detection of PPO1 protein in the T1 rice plants of the QY2234 lines. 5#, 42#, 114#, and 257#represent the samples from the inversion event lines of QY2234 / 818-5, QY2234 / 818-42, QY2234 / 818-144, and QY2234 / 818-257, respectively.

[0507] Figure 26 shows the field assay of HPPD inhibitor herbicide resistance under field conditions at T1 generation of QY2091 rice plants. 12#and 21#represent QY2091-12 and QY2091-21 duplication event lines, respectively. The herbicide tested was HHPD inhibitor Bipyrazone.

[0508] Figure 27 A schematic diagram of the duplicated DNA fragment harboring PPO1 gene in rice, and 4 duplicated events were detected in rice protoplast cells using sequencing peak comparison. pQY2648, pQY2650, pQY2651, pQY2653 are the vector numbers tested. R2, F2 were used as sequencing primers. The diagram is not in proportion with DNA segment lengths.

[0509] Figure 28 A schematic diagram of fragment translocation between chromosome1 and chromosome2 that up-regulates HPPD gene expression in rice. After targeted fragment translocation, CP12 gene promoter drives HPPD CDS expression; at the same time, HPPD gene promoter drives CP12 CDS expression. The diagram is not in proportion with DNA segment lengths.

[0510] Figure 29 Fusion of the promoter of CP12 and the coding region of HPPD was detected in rice protoplast cells transformed with pQY2257. The diagram is not in proportion with DNA segment lengths.

[0511] Figure 30 Fusion of the promoter of HPPD and the coding region of CP12 was detected in rice protoplast cells transformed with pQY2259. The diagram is not in proportion with DNA segment lengths.

[0512] Figure 31 A schematic diagram of knocking-up HPPD gene expression as a result of the duplication of the segment between the two targeted cuts in rice, which was mediated by  CRISPR / LbCpf1. The diagram is not in proportion with DNA segment lengths.

[0513] Figure 32 A schematic diagram of fusing the OsCATC gene with a chloroplast signal peptide domain (LOC4331514CTP) through the deletion of the segment between the two targeted cuts in rice protoplast, which results in OsCATC protein have achloroplast signal peptide domain and thus could go to chloroplast after expressed; and the positive events were detected in rice protoplast cells, which was demonstrated by sequencing. CTP stands for chloroplast signal peptide domain. The diagram is not in proportion with DNA segment lengths.

[0514] Figure 33 A schematic diagram of the OsGLO3 gene linking the chloroplast signal peptide domain (LOC4337056CTP) through chromosome fragment inversion between the targeted cuts, which results in OsGLO3 protein have a chloroplast signal peptide domain and thus could go to chloroplast after expressed; while LOC4337056 gene drops its CTP; and the detection results of positive event rice protoplasts. CTP stands for chloroplast signal peptide domain. The diagram is not in proportion with DNA segment lengths.

[0515] Figure 34 A schematic diagram showing knock-up of PPO2 gene by duplication of the DNA fragments between the two targeted cuts in rice. A new gene is produced wherethe SAMDC strong promoter drives the expression of PPO2. The diagram is not in proportion with DNA segment lengths.

[0516] Figure 35 Positive duplication events were detected in pQY1386-transformed rice calli as indicated by alignment of sequencing data. 28#, 62#are two duplication-positive calli. The diagram is not in proportion with DNA segment lengths.

[0517] Figure 36 Positive duplication events were detected in pQY1387-transformed rice calli as indicated by alignment of sequencing data. 64#, 82#, 110#, 145#are duplication-positive calli. The diagram is not in proportion with DNA segment lengths.

[0518] Figure 37 Positive duplication events were detected in T0 rice plants (QY1387 / 818-2) emerged from pQY1387-transformed calli. The repair outcomes of two targets as well as the duplication joint were aligned with Sanger sequencing data. The diagram is not in proportion with DNA segment lengths.

[0519] Figure 38 The detection results of the relative expression level of PPO2 in QY1387 / 818 T0 rice plants. As expected, PPO2 expression significantly increased meanwhile SAMDC expression significantly reduced.

[0520] Figure 39 Herbicide resistance assay of rice QY1387 T0 plants. 2#represents the 1387 / 818-2 line, 4#represents the 1387 / 818-4 line, and WT is the wild type of Jinjing 818. The herbicide tested is PPO inhibitor compound A

[0521] Figure 40 A schematic diagram of creation of new PPO2 genes by DNA fragment inversion between the two targeted cuts in rice. The diagram is not in proportion with DNA segment lengths.

[0522] Figure 41 Positive inversion events were detected in QY2611-transformed rice calli as indicated by alignment of sequencing data. 10#represents the QY2611 / 818-10 callus, 13#represents the QY2611 / 818-13 callus. The diagram is not in proportion with DNA segment lengths.

[0523] Figure 42 Positive inversion events were detected in QY2612-transformed rice calli as indicated by alignment of sequencing data. 5#represents the QY2612 / 818-5 callus, 34#represents the QY2612 / 818-34 callus. The diagram is not in proportion with DNA segment lengths.

[0524] Figure 43 A schematic diagram of successful generation of new PPO2 gene cassette in maize protoplast cells, through duplication of the segment between the two targeted cutsand demonstrated by alignment of Sanger sequencing data. pQY1340 and pQY1341 are test vectors. The diagram is not in proportion with DNA segment lengths.

[0525] Figure 44 A schematic diagram of successful generation of new PPO2-2A gene cassette in wheat protoplast cells transfected with pQY2626 vector, through inversion of the segment between the two targeted cuts, anddemonstrated by alignment of Sanger sequencing data. The diagram is not in proportion with DNA segment lengths.

[0526] Figure 45 A schematic diagram of successful generation of new PPO2-2B gene cassette in wheat protoplast cells transfected with pQY2631 vector, through duplication of the segment between the two targeted cuts, and demonstrated by alignment of Sanger sequencing data. The diagram is not in proportion with DNA segment lengths.

[0527] Figure 46 A schematic diagram of successful generation of new PPO2-2D gene cassette in wheat protoplast cells transfected with pQY2635 vector, through duplication of the segment between the two targeted cuts, and demonstrated by alignment of Sanger sequencing data. The diagram is not in proportion with DNA segment lengths.

[0528] Figure 47 Sequencing results of chromosome fragment inverted rice Line QY1085 / 818-23.

[0529] Figure 48 Sequencing results of chromosome fragment duplicatedrice Line QY1089 / 818-321.

[0530] Figure 49 A schematic diagram of successful generation of new IGF2 (Insulin-like growth factor 2) gene cassette driven by TNNI2 gene promoter, through inversion of the segment between the two targeted cuts, and demonstrated the detection of the positive fusion event of Pig TNNI2 promoter and IGF2 genein pig primary fibroblast cells. The diagram is not in proportion with DNA segment lengths.

[0531] Figure 50 A schematic diagram of successful generation of new TNNI3 (muscle troponin T) gene cassette driven by IGF2 gene promoter, through inversion of the segment between the two targeted cuts, and demonstrated thedetection of the fusion event of Pig IGF2 promoter and TNNT3 gene in pig primary fibroblast cells. The diagram is not in  proportion with DNA segment lengths.

[0532] Figure 51 shows the sequencing result of forward and reverse primers. The experiment result shows that the fragments between gh1 gene and col1a1a gene in zebra fish embryo are doubled.

[0533] Figure 52 is the sequencing result. The experiment result shows that the coding area and the coding area &promotor of ddx5 gene and the coding area &the promotor of gh1 gene are exchanged due to the inversion of chromosome fragments;

[0534] Figure 53 is the comparison diagram of inversion and wild type zebra fish. The result shows that the growth of zebra fish with upregulated expression is obviously accelerated.

[0535] Figure 54 is a schematic diagram of Ubi2 promoter translocation to knock-up PPO2 gene in rice.

[0536] Figure 55 shows the herbicide resistance test results for the T1 generation of the QY378-16 translocation rice at seedling stage.

[0537] Specific Models for Carrying Out the Invention

[0538] The present invention is further described in conjunction with the examples as follows. The following description is just illustrative, and the protection scope of the present invention should not be limited to this.

[0539] Example 1: An editing method for knocking up the expression of the endogenous HPPD gene by inducing doubling of chromosome fragment in plant -rice protoplast test

[0540] HPPD was a key enzyme in the pathway of chlorophyll synthesis in plants, and the inhibition of the activity of the HPPD would eventually lead to albino chlorosis and death of plants. Many herbicides, such as mesotrione and topramezone, were inhibitors with the HPPD as the target protein, and thus increasingthe expression level of the endogenous HPPD gene in plants could improve the tolerance of the plants to these herbicides. The rice HPPD gene (as shown in SEQ ID NO: 6, in which 1-1067bp is the promoter, and the rest is the expression region) locates on rice chromosome 2. Through bioinformatic analysis, it was found that rice Ubiquitin2 (hereinafter referred to as UBI2) gene (as shown in SEQ ID NO: 5, in which 1-2107bp was the promoter, and the rest was the expression region) locates about 338 kb downstream of HPPD gene, and the UBI2 gene and the HPPD gene were in the same direction on the chromosome. According to the rice gene expression profile data provided by the International Rice Genome Sequencing Project (http:  / / rice. plantbiology. msu. edu / index. shtml) , the expression intensity of the UBI2 gene in rice leaves was 3 to 10 times higher than that of the HPPD gene, and the UBI2 gene promoter was a strong constitutively expressed promoter.

[0541] As shown in Figure 1, Scheme 1 shows that double-strand breaks were simultaneously generated at the sites between the promoters and the CDS region of the HPPD and UBI2 genes respectively, the event of doubling the region between the two breaks were obtained after screening and identification, and a new gene could be formed by fusing the promoter of UBI2 and the coding region of HPPD together. In addition, according to Scheme 2 as shown in Figure 1, a new gene in which the promoter of UBI2 and the coding region of HPPD were fused could also be formed by two consecutive inversions. First, the schemes as shown in Figure 1 were tested in the rice protoplast system as follows:

[0542] 1.Firstly, the genomic DNA sequencesof the rice HPPD and UBI2 geneswere input into the CRISPOR online tool (http:  / / crispor. tefor. net / ) to search for available editing target sites. After online scoring, the following target sites between the promoters and the CDS regions of HPPD and UBI2 genes were selected for testing:

[0543]

[0544] The guide RNA1 and guide RNA2 located between the promoter and the CDS region of the HPPD gene, close to the start codon of the HPPD protein, and the guide RNA3 and guide RNA4 located between the promoter and CDS region of the UBI2 gene, close to the UBI2 protein initiation codon.

[0545] pHUE411 vector (https:  / / www. addgene. org / 62203 / ) is used as the backbone, and the following primers were designed for the above-mentioned target sites to perform vector construction as described in “Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. A CRISPR / Cas9 Toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29; 14 (1) : 327" .

[0546]

[0547] gene editing vectors for the following dual-target combination were constructed following the method provided in the above-mentioned literature. Specifically, with the pCBC-MT1T2 plasmid (https:  / / www. addgene. org / 50593 / ) as the template, sgRNA1+3, sgRNA1+4, sgRNA2+3 and sgRNA2+4 double target fragments were amplified respectively for constructing the sgRNA expression cassettes. The vectorbackbone of pHUE411 was digested with BsaI, and recovered from the gel, and the target fragment was digested and directly used for the ligation reaction. T4 DNA ligase was used to ligate the vector backbone and the target fragment, and the ligation product was transformed into Trans5α competent cells. Different monoclones were picked and sequenced The Sparkjade High Purity Plasmid Mini Extraction Kit was used to extract plasmids from the clones with correct sequences, thereby obtaining recombinant plasmids, respectively named as pQY002065, pQY002066, pQY002067, and pQY002068, as follows:

[0548] pQY002065 pHUE411-HPPD-sgRNA1+3 combination of OsHPPD-guide RNA1, guide RNA3

[0549] pQY002066 pHUE411-HPPD-sgRNA1+4 combination of OsHPPD-guide RNA1, guide RNA4

[0550] pQY002067 pHUE411-HPPD-sgRNA2+3 combination of OsHPPD-guide RNA2, guide RNA3

[0551] pQY002068 pHUE411-HPPD-sgRNA2+4 combination of OsHPPD-guide RNA2, guide RNA4

[0552] 2.Plasmids of high-purity and high-concentration were prepared for the above-mentioned pQY002065-002068 vectors as follows:

[0553] Plasmids were extracted with the Promega Medium Plasmid Extraction Kit (Midipreps DNA Purification System, Promega, A7640) according to the instructions. The specific steps were:

[0554] (1) Adding 5 ml of Escherichia coli to 300 ml of liquid LB medium containing kanamycin, and shaking at 200 rpm, 37℃ for 12 to 16 hours;

[0555] (2) Placing the above bacteria solution in a 500 ml centrifuge tube, and centrifuging at 5,000 g for 10 minutes, discarding the supernatant;

[0556] (3) Adding 3 ml of Cell Resuspension Solution (CRS) to resuspend the cell pellet and vortexing for thorough mixing;

[0557] (4) Adding 3 ml of Cell Lysis Solution (CLS) and mixing up and down slowly for no more than 5 minutes;

[0558] (5) Adding 3 ml of Neutralization Solution and mixed well by overturning until the color become clear and transparent;

[0559] (6) Centrifuging at 14,000g for 15 minutes, and further centrifuging for 15 minutes if precipitate was not formed compact;

[0560] (7) Transferring the supernatant to a new 50 ml centrifuge tube, avoiding to suck in white precipitate into the centrifuge tube;

[0561] (8) Adding 10 ml of DNA purification resin (Purification Resin, shaken vigorously before use) and mixing well;

[0562] (9) Pouring the Resin / DNA mixture was poured into a filter column, and treating by the vacuum pump negative pressure method (0.05 MPa) ;

[0563] (10) Adding 15 ml of Column Wash Solution (CWS) to the filter column, and vacuuming.

[0564] (11) Adding 15 ml of CWS, and repeating vacuuming once; vacuuming was extended for 30 s after the whole solution passed through the filter column;

[0565] (12) Cutting off the filter column, transferring to a 1.5 ml centrifuge tube, centrifuging at 12,000 g for 2 minutes, removing residual liquid, and transferring the filter column to a new 1.5 ml centrifuge tube;

[0566] (13) Adding 200 μL of sterilized water preheated to 70℃, and keeping rest for 2 minutes;

[0567] (14) Centrifuging at 12,000 g for 2 minutes to elute the plasmid DNA; and the concentration was generally about 1 μg / μL.

[0568] 3.Preparing rice protoplasts and performing PEG-mediated transformation:

[0569] First, rice seedlings for protoplasts were prepared, which is of the variety Nipponbare. The seeds were provided by the Weeds Department of the School of Plant Protection, China Agricultural University, and expanded in house. The rice seeds were hulled first, and the hulled seeds were rinsed with 75%ethanol for 1 minute, treated with 5% (v / v) sodium hypochlorite for 20 minutes, then washed with sterile water for more than 5 times. After blow-drying in an ultra-clean table, they were placed in a tissue culture bottle containing 1 / 2 MS medium, 20 seeds for each bottle. Protoplasts were prepared by incubating at 26℃ for about 10 days with 12 hours light.

[0570] The methods for rice protoplast preparation and PEG-mediated transformation were conducted according to "Lin et al., 2018 Application of protoplast technology to CRISPR / Cas9  mutagenesis: from single-cell mutation detection to mutant plant regeneration. Plant Biotechnology Journal https:  / / doi. org  / 10.1111 / pbi. 12870" . The steps were as follows:

[0571] (1) the leaf sheath of the seedlings was selected, cut into pieces of about 1 mm with a sharp Geely razor blade, and placed in 0.6 M mannitol and MES culture medium (formulation: 0.6 M mannitol, 0.4 M MES, pH 5.7) for later use. All materials were cut and transferred to 20 ml of enzymatic hydrolysis solution (formulation: 1.5%Cellulase R10 / RS (YaKult Honsha) , 0.5%Mecerozyme R10 (YaKult Honsha) , 0.5M mannitol, 20mM KCl, 20mM MES, pH 5.7, 10mM CaCl2, 0.1%BSA, 5 mM β-mercaptoethanol) , wrapped in tin foil and placed in a 28℃ shaker, enzymatically hydrolyzed at 50 rpm in the dark for about 4 hours, and the speed was increased to 100 rpm in the last 2 minutes;

[0572] (2) after the enzymatic lysis, an equal volume of W5 solution (formulation: 154mM NaCl, 125mM CaCl2, 5mM KCl, 15mM MES) was added, shaken horizontally for 10 seconds to release the protoplasts. The cells after enzymatic lysis were filtered through a 300-mesh sieve and centrifuged at 150 g for 5 minutes to collect protoplasts;

[0573] (3) the cells were rinsed twice with the W5 solution, and the protoplasts were collected by centrifugation at 150 g for 5 minutes;

[0574] (4) the protoplasts were resuspended with an appropriate amount of MMG solution (formulation: 3.05g / L MgCl2, 1g / L MES, 91.2g / L mannitol) , and the concentration of the protoplasts was about 2×106 cells / mL.

[0575] The transformation of protoplasts was carried out as follows:

[0576] (1) to 200 μL of the aforementioned MMG resuspended protoplasts, endotoxin-free plasmid DNA of high quality (10-20 μg) was added and tapped to mix well;

[0577] (2) an equal volume of 40% (w / v) PEG solution (formulation: 40% (w / v) PEG, 0.5M mannitol, 100mM CaCl2) was added, tapped to mix well, and kept rest at 28℃ in the dark for 15 minutes;

[0578] (3) after the induction of transformation, 1.5 ml of W5 solution was added slowly, tapped to mix the cells well. The cells were collected by centrifugation at 150 g for 3 minutes. This step was repeated once;

[0579] (4) 1.5 ml of W5 solution was added to resuspend the cells, and placed in a 28℃ incubator and cultured in the dark for 12-16 hours. For extracting protoplast genomic DNA, the cultivation should be carried out for 48-60 hours.

[0580] 4. Genome targeting and detecting new gene:

[0581] (1) First, protoplast DNAs were extracted by the CTAB method with some modifications. The specific method was as follows: the protoplasts were centrifuged, then the supernatant was discarded. 500 μL of DNA extracting solution (formulation: CTAB 20g / L, NaCl 81.82g / L, 100mM Tris-HCl (pH 8.0) , 20 mM EDTA, 0.2%β-mercaptoethanol) was added, shaken to mix well, and incubated in a 65℃ water bath for 1 hour; when the incubated sample was cooled, 500 μL of chloroform was added and mixed upside down and centrifuged at 10,000 rpm for 10 minutes; 400 μL of the supernatant was transferred to a new 1.5 ml centrifuge tube, 1 ml of 70%(v / v) ethanol was added and the mixture was kept at -20℃ for precipitating for 20 minutes; the mixture was centrifuged at 12,000 rpm for 15 minutes to precipitate the DNA; after the precipitate was air dried, 50 μL of ultrapure water was added and stored at -20℃ for later use.

[0582] (2) The detection primers in the following table were used to amplify the fragments containing the target sites on both sides or the predicted fragmentsresulting from the fusion of the UBI2 promoter and the HPPD coding region. The lengths of the PCR products were between 300-1000 bp, in which the primer8-F + primer6-R combination was used to detect the fusion fragment at the middle joint after the doubling of the chromosome fragment, and the product length was expected to be 630bp.

[0583]

[0584] The PCR reaction system was as follows:

[0585]

[0586] (3) A PCR reaction was conducted under the following general reaction conditions:

[0587]

[0588] (4) The PCR reaction products were detected by 1%agarose gel electrophoresis. The results showed that the 630 bp positive band for the predicted fusion fragment of the UBI2 promoter and the HPPD coding region could be detected in the pQY002066 and pQY002068 transformed samples.

[0589] 5. The positive samples of the fusion fragment of the UBI2 promoter and the HPPD coding region were sequenced for verification, and the OsHPPDduplicated-primer8-F and OsHPPDduplicated-primer6-R primers were used to sequence from both ends. As shown in Figure 5, the promoterof the UBI2 gene and the expression region of the HPPD gene could be directly ligated, and the editing event of the fusion of the promoter of rice UBI2 gene and the expression region of the HPPD gene could be detected in the protoplast genomic DNA of the rice transformed with pQY002066 and pQY002068 plasmids, indicating that the scheme of doubling the chromosome fragments to form a new HPPD gene was feasible, a new HPPD gene which  expression was driven by a strong promoter could be created, and this was defined as an HPPD doubling event. The sequencing result of the pQY002066 vector transformed protoplast for testing HPPD doubling event was shown in SEQ ID NO: 9; and the sequencing result of the pQY002068 vector transformed protoplast for testing HPPD doubling event was shown in SEQ ID NO: 10.

[0590] Example 2: Creation of herbicide-resistant rice with knock-up expression of endogenous HPPD gene by chromosome fragment doubling through Agrobacterium-mediated transformation

[0591] 1. Construction of knock-up editing vector: Based on the results of the protoplast test in Example 1, the dual-target combination OsHPPD-guide RNA1: 5'GTGCTGGTTGCCTTGGCTGC3' and OsHPPD-guide RNA4: 5'GAAATAATCACCAAACAGAT3' with a high editing efficiency was selected. The Agrobacterium transformation vector pQY2091 was constructed according to Example 1. pHUE411 was used as the vector backbone and subjected to rice codon optimization. The map of the vector was shown in FIGURE 6.

[0592] 2. Agrobacterium transformation of rice callus:

[0593] 1) Agrobacterium transformation: 1μg of the rice knock-up editing vector pQY2091 plasmid was added to 10μl of Agrobacterium EHA105 heat-shock competent cells (Angyu Biotech, Catalog No. G6040) , placed on ice for 5 minutes, immersed in liquid nitrogen for quick freezing for 5 minutes, then removed and heated at 37℃ for 5 minutes, and finally placed on ice for 5 minutes. 500μl of YEB liquid medium (formulation: yeast extract 1g / L, peptone 5g / L, beef extract 5g / L, sucrose 5g / L, magnesium sulfate 0.5g / L) was added. The mixture was placed in a shaker and incubated at 28℃, 200 rpm for 2~3 hours; the bacteria were collected by centrifugation at 3500 rpm for 30 seconds, the collected bacteria were spread on YEB (kanamycin 50 mg / L + rifampicin 25 mg / L) plate, and incubated for 2 days in an incubator at 28℃; the single colonies were picked and placed into liquid culture medium, and the bacteria were stored at -80 ℃.

[0594] 2) Cultivation of Agrobacterium: The single colonies of the transformed Agrobacterium on the YEB plate was picked, added into 20 ml of YEB liquid medium (kanamycin 50 mg / L +rifampicin 25 mg / L) , and cultured while stirring at 28℃ until the OD600 was 0.5, then the bacteria cells were collected by centrifugation at 5000 rpm for 10 minutes, 20-40 ml of AAM (Solarbio, lot number LA8580) liquid medium was added to resuspend the bacterial cells to reach OD600 of 0.2-0.3, and then acetosyringone (Solarbio, article number A8110) was added to reach the final concentration of 200μM for infecting the callus.

[0595] 3) Induction of rice callus: The varieties of the transformation recipient rice were Huaidao 5 and Jinjing 818, purchased from the seed market in Huai’an, Jiangsu, and expanded in house. 800-2000 clean rice seeds were hulled, then washed with sterile water until the water was clear after washing. Then the seeds were disinfected with 70%alcohol for 30 seconds, then 30 ml of 5%sodium hypochlorite was added and the mixture was placed on a horizontal shaker and shaken at 50 rpm for 20 minutes, then washed with sterile water for 5 times. The seeds were placed on sterile absorbent paper, air-dried to remove the water on the surface of the seeds, inoculated on an induction medium and cultivated at 28℃ to obtain callus.

[0596] The formulation of the induction medium: 4.1g / L N6 powder + 0.3 g / L hydrolyzed casein +2.878 g / L proline + 2 mg / L 2, 4-D + 3%sucrose + 0.1g / L inositol + 0.5 g glutamine + 0.45%phytagel, pH 5.8.

[0597] 4) Infection of rice callus with Agrobacterium: The callus of Huaidao No. 5 or Jinjing 818 subcultured for 10 days with a diameter of 3 mm was selected and collected into a 50 ml centrifuge tube; the resuspension solution of the Agrobacterium AAM with the OD600 adjusted to 0.2-0.3 was poured into the centrifuge tube containing the callus, placed in a shaker at 28℃ at a speed of 200 rpm to perform infection for 20 minutes; when the infection was completed, the bacteria solution was discarded, the callus was placed on sterile filter paper and air-dried for about 20 minutes, then placed on a plate containing co-cultivation medium to perform co-cultivation, on which the plate was covered with a sterile filter paper soaked with AAM liquid medium containing 100 μM acetosyringone; after 3 days of co-cultivation, the Agrobacterium was removed by washing (firstly washing with sterile water for 5 times, then washing with 500mg / L cephalosporin antibiotic for 20 minutes) , and selective cultured on 50mg / L hygromycin selection medium.

[0598] The formulation of the co-cultivation medium: 4.1g / L N6 powder + 0.3 g / L hydrolyzed casein + 0.5 g / L proline + 2 mg / L 2, 4-D + 200 μM AS + 10 g / L glucose + 3%Sucrose + 0.45%phytagel, pH 5.5.

[0599] 3. Molecular identification and differentiation into seedlings of hygromycin resistant callus:

[0600] Different from the selection process of conventional rice transformation, with specific primers of the fusion fragments generated after the chromosome fragment doubling, hygromycin resistant callus could be molecularly identified during the callus selection and culture stage in the present invention, positive doubling events could be determined, and callus containing new genes resulting from fusion of different gene elements was selected for differentiation cultivation and induced to emerge seedlings. The specific steps were as follows:

[0601] 1) The co-cultured callus was transferred to the selection medium for the first round of selection (2 weeks) . The formulation of the selection medium is: 4.1g / L N6 powder + 0.3 g / L hydrolyzed casein + 2.878 g / L proline + 2 mg / L 2, 4-D + 3%sucrose + 0.5g glutamine + 30 mg / L hygromycin (HYG) + 500 mg / L cephalosporin (cef) + 0.1 g / L inositol + 0.45%phytagel, pH 5.8.

[0602] 2) After the first round of selection was completed, the newly grown callus was transferred into a new selection medium for the second round of selection (2 weeks) . At this stage, the newly grown callus with a diameter greater than 3 mm was clamped by tweezers to take a small amount of sample, the DNA thereof was extracted with the CTAB method described in Example 1 for the first round of molecular identification. In this example, the primer pair of OsHPPDduplicated-primer8-F (8F) and OsHPPD duplicated-primer6-R (6R) was selected to perform PCR identification for the callus transformed with the pQY2091 vector, in which the reaction system and reaction conditions were similar to those of Example 1. Among the total of 350 calli tested, no positive sample was detected in the calliof Huaidao 5, while 28 positive samples were detected in the calli of Jinjing 818. The PCR detection results of some calli were shown in Figure 7.

[0603] 3) The calli identified as positive by PCR were transferred to a new selection medium for the third round of selection and expanding cultivation; after the diameter of the calli was greater than  5 mm, the callus in the expanding cultivation was subjected to the second round of molecular identification using 8F+6R primer pair, the yellow-white callus at good growth status that was identified as positive in the second round was transferred to a differentiation medium to perform differentiation, and the seedlings of about 1 cm could be obtained after 3 to 4 weeks; the differentiated seedlings were transferred to a rooting medium for rooting cultivation; after the seedlings of the rooting cultivation were subjected to hardening off, they were transferred to a flowerpot with soil and placed in a greenhouse for cultivation. The formulation of the differentiation medium is: 4.42g / L MS powder + 0.5 g / L hydrolyzed casein + 0.2 mg / L NAA + 2 mg / L KT + 3%sucrose+ 3%sorbitol+30 mg / L hygromycin + 0.1 g / L inositol + 0.45%phytagel, pH 5.8. The formulation of the rooting medium is: 2.3g / L MS powder + 3%sucrose + 0.45%phytagel.

[0604] 4. Molecular detection of HPPD doubling seedlings (T0 generation) :

[0605] After the second round of molecular identification, 29 doubling event-positive calli were co-differentiated to obtain 403 seedlings of T0 generation, and the 8F+6R primer pair was used for the third round of molecular identification of the 403 seedlings, among which 56 had positive bands. The positive seedlings were moved into a greenhouse for cultivation. The PCR detection results of some T0 seedlings were shown in Figure 8.

[0606] 5. HPPD inhibitory herbicide resistance test for HPPD doubled seedlings (T0 generation) :

[0607] The transformation seedlings of T0 generation identified as doubling event positive were transplanted into large plastic buckets in the greenhouse for expanding propagation to obtain seeds of T1 generation. After the seedlings began to tiller, the tillers were taken from vigorously growing strains, and planted in the same pots with the tillers of the wild-type control varieties at the same growth period. After the plant height reached about 20 cm, the herbicide resistance test was conducted. The herbicide used was Bipyrazone (CAS No. 1622908-18-2) produced by our company, and its field dosage was usually 4 grams of active ingredients per mu (4g a. i.  / mu) . In this experiment, Bipyrazone was applied at adosage gradient of 2g a. i.  / mu, 4g a. i.  / mu, 8g a. i.  / mu and 32g a. i.  / muwith a walk-in spray tower.

[0608] The resistance test results were shown in Figure 9. After 5-7 days of the application, the wild-type control rice seedlings began to show albino, while the strains of the HPPD doubling events all remained normally green. After 4 weeks of the application, the wild-type rice seedlings were close to death, while the strains of the doubling events all continued to remain green and grew normally. The test results showed that the HPPD gene-doubled strains had a significantly improved tolerance to Bipyrazone.

[0609] 6. Quantitative detection of the relative expression of the HPPD gene in the HPPD doubled seedlings (T0 generation) :

[0610] It was speculated that the improved resistance of the HPPD gene doubled strain to Bipyrazone was due to the fusion of the strong promoter of UBI2 and the HPPD gene CDS that increased the expression of HPPD, so the T0 generation strains QY2091-13 and QY2091-20 were used to take samples from the primary tillers and the secondary tillers used for herbicide resistance test to detect the expression levels of the HPPD and UBI2 genes, respectively, with the wild-type Jinjing 818 as the control. The specific steps were as follows:

[0611] 1) Extraction of total RNA (Trizol method) :

[0612] 0.1-0.3g of fresh leaves were taken and ground into powder in liquid nitrogen. 1ml of Trizol reagent was added for every 50-100mg of tissue for lysis; the Trizol lysate of the above tissue was transferred into a 1.5ml centrifuge tube, stood at room temperature (15-30℃) for 5 minutes; chloroform was added in an amount of 0.2ml per 1ml of Trizol; the centrifuge tube was capped, shaken vigorously in hand for 15 seconds, stood at room temperature (15-30℃) for 2-3 minutes, then centrifuged at 12000g (4℃) for 15 minutes; the upper aqueous phase was removed and placed in a new centrifuge tube, isopropanol was added in an amount of 0.5 ml per 1 ml of Trizol, the mixture was kept at room temperature (15-30℃) for 10 minutes, then centrifuged at 12000g (2-8℃) for 10 minutes; the supernatant was discarded, and 75%ethanol was added to the pellet in an amount of 1ml per 1ml of Trizol for washing. The mixture was vortexed, and centrifuged at 7500g (2-8℃) for 5 minutes. The supernatant was discarded; the precipitated RNA was dried naturally at room temperature for 30 minutes; the RNA precipitate was dissolved by 50 μl of RNase-free water, and stored in the refrigerator at -80℃ after electrophoresis analysis and concentration determination.

[0613] 2) RNA electrophoresis analysis:

[0614] An agarose gel at a concentration of 1%was prepared, then 1 μl of the RNA was taken and mixed with 1 μl of 2X Loading Buffer. The mixture was loaded on the gel. The voltage was set to 180V and the time for electrophoresis was 12 minutes. After the electrophoresis was completed, the agarose gel was taken out, and the locations and brightness of fragments were observed with a UV gel imaging system.

[0615] 3) RNA purity detection:

[0616] The RNA concentration was measured with a microprotein nucleic acid analyzer. RNA with a good purity had an OD260 / OD280 value between 1.8-2.1. The value lower than 1.8 indicated serious protein contamination, and higher than 2.1 indicated serious RNA degradation.

[0617] 4) Real-time fluorescence quantitative PCR

[0618] The extracted total RNA was reverse transcribed into cDNA with a special reverse transcription kit. The main procedure comprised: first determining the concentration of the extracted total RNA, and a portion of 1-4 μg of RNA was used for synthesizing cDNA by reverse transcriptase synthesis. The resulting cDNA was stored at -20℃.

[0619] ①Asolution of the RNA template was prepared on ice as set forth in the following table and subjected to denaturation and annealing reaction in a PCR instrument. This process was conducive to the denaturation of the RNA template and the specific annealing of primers and templates, thereby improving the efficiency of reverse transcription.

[0620] Table 1: Reverse transcription, denaturation and annealing reaction system

[0621]

[0622] Reaction conditions for denaturation and annealing:

[0623]

[0624]

[0625] ②The reverse transcription reaction system was prepared as set forth in Table 2for synthesizing cDNA:

[0626] Table 2: Reverse transcription reaction system

[0627]

[0628] Reaction conditions for cDNA synthesis:

[0629]

[0630] ③ The UBQ5 gene of rice was selected as the internal reference gene, and the synthesized cDNA was used as the template to perform fluorescence quantitative PCR. The primers listed in Table 3 were used to prepare the reaction solution according to Table 4.

[0631] Table 3: Sequence 5’-3’ of the primer for Fluorescence quantitative PCR

[0632]

[0633] Table 4: Reaction solution for real-time quantitative PCR (Real Time PCR)

[0634]

[0635] ④ The reaction was performed following the real-time quantitative PCR reaction steps in Table 5. The reaction was conducted for 40 cycles.

[0636] Table 5: Real-time quantitative PCR reaction steps

[0637]

[0638]

[0639] 5) Data processing and experimental results

[0640] As shown in Table 6, UBQ5 was used as an internal reference, ΔCt was calculated by subtracting the Ct value of UBQ5from the Ct value of the target gene, and then 2-ΔCt was calculated, which represented the relative expression level of the target gene. The 818CK1 and 818CK3 were two wild-type Jinjing 818 control plants; 13M and 20M represented the primary tiller leaf samples of QY2091-13 and QY2091-20 T0 plants; 13L and 20L represented the secondary tiller leaf samples of QY2091-13 and QY2091-20 T0 plants used for herbicide resistance testing.

[0641] Table 6: Ct values and relative expressionfolds of different genes

[0642] UBQ5MeanUBI2ΔCt2-ΔCtMeanHPPDΔCt2-ΔCtMean 23.27 17.56-5.8858.95 20.81-2.636.20  23.55 17.71-5.7353.09 21.01-2.435.40 818CK123.5123.4417.66-5.7855.0655.7020.98-2.475.525.71 23.45 17.88-5.5045.20 20.93-2.445.43  23.19 17.94-5.4443.41 21.13-2.244.74 818CK323.4923.3717.72-5.6550.2646.2921.14-2.244.724.96 24.61 19.56-4.9230.32 20.23-4.2519.07  24.27 19.52-4.9631.05 20.29-4.1918.28 13M24.5624.4819.16-5.3239.9733.7820.48-4.0015.9917.78 23.98 18.76-5.2036.70 19.02-4.9430.64  23.89 18.52-5.4343.19 19.07-4.8929.56 13L24.0023.9618.81-5.1435.3438.4119.07-4.8829.4529.88 24.34 19.01-5.4042.30 19.37-5.0432.98  24.41 19.07-5.3440.64 19.33-5.0934.05 20M24.4924.4119.29-5.1335.0039.3219.26-5.1635.6534.22 24.63 19.46-5.1134.52 19.88-4.6925.83  24.67 19.38-5.1936.48 19.91-4.6625.31 20L24.4124.5719.42-5.1535.6135.5419.86-4.7126.1625.77

[0643] The results were shown in Figure 10. The rice UBQ5 was used as an internal reference gene to calculate the relative expression levels of the OsHPPD and UBI2 genes. The results showed that the HPPD expression level of the HPPD doubled strain was significantly higher than that of the wild type, indicating that the fused UBI2 strong promoter did increase the expression level of HPPD, thereby creating a highly-expressing HPPD gene, with the HPPD gene knocked up. The slight decrease in the expression level of UBI2 could be due to the small-scale mutations resulting from the edition of the promoter region, and we had indeed detected base insertions, deletions or small fragment deletions at the UBI2 target site. Compared with the wild type, the  expression levels of UBI2 and HPPD significantly tended to be consistent and met the oretical expectations; among them, the HPPD expression level of the 20M sample was about 6 times higher than that of the wild type CK3 group.

[0644] The above results proved that, following the effective chromosome fragment doubling program as tested in protoplasts, calli and transformed seedlings with doubling events could be selected by multiple rounds of molecular identification during theAgrobacterium transformation and tissue culturing, and the UBI2 strong promoter in the new HPPD gene fusion generated in the transformed seedlings did increase the expression level of HPPD gene, rendering the plants to get resistance to HPPD inhibitory herbicideBipyrazone, up to 8 times the field dose, and thus a herbicide-resistant rice with knock-up endogenous HPPD gene was created. Taking this as an example, using the chromosome fragment doubling technical solution of Example 1 and Example 2, a desired promoter could also be introduced into an endogenous gene which gene expression pattern should be changed to create a new gene, and a new variety of plants with desired gene expression pattern could be created through Agrobacterium-mediated transformation.

[0645] Example 3: Molecular detection and herbicide resistance test of T1 generation of herbicide-resistant rice strain with knock-up expression of the endogenous HPPD gene caused by chromosome fragment doubling

[0646] The physical distance between the HPPD gene and the UBI2 gene in the wild-type rice genome was 338 kb, as shown in Scheme 1 in Figure 1. The length of the chromosome was increased by 338 kb after the chromosome fragment between them was doubled by duplication, and a highly-expressing new HPPD gene was generated with a UBI2 promoter at the joint of the duplicated fragment to drive the expression of the HPPD CDS region. In order to determine whether the new gene could be inherited stably and the effect of the doubling chromosome fragment on the genetic stability, molecular detection and herbicide resistance test was conducted for the T1 generation of the HPPD doubled strains.

[0647] First of all, it was observed that the doubling event had no significant effect on the fertility of T0 generation plants, as all positive T0 strains were able to produce normal seeds. Planting test of T1 generation seedlings were further conducted for the QY2091-13 and QY2091-20 strains.

[0648] 1.Sample preparation:

[0649] For QY2091-13, a total of 36 T1 seedlings were planted, among which 27 grew normally and 9 were albino. 32 were selected for DNA extraction and detection, where No. 1-24 were normal seedlings, and No. 25-32 were albino seedlings.

[0650] For QY2091-20, a total of 44 T1 seedlings were planted, among which 33 grew normally and 11 were albino. 40 were selected for DNA extraction and detection, where No. 1-32 were normal seedlings, and No. 33-40 were albino seedlings.

[0651] Albino seedlings were observed in the T1 generation plants. It was speculated that, since HPPD was a key enzyme in the chlorophyll synthesis pathway of plants, and the T0 generation plants resulting from the dual-target edition possibly could be chimeras of many genotypes such as doubling, deletion, inversion of chromosome fragments, or small fragment mutation at the edited target site. The albino phenotype could be generated in the plants where the HPPD gene was destroyed, for example, the HPPD CDS region was deleted. Different primer pairs were designed for PCR to determine possible genotypes.

[0652] 2.PCR molecular identification:

[0653] 1) Sequences ofdetection primers: sequence 5’-3’

[0654] Primer 8F: TCTGTGTGAAGATTATTGCCACTAGTTC

[0655] Primer 6R: GAGTTCCCCGTGGAGAGGT

[0656] Test 141-F: CCCCTTCCCTCTAAAAATCAGAACAG

[0657] Primer 4R: GGGATGCCCTCCTTATCTTGGATC

[0658] Primer 3F: CCTCCATTACTACTCTCCCCGATTC

[0659] Primer 7R: GTGTGGGGGAGTGGATGACAG

[0660] pg-Hyg-R1: TCGTCCATCACAGTTTGCCA

[0661] pg-35S-F: TGACGTAAGGGATGACGCAC

[0662] 2) The binding sites of the above primers were shown in Figure 11. Among them, the Primer 8F + Primer 6R were used to detect the fusion fragment of the UBI2 promoter and the HPPD CDS after the chromosome fragment doubling, and the length of the product was 630 bp; the Test 141-F + Primer 4R were used to detect chromosome fragment deletion event, and the length of the product was 222bp; and the pg-Hyg-R1+ pg-35S-F were used to detect the T-DNA fragment of the editing vector, and the lengthof the product was 660bp.

[0663] 3) PCR reaction system, reaction procedure and gel electrophoresis detection were performed according to Example 1.

[0664] 3. Molecular detection results:

[0665] The detection results of doubling and deletion events were shown in Table 7. It could be noted that the chromosome fragment doubling events and deletion events were observed in the T1 generation plants, with different rations among different lines. The doubling events in the QY2091-13 (29 / 32) were higher than that in the QY2091-20 (21 / 40) , possibly due to the different chimeric ratios in the T0 generation plants. The test results indicated that the fusion gene generated by the doubling was heritable.

[0666] Table 7: Detection results of doubling and deletion events

[0667] QY2091-201234567891011121314151617181920Doubling+---+++---+-----+++-Deletion-----+--+--+-------- 2122232425262728293031323334353637383940Doubling-+--+-+++-+++-+++++-Deletion--++-+---++-+-+----+

[0668]

[0669] The pg-Hyg-R1+ pg-35S-F primers were used to detectthe T -DNA fragmentof the editing vector for the above T1 seedlings. The electrophoresis results of the PCR products of QY2091-20-17 and QY2091-13-7 were negative for the T-DNA fragment, indicating that it was a  homozygous doubling. It could be seen that doubling-homozygous non-transgenic strains could be segregated from the T1 generationof the doubling events.

[0670] 4. Detection of editing events by sequencing:

[0671] The doubling fusion fragments were sequenced for the doubling-homozygous positive T1 generation samples 1, 5, 7, 11, 18 and 19 for QY2091-20 and for the doubling-homozygous positive T1 samples 1, 3, 7, 9, 10 and 12 for QY2091-13. The left target site of the HPPD gene and the right target site of the UBI2 were amplified at the same time for sequencing to detect the editing events at the target sites. Among them, the Primer 3F + Primer 7R were used to detect the editing event of the left HPPD target site, where the wild-type control product was 481bp in length; the Primer 8F+Primer 4R were used to detect the editing event of the right UBI2 target site, where the wild-type control product was 329bp in length.

[0672] 1) Genotype of the doubling events:

[0673] The sequencing result of the HPPD doubling in QY2091-13 was shown in SEQ ID NO: 18, and the sequencing result of the HPPD doubling in QY2091-20 was shown in SEQ ID NO: 19, see Figure 12. Compared with the predicted linker sequences of the doubling, one T base was inserted at the linker in QY2091-13, 19 bases were deleted from the linker in QY2091-20, and both of the insertion and deletion occurred in the promoter region of UBI2 and had no effect on the coding region of the HPPD protein. From the detection results on the expression levels of the HPPD gene in Example 2, it can be seen that the expression levels of these new HPPD genes where the UBI2 promoters were fused to the HPPD CDS region was significantly increased.

[0674] 2) Editing events at the original HPPD and UBI2 target sites on both sides:

[0675] There were more types of editing events at the target sites on both sides. In two lines, three editing types occurred in the HPPD promoter region, namely insertion of single base, deletion of 17 bases, and deletion of 16 bases; and two editing types occurred in the UBI2 promoter region, namely insertion of 7 bases and deletion of 3 bases. The T1 plants used for testing and sampling were all green seedlings and grew normally, indicating that small-scale mutations in these promoter regions had no significant effect on gene function, and herbicide-resistant rice varieties could be selected from their offspring.

[0676] 5. Herbicide resistance test on seedlings of T1 generation:

[0677] The herbicide resistance of the T1 generation of the QY2091 HPPD doubled strain was tested at the seedling stage. After the T1 generation seeds were subjected to surface disinfection, they germinated on 1 / 2 MS medium containing 1.2μM Bipyrazone, and cultivated at 28℃, 16 hours light / 8 hours dark, in which wild-type Jinjing 818 was used as a control.

[0678] The test results of resistance were shown in Figure 13. After 10 days of cultivation in light, the wild-type control rice seedlings showed phenotypes of albinism and were almost all albino, while the lines of the HPPD doubling events QY2091-7, 13, 20, 22 showed phenotype segregation of chlorosis and green seedlings. According to the aforementioned molecular detection results, there was genotype segregation in the T1 generation. Albino seedlings appeared in the absence of herbicide treatment, while green seedlings continued to remain green and grew normally after the addition of 1.2 μM Bipyrazone. The test results indicated that the high resistance to Bipyrazone of the HPPD gene-doubled lines could be stably inherited to the T1 generation.

[0679] Example 4: An editing method for knocking up the expression of the endogenous PPO gene by inducing chromosome fragment inversion -rice protoplast test

[0680] The rice PPO1 (also known as PPOX1) gene (as shown in SEQ ID NO: 7, in which 1-1065bp was the promoter, the rest was the coding region) was located on chromosome 1, and the calvin cycle protein CP12 gene (as shown in SEQ ID NO: ID NO: 8, in which 1-2088bp was the promoter, and the rest was the coding region) was located 911kb downstream of the PPO1 gene with opposite directions. According to the rice gene expression profile data provided by the International Rice Genome Sequencing Project (http:  / / rice. plantbiology. msu. edu / index. shtml) , the expression intensity of the CP12 gene in rice leaves was 50 times that of the PPO1 gene, and the CP12 gene promoter was a strong promoter highly expressing in leaves.

[0681] As shown in Scheme 1 of Figure 4, by simultaneously inducing double-strand breaks between the respective promoters and the CDS region of the two genes and screening, the region between the two breaks could be reversed, with the promoter of PPO1 gene replaced with the promoter of CP12 gene, increasing the expression level of the PPO1 gene and achieving the resistance to PPO inhibitory herbicides, thereby herbicide-resistant lines could be selected. In addition, as shown in Scheme 2 of Figure 4, a new gene of PPO1 driven by the promoter of CP12 gene could also be created by first inversion and then doubling.

[0682] 1. First, the rice PPO1 and CP12 genomic DNA sequences were input into the CRISPOR online tool (http:  / / crispor. tefor. net / ) to search for available editing target sites. After online scoring, the following target sites were selected between the promoters and the CDS regions of the PPO1 and CP12 genes for testing:

[0683]

[0684] The guide RNA1 and guide RNA2 located between the promoter and the CDS region of the PPO1 gene, close to the PPO1 start codon, and the guide RNA3 and guide RNA4 located between the promoter and the CDS region of the CP12 gene, close to the CP12 start codon.

[0685] As described in Example 1, primers were designed for the above target sites to construct dual-target vectors, with pHUE411 as the backbone:

[0686]

[0687] Specifically, the pCBC-MT1T2 plasmid (https:  / / www. addgene. org / 50593 / ) was used as the template to amplify the sgRNA1+3, sgRNA1+4, sgRNA2+3, sgRNA2+4 dual-target fragments  and construct sgRNA expression cassettes, respectively. The pHUE411 vector backbone was digested with BsaI and recovered from gel, and the target fragment was directly used for the ligation reaction after digestion. T4 DNA ligase was used to ligate the vector backbone and the target fragment, the ligation product was transformed into Trans5α competent cells, different monoclones were selected and sequenced. The Sparkjade High Purity Plasmid Mini Extraction Kit was used to extract plasmids with correct sequencing results, thereby obtaining recombinant plasmids, respectively named as pQY002095, pQY002096, pQY002097, pQY002098, as shown below:

[0688] pQY002095 pHUE411-PPO-sgRNA1+3 containing OsPPO-guide RNA1, guide RNA3 combination

[0689] pQY002096 pHUE411-PPO-sgRNA2+3 containing OsPPO-guide RNA2, guide RNA3 combination

[0690] pQY002097 pHUE411-PPO-sgRNA1+4 containing OsPPO-guide RNA1, guide RNA4 combination

[0691] pQY002098 pHUE411-PPO-sgRNA2+4 containing OsPPO-guide RNA2, guide RNA4 combination

[0692] 2. Plasmids of high-purity and high-concentration were prepared for the above-mentioned pQY002095-002098 vectors as described in the step 2 of Example 1.

[0693] 3. Rice protoplasts were prepared and subjected to PEG-mediated transformation with the above-mentioned vectors as described in step 3 of Example 1.

[0694] 4. Genomic targeting and detection of new genewith the detection primers shown in the table below for the PCR detection as described in the step 4 of Example 1.

[0695]

[0696] Among them, the combination of PPO-R2 and CP-R2 was used to amplify the CP12 promoter-driven PPO1 CDS new gene fragment that was generated on the right side after chromosome fragment inversion, and the combination of PPO-F2 and CP-F2 was used to amplify the PPO1 promoter-driven CP12 CDS new gene fragment that was generated on the left side after inversion. The possible genotypes resulting from the dual-target editing and the binding sites of the molecular detection primers were shown in Figure 14.

[0697] 5. The PCR and sequencing results showed that the expected new gene in which the CP12 promoter drove the expression of PPO1 was created from the transformation of rice protoplasts. The editing event where the rice CP12 gene promoter was fused to the PPO1 gene expression region could be detected in the genomic DNA of the transformed rice protoplasts. This indicated that the scheme to form a new PPO gene through chromosome fragment inversion was feasible,  and a new PPO gene driven by a strong promoter could be created, which was defined as a PPO1 inversion event. The sequencing results for the chromosome fragment inversion in protoplasts transformed with the pQY002095 vector were shown in SEQ ID NO: 15; the sequencing results for the chromosome fragment deletion in protoplasts transformed with the pQY002095 vector were shown in SEQ ID NO: 16; and the sequencing results for the chromosome fragment inversion in protoplasts transformed with the pQY002098 vector were shown in SEQ ID NO: 17.

[0698] Example 5: Creation of herbicide-resistant rice with knock-up expression of the endogenous PPO gene caused by chromosome fragment inversion through Agrobacterium-mediated transformation

[0699] 1. Construction of knock-up editing vector: Based on the results of the protoplast testing, the dual-target combination of OsPPO-guide RNA1: 5'CCATGTCCGTCGCTGACGAG3' and OsPPO-guide RNA4: 5'CGGATTTCTGCGT-GTGATGT3' with high editing efficiency was selected to construct the Agrobacterium transformation vector pQY2234. pHUE411 was used as the vector backbone and the rice codon optimization was performed. The vector map was shown in Figure 16.

[0700] 2. Agrobacterium transformed rice callus and two rounds of molecular identification:

[0701] The pQY2234 plasmid was used to transform rice callus according to the method described in step 2 of Example 2. The recipient varieties were Huaidao No. 5 and Jinjing 818. In the callus selection stage, two rounds of molecular identification were performed on hygromycin-resistant callus, and the calli positive in inversion event were differentiated. During the molecular detection of callus, the amplification of the CP12 promoter-driven PPO1 CDS new gene fragment generated on the right side after chromosome fragment inversion by the combination of PPO-R2 and CP-R2 was deemed as the positive standard for the inversion event, while the CP12 new gene generated on the left side after inversion was considered after differentiation and seedling emergence of the callus. A total of 734 calli from Huaidao No. 5 were tested, in which 24 calli were positive for the inversion event, and 259 calli from Jinjing 818 were tested, in which 29 calli were positive for the inversion event. Figure 17 showed the PCR detection results of Jinjing 818 calli No. 192-259.

[0702] 3. A total of 53 inversion event-positive calli were subjected to two rounds of molecular identification and then co-differentiated, and 9 doubling event-positive calli were identified, which were subjected to two rounds of molecular identification and then co-differentiated to produce 1,875 T0 seedlings, in which 768 strains were from Huaidao No. 5 background, and 1107 strains were from Jinjing 818 background. These 1875 seedlings were further subjected to the third round of molecular identification with the PPO-R2 and CP-R2 primer pair, in which 184 lines from Huaidao No. 5 background showedinversion-positive bands, 350 strains from Jinjing 818 background showed inversion-positive bands. The positive seedlings were moved to the greenhouse for cultivation.

[0703] 4. PPO inhibitory herbicide resistance test of PPO1 inversion seedlings (T0 generation) :

[0704] Transformation seedlings of QY2234 T0 generation identified as inversion event-positive were transplanted into large plastic buckets in the greenhouse to grow seeds of T1 generation. There were a large number of positive seedlings, so some T0 seedlings and wild-type control lines with similar growth period and status were selected. When the plant height reached about 20  cm, the herbicide resistance test was directly carried out. The herbicide used was a high-efficiency PPO inhibitory herbicideproduced by the company ( “Compound A” ) . In this experiment, the herbicide was applied at the gradients of three levels, namely 0.18, 0.4, and 0.6 g ai / mu, by a walk-in type spray tower.

[0705] The resistance test results were shown in Figure 18. 3-5 days after the application, the wild-type control rice seedlings began to wither from tip of leaf, necrotic spots appeared on the leaves, and the plants gradually withered, while most of the lines of the PPO1 inversion event maintained normal growth, the leaves had no obvious phytotoxicity. In addition, some lines showed phytotoxicity, probably due to the polygenotypic mosaicism of editing events and the low expression level of PPO1 in the T0 generation lines. Two weeks after the application, the wild-type rice seedlings died, and most of the inversion event strains continued to remain green and grew normally. The test results showed that the PPO1 inversion lines could significantly improve the tolerance of plants to Compound A.

[0706] 5.Quantitative detection of relative expression level of PPO1 gene in PPO1 inversion seedlings (T0 generation) :

[0707] It was speculated that the increased resistance of the PPO1 gene inversion lines to Compound A was due to the fusion of the strong CP12 promoter and the CDS of the PPO1 gene which would increase the expression level of PPO1. Therefore, the lines of T0 generation QY2234-252, QY2234-304 and QY2234-329 from Huaidao No. 5 background were selected, their primary tillers and secondary tillers were sampled and subjected to the detection of expression levels of PPO1 and CP12 genes. The wild-type Huaidao No. 5 was used as the control. The specific protocols followed step 6 of Example 2, with the rice UBQ5 gene as the internal reference gene. the fluorescence quantitative primers were as follows: 5'-3'

[0708]

[0709] The UBQ5 was used as an internal reference. ΔCt was calculated by subtracting the Ct value of UBQ5 from the Ct value of the target gene. Then 2-ΔCt was calculated, which represented the relative expression level of the target gene. The H5CK1 and H5CK2 were two wild-type control plants of Huaidao No. 5, the 252M, 304M and 329M represented the primary tiller leaf samples of QY2234-252, QY2234-304 and QY2234-329 T0 plants, and the 252L, 304L, and 329L represented their secondary tiller leaf samples. The results were shown in Table 8 below:

[0710] Table 8: Ct values and relative expression folds of different genes

[0711] UBQ5MeanPPO1ΔCt2-ΔCtMeanCP12ΔCt2-ΔCtMean 28.18 25.83-2.435.39 22.28-3.9815.77  28.37 25.98-2.284.85 22.06-4.2018.44 H5CK128.2328.2625.93-2.335.035.0922.11-4.1517.7617.32 28.23 25.73-2.365.15 21.63-6.4788.58  27.98 26.02-2.074.20 21.53-6.5794.87

[0712] H5CK228.0728.0925.92-2.184.524.6221.54-6.5593.8392.43 25.51 25.17-0.541.45 22.26-3.4510.95  25.82 25.22-0.491.41 22.36-3.3610.23 252M25.8025.7125.22-0.491.411.4222.43-3.299.7610.31 26.41 23.36-3.148.84 22.30-4.2118.49  26.64 23.41-3.108.56 21.95-4.5623.55 252L26.4726.5123.46-3.058.288.5621.78-4.7326.4722.84 25.74 24.55-1.292.44 22.51-3.3210.02  25.99 24.53-1.312.48 22.45-3.3910.47 304M25.7825.8424.48-1.362.572.5022.56-3.289.7110.07 25.97 23.63-2.365.14 21.60-4.3920.97  26.00 23.75-2.254.74 21.43-4.5623.55 304L26.0025.9923.56-2.435.395.0922.32-3.6812.7819.10 26.94 23.11-3.8914.84 22.23-4.7627.16  26.99 23.25-3.7513.42 21.85-5.1535.39 329M27.0727.0023.22-3.7813.7113.9921.82-5.1836.2932.95 26.50 23.64-2.636.19 22.00-4.2719.30  26.52 23.74-2.535.79 21.97-4.3019.71 329L25.7926.2723.77-2.505.655.8722.15-4.1217.4218.81

[0713] The relative expression levels of PPO1 and CP12 in different strains were shown in Figure 19. As the results showed, unlike the doubling event in Example 2, the gene expression levels of these inversion event strains were significantly different. The expression levels of CP12 are very different between the two Huaidao No. 5 CK groups, possibly because of the different growth rates of the seedlings. Compared with the H5CK2 control group, the expression levels of CP12 in the experimental groups all showed a tendency of decrease, while the expression levels of PPO1 for 252L and 329M increased significantly, and the expression levels of PPO1 for 304L and 329L modestly increased, and the expression levels of PPO1 for 252M and 304M decreased. Different from the doubling of chromosome fragments which mainly increased the gene expression level, the inversion of chromosome fragments generated new genes on both sides, so various editing events might occur at the targets on both sides, and the changes in the transcription direction might also affect gene expression level at the same time. That is to say, the T0 generation plants were complex chimeras. There might also be significant differences in gene expression levels between primary and secondary tillers of the same plant. It could be seen from the results of quantitative PCR that the PPO1 inversion events showed a higher likelihood of increasing the PPO1 gene expression level, and thus herbicide-resistant strains with high expression level of PPO1 could be selected out by herbicide resistance selection for the inversion events.

[0714] The above results proved that, following the scheme of detecting effective chromosome fragment inversion in protoplasts, calli and transformed seedlings with inversion events could be selected through the multiple rounds of molecular identification during theAgrobacterium transformation and tissue culturing, and the CP12 strong promoter fused with the new PPO1 gene generated in the transformant seedlings could indeed increase the expression level of the PPO1 gene, which could confer the plants with resistance to the PPO inhibitory herbicideCompound A,  thereby herbicide-resistant rice with knock-up endogenous PPO gene was created. Taking this as an example, the chromosome fragment inversion protocol of Example 4 and Example 5 also applied to other endogenous genes which gene expression pattern needed to be changed by introducing and fusing with a required promoter, thereby a new gene can be created, and new varieties with a desired gene expression pattern could be created through Agrobacterium-mediated transformation in plants.

[0715] Example 6: Molecular detection and herbicide resistance test of the T1 generation plants of the herbicide-resistant rice lines with knock-up expression of the endogenous PPO1 gene through chromosome fragment inversion

[0716] The physical distance between the wild-type rice genome PPO1 gene and CP12 gene was 911 kb. As shown in Figure 14, a highly-expressing PPO1 gene with a CP12 promoter-driven PPO1 CDS region was generated on the right side after the inversion of the chromosome fragment between the two genes. A deletion of chromosome fragment could also occur. In order to test whether the new gene could be inherited stably and the influence of the chromosome fragment inversion on genetic stability, molecular detection and herbicide resistance test was carried out on the T1 generation of the PPO1 inversion strain.

[0717] First of all, it was observed that the inversion event had no significant effect on the fertility of the T0 generation plants, as all positive T0 strains were able to produce seeds normally. The T1 generations of QY2234 / H5-851 strains with the Huaidao No. 5 background were selected for detection.

[0718] 1. Sample preparation:

[0719] For QY2234 / H5-851, a total of 48 T1 seedlings were planted. All the plants grew normally.

[0720] 2. PCR molecular identification:

[0721] 1) Detection primer sequence: 5’-3’

[0722] PPO-R2: AAGGCTGGAAGCTGTTGGG

[0723] CP-R2: CTGAGGAGGCGATAAGAAACGA

[0724] PPO-F2: CGGACTTATTTCCCACCAGAA

[0725] CP-F2: AGGTCTCCTTGAGCTTGTCG

[0726] pg-Hyg-R1: TCGTCCATCACAGTTTGCCA

[0727] pg-35S-F: TGACGTAAGGGATGACGCAC

[0728] 2) The binding sites of the above primers were shown in Figure 14, wherein the PPO-R2 +CP-R2 was used to detect the fusion fragment of the right CP12 promoter and the PPO1 coding region after the inversion of the chromosome fragment, and the length of the product was 507bp; the PPO-F2 + CP-F2 was used to detect the fusion fragment of the left PPO1 promoter and the CP12 coding region after the inversion of the chromosome fragment, and the length of the product was 560bp; the PPO-F2 + PPO-R2 was used to detect the left PPO target site before the inversion, and the length of the product in the wild-type control was 586bp; the CP-F2 + CP-R2 was used to detect the right CP12 target site before the inversion, and the length of the product in the wild-type control was 481bp. The pg-Hyg-R1 + pg-35S-F was used to detect theT-DNA fragment of the editing vector, and the length of the product was 660bp.

[0729] 3) PCR reaction system and reaction conditions:

[0730] Reaction system (10μL system) :

[0731]

[0732] Reaction conditions:

[0733]

[0734] The PCR products were subjected to electrophoresis on a 1%agarose gel with a voltage of 180V for 10 minutes.

[0735] 3. Molecular detection results:

[0736] The detection results were shown in Table 9. A total of 48 plants were detected, of which 12 plants (2 / 7 / 11 / 16 / 26 / 36 / 37 / 40 / 41 / 44 / 46 / 47) were homozygous in inversion, 21 plants (1 / 3 / 4 / 5 / 6 / 8 / 9 / 15 / 17 / 20 / 22 / 23 / 24 / 27 / 30 / 31 / 33 / 34 / 39 / 42 / 43) were heterozygous in inversion, and 15 plants (10 / 12 / 13 / 14 / 18 / 19 / 21 / 25 / 28 / 29 / 32 / 35 / 38 / 45 / 48) were homozygous in non-inversion. The ratio of homozygous inversion: heterozygous inversion: homozygous non-inversion was 1: 1.75: 1.25, approximately 1: 2: 1. So the detection results met the Mendel’s law of inheritance, indicating that the new PPO1 gene generated by inversion was heritable.

[0737] Table 9: Results of molecular detection

[0738]

[0739]

[0740] For the above T1 seedlings, the Pg-Hyg-R1 + pg-35S-F primers were used to detect the T-DNA fragmentof the editing vector. The electrophoresis results of 16 and 41 were negative for T-DNA fragment, indicating homozygous inversion. It could be seen that non-transgenic strains of homozygous inversion could be segregated from the T1 generationof the inversion event.

[0741] 4. Sequencing detection of the editing events:

[0742] The genotype detection of the inversion events focused on the editing events of the new PPO gene on the right side. The mutation events with the complete protein coding frame of the PPO1 gene were retained. The CP12 site editing events on the left side that did not affect the normal growth of plants through the phenotype observation in the greenhouse and field were retained. The genotypes of the editing events detected in the inversion event-positive lines were listed below, in which seamless indicated identical to the predicted fusion fragment sequence after inversion. The genotypes of the successful QY2234 inversion events in Huaidao No. 5 background were as follows:

[0743]

[0744] Some of the sequencing peak maps and sequence comparison results were shown in Figure 20.

[0745] The genotypes of the successful QY2234 inversion in the Jinjing818 background were as follows:

[0746]

[0747] Some of the sequencing peak maps and sequence comparison results were shown in Figure 21.

[0748] The sequencing results of the above different new PPO1 geneswith the CP12 promoter fused to the PPO1 coding regionwere shown in SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO : 25, and SEQ ID NO: 26.

[0749] 5. Herbicide resistance test of T1 generation seedlings:

[0750] The herbicide resistance test was performed on the T1 generation of the QY2234 / H5-851 PPO1 inversion lines at seedling stage. The wild-type Huaidao No. 5 was used as a control, and planted simultaneously with the T1 generation seeds of the inversion lines. When the seedlings reached a plant height of 15 cm, Compound A was applied by spraying at four levels of 0.3, 0.6, 0.9 and 1.2 g a. i.  / mu. The culture conditions were 28℃, with 16 hours of light and 8 hours of darkness.

[0751] The resistance test results were shown in Figure 22. After 5 days of the application, the wild-type control rice seedlings showed obvious phytotoxicity at a dose of 0.3 g a. i.  / mu. They began to wither from the tip of leaf, and necrotic spots appeared on the leaves; at a dose of 0.6 g a.i.  / mu, the plants died quickly. However, QY2234 / H5-851 T1 seedlings could maintain normal growth at a dose of 0.3 g a. i.  / mu, and no obvious phytotoxicity could be observed on the leaves; at doses of 0.6 and 0.9 g ai / mu, some T1 seedlings showed dry leaf tips, but most T1 seedlings could keep green and continue to grow, while the control substantially died off. At a dose of 1.2 g a.i.  / mu, the control plants were all dead, while some of the T1 seedlings could keep green and continue to grow. The test results indicated that the resistance of the PPO1 gene inversionlines to Compound A could be stably inherited to their T1 generation.

[0752] Example 7: An editing method for knocking up the expression of theendogenous EPSPS gene in plant

[0753] EPSPS was a key enzyme in the pathway of aromatic amino acid synthesis in plants and the target site of the biocidal herbicide glyphosate. The high expression level of EPSPS gene could endow plants with resistance to glyphosate. The EPSPS gene (as shown in SEQ ID NO: 4, in which 1-1897bp was the promoter, and the rest was the expression region) was located on chromosome 6 in rice. The gene upstream was transketolase (TKT, as shown in SEQ ID NO: 3, in which 1-2091bp was the promoter, and the rest was the expression region) with an opposite direction. The expression intensity of TKT gene in leaves was 20-50 times that of the EPSPS gene. As shown in Figure 2, by simultaneously inducing double-strand breaks between the promoter and the CDS region of the two genes respectively, the inversion (Scheme 1) or inversion doubling (Scheme 2) of the region between the two breaks could be obtained after screening. In both cases, the promoter of the EPSPS gene would be replaced with the promoter of the TKT gene, thereby increasing the expression level of the EPSPS gene and obtaining the resistance to glyphosate. In addition, the Schemes 3, 4 and 5 as shown in Figure 2 could also create new EPSPS genes driven by the TKT gene promoter. The gene structure of EPSPS adjacent to and opposite in direction relative to TKTwas conserved in monocotyledonous plants (Table 10) . While in dicotyledonous plants, both genes were also adjacent yet in the same direction; therefore, this method was universal in plants.

[0754] Table 10: Distance between the EPSPS gene and the adjacent TKT gene in different plants

[0755]

[0756]

[0757] To this end, pHUE411 was used as the backbone, and the following as targets:

[0758]

[0759] Several different dual-target vectors had been constructed:

[0760] pQY002061 pHUE411-EPSPS-sgRNA1+3

[0761] pQY002062 pHUE411-EPSPS-sgRNA2+3

[0762] pQY002063 pHUE411-EPSPS-sgRNA1+4

[0763] pQY002064 pHUE411-EPSPS-sgRNA2+4

[0764] pQY002093 pHUE411-EPSPS-sgRNA2+5

[0765] pQY002094 pHUE411-EPSPS-sgRNA2+6

[0766] (2) With the relevant detection primers shown in the following table, the fragments containing the target sites on both sides or the predicated fragments generated by the fusion of the TKT promoter and the EPSPS coding region were amplified, and the length of the productsis between 300-1000 bp.

[0767]

[0768]

[0769] After protoplast transformation, the detection results showed that the expected inversion events were obtained. As shown in Figure 15, the sequencing result of the inversion detection of pQY002062 vector transformed protoplast was shown in SEQ ID NO: 11; the sequencing result of the deletion detection of pQY002062 vector transformed protoplast was shown in SEQ ID No: 12; the sequencing result of the inversion detection of the pQY002093 vector transformed protoplast was shown in SEQ ID NO: 13; and the sequencing result of the deletion detection of pQY002093 vector transformed protoplast was shown in SEQ ID NO: 14.

[0770] These vectors were transferred into Agrobacterium for transforming calli of rice. Plants containing the new EPSPS gene were obtained. The herbicide bioassay results showed that the plants had obvious resistance to glyphosate herbicide.

[0771] Example 8: An editing method for knocking up the expression of the endogenous PPO gene in Arabidopsis

[0772] Protoporphyrinogen oxidase (PPO) was one of the main targets of herbicides. By highly expressing plant endogenous PPO, the resistance to PPO inhibitory herbicides could be significantly increased. The Arabidopsis PPO gene (as shown in SEQ ID NO: 1, in which 1-2058bp was the promoter, and the rest was the expression region) located on chromosome 4, and the ubiquitin10 gene (as shown in SEQ ID NO: 2, in which 1-2078bp was the promoter, and the rest was the expression region) located 1.9M downstream with the same direction as the PPO gene.

[0773] As shown in the Scheme as shown in Figure 3, simultaneously generating double-strand breaks at the sites between the promoter and the CDS region of the PPO and the ubiquitin10 genes respectively. Doubling events of the region between the two breaks could be obtained by screening, namely a new gene generated by fusing the ubiquitin10 promoter and the PPO coding region. In addition, following Scheme 2 as shown in Figure 1, a new gene in which the ubiquitin10 promoter and the PPO coding region were fused together could also be created.

[0774] To this end, pHEE401E was used as the backbone (https:  / / www. addgene. org / 71287 / ) , and the following locations were used as target sites:

[0775]

[0776] The dual-target vectors were constructed following the method described by "Wang ZP, Xing HL, Dong L, Zhang HY, Han CY, Wang XC, Chen QJ. Egg cell-specific promoter-controlled CRISPR / Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol . 2015 Jul 21; 16: 144. " :

[0777]

[0778]

[0779] Arabidopsis was transformed according to the method as follows:

[0780] (1) Agrobacterium transformation

[0781] Agrobacterium GV3101 competent cells were transformed with the recombinant plasmidsto obtain recombinant Agrobacterium.

[0782] (2) Preparation of Agrobacterium infection solution

[0783] 1) Activated Agrobacterium was inoculated in 30ml of YEP liquid medium (containing 25mg / L Rif and 50mg / L Kan) , cultured at 28℃ under shaking at 200 rpm overnight until the OD600 value was about 1.0-1.5.

[0784] 2) The bacteria were collected by centrifugation at 6000 rpm for 10 minutes, and the supernatant was discarded.

[0785] 3) The bacteria were resuspended in the infection solution (no need to adjust the pH) to reach OD600=0.8 for later use.

[0786] (3) Transformation of Arabidopsis

[0787] 1) Before the plant transformation, the plants shouldgrow well with luxuriant inflorescence and no stress response. The first transformation could be carried out as long as the plant height reached 20cm. When the soil was dry, watering was carried out as appropriate. On the day before the transformation, the grown siliques were cut with scissors.

[0788] 2) The inflorescence of the plant to be transformed was immersed in the above solution for 30 seconds to 1 minute with gentle stirring. The infiltrated plant should have a layer of liquid film thereon.

[0789] 3) After transformation, the plant was cultured in the dark for 24 hours, and then removed to a normal light environment for growth.

[0790] 4) After one week, the second transformation was carried out in the same way.

[0791] (4) Seed harvest

[0792] Seeds were harvested when they were mature. The harvested seeds were dried in an oven at 37℃ for about one week.

[0793] (5) Selection of transgenic plants

[0794] The seeds were treated with disinfectant for 5 minutes, washed with ddH2O for 5 times, and then evenly spread on MS selection medium (containing 30μg / ml Hyg, 100μg / ml Cef) . Then the medium was placed in a light incubator (at a temperature of 22℃, 16 hours of light and 8 hours of darkness, light intensity 100-150 μmol / m2 / s, and a humidity of 75%) for cultivation. The positive seedlings were selected and transplanted to the soil after one week.

[0795] (6) Detection of T1 mutant plants

[0796] (6.1) Genomic DNA extraction

[0797] 1) About 200 mg of Arabidopsis leaves was cut and placed into a 2 ml centrifuge tube. Steel balls were added, and the leaves were ground with a high-throughput tissue disruptor.

[0798] 2) After thorough grinding, 400μL of SDS extraction buffer was addedand mixed upside down. The mixture was incubated in 65℃ water bath for 15 minutes, and mixed upside down every 5 minutes during the period.

[0799] 3) The mixture was centrifuged at 13000rpm for 5 minutes.

[0800] 4) 300μL of supernatant was removed and transferred to a new 1.5ml centrifuge tube, an equal volume of isopropanol pre-cooled at -20℃ was added into the centrifuge tube, and then the centrifuge tube was kept at -20℃ for 1 hour or overnight.

[0801] 5) The mixture was centrifuged at 13000rpm for 10 minutes, and the supernatant was discarded.

[0802] 6) 500μL of 70%ethanol was added to the centrifuge tube to wash the precipitate, the washing solution was discarded after centrifugation (carefully not discarding the precipitate) . After the precipitate was dried at room temperature, 30μL of ddH2O was added to dissolve the DNA, and then stored at -20℃.

[0803] (6.2) PCR amplification

[0804] With the extracted genome of the T1 plant as template, the target fragment was amplified with the detection primers. 5 μL of the amplification product was taken and detected by 1%agarose gel electrophoresis, and then imaged by a gel imager. The remaining product was directly sequenced by a sequencing company.

[0805] The sequencing results showed that the AtPPO1 gene doubling was successfully achieved in Arabidopsis, and the herbicide resistance test showed that the doubling plant had resistance to PPO herbicides.

[0806] Example 9: Creation of GH1 gene with new expression characteristics in zebrafish

[0807] The growth hormone (GH) genes in fishes controlled their growth and development speed. At present, highly expressingthe GH gene in Atlantic salmons through the transgenic technology could significantly increase their growth rates. The technique was of great economical value, but only approved for marketing after decades. The GH1 gene was the growth hormone gene in zebrafish. In the present invention, suitable promoters in zebrafish (suitable in terms of continuous expression, strength, and tissue specificity) were fused together with the CDS region of GH1 gene in vivo through deletion, inversion, doubling, inversion doubling, chromosome transfer, etc., to create a fast-growing fish variety.

[0808] The experiment procedure was as follows:

[0809] 1. Breeding of Zebra fish:

[0810] 1) Preparation of paramecia: The mother liquor of paramecia was purchased online (https:  / / item. taobao. com / item. htm? spm=a230r. 1.14.49.79f774c6C6elpL&id=573612042855 &ns=1&abbucket=18#detail) . A 2L beaker was washed, sterilized and filled with 200 mL of paramecia mother liquor; two yeast pieces and two sterilized grains of wheat were added thereto; sterile water was added until the volume reaches 2L; then the opening was covered and sealed with sterilized kraft paper; stationary culture was performed at 25-28℃ for 3-5 d; the mixture was used to feed the juvenile zebra fish when the usable concentration was reached. Each time the paramecia solution was taken, a dense filter screen was used to remove impurities.

[0811] 2) Incubation of brine shrimp: Brine shrimp, also known as fairy shrimp and artemia, was a marine plankton. Brine shrimp eggs were purchased and stored at 4℃. For the incubation, the mixture was prepared at a ratio of 1L deionized water: 32 g NaCl: 3.5 g brine  shrimp eggs; oxygenation was performed at 28.5℃ for 25-30h; the incubated brine shrimps were collected. The incubated brine shrimps were kept in a small amount of 3.2%NaCl solution, where they could be kept for 2-3 d at 4℃.

[0812] 3) The standardized large-scale breeding of zebra fish was realized with anindependent zebrafish farming system manufactured by Shanghai Haisheng. The tap water treated with a water purifier was kept in a dosing barrel, where an appropriate amount of NaCl and NaHCO3 was added to maintain a specific conductivity of 500 μs / cm and a pH of 7.0. The water circulation system ensured all breeding tanks maintain a constant water level and flow state. A waste treatment system automatically filters the fish feces and remaining fish food; the fish culture water was reused after being sterilized by UV exposure and heated (28.5℃) ; the fresh water was automatically replenished after the wastewater was discharged. The lighting was controlled with an automatic timer in fish house to maintain the "14h-light +10h-dark cycles" ; an air conditioning system kept the indoor temperature at 28℃; an exhaust fan removed indoor moisture at regular intervals to avoid excessively high humidity. Zebra fish embryos were subjected to stationary culture in a biochemical incubator at 28.5℃, and could be fed with paramecia 5 days after fertilization. Feeding was performed 3-4 times a day. Fresh brine shrimp started to be supplemented gradually after about 13 days. When the bodies of all juveniles became red, it means the zebra fish can completely eat brine shrimp. The juvenile zebra fish was then transferred to the breeding tank. A moderate amount of fresh brine shrimp was fed 3 times a day.

[0813] AB varieties of zebra fish were transferred into an incubation box on a 2-female : 2-male basis on the afternoon of the day before reproduction of zebra fish; they were separated by a baffle. The baffle was removed the next morning; the zebra fish generally began to lay eggs in about 10 minutes; embryos were collected within 30 minutes after egg laying and rinsed with E3 culture medium (mass ratio29.3 %NaCl, 3.7 %CaCl2, 4%MgSO4, 1.3%KCl, pH7.2) to remove dead eggs.

[0814] 4) Preparation of injection dish: 1.5%agarose was prepared; 30-40 ml of agarose melt was poured into each plastic culture dish. The surface of agarose was gently covered with the mold to avoid bubbles. The mold was removed after the gel got completely solidified to attain a "V-shaped" groove; a small amount of E3 culture medium was added into the prepared culture dish; it was sealed and kept at 4℃.

[0815] 2. Preparation of RNP sample:

[0816] For zebrafish GH1 gene initiation codon upstream 100bp DNA sequence designed sgRNA-GH1 target: 5’aagaacgagtttgtctatct3’, for zebrafish col1a1a gene termination codon designed sgRNA-col1a1a target: 5’atgtagactctttgaggcga3’, and for zebrafish ddx5 gene initiation codon upstream designed sgRNA-ddx5 target: 5’gcaccatcactgcgcgtaca3’. Genscript was entrusted to synthesize the EasyEdit sgRNA. The synthetic sgRNA and the  purified Cas9 were mixed at a ratio of 1: 3; 10×Cas9 buffer solution (200 mM HEPES, 100 mM MgCl2, 5 mM DTT, 1.5 M KCl) was added and RNase-free ultra-pure water was used to dilute it to 1X so that the Cas9 protein concentration was 600 ng / uL, and the sgRNA concentration was 200 ng / uL; after 10 minutes of incubation at 25℃, a small amount of phenol red was added to dye the injection sample for convenient observation during injection; the volume of phenol red was normally less than 10%of the total volume. In the experiment, sgRNA-GH1 combined with sgRNA-col1a1a and sgRNA-ddx5, respectively and the RNP complex was prepared at equal ratio, and the mixture was injected into fish eggs.

[0817] 3. Microinjection:

[0818] Under a stereomicroscope, the tip of injection needle was fractured slightly in a beveled manner using medical pointed toothless forceps for convenient injection. 4 μL of sample containing phenol red was taken by a micro loading tip; the pipette tip inserts into the needle from the end of needle to the tip reaching the point of injection needle; the tip was gently pushed to inject the sample into the needle while the tip was gently pulled out so that the front end of injection needle was filled with the red RNP sample; the injection needle with sample was then inserted into the holder for fixation. The quantitative capillary was 33 mm in length and 1 μL in total volume. The injection pressure was adjusted to increase the length of the liquid column in the capillary by 1 mm after 15 injections; then, each sample injection volume was 1 nL. The injection dish was taken out of the refrigerator in advance, and set aside until the room temperature was reached. The collected one-cell stage fertilized eggs were arranged in the groove of dish; a small amount of E3 culture medium was added so that the liquid level was just over the fertilized eggs. Under a stereomicroscope, the tip of the injection needle was gently penetrated into the membrane of the fertilized egg and reaches the yolk close to the animal pole; RNP sample was injected by stepping on the pedal. Due to the small amount of phenol red in the RNP sample, the light red sample liquid can be clearly observed during the injection. The injected embryos were placed in a disposable plate containing E3 culture medium and cultured in a constant temperature incubator at 28.5℃. The culture medium needs to be replaced every 24 hours to ensure the ion concentration and oxygen content.

[0819] 4. DNA extraction:

[0820] After each set of injections, the tail fin of survived zebrafish at about 2-3 months old were treated with cell lysate buffer (10 mmol / L Tris, 10 mmol / L EDTA, 200 mmol / L NaCl, 0.5%SDS, 200 μg / mL Proteinase K, pH 8.2) . Each tube was filled with 200 μL of lysate and held overnight at 50℃; they were violently shaken 2-3 times during this period. The tube was centrifuged at 1200 r / min for 5 min at room temperature, and then 200 μL of supernatant was taken. Equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) was  added and violently shaken. The tube was centrifuged at 12000 r / min at room temperature for 10 min; the supernatant taken was mixed with equal volume of chloroform, and then the tube was violently shaken. The tube was centrifuged at 12000 r / min at room temperature for 10 min; the supernatant was mixed with 1 / 20-volume 3 mol / L NaCl and 2.5-time volume pre-cooled anhydrous ethanol; the mixture was blended well and should not be made upside down; it's kept on ice for 30 min. The tube was centrifuged at 12000 r / min at 4℃ for 10 min, and the supernatant was abandoned swiftly. 1 mL 70%alcohol was added for rinsing. The tube was centrifuged at 12000 r / min at 4℃ for 10 min. The supernatant was abandoned swiftly, and vacuum drying was performed. Finally, 30 μL of deionized water was added in the end to dissolve the DNA. The solution was kept at -20 ℃ for future use. After the 0.8%agarose electrophoresis detection, the PCR test was performed with the corresponding primer, and the positive strip was subjected to sequencing verification. Wherein, gh1-R: tgctacaaataaagtgcactacaca and col1a1a-F: gggtctggattggagtcaca were double treated between the amplified col1a1a gene and gh1; gh1-R: tgctacaaataaagtgcactacaca and ddx5-F: acgcgttacgtacgtcagaa, as well as GH1-F: aaatgaccggaatcacaaca and ddx5-R: acgaccatccttaccctctg were inversely treated between the amplified ddx5 gene and gh1.

[0821] The experimental results were shown as follows: as shown in Figure 23, the characteristic fragments of chromosome duplication were detected in the zebrafish embryo samples of the RNP injection group; as shown in Figure 51, sequencing results showed that the expected duplication event occurred in the chromosome fragments between GH1 and COL1A1A gene targets in zebrafish embryos; as shown in Figure 52, sequencing results showed that the coding area &promotor of ddx5 gene and the coding area &the promotor of gh1 gene were exchanged due to the inversion of chromosome fragments; as shown in Figure 53, the growth of zebrafish with upregulated expression was obviously accelerated.

[0822] Example 10: Field herbicide resistance test on T1 generation of herbicide-resistant rice linesQY2234

[0823] T1 generation of inversion lines QY2234 / 818-5 and QY2234 / 818-42 PPO1 were subjected to field herbicide resistance test with the wild-type Jinjing 818 rice variety as an herbicide-susceptible control. They were planted in sync with the inversion line T1 generation seeds in a paddy field of Red Flag Team, Nanbin Farm, Sanya, Hainan Province; the test was performed between November 30, 2020 and April 15, 2021. Seedlings were cultivated after 2 days of soaking rice seeds, and transplantation was performed after 3 weeks of seedling; 3 sets of replications were arranged; an herbicide called as compound A was applied in 3 weeks after transplantation, and the concentration was set to 0.3, 0.6 and 0.9 ga. i.  / mu (1 mu = 1 / 15 ha) ; the status of rice seedlings was investigated 10 days post application (DPA) .

[0824] The result of the field herbicide resistance test was shown in Figure 24. In 10 DPA at a dose of 0.3 ga. i.  / mu, all wild-type Jinjing 818 rice plants died; QY2234 / 818-5 and QY2234 / 818-42 were growing normally; at the dose of 0.6 ga. i.  / mu, QY2234 / 818-42 was growing normally, while most individual plants of QY2234 / 818-5 died, but there were resistant individual plants of QY2234 / 818-5; at the dose of 0.9 ga. i.  / mu, most individual plants of QY2234 / 818-42 and QY2234 / 818-5 died, but a few resistant plants were green and continued to grow. The test result indicated that the PPO1 gene inverted line exhibited herbicide resistance under field conditions under high light intensity in Hainan; stable resistant lines can be selected from the populations, whichprovides basic materials for herbicide-resistant rice breeding.

[0825] Example 11: Western Blot test on T1-generation PPO1 protein expression level of the QY2234 line rice

[0826] The T1-generation seedling leaves of the four PPO1 inversion rice lines, i.e., QY2234 / 818-5, QY2234 / 818-42, QY2234 / 818-144 and QY2234 / 818-257, were selected to determine the PPO1 protein expression level. With the wild-type Jinjing 818 rice variety as a control, they were planted in the greenhouse in sync with the inversion line T1 generation seeds; when the seedlings grew to a height of 15 cm, leaf samples were taken with reference to Example 6 for molecular identification; the inversion-positive seedlings were selected for the Western Blot Test on protein expression.

[0827] A Western Blot test was performed as per the Molecular Cloning: A Laboratory Manual (Sambrook, J., Fritsch, E.F. and Maniatis, T, Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989) . The PPO1 protein antibody was rice PPO1 polyclonal antibody prepared by Qingdao Jinmotang Biotechnology Co., Ltd. (Qingdao, China) ; a plant endogenous reference Actin protein antibody was purchased from Sangon Biotech (Shanghai, China) Co., Ltd. (Art. No. D195301) ; the secondary antibody was HRP-labeled goat anti-rabbit IgG (Sangon, Art. No. D110058) ; the test was performed according to the operating instructions using the Western Blot Kit (Boster, Art. No. AR0040) .

[0828] To be more specific, 2 g of single-plant rice sample was taken and ground with liquid nitrogen into powder; an appropriate amount of protein extraction buffer (material: Protein extraction buffer = 1: 1.5) ; incubated on ice for 30 min; centrifuged at 4℃ with 27100 g for 15 min; the supernatant was mixed with 5Xloading buffer (delivered with the kits) ; the mixture was boiled for 15 min and subjected to electrophoresis at 110 V for 30 min.

[0829] The protein extraction buffer was formulated as follows:

[0830] componentconcentrationTris-HCl (PH8.0)100mMglycerin10%EDTA1mM

[0831] AsA (ascorbic acid)2mMPVPP0.5%PVP-400.5%DTT (Add at operation time)20mMPMSF (Add at operation time)1mM

[0832] After the electrophoresis was finished, the gel was removed, and the gel block in an appropriate size was taken depending on the size of target protein, and then the filter paper and PVDF film of approximately the same volume was taken; the gel block was cleaned with clear water and then soaked with transfer solution; the filter paper and PVDF film were also soaked and wetted with the transfer solution; the wet filter paper, PVDF film, SDS-PAGE gel block and filter paper were stacked from bottom to top to expel as many bubbles as possible; they could be flattened with a test tube, while the displacement between layers should be prevented during the flattening; the film was transferred under at 25 V and 1.3A for 10-30 min; after the transfer, the PVDF film was cleaned with PBST buffer. Upon completion of the cleaning, they were transferred to the blocking buffer solution and blocked at room temperature for 1h. After the confining, the PVDF film was cleaned with PBST buffer solution for 3 times to remove the blocking liquid, then the primary antibody was incubated at a dilution ratio of approx. 1: 1000 -1: 3000; the incubation time of the primary antibody was 2h at room temperature, or 12h at 4℃. Upon completion of the primary antibody incubation, the PVDF film was cleaned with the PBST buffer solution for 3 times with each cycle lasting for 10 min. The secondary antibody was incubated at a dilution ratio of approx. 1: 10000 -1: 20000 for 1h at room temperature. Upon completion of the secondary antibody incubation, the PVDF film was cleaned with the PBST buffer solution for 3 times with each cycle lasting for 10 min. ECL luminescence: ECL solutions A and B were mixed well in equal volume (prepared when needed) , and the liquid mixture was dropped onto the PVDF film evenly; the film was placed in the fluorescence imager for imaging.

[0833] The Western Blot test result was shown in Figure 25. According to the result, the internal-control Actin protein expression levels of the PPO1 inversion-positive lines werethe same as the wild-type Jinjing 818, while the expression levels of PPO1 protein weresignificantly up-regulated. The 4 selected QY2234 lines had different genotypes at the inverted junction region between the CP12 promoter and the PPO1 protein coding region; QY2234 / 818-5 was identical to the predicted post-inverted fusion fragment sequence; compared with the predicted sequence, QY2234 / 818-42 lacks 16 bases in the CP12 promoter region; 1 base was inserted in the CP12 promoter region of QY2234 / 818-144 and QY2234 / 818-257. The test result showed that all the new genotypes could express PPO1 protein at high levels, and manifested that the method for creating new genes provided by the present invention could produce a variety of functional genotypes in the genome to  enrich the gene pool.

[0834] Example 12: Field herbicide resistance test on T1 generation of HPPD-duplicated rice lines QY2091

[0835] Through germination test, the T1-generation of HPPD-gene duplicated lines QY2091-12 and QY2091-21 without albino seedling separation were selected for the field herbicide resistance test with the wild-type Jinjing 818 rice variety as a control. They were planted in sync with the T1 generation seeds of QY2091 lines in a paddy field of Red Flag Team, Nanbin Farm, Sanya, Hainan Province; the test was performed between November 1, 2020 and April 10, 2021. Seedlings were cultivated after 2 days of soaking rice seeds, and QY2091 seeds were soaked with 1 / 30000 herbicide compound Bipyrazone aqueous solution; albino seedlings were removed after emergence; transplantation was performed after 3 weeks of seedling, and 3 sets of repetitions were arranged; herbicide compound Bipyrazone was applied in 3 weeks after the transplantation at a concentration of 4, 8, 16, and 32 ga. i.  / mu; the seedling status was investigated 21 days after application.

[0836] The result of field herbicide resistance test was shown in Figure 26. In 21 days after application, all wild-type Jinjing 818 rice plants died of albinism at 4 ga. i.  / mu and 8 ga.i.  / mu ofherbicide compound Bipyrazone, while the QY2091-12 and QY2091-21 were normally growing; at 16 g a. i.  / mu, the QY2091-12 line was growing normally, while the QY2091-21 line began to exhibit resistance separation: Most individual plants showed resistance, and a few individual plants developed yellowing of new leaves; at 32 g a. i.  / mu, QY2091-12 and QY2091-21 began to exhibit resistance separation, and a few individual plants died of albinism, while significant yellowing of new leaves was observed in some individual plants; approx. 1 / 2 of the individual plants were growing normally and exhibit extremely high resistance. The recommended dosage for field application of herbicide compound Bipyrazone was 4 g a. i.  / mu. The test result indicated that the edited lines with highly expressive HPPD new genes created through chromosome segment duplication exhibited herbicide resistance under field conditions under high light intensity in Hainan, and could withstand an herbicide dose that was 8 times the recommended field dose. The screening of stable resistant lines will provide basic materials for herbicide-resistant rice breeding.

[0837] Example 13: New gene creation activity of NLS-free Cas9 and separately expressed crRNA and tracrRNA in rice protoplast

[0838] Targets were chosen from upstream and downstream of the PPO1 gene to test whether chromosome fragment duplication events could be produced; furthermore, tests were performed on whether the nuclear localization signal with Cas9 removed could produce duplication event, and on whether replacing sgRNA (single guide RNA) with separated expression of crRNA and tracrRNA could induce cell targeted site editing to produce  chromosome fragment duplication events.

[0839] Dual-target editing vector pQY2648 was constructed by the method described in Example 1 for the selected target sequence design primers, i.e., OsPPO1-esgRNA3: 5’ taggtctccaaacATG GCGTTTTCTGTCCGCGTgcttcttggtgccgcg3' and OsPPO1-esgRNA2: 5’ TaggtctccggcgCAGTTGGATTAGGGAATATGGTTTAAGAGCTATGCTGGAAACAGC3'. The NLS signal peptides at both ends of SpCas9 wereremoved on the basis of pQY2648 to construct the NLS-free rice PPO1 dual-target editing vector pQY2650; the sgRNA expression cassette was modified based on pQY2650 and pQY2648; the fused Scaffold sequence was removed, and the crRNA and tracrRNA sequences were separately expressed. To be more specific, the OsU3 promoter drove the expression of OsPPO1-sgRNA2: 5'CAGTTGGATTAGGGAATATGGTTTAAGGCTATGCT3' crRNA sequence; the TaU3 promoter drove the expression of the OsPPO1-sgRNA3: 5' ACGCGGACAGAAAACGCCATGTTTAAGGCTATGC3' sequence; the OsU3 promoter drove the expression of the expression cassette of tracrRNA sequence 5'AGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT3'; the NLS-free crRNA rice PPO1 dual-target editing vector pQY2651 and the crRNA rice PPO1 dual-target editing vector pQY2653 containing NLS were constructed; the primers used during the process were as follows:

[0840] 2650F-BstBI: 5’gtacaaaaaagcaggcttcgaaATGgacaagaagtactcgatcggc3’

[0841] 2650R-SacI: 5’tgaacgatcggggaaattcgagctcCTAgtcgcccccgagctgag3’

[0842] OsU3-HindIII-For2651F: 5’GCAGGTCTCaagcttaaggaatctttaaacatacgaacag3’

[0843] CrRNA1-BsaI-R1:

[0844] 5’GCAGGTCTCCAGGTAAAAAAAAAAAGCATAGCCTTAAACCATATTCCCTAATCCAACTG3’

[0845] TaU3-BsaI-F2: 5’GCAGGTCTCCACCcatgaatccaaaccacacggag3’

[0846] CrRNA2-BsaI-R2:

[0847] 5’GCAGGTCTCGCTAGAAAAAAAAAAGCATAGCCTTAAACATGGCGTTTTCTGTCCGCGT3’

[0848] TraCrRNA-OsU3-BsaIF3: 5’GCAGGTCTCGCTAGaaggaatctttaaacatacgaac3’

[0849] TraCrRNA-KpnI-R3:

[0850] 5’GgtaccAAAAAAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTCGCCacggatcatctgcacaac3’,

[0851] For the above-mentioned 4 vectors, Example 1 was consulted to prepare the high-purity and high-concentration plasmids for PEG-mediated transformation of rice protoplast; the protoplast DNA was extracted for detection of edit duplication event; PCR primersto  amplifythe designed duplicated DNA at the junction regions weredesigned basedthe targeted cut sites on both sides, and then the PCR amplified fragments were sequenced; the primer sequences wereas follows:

[0852] OsPPO1Dup-testF1: CCACTGCTGCCACTTCCAC

[0853] OsPPO1Dup-testF2: GGCGACTTAGCATAGCCAG

[0854] OsPPO1Dup-testR1: GCTATTGCGGTGCGTATCC

[0855] OsPPO1Dup-testR2: TCCAAGCTAGGGGTGAGAGA

[0856] The test result was shown in Figure 27; chromosome fragment duplication events were detected through the sequencing of PCR products using primers OsPPO1Dup-testF2 or OsPPO1Dup-testR2 and DNA extracted from pQY2648, pQY2650, pQY2651 and pQY2653 transformed rice protoplast samples; small fragments of DNA were missing between two DNA break sites at the expected fragment junction regions. The protoplast test result of pQY2650 demonstrated that the Cas9 without NLS could cut the target effectively to produce and detected the doubling event of chromosome fragments between targeted cuts when chromosomes were edited with the dual-target editing vector. The result of pQY2653 protoplast test demonstrates that the assembled gRNA could effectively guide the target editing in the event of separately expressed crRNA and tracrRNA to produce and detect doubling event of chromosome fragments between targeted cutting sites. The pQY2651 protoplast test result demonstrated that NLS-free Cas9 could work with separately expressed crRNA and tracrRNA and the spontaneously assembled gRNA to effectively guide target editing to produce and detect doubling event of chromosome fragments between cuts, which indicated that the creation of new genes through doubling / duplication, inversion, or translocation of chromosome fragments using the method of the present invention was independent of the nuclear localization signal of Cas9 protein or the fused single guide RNA (sgRNA) system.

[0857] Example 14: Different chromosome fragment translocation and restructureto createa new HPPD gene in rice

[0858] As mentioned in example 1 and example 4, rice HPPD gene is located on chromosome 2, CP12 gene is located on chromosome 1 but in opposite direction. ThroughCRISPR / Cas9-mediated chromosome cutting andnaturally occurred inversion of CP12 and PPO1 gene protein coding regions-containing fragmentand followed by the chromosomalfragments fusion, a new gene was generated in which CP12 promoter drives PPO1 expression, andas expected PPO1 expression was significantly enhanced, and conferred rice plant herbicide resistance. Taking advantage of thehigh expression characteristics of the CP12 promoter, a dual-target editing vector was designed and constructed, which cut thetwo regions upstream two start codons ATGs. After Agrobacterium-mediatedtransformation and followed by selection and plant-regeneration, a  new HPPD gene in which CP12 promoter drives HPPD protein expression was identified through PCRand amplicon sequencing.

[0859] According to the analysis of rice gene expression profile data (http:  / / rice. plantbiology. msu. edu / index. shtml) provided by the international rice genome sequencing project (International Rice Genome Sequencing Project) , CP12 gene expression intensity isdozens to hundred times that of HPPD gene in rice leaf blade, CP12 gene promoter isstrong in leaf blades and seedlings.

[0860] With reference to example 1 and example 2, the related genomic DNA sequences of rice HPPD and CP12 genes were input into CRISPOR online tool (http:  / / crispor. tefor. net / ) to find and assess available edit targets. After online scoring, the following targets (5’-3’) were selected between the promoters and protein coding regions of HPPD and CP12 genes for testing:

[0861]

[0862] HPPD-guide RNA1 and HPPD-guide RNA2 are located between HPPD gene promoter and protein coding region and close to HPPD protein start codon ATG, while CP12-guide RNA1 and CP12-guide RNA2 are located between CP12 gene promoter and protein coding region and close to CP12 protein start codon ATG.

[0863] For the above-mentioned targets the following primersweredesigned and synthezed, the double-target editors pQY2257, pQY2258, pQY2259, pQY2260 were constructed with expectation ofthe editing eventsin whichCP12 promoter driving HPPD protein coding region could be identifiedafter transformation and selection with hyg, as shown in Figure 28.

[0864]

[0865] Wherein, guide RNA combinations in each editing vector:

[0866] pQY2257 contains the combination of HPPD-guide RNA1and CP12-guide RNA1,

[0867] pQY2258 contains the combination of HPPD-guide RNA1 and CP12-guide RNA2 combination,

[0868] pQY2259 contains the combination of HPPD-guide RNA2 and CP12-guide RNA1 combination,

[0869] pQY2260 contains the combination of HPPD-guide RNA2 and CP12-guide RNA2 combination.

[0870] With reference to the example 1 for rice protoplast transformation method, the above  pQY2257-2260 vectors with high purity and concentration of the plasmid DNA were prepared, and then the high-quality rice protoplast was prepared as well, PEG mediated transformation of the rice protoplast was carried out, and finally thegenome editing and the designed new gene wasexpected to be detected where CP12 promoter drives HPPD gene expression.

[0871] The following detecting primers, OsCP12pro-detection-F and OsHPPDutr-detection-R, were used to amplify the predicted fragment generated by the fusion of CP12 promoter and HPPD coding region, and the length of PCR amplicon was expected to be 305 bp. Similarly, OsHPPDpro-detection-F and OsCP12cds-detection-R were used to detect the fragment produced by the fusion of HPPD promoter and CP12 coding region, and the length of PCR products was expected to be 445bp.

[0872] Primer IDSequence (5' to 3')OsCP12pro-detection-FctgaggaggcgataagaaacgaOsHPPDutr-detection-RgtgtgggggagtggatgacOsHPPDpro-detection-FcaagagctttactccaagttaccOsCP12cds-detection-Racccgccctcggagttgg

[0873] The identification results showed that in pQY2257-transformed protoplastsamples were detected to have the CP12 promoter fused with the HPPD coding region, as shown in figure 29. Whilein the pQY2259-transformed protoplast samples were detected to have the HPPD promoter fused with the CP12 coding region, as shown in figure 30.

[0874] The above results show that, using the method described in this invention, can generaterecombination between two chromosome fragments derived from two different chromosomes, whichis expected to create the new genes as designed.

[0875] In this particular example, HPPD gene expression increasesdrivenby the strong promoter of CP12 gene, meanwhileCP12 gene expression decreases driven by the weak promoter of HPPD gene. Therefore, the expressionlevel of the new genes generated through this invention can be regulated as needed by choice of a strong or weak promoter.

[0876] Example 15: Creation of a newhigh-expression HPPD gene caused by chromosome fragment duplication mediated by LbCpf1 dual-target editing-rice protoplast test

[0877] LbCpf1 belongs to the Cas12a type of nucleases, recognizes a TTTV PAM site, and thus is suitable to edit a high AT-content DNA sequence; while Cas9 recognizes a NGGPAMsite and is suitable to edit a high GC-content DNA sequence. Therefore, the DNA scope of their editing ability is complementary to each other. In the rice protoplast system, the ability of LbCpf1 to cut and then induce the chromosome fragment to duplicate, i.e. to create a new HPPD gene was tested, as shown in the Figure 31.

[0878] With reference to Example 1, the pHUE411 vector (https:  / / www. addgene. org / 62203 / ) was used as the backbone, and the sgRNA expression cassette was removed by restriction enzyme digestion. The SV40 NLS-LbCpf1-nucleoplasmin NLS gene fragment synthesized in  GenScript Biotechnology Company (Nanjing, China) replaced the Cas9 CDS of pHUE411. At 338kb downstream of HPPD gene is a high-expression Ubi2 gene with a same expression orientation. Thus, a duplication strategy was used to increase the expression of HPPD, which confers resistance to HPPD inhibitor herbicides. To this end, acrRNA was designed in the upstream of the start codon of rice HPPD gene: 5'accccccaccaccaactcctccc3', and thesecond crRNA was designed in the upstream of the start codon of rice UBI2 gene: 5'ctatctgtgtgaagattattgcc3'. A tandem crRNA sequence was synthesized with HH ribozyme and HDV ribozyme recognition sites at both ends, as shown below:

[0879] 5’AAATTACTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCTAATTTCTACTAAGTGTAGATaccccccaccaccaactcctcccTAATTTCTACTAAGTGTAGATctatctgtgtgaagatt attgccTAATTTCTACTAAGTGTAGATGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGAC3’. It was connected to the end of LbCpf1 protein expression cassettein the vector according to the operating instructions of the Seamless Cloning Kit from HB-infusion Hanbio Biotechnology Co. Ltd. (Shanghai, China) . The maize UBI1 promoter was used to drive both Lbcpf1 protein and crRNA in the same expression cassette. This vector was named pQY2658.

[0880] With reference to Example 1, plasmidswithhigh-purityandhigh-concentrationwereprepared for PEG-mediated transformation of rice protoplasts. After 48-72 hr of transformation protoplast DNA was extractedfordetectingduplication-editing events. The primers fromboth sides of the targetswere designedto cover the duplicated area, and the target fragment was expected to be 494bp. The primer sequencesare:

[0881] Ubi2pro-Primer 5: gtagcttgtgcgtttcgatttg

[0882] HPPDcds-Primer 10: tcgacgtggtggaacgcgag

[0883] The PCR amplification of the DNA extracted from the pQY2658 transformed rice protoplasts forthe duplicated adapter fragments did produce bands with the expected size, and the sequencing result of the amplicon is consistent with the expected chromosome fragment duplicated adapter sequence. The sequencing result is shown in SEQ. No. 27.

[0884] The test results onprotoplasttransformed with pQY2658 proved that LbCpf1 nuclease can effectively cleave the target, generatethe detectableduplication of chromosome fragments between the targeted cut sites. It shows that the present invention can be used to create new genes through the duplication, inversion, or translocation of chromosome fragments, which can also be realized on the nuclease system of Cas12a.

[0885] Example 16: OsCATC gene connected to the chloroplast signal peptide domain through deletion of a chromosome segment

[0886] Three genes of rice, namely glycolate oxidase OsGLO3, oxalate oxidase OsOXO3 and catalase OsCATC, form a photorespiratory branch, which was referred to as GOC branch.  The glycolic acid produced by photorespiration could be directly catalyzed into oxalic acid in chloroplast and finally completely decomposed into CO2 by introducing the GOC branch into rice by transgene and locating it in the chloroplast, thereby creating a photosynthetic CO2 concentration mechanism similar to C4 plants, which helped improve the photosynthetic efficiency and yield of rice (Shen et al. Engineering a New Chloroplastic Photorespiratory Bypass to Increase Photosynthetic Efficiency and Productivity in Rice. Molecular Plant, 2019, 12 (2) : 199-214) .

[0887] By using the method presented by the invention, the protein domains of different genes could be recombined by non-transgenic method to add chloroplast signal domains to genes that required chloroplast localization. Primer OsCATC-sgRNA1: 5'gtcctggaacaccgccgcgg3' was designed at the end of the chloroplast signal peptide domain of LOC4331514 gene of upstream 28Kb of OsCATC gene; OsCATC-sgRNA2: 5'atcagccatggatccctaca3' was designed in the first five amino acid coding regions of OsCATC gene. The chloroplast signal peptide domain of LOC4331514 gene was expected to fuse with the coding region of OsCATC gene to produce a new CATC gene located in chloroplast after the removal of inter-target fragment. Dual-target editing vector pQY2654 was constructed by the method stated in Example 1, and the primers used were OsCATC-sgRNA1-For2654F: taggtctccggcggtcctggaacaccgccgcggGTTTAAGAGCTATGCTGGAAACAGC, and OsCATC-sgRNA2-For2654R: taggtctccaaactgtagggatccatggctgatgcttcttggtgccgcg.

[0888] High-purity and high-concentration plasmids were prepared for PEG-mediated transformation of rice protoplast; the protoplast DNA was extracted for detection of deletion edit event; detection primers were designed to extend the linker segment after the middle 28Kb chromosome segment deletion for the targets on both sides; sequencing was performed, and the primer sequences were shown below:

[0889] OsCATC-TestF: ccacaaaacgagtggctcag

[0890] OsCATC-TestR: gtgagcgagttgttgttgttcc

[0891] OsCATC-seqF: ctcttccctccactccactg

[0892] The test result was shown in Figure 32. The extraction of DNA from pQY2654 transformed rice protoplast could detect chromosome fragment deletion event through PCR amplification of the expected junction region after the targeted deletion, and then sequencing; the chloroplast signal peptide domain of LOC4331514 gene was fused with the coding region of OsCATC gene to create a new gene; the sequencing result was shown in SEQ ID No: 28. The protoplast test result of pQY2654 indicates that new genes combined from new protein domains could be created through the deletion of chromosome segments between different protein domains by using the method of the present invention.

[0893] Example 17: OsGLO3 gene connected to the chloroplast signal peptide domain  through inversion of a chromosome segment

[0894] As stated in Example 16, the OsGlO3 gene also needed to be heterotopically expressed in chloroplasts to improve the photosynthetic efficiency of rice. Hence, for the OsGLO3 gene, OsGLO3-gRNA1: 5'gtcctggaacaccgccgcgg3' was designed at the end of chloroplast signal peptide domain of the LOC4337056 gene of the upstream 69Kb, and OsGLO3-sgRNA2: 5'tgatgacttgagcagagaaa3' was designed in the initiation codon region of the OsCATC gene; the chloroplast signal peptide domain of the LOC4337056 gene was expected to fuse with the coding region of OsGLO3 gene to produce the new GLO gene located in chloroplast after the inversion of inter-target fragments. Dual-target editing vector pQY2655 was constructed as described in Example 1 using primers OsGLO3-sgRNA1-For2655F: taggtctccggcgcgatgcttggtggcaagtgcGTTTAAGAGCTATGCTGGAAACAGC and OsGLO3-sgRNA2-For2655R: taggtctccaaactttctctgctcaagtcatcagcttcttggtgccgcg. High-purity and high-concentration plasmids were prepared for PEG-mediated transformation of rice protoplast; the protoplast DNA was extracted for detection of inversion edit event; detection primers were designed to extend the linker segment after the middle 69Kb chromosome segment inversion for the targets on both sides; sequencing was performed, and the primer sequenceswere shown below:

[0895] OsGLO3-TestF1: cctccttgttcgtgttctccg

[0896] OsGLO3-TestF2: cggtcggttggttcatttcagg

[0897] OsGLO3-TestR1: catccagcagtgtgctaccag

[0898] OsGLO3-TestR2: cttgagaaggcctccctgttc

[0899] The test result was shown in Figure 33. The extraction of DNA from pQY2655 transformed rice protoplast could detect chromosome fragment inversion event through PCR amplification of the expected junction region after the targeted inversion, and then sequencing; the chloroplast signal peptide domain of LOC4337056 gene was fused with the coding region of OsCATC gene to create a new gene; the sequencing result was shown in SEQ ID NO: 29 The protoplast test result of pQY2655 indicated that new genes combined from new protein domains could be created through the inversion of chromosome segments between different protein domains by using the method of the present invention.

[0900] Example 18: Creation of Herbicide-resistant Rice through Knock-up of Endogenous PPO2 Gene Expression

[0901] The rice PPO2 gene was located on rice chromosome 4; bioinformatics analysis indicated that the S-adenosylmethionine decarboxylase (hereinafter referred as “SAMDC” ) gene was approx. 436kb downstream the PPO2 gene; the PPO2 gene and SAMDC gene had the same transcription direction on the chromosome. According to the analysis performed with the rice gene expression profile data (http:  / / rice. plantbiology. msu. edu / index. shtml)  from the International Rice Genome Sequencing Project, the expression intensity of SAMDC gene in rice leaves was tens to hundreds of times that of PPO2 gene; the promoter of SAMDC gene was a strong and constitutive express promoter.

[0902] For the rice PPO2 gene, the genomic DNA sequence of rice PPO2 and SAMDC was entered into the CRISPOR online tool (http:  / / crispor. tefor. net / ) respectively, to seek available edit targets following the procedures stated in Examples 1 and 2. Based on the online scoring, the following targets were selected for test between the promoter and CDS region of PPO2 and SAMDC genes:

[0903]

[0904] PPO2-guide RNA1 and PPO2-guide RNA2 were close to the initiation codon ATG of PPO2 between the promoter and CDS region of PPO2 gene, (i.e. 5’UTR) ; SAMDC-guide RNA1 and SAMDC-guide RNA2 were also close to the SAMDC protein initiation codon between SAMDC gene promoter and CDS region (i.e. 5’UTR) .

[0905] The following primers were designed for above-noted targets; dual-target edit vectors pQY1386 and pQY1387 were constructed, and the edit event of chromosome fragment duplication between two targeted cuts was expected to be achieved; the novel gene expressed by PPO2 CDS driven by SAMDC promoter was produced at the duplication fragment linker, as shown in Figure34.

[0906]

[0907] Wherein,

[0908] pQY1386 contains the combination of PPO2-guide RNA1 and SAMDC-guide RNA1

[0909] pQY1387 contains the combination of PPO2-guide RNA2 and SAMDC-guide RNA2.

[0910] Vector plasmids were extracted, and agrobacterium strain EHA105 was electrotransformed. Agrobacterium tumefaciens-mediated transformation was performed with rice variety Jinjing 818 as the receptor by the method stated in Example 2. Several rounds of callus identification were conducted during the transformation and selection, and positive calli of duplication events were selected for differentiation.

[0911] The detection primers in the table below were used to amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted SAMDC  promoter and PPO2 coding region; the length of PCR product was expected to be 300-1000 bp; the primer5-F+primer4-R combination was used to detect the fusion segment at the intermediate linker after chromosome fragment duplication; the predicted product length was 912 bp.

[0912]

[0913] According to the final identification result, duplication edit events were detected in QY1386 / 818-28#and QY1386 / 818-62#calli; the sequencing result at the duplication fragment linker was shown in SEQ ID NO: 30andSEQ ID NO: 31; The sequence alignment result was shown in Figure35; the result at #62 callus linker was exactly in line with expectations; seamless connection was observed, but duplication edit event was not detected in later differentiated seedlings.

[0914] Five duplication edit events were detected in the calli of QY1837; the sequencing results at the duplication fragment linker were shown inSEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36; some sequence alignment results were shown in Figure36.

[0915] Duplication events were detected in QY1837 differentiated seedlings; the results of the PCR amplified products and the sequencing at chromosome duplication linkers, PPO2 targets and SAMDC targets of some T0 seedlings were given below:

[0916]

[0917] The result of comparison of 1387 / 818-2 with the sequencing peak diagram was shown in Figure37; it was obvious that novel PPO2 gene expressed by PPO2 driven by SAMDC promoter developed in the genome; small fragments were deleted on both sides of the target, but this did not affect the integrity of CDS region reading frame.

[0918] Quantitative PCR detection of the relative expression of PPO2 gene was performed for T0-generation differentiated seedlings 1387 / 818-2, 1387 / 818-4 and 1387 / 818-6; the experiment operation was in line with Example 2; the quantitative PCR primer sequence was 5'-3' as follows:

[0919]

[0920] With UBQ5 as the internal control, the result was shown in Figure 35; compared with the wild-type rice Jinjing 818 control, the PPO2 gene expression of double-edited seedlings increases significantly, while SAMDC expression decreases relatively.

[0921] The herbicide resistance of T0 seedlings of 1387 / 818-2 and 1387 / 818-4 was preliminarily determined as stated in Example 6; wild-type Jinjing 818 seedlings with similar plant heights were taken as the control, and compound A was applied to them and T0 seedlings at the same time at a chemical concentration of 0.6 g a. i.  / mu; the culture temperature was kept at 28℃ on a 16 (light) + 8 (dark) basis; pictures were taken to record the results 7 days after application, as shown in Figure 36. The T0 seedlings of 1387 / 818-2 and 1387 / 818-4 were a little dried-up at the top, while a few drug spots appear on the leaf surface; the wild-type Jinjing 818 withered and died; the result indicated that the SAMDC promoter-driven high expression of PPO2 protein enables rice to resist PPO inhibitor herbicides.

[0922] Example 19: Creation of herbicide-resistant rice through knock-up expression of the endogenous OsPPO2 gene caused by CRISPR / Cas9targetedchromosome cutting and inversion afterAgrobacterium-mediated transformation

[0923] With reference to Example 4 to operateOsPPO2 gene, OsZFF (LOC_OS04G41560) , a highly expressed gene at 170kb downstream from OsPPO2 in the opposite direction, was selected to design two sgRNAs targeting in the regions close to the protein start codons ATGs, and a dual-target editing vector pQY2611 was constructed. Similarly, to increase the inversion probability, the downstream 40kb from OsPPO2 and highly expressed gene OsNPP (LOC_OS04G41340) in the opposite direction of OsPPO2 was also selected to design another two sgRNAs targeting in the regions close to the protein start codons ATGs, and another dual-target editing vector pQY2612 was constructed. The three selected targets were shown as the following table. It was expected that the editing could produce double-strand DNA cut and then the inversion of chromosome fragments between the targets to form a new gene with high expression of PPO2, respectively, as shown in Figure 40:

[0924]

[0925] The following primers were used to construct the vectors:

[0926]

[0927]

[0928] Wherein,

[0929] pQY2611 contains the combination of OsPPO2-guide RNA2 and 560-guide RNA3

[0930] pQY2612 contains the combination of OsPPO2-guide RNA2 and 340-guide RNA4

[0931] pQY2611 contains the combination of OsPO2-guide RNA2and560-guide RNA3

[0932] pQY2612 contains the combination of OsPO2-guide RNA2and340-guide RNA4

[0933] The vector plasmid was extracted and transformed into Agrobacterium tumefacien strain EHA105. The rice variety Jinjing 818 was used as the receptor for Agrobacterium-mediated transformation, and the transformation method was referred to Example 2. Several rounds of callus identification were carried out during the transformation-postselection process, and the callus with positive inversion events was selected for differentiation.

[0934] The detecting primers in the table below were used to amplify the fragments containing both target sites and the fused fragment betweenthe predicted 560 promoter and the PPO2 coding region. The length of the PCR amplicon was expected 300-1000 bp. Primer2-F +Primer12-R and Primer3-F + Primer10-R were used to detect fused fragments at the junction of OsZFF after chromosome fragmentation and then inversion, and the expected amplicon lengths were 512bp and 561bp, respectively. Similarly, Primer2-F + Primer6-R and Primer3-F + Primer7-R were used to detect the fused fragments at the junction of OSNPP after chromosome fragmentation and then inversion, and the expected amplicon lengths were 383bp and 666bp, respectively.

[0935]

[0936] The pQY2611-transformed calli were identified through PCR and amplicon sequencing. 292 samples were identified, 19 of which were positivefor the inversion. The identified inversion event genotypes were shown as following table:

[0937]

[0938]

[0939] The sequencing results of the OsZFF promoter fused with OsPPO2 CDS region were shown in Seq No. 37, Seq No. 38, Seq No. 39, Seq No. 40, Seq No. 41, Seq No. 42, Seq No.43. The alignment comparison results of 2611 / 818-10 and 2611 / 818-13 chromatogram peaks are shown in Figure 41. The events 2611 / 818-3, 2611 / 818-10, 2611 / 818-54 were differentiated further and obtained inversion positive T0 plants.

[0940] Similarly, pQY2612-transformed calli were identified for inversion events. A total of 577 callus samples were identified, and 45 callus samples were detected to be positive for the inversion. The genotypes of inversion events detected were shown as following table:

[0941]

[0942]

[0943] The sequencing results of the OsNPP promoter fused OSPPO2 CDS region were shown in Seq No. 44, Seq No. 45, Seq No. 46, and Seq No. 47. The sequencing results of events 2612 / 818-5 and 2611 / 818-34 and the chromatogrampeaks are shown in Figure 42.Eventually only event 2612 / 818-29 was differentiated successfully and obtained a positive T0 plant with desired inversion.

[0944] Example 20: Test on creation of novel PPO2 gene with maize protoplasts

[0945] As shown in Example 7, the gene distribution on chromosomes was collinear among different plants; the method for successful creation of novel genes like EPSPS, PPO1, PPO2 and HPPD in new mode of expression was versatile among other plant species. According to Example 18, novel PPO2 gene was created through the PPO2 gene selection in maize and the duplication of chromosome fragments between maize SAMDC genes, and then dual-target edit vectors were constructed for maize protoplast test.

[0946] The following targets were selected for test between the promoter and CDS region of PPO2 and SAMDC genes: ZmPPO2-sgRNA1: 5'ggatttgcttgttgtcgtgg3' was close to the initiation codon ATG of PPO2 protein between the promoter and CDS region of PPO2 gene (i.e. 5’UTR) . ZmSAMDC-sgRNA2: 5'gtcgattatcaggaagcagc3' and ZmSAMDC-sgRNA3: 5'acaatgctggagatggaggg3' were close to the SAMDC protein initiation codon ATG between the promoter and CDS region of SAMDC gene (i.e. 5’UTR) .

[0947] Dual-target edit vectors pQY1340 and pQY1341 were constructed using the following primers designed for above-noted targets.

[0948]

[0949] Wherein, pQY1340 contained ZmPPO2-sgRNA1 and SAMDC-sgRNA2 targets combination, while pQY1341 contained ZmPPO2-sgRNA1 and SAMDC-sgRNA3 targets combination.

[0950] High-concentration plasmids were prepared for above-noted vectors and used for the protoplast transformation in maize following the procedures stated in Example 1 for preparation and transformation of rice protoplasts; it was slightly different from rice in that a vacuum degree of 15 pa should be maintained for 30 minutes before enzymolysis so that the enzymatic hydrolysate contacts the cells more adequately; the maize variety used was B73.

[0951] The detection primers in the table below were used to amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted SAMDC promoter and PPO2 coding region; the length of PCR product was expected to be 300-1100  bp; the ZmSAMDC test-F1+ ZmPPO2 test-R2 combination was used to detect the fusion segment at intermediate linker after chromosome fragment duplication; the expected product length was approx. 597 bp; inner primer ZmSAMDC test-F2 was used for sequencing.

[0952]

[0953] 1%agarose gel electrophoresis test was performed for the PCR reaction product, and the result indicated that the predicted positive band (approx. 597 bp) into which the ZmSAMDC promoter and ZmPPO2 coding region were fused was detected in all pQY1340 and pQY1341 transformed maize protoplast samples. Positive fragments were sequenced, and the PPO2 duplication event sequencing result of pQY1340 vector transformed protoplast test was shown in SEQ ID NO: 48; the PPO2 duplication event sequencing result of pQY1341 vector transformed protoplast test was shown in SEQ ID NO: 49. The result of comparison with the sequence at predicted chromosome segment duplication linker was shown in Figure43, indicating that the SAMDC gene promoter and the PPO2 gene expression region can be linked up directly to create novel PPO2 gene with strong promoter-driven expression; thus, it's obvious that the method provided by the present invention for creating novel genes was also applicable to maize.

[0954] Example 21: Creation of novel PPO2 gene in wheat protoplast test

[0955] According to Example 18, in wheat the chromosome fragment region between PPO2 gene and SAMDC gene was selected for dual-target editing to create the novel gene expressed by PPO2 coding region driven by the SAMDC promoter. Wheat was hexaploid, so there were 3 sets of PPO2 genes and SAMDC genes in genomes A, B, and D. The TaPPO2-2A (TraesCS2A02G347900) gene was located at the wheat 2A chromosome, and the TaSAMDC-2A (TraesCS2A02G355400) gene was approx. 11.71Mb downstream; since the TaSAMDC-2A and TaPPO2-2A gene transcriptions are in opposite directions on the same chromosome, it's necessary to choose inversion editing strategy, as shown in Figure44; TaPPO2-2B (TraesCS2B02G366300) was located at the wheat 2B chromosome, and TaSAMDC-2B (TraesCS2B02G372900) was 9.5 Mb downstream; since TaSAMDC-2B and TaPPO2-2B gene expressions are in the same direction on the chromosome, the duplication editing strategy should be used, as shown in Figure45; TaPPO2-2D (TraesCS2D02G346200) was located at the wheat 2D chromosome, and TaSAMDC-2D (TraesCS2D02G352900) was 8.3 Mb downstream; since the TaSAMDC-2D and TaPPO2-2D gene transcriptions are in the same direction on the chromosome, the duplication edit event should be selected, as shown in Figure46.

[0956] The DNA sequence of wheat ABD gene group PPO2 and SAMDC gene was entered into the CRISPOR online tool (http:  / / crispor. tefor. net / ) respectively, to seek available edit targets. Based on the online scoring, the following targets were selected for test between the promoter and CDS region of PPO2 and SAMDC genes:

[0957]

[0958] 2A guide RNA1 and 2A guide RNA2 were close to the initiation codon of PPO2 protein between the promoter and CDS region of PPO2 gene (i.e. 5’UTR) ; 2A guide RNA3 and 2A guide RNA4 were close to the SAMDC protein initiation codon between SAMDC gene promoter and CDS region (i.e. 5’UTR) . 2B and 2D followed the same principle as above.

[0959] The following primers were designed for above-noted targets to construct the vector with pHUE411 vector (https:  / / www. addgene. org / 62203 / ) as the framework using the method presented in "Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29; 14 (1) : 327" .

[0960]

[0961]

[0962] The following dual-target combined gene edit vectors were constructed using the method described in the literature above. To be more specific, pCBC-MT1T2 plasmid (https:  / / www. addgene. org / 50593 / ) was used as template to amplify dual-target fragments sgRNA1+3, sgRNA1+4, sgRNA2+3 and sgRNA2+4 to construct the sgRNA expression cassettes. BsaI digests the pHUE411 vector framework, and the gel was recovered; the target fragment was used for ligation reaction directly after digestion. T4 DNA ligase was used to link up the vector framework and target fragment, and the ligation product was transformed to the Trans5α competent cell; different monoclonal sequences were selected; after the sequences were confirmed by sequencing to be correct, the Sigitech small-amount high-purity plasmid extraction kit was used to extract plasmids and attain recombinant plasmids, which were respectively named as pQY2626, pQY2627, pQY2628, pQY2629, pQY2630, pQY2631, pQY2632, pQY2633, pQY2634, pQY2635, pQY2636, and pQY2637 as follows:

[0963] pQY2626 contains the combination of 2A-guide RNA1 and 2A-guide RNA3

[0964] pQY2627 contains the combination of 2A-guide RNA1 and 2A-guide RNA4

[0965] pQY2628 contains the combination of 2A-guide RNA2 and 2A-guide RNA3

[0966] pQY2629 contains the combination of 2A-guide RNA2 and 2A-guide RNA4

[0967] pQY2630 contains the combination of 2B-guide RNA1 and 2B-guide RNA3

[0968] pQY2631 contains the combination of 2B-guide RNA1 and 2B-guide RNA4

[0969] pQY2632 contains the combination of 2B-guide RNA2 and 2B-guide RNA3

[0970] pQY2633 contains the combination of 2B-guide RNA2 and 2B-guide RNA4

[0971] pQY2634 contains the combination of 2D-guide RNA1 and 2D-guide RNA3

[0972] pQY2635 contains the combination of 2D-guide RNA1 and 2D-guide RNA4

[0973] pQY2636 contains the combination of 2D-guide RNA2 and 2D-guide RNA3

[0974] pQY2637 contains the combination of 2D-guide RNA2 and 2D-guide RNA4

[0975] High-concentration plasmids were prepared for above-noted vectors and used for the protoplast transformation in wheat following the procedures stated in Example 1 for preparation and transformation of rice protoplasts; it’s slightly different from rice that a vacuum degree of 15 pa should be maintained for 30 minutes before enzymolysis so that the enzymatic hydrolysate contacts the cells more adequately. The variety of wheat used was KN199; the seeds were from the Teaching and Research Office on Weeds, School of Plant Protection, China Agricultural University, and were propagated at our lab; the wheat seeds were sown in small pots for dark culture at 26℃ for approx. 10 d -15 d; stems and leaves of  the etiolated seedlings were used to prepare protoplasts.

[0976] The detection primers in the table below were used to PCR amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted SAMDC promoter and PPO2 coding region; the length of PCR product was expected to be 300-1100 bp; the ZmSAMDC test-F1+ ZmPPO2 test-R2 combination was used to detect the fusion segment at intermediate linker after chromosome fragment duplication; the PCR product length was expected to be 300-1100 bp; primer pair combinations TaSAMDCA-g600F&TaPPO2A+g480R, TaSAMDCB-g610F &TaPPO2B+g470R, and TaSAMDCD-g510F &TaPPO2D+g490R were respectively used to test the fusion segments at intermediate linker after the chromosome fragment duplication or inversion in the ABD genome; the product length was expected to be approx. 1 kb.

[0977]

[0978] 1%agarose gel electrophoresis test was performed for the PCR reaction product, and the result indicated that the predicted SAMDC promoter and the positive strip / band of approx. 1 kb in the PPO2 coding region fusion segment can be detected in the pQY2626 and PQY2627 transformed samples of the 2A genome, the pQY2630 and pQY2631 transformed samples of 2B genome, and the QY2634, pQY2635 and pQY2636 transformed samples of 2B genome.

[0979] PCR amplified positive fragments were sequenced, and the PPO2 inversion event sequencing result of pQY2626 vector transformed protoplast test was shown in SEQ ID NO: 50; the PPO2 inversion event sequencing result of PQY2627 vector transformed protoplast test was shown in SEQ ID NO: 51. The result of sequence comparison at inversion linker of predicted chromosome segment indicated that the TaSAMDC-2A gene promoter and the TaPPO2-2A gene expression region can be linked up directly to create novel PPO2 gene with strong promoter-driven expression.

[0980] The PPO2 duplication event sequencing result of pQY2630 vector transformed protoplast test was shown in SEQ ID NO: 52; the PPO2 duplication event sequencing result of pQY2631 vector transformed protoplast test was shown in SEQ ID NO: 53. The result of sequence comparison at duplication linker of predicted chromosome segment indicated that the TaSAMDC-2B gene promoter and the TaPPO2-2B gene expression region can be linked  up directly to create novel PPO2 gene with strong promoter-driven expression; the result of pQY2631 sequencing peak diagram comparison was shown in Figure45.

[0981] The PPO2 duplication event sequencing result of pQY2634 vector transformed protoplast test was shown in SEQ ID NO: 54; the PPO2 duplication event sequencing result of pQY2635 vector transformed protoplast test was shown in SEQ ID NO: 55. The PPO2 duplication event sequencing result of QY2636 vector transformed protoplast test was shown in SEQ ID NO: 56. The comparison with the predicted sequence at chromosome segment duplication linker indicated that TaSAMDC-2D gene promoter and TaPPO2-2D gene expression region can be linked up directly to create novel PPO2 gene with strong promoter-driven expression; the result of pQY2635 sequencing peak diagram comparison was shown in Figure46.

[0982] According to the results of these protoplast tests, novel PPO2 genes expressed by TaPPO2 driven by TaSAMDC promoter can also be created through chromosome segment inversion or duplication in wheat; therefore, it's obvious that the method presented in the present invention for creating new genes was also applicable to wheat.

[0983] Example 22: Creation of herbicide-resistant rape with knock-up endogenous PPO2 gene expression through agrobacterium tumefaciens-mediated transformation

[0984] Brassica napus was tetraploid, where the chromosome set was AACC; the redundancy between the A and C genomes enables the creation of new genes with different combinations of gene elements through the deletion or rearrangement of chromosome segments. To create a rape germplasm resistant to PPO inhibitor herbicides, the up-regulation of endogenous PPO gene expression was a feasible technical route. The analysis of the genomic data of rape C9 chromosome shows that the 30S ribosomal protein S13 gene (hereinafter referred as 30SR) was located at approx. 23 kb upstream the BnC9. PPO2; both were in the same direction for transcription on the same chromosome; the expression levels of rape 30SR and BnC9. PPO2 in various tissues in rapeseed were analyzed with BrassicaEDB database (https:  / / brassica. biodb. org / ) ; 30SR and BnC9. PPO2 were principally expressed in leaves, and the expression level of 30SR was significantly higher than that of BnC9. PPO2; the PPO2 protein expression level was expected to rise when the novel gene expressed by BnC9. PPO2 CDS driven by 30SR promoter was created by deleting the chromosome segment between 30SR promoter and BnC9. PPO2 CDS; in that way, rape gained herbicide tolerance.

[0985] Targets available were identified by finding the information on C9 chromosome of transformed receptor rape variety Westar at the rape database website (http:  / / cbi. hzau. edu. cn / bnapus / ) ; a total of 6 targets were selected:

[0986]

[0987] Wherein, guide RNA1, guide RNA2 and guide RNA3 were close to the initiation codon  ATG of 30SR protein between the promoter and CDS region of 30SR gene (i.e. 5’UTR region) ; guide RNA4, guide RNA5 and guide RNA6 were close to the BnC9. PPO2 protein initiation codon ATG between BnC9. PPO2 gene promoter and CDS region (i.e. 5’UTR region) .

[0988] With reference to Example 1, the edit vectors of different target combinations, namely pQY2533, pQY2534, pQY2535 and pQY2536 were constructed with pHSE401 vector as the framework; where:

[0989] pQY2533 contains the combination of guide RNA1 and guide RNA4

[0990] pQY2534 contains the combination of guide RNA2 and guide RNA5

[0991] pQY2535 contains the combination of guide RNA3 and guide RNA6

[0992] pQY2536 contains the combination of guide RNA1 and guide RNA5

[0993] Vector plasmids were extracted, and agrobacterium strain GV3101 was electrotransformed. Agrobacterium tumefaciens-mediated transformation was performed with rape variety Westar as receptor using the method below:

[0994] ① Sowing: Seeds were soaked in 75%alcohol for 1 min, disinfected with 10%sodium hypochlorite solution for 9 min, washed 5 times with sterile water, sown into M0 medium, and cultured in darkness at 24℃ for 5-6 days.

[0995] ② Preparation of agrobacterium: 3 mL of liquid LB medium was transferred into the sterile tube; the solution with agrobacterium was subjected to shake culture in a 200-rpm shaker at 28℃ for 20-24h. The solution with bacteria was incubated for 6-7h in the LB culture medium. The cultured bacteria solution was poured into a 50 mL sterile centrifuge tube; the tube was centrifuged for 5 min at 6000 rpm; the supernatant was discarded, and a moderate amount of DM suspension was added; the solution was shaken well and the OD600 value of infecting bacteria solution was set to approx. 0.6-0.8.

[0996] ③ Infection and co-cultivation of explants: The prepared infecting bacteria solution was activated on ice, while the hypocotyls of seedlings cultured in darkness were cut off vertically with sterile forceps and scalpel; the cut-off explant was infected for 12 minutes in a dish, which was shaken every 6 min during infection; the explants were transferred to sterile filter paper after infection, and the excess infection solution was sucked out; then, the explants were placed in M1 culture medium and co-cultured at 24℃ for 48h.

[0997] ④ Callus induction: After the co-culture, the explants were transferred to M2 culture medium, where callus was induced for 18-20 days; the culture conditions: Light culture at 22-24℃; light for 16 hrs  / dark for 8 hrs. The conditions for differentiation culture and rooting culture were the same as the present stage.

[0998] ⑤ Induced germination: The callus was transferred to M3 culture medium for differentiation culture, and succession was performed every 14 days until germination.

[0999] ⑥ Rooting culture and transplantation: After the buds were differentiated to see obvious growth points, the buds were carefully cut off from the callus with sterile forceps and scalpel; the excess callus was removed as much as possible, and then the buds were transferred to M4 medium for rootage. Rooted plants were transplanted into the culture soil; T1-generation seeds were achieved through bagged selfing of the T0-generation regenerated plants.

[1000] The formula of culture medium used during the process was as follows:

[1001] Sowing culture medium M0

[1002]

[1003] DM transform buffer solution

[1004]

[1005] Co-culture medium M1

[1006]

[1007] Screening medium M2

[1008]

[1009] Differential medium M3

[1010]

[1011] Rooting medium M4

[1012]

[1013] After the emergence of seedlings, leaves were taken from T0 seedlings for molecular identification. The detection primers in the table below were used to amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted 30SR promoter and BnC9. PPO2 coding region; where klenow fragment was removed, the PCR product length should be approx. 700 bp.

[1014]

[1015] 363 T0 seedlings from the transformation of the four vectors were tested; Klenow fragment deletion event was observed in 18 plants; the probability of Klenow fragment deletion varied depending on target combination; even the same target combination may bring about different probabilities of Klenow fragment deletion; pQY2534 vector offered the highest probability (10.96%) , while pQY2535vector offered the lowest probability (2%) ; the average probability was on the order of 5.56%.

[1016] Analysis of the sequencing result of 18 individual plants with positive knocked out: The sequencing results of 10 individual plants showed seamless Klenow fragment deletion between two targets; homozygous seamless knockout occurred in QY2533 / w-7, and heterozygous knockout occurred in the other 9 plants; compared with the expected sequence after deletion, the insertion or deletion of small fragments of base was observed in 8 individual plants; up to 32 bases were deleted in the 30SR promoter region, and this was not  expected to affect the promoter activity; homozygous knockout was observed in QY2533 / w-36, QY2533 / w-42, QY2535 / w-32 and QY2536 / w-124; the details of result were as follows:

[1017]

[1018] The sequencing result showed that the 30SR promoter can be directly connected with the BnC9. PPO2 CDS region to create novel PPO2 gene with strong promoter-driven expression after the deletion of inter-target sequence. The sequencing results of the 30SR promoter fused BnC9. PPO2 CDS region were shown in Seq No. 57, Seq No. 58, Seq No. 59, Seq No. 60, and Seq No. 61.

[1019] T0 seedling test result indicated that the method presented in the present invention enabled the creation of novel genes expressed by the BnC9. PPO2 CDS region driven by the 30SR promoter; so, it's obvious that the way presented in the present invention to create new  genes was also applicable to rape. The results of test on rice, corn, wheat, arabidopsis thaliana, and rape demonstrate that the method provided by the present invention was designed for purposeful precise creation of novel genes with combinations of different gene elements or different protein domains in both monocotyledons and dicotyledons.

[1020] Example 23: Creation of Rice Blast Resistance through knock-up Expression of an Endogenous Gene OsWAK1

[1021] OsWAK1 is a novel functional protein kinase. It was reported that overexpression of the OsWAK1 gene can confer resistance to rice blast (Li et al. A novel wall-associated receptor-like protein kinase gene, OsWAK1, plays important roles in rice blast disease resistance. Plant Mol Biol, 2009, 69: 337-346) . The OsWAK1 gene locates on rice chromosome 1. Through bioinformatics analysis, it was found that LOC_Os01g044350 (hereinafter referred to as 44350) gene, which is highlyexpressed in rice, locates about 26 kb upstream of OsWAK1 gene, and the 44350 gene and the OsWAK1 gene are in the opposite direction on the chromosome. The 44350 gene promoter can be used for inversion to increase the expression of OsWAK1 gene. Similarly, BBTI12 (MSU ID: LOC_Os01g04050) , which is highlyexpressed in rice, locates about 206 kb upstream of OsWAK1 gene, and the BBTI12 gene and the OsWAK1 gene are in the same direction on the chromosome. The BBTI12 gene promoter can be used for duplication to increase the expression of OsWAK1 gene.

[1022] Similarly, the dual-target combination OsWAK1ts2: 5’TTCAGCTAGCTGCTACACAA 3’ and 44350ts2: 5’ TAGAAGCTTTGATGCTTGGA 3’, was used to construct the duplication editing vector pQY1085. The construction primers used were bsaI-OsWAK1 5'UTR ts2-F:

[1023] 5’AATGGTCTCAggcATTCagctagctgctacacaaGTTTAAGAGCTATGCTGGAAACAGCAT3’ and bsaI-44350 5'UTR ts2-R:

[1024] 5’AATGGTCTCAAAACTCCAAGCATCAAAGCTTCTAgcttcttggtgccgcgc 3’.

[1025] Similarly, the dual-target combination OsWAK1ts2: 5’ TTCAGCTAGCTGCTACACAA 3’ and BBTI12ts2: 5’ CAAGTAGAGGAAATAGCTCA 3’ was used to construct the duplication editing vector pQY1089. The construction primers used were bsaI-OsWAK1 5'UTR ts2-F:

[1026] 5’AATGGTCTCAGGCATTCAGCTAGCTGCTACACAAGTTTAAGAGCTATGCTGGAAACAGCAT3’ and bsaI-BBTI12 5'UTR ts2-R:

[1027] 5’AATGGTCTCAAAACTGAGCTATTTCCTCTACTTGGCTTCTTGGTGCCGCGC 3’.

[1028] The above two plasmids were extracted to transform Agrobacterium sp. EHA105., The recipient rice variety Jinjing 818 was transformed through Agrobacterium-mediated transformation and the transformation method was referenced to Example2. During the transformation process, genotype identification at the junction regions was performed on the  rice calli, and the inversion or duplication event-positive calli were selected to enter the differentiation stage for regeneration of seedlings.

[1029] For pQY1085 transformed rice calli, the primer44350tsdet-F+primerOsWAK1tsdet-F combination was used to detect the fusion fragment at the middle joint after the inversion of the chromosome fragment, and the PCR product length was expected to be 713 bp.

[1030] Primer IDSequences (5' to 3')44350tsdet-FCGATCGATTCATCGAGAGGGCT44350tsdet-RATCACCAGCACGTTCCCCTCOsWAK1TSDET-FTTTTGTGTGCCGCGACGAATGAGOsWAK1TSDET-RCATAACGCTGTCGACAATTGACCTG

[1031] For pQY1089 transformed rice calli, the primerOsWAK1tsdet-F+primerBBTI12tsdet-R combination was used to detect the fusion fragment at the middle joint after the duplication of the chromosome fragment, and the PCR product length was expected to be 837 bp.

[1032] Primer IDSequences (5' to 3')BBTI12tsdet-FTTTTCTTTTGCAACAGCAGCAAAGATTBBTI12tsdet-RAGGGTACATCCTAGACGAGTCCAAGOsWAK1tsdet-FTTTTGTGTGCCGCGACGAATGAGOsWAK1tsdet-RCATAACGCTGTCGACAATTGACCTG

[1033] The above two vectors were referred to in Example 2 for Agrobacterium-mediated transformation of rice callus. After the callus was identified, the inversion or duplication event-positive calli were differentiated, and eventually positive edited seedlings were obtained. The results of molecular identification are shown in the Figure47. As shown, the pQY1085-transformed seedlings were detected to identifythe inversion editing events in which the Os01g044350 promoter drives the OsWAK1 gene expression and thus a new OsWAK1 gene was formed. The representative sequences of the sequenced inversion events, QY1085 / 818-57, QY1085 / 818-107, QY1085 / 818-167, QY1085 / 818-23are shown in SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 65andSEQ ID NO: 66.

[1034] As shown in the Figure 48, the pQY1089-transformed seedlings were detected to identify theduplication editing events in which the BBTI12 promoter drives the OsWAK1 gene expression and another new OsWAK1 gene was also formed. The representative sequences of the sequenced duplication events, QY1089 / 818-595, QY1089 / 818-321, QY1089 / 818-312 are shown in SEQ ID NO: 63, SEQ ID NO: 67and SEQ ID NO: 68.

[1035] Example 24: Creation of blast-resistant rice through knock-up expression of endogenous OsCNGC9 gene in rice

[1036] The cyclic nucleotide-gated channels (CNGCs) gene family encodes a set of non-specific, Ca2+ permeable cation channels. It was reported that overexpression of the OsCNGC9 gene can confer resistance to rice blast (Wang et al. A cyclic nucleotide-gated  channel mediates cytoplasmic calcium elevation and disease resistance in rice. Cell Research, 2019, epub) . The OsCNGC9 gene locates on rice chromosome 9. Through bioinformatics analysis, it was found that LOC_Os09g39180 (hereinafter referred to as 39180) gene, which is highly expressed in rice, locates about 314 kb downstream of OsCNGC9 gene, and the 39180 gene and the OsCNGC9 gene were in the opposite direction on the same chromosome. The 39180 gene promoter can be used for inversion to increase the expression of OsCNGC9 gene. In addition, LOC_Os09g39390 (hereinafter referred to as 39390) , which is highly expressed in rice, locates about 456 kb downstream of OsCNGC9 gene, and the 39390 gene and the OsCNGC9 gene were in the same direction on the same chromosome. The 39390 gene promoter can be used for duplication to increase the expression of OsCNGC9 gene.

[1037] The dual-target combination OsCNGC9ts1: 5’ ACAGCAAGATTTGGTCCGGG 3’ and 39180ts1: 5’ ATGGAATGGAAGAGAATCGA 3’ was used to construct the inversion editing vector pQY1090. The construction primers used were bsaI-OsCNGC9 5'UTR ts1-F:

[1038] 5’ AATGGTCTCAGGCAACAGCAAGATTTGGTCCGGGGTTTAAGAGCTATGCTGGAAACAGCAT3’ and bsaI-39180

[1039] 5'UTR ts1-R: 5’ AATGGTCTCAAAACTCGATTCTCTTCCATTCCATGCTTCTTGGTGCCGCGC 3’.

[1040] The dual-target combination OsCNGC9ts1: 5’ ACAGCAAGATTTGGTCCGGG 3’ and 39390ts1: 5’ CTACTGGCCTCGATTCGTCG 3’ was used to construct the duplication editing vector pQY1094. The construction primers used were bsaI-OsCNGC9 5'UTR ts1-F:

[1041] 5’ AATGGTCTCAGGCAACAGCAAGATTTGGTCCGGGGTTTAAGAGCTATGCTGGAAACAGCAT3’ and bsaI-39390

[1042] 5'UTR ts1-R: 5’ AATGGTCTCAAAACCGACGAATCGAGGCCAGTAGGCTTCTTGGTGCCGCGC 3’.

[1043] The above two plasmids were extracted to transform Agrobacterium sp. EHA105., The recipient rice variety Jinjing 818 was transformed through Agrobacterium-mediated transformation and the transformation method was referenced to Example2. During the transformation process, molecular identification was performed on the rice calli, and the inversion or duplication event-positive calli were selected to enter the differentiation stage and regeneration of seedlings.

[1044] For pQY1090 transformed calli, the primer39180tsdet-R+ primerOsCNGC9tsdet-R combination was used to detect the fusion fragment at the middle joint after the inversion of the chromosome fragment, and the PCR product length was expected to be 778 bp.

[1045] Primer IDSequences (5' to 3')OsCNGC9tsdet-FACATCTCATGTGCAAGATCCTAGCAOsCNGC9tsdet-RAAACTGGTCCTGTCTCTCATCAGGA39180tsdet-FTGGCTCAGCGAAGTCGAGC39180tsdet-RCATGGTTGAACTGTCATGCTAATCAGT

[1046] For pQY1094 transformed calli, the primer3390tsdet-F3+ primerOsCNGC9tsdet-R combination was used to detect the fusion fragment at the middle joint after the duplication of the chromosome fragment, and the PCR product length was expected to be 895 bp.

[1047] Primer IDSequences (5' to 3')OsCNGC9tsdet-FACATCTCATGTGCAAGATCCTAGCAOsCNGC9tsdet-RAAACTGGTCCTGTCTCTCATCAGGA39390tsdet-F3TACTACAGCCTTTGCCTTTCACGGTTC39390tsdet-RGTCTGCCACATGCCGTTGAG

[1048] The above two vectors were referred to in Example 2 for Agrobacterium-mediated transformation of rice callus. After the callus was identified, the inversion or duplication event-positive calli were differentiated, and finally positive edited seedlings were obtained. Sequencing results prove thatthe pQY1090 transformed seedlings were detected to identify the inversion edited events in which the LOC_Os09g39180 promoter drives the OsCNGC9 gene expression and thus a new OsCNGC9 gene was formed. The representative sequences of the sequenced inversion events QY1090 / 818-192, QY1090 / 818-554 and QY1090 / 818-541, are shown in SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71.

[1049] Sequencing results prove that the pQY1094 transformed seedlings were detected to identify duplication edited events in which the LOC_Os09g39390 promoter drives the OsCNGC9 gene expression and thus another new OsCNGC9 gene was also formed. The representative sequence of the sequenced duplicated event QY1094 / 818-202 are shown in SEQ ID NO: 72.

[1050] Example 25: Pig IGF2 gene expression knock-up

[1051] IGF-2 (Insulin-like growth factor 2) is one of three protein hormones that have similar structure with insulin. IGF2 is secreted by the liver and circulates in the blood. It has the activity of promoting mitosis and regulating growth.

[1052] TNNI2 and TNNT3 encode muscle troponin I and troponin T, respectively, and they are the core components of muscle fibers. These two protein coding genes are constitutively and highly expressed in muscle tissue. Therefore, using the promoters of these two genes to drive the expression of IGF2 gene is expected to significantly increase its expression in muscle cells and promote growth. Since the directions of these two genes are opposite to IGF2 on the same chromosome, knock-up of IGF2 could be achieved by promoters exchange through chromosome segmentsinversion.

[1053] The experiment procedure was...

Claims

1.A method for creating a new gene in an organism, characterized by comprising the following steps:simultaneously generating DNA breaks at two or more different specific sites in the organism’s genome, wherein the specific sites are genomic sites capable of separating different genetic elements or different protein domains, and the DNA breaks are ligated to each other by a non-homologous end joining (NHEJ) or homologous repair, generating a new combination of the different genetic elements or different protein domains different from the original genomic sequence, thereby creating the new gene; ora method for in vivo creation of new genes that can be stably inherited in an organism, characterized by comprising the following steps:(1) simultaneously generating double-stranded DNA breaks at two or more different specific sites in the organism’s genome, wherein the specific sites are capable of separating different gene elements or different protein domains, and the DNA breaks are then ligated to each other by a non-homologous end joining (NHEJ) or homologous repair, generating a new combination or assemble of the different gene elements or different protein domains derived from the original genomic sequence, thereby the new gene is generated;preferably, it also includes (2) designing primer pairs that can specifically detect the above-mentioned new combination or assemble, then cells or tissues containing the new genes can be screened out by PCR test, and the characteristic sequences of new combinations of gene elements can be determined by sequencing; and(3) cultivating the above-screened cells or tissues to obtain T0 generation organisms, and perform PCR tests and sequencing on the organisms for two consecutive generations including the T0 generation and its bred T1 or at least three consecutive generations to select the organisms containing the above-mentioned characteristic sequence of new combination of gene elements, namely, a new gene that can be stably inherited has been created in the organism;optionally, it also includes (4) testing the biological traits or phenotypes related to the function of the new gene, to determine the genotype that can bring beneficial traits to the organism, and to obtain a new functional gene that can be stably inherited.2.The method according to claim 1, wherein in the step (1) , DNA breaks are simultaneously generated at two different specific sites in the genome of the organism, wherein one site is the genomic locus between the promoter region and the coding region of a gene, meanwhile, the other site is between the promoter region and the coding region of another gene with different expression patterns, resulting in a new combination of the promoter of one gene and the coding region of the other gene that has a different expression pattern; preferably, a combination of the strong promoter and the gene of interest is eventually produced.3.The method according to claim 1, wherein in the step (1) , DNA breaks are simultaneously generated at three different specific sites in the genome of the organism, the  three specific sites include two genomic sites whose combination capable of cutting off the promoter region of a highly expressed gene and the third genomic site between the coding region and the promoter region of the gene of interest that has a different expression pattern; or a genomic site between the promoter region and the coding region of a highly expressed gene and another two genomic sites whose combination capable of cutting off the coding region fragment of the gene of interest that has a different expression pattern; then through gene editing at the above-mentioned sites, translocation editing events can be generated, in which the strong promoter fragment that is inserted upstream of the coding region of the gene of interest, or the coding region fragment of the gene of interest is inserted the downstream of the promoter of another highly expressed gene, finally, the combination of the promoter of one gene and the coding region of the other gene of interest with different expression patterns is generated.4.The method according to any one of claims 1-3, characterized in that said two or more different specific sites locate on the same chromosome or on different chromosomes; preferably, said two or more different specific sites may be specific sites on at least two different genes, or may be at least two different specific sites on the same gene; and said at least two different genes may have the same or different transcription directions.5.The method according to any one of claims 1-4, characterized in that said gene elements are selected from the group consisting of a promoter, a 5' untranslated region, a coding region or non-coding RNA region, a 3' untranslated region, a terminator of the gene, or any combination thereof.6.The method according to any one of claims 1-5, characterized in that the combination of different gene elements is a combination of the promoter of one of the two genes with different expression patterns and the coding region or the non-coding RNA region of the other gene, or the combination of different gene elements is a combination of the region from the promoter to 5'UTR of one of the two genes with different expression patterns and the CDS or non-coding RNA region of the other gene, or the combination of different gene elements is a combination of adjacent gene elements of the same gene; preferably, the different expression patterns are different levels of gene expression, different tissue-specific of gene expression, or different developmental stage-specificities of gene expression.7.The method according to any one of claims 1-4, characterized in that the protein domain is a DNA fragment corresponding to a specific functional domain of a protein; preferably including but not being limited to a nuclear localization signal, a chloroplast leading peptide, a mitochondrial leading peptide, a phosphorylation site, a methylation site, a transmembrane domain, a DNA binding domain, a transcription activation domain, a receptor activation domain, or an enzyme catalytic center.8.The method according to any one of claims 1-4 and 7, characterized in that the combination of different protein domains is a combination of the localization signal region of one of two proteins with different subcellular localizations and the mature protein coding region of the other gene, or a combination of two protein domains with different biological functions, or a combination of adjacent protein domains of the same gene; preferably, the different subcellular  locations are selected from the group consisting of nuclear location, cytoplasmic location, cell membrane location, chloroplast location, mitochondrial location, and endoplasmic reticulum membrane location; preferably, the different biological functions are selected from the group consisting of recognition of specific DNA or RNA conserved sequence, activation of gene expression, binding to a protein ligand, binding to small molecular signal, binding to an ion, specific enzymatic reaction, and any combination thereof.9.The method according to any one of claims 1-5 and 7, characterized in that the combination of gene elements and protein domains are a combination of protein domains and adjacent promoters, 5'UTR, 3'UTR or terminators of the same gene.10.The method according to any one of claims 1-9, characterized in that the organism is a non-human animal, a plant or a fungus.11.The method according to claim 1, characterized in that the combination of different gene elements is selected from any of the following:(1) one element is a plant endogenous strong promoter or the region from a strong promoter to 5’UTR, and the other is the HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST, SPS, cellulose synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein phosphatase or lycopene cyclase gene coding region of the same plant;(2) one element is an endogenous strong promoter or the region from a strong promoter to 5’UTR of the organism, and the other is a gene coding region of any one of the P450 family in the same organism;(3) one element is a rice or maize endogenous strong promoter or the region from a strong promoter to 5’ UTR, and the other is a gene coding region of OsCYP81A gene or ZmCYP81A9 gene in the same organism;(4) one element is a maize endogenous strong promoter or the region from a strong promoter to 5’UTR, and the other is the coding region of maize gene ZMM28 (Zm00001d022088) , ZmKNR6 or ZmBAM1d;(5) one element is a rice endogenous strong promoter or the region from a strong promoter to 5’UTR, and the other is the coding region of rice gene COLD1 or OsCPK24;(6) one element is an endogenous strong promoter or the region from a strong promoter to 5’UTR of the organism, and the other is a gene coding region of any one of the ATP-binding cassette (ABC) transporter family in the same organism;(7) one element is a plant endogenous strong promoter or the region from a strong promoter to 5’UTR of the plant, and the other is a gene coding region of any one of the NAC transcription factor family (for example, OsNAC045, OsNAC67, ZmSNAC1, OsNAC006, OsNAC42, OsSNAC1 or OsSNAC2) in the same plant;(8) one element is a plant endogenous strong promoter or the region from a strong promoter to 5’UTR, and the other is the gene coding region of any one of MYB, MADS, DREB and bZIP transcription factor family in the same plant;(9) one element is the promoter of any one of overexpression or tissue-specific expression  rice genes listed in Table A, and the other is the protein coding region or the non-coding RNA region of another gene that is different from the selected promoter corresponding to the rice gene;(10) one element is a protein coding region or non-coding RNA region selected from any one of the biological functional genes listed in Table B to K, and the other is the promoter region of another gene that is different from the selected functional gene of the biological genome corresponding to the selected gene;(11) one element is an endogenous strong promoter or the region from a strong promoter to 5’UTR of the organism, and the other is a gene coding region of any one of the GST (glutathione-s-transferases) family in the same organism;(12) one element is a wheat or maize endogenous strong promoter or the region from a strong promoter to 5’ UTR of the organism, and the other is a gene coding region of wheat GST Cla47 (AY064480.1) gene, wheat GST 19E50 (AY064481.1) , wheat GST28E45 (AY479764.1) , maize ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI, maize GSTIII, maize GSTIV, maize GST5 or maize GST7 gene in the same organism;(13) one element is an rice endogenous strong promoter or the region from a strong promoter to 5’ UTR of the organism, and the other is the coding region of any one of gene protein in rice GIF1 (Os04g0413500) , NOG1 (Os01g075220) , LAIR (Os02g0154100) , OSA1 (Os03g0689300) , OsNRT1.1A (Os08g0155400) , OsNRT2.3B (Os01g0704100) , OsRac1 (Os01g0229400) , OsNRT2.1 (Os02g0112100) , OsGIF1 (Os03g0733600) , OsNAC9 (Os03g0815100) , CPB1 / D11 / GNS4 (Os04g0469800) , miR1432 (Os04g0436100) , OsNLP4 (Os09g0549450) , RAG2 (Os07g0214300) , LRK1 (Os02g0154200) , OsNHX1 (Os07t0666900) , GW6 (Os06g0623700) , WG7 (Os07g0669800) , D11 / OsBZR1 (Os04g0469800, Os07g0580500) , OsAAP6 (Os07g0134000) , OsLSK1 (Os01g0669100) , IPA1 (Os08g0509600) , SMG11 (Os01g0197100) , CYP72A31 (Os01g0602200) , SNAC1 (Os03g0815100) , ZBED (Os01g0547200) , OsSta2 (Os02g0655200) , OsASR5 (Os11g0167800) , OsCPK4 (Os02g03410) , OsDjA9 (Os06g0116800) , EUI (Os05g0482400) , JMJ705 (Os01g67970) , WRKY45 (Os05t0322900) , OsRSR1 (Os05g0121600) , OsRLCK5 (Os01g0114100) , APIP4 (Os01g0124200) , OsPAL6 (Os04t0518400) , OsPAL8 (Os11g0708900) , TPS46 (Os08t0168000) , OsERF3 (Os01g58420) and OsYSL15 (Os02g0650300) ;(14) one element is a fish endogenous strong promoter, and the other is a gene coding region of GH1 (growth hormone 1) in the selected fish.12.A new gene created by the method according to claim 11, characterized in that the new genes formed by any one of the combinations of the different gene elements (1) - (14) respectively have the following characters:(1) the level of the new gene expression is up-regulated relative to the plant endogenous wild-type HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST, SPS, cellulose synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein phosphatase or lycopene cyclasegenes gene;(2) the level of the new gene expression is up-regulated relative to the corresponding endogenous wild-type P450 gene of the organism;(3) the level of the new gene expression is up-regulated relative to the rice endogenous OsCYP81A6 gene or corn endogenous ZmCYP81A9 gene, respectively;(4) the level of the new gene expression is up-regulated relative to the plant endogenous wild-type ZMM28 gene, ZmKNR6 gene or ZmBAM1d gene, respectively;(5) the level of the new gene expression is up-regulated relative to the rice endogenous wild-type COLD1 gene or OsCPK24, respectively;(6) the level of the new gene expression is up-regulated relative to the corresponding endogenous wild-type ATP-binding cassette (ABC) transporter gene of the organism;(7) the level of the new gene expression is up-regulated relative to the corresponding plant endogenous wild-type NAC transcription factor family gene;(8) the level of the new gene expression is up-regulated relative to the corresponding plant endogenous wild-type MYB transcription factor gene, MADS transcription factor family gene, DREB transcription factor family gene coding region or bZIP transcription factor family gene, respectively;(9) the expression pattern of the new gene is changed relative to the selected protein coding region or the non-coding RNA region of the rice endogenous gene;(10) the expression pattern of the new gene is changed relative to the selected functional gene;(11) the level of the new gene expression is up-regulated relative to the corresponding endogenous GST (glutathione-s-transferases) family gene of the organism;(12) the level of the new gene expression is up-regulated relative to the endogenous wheat GST Cla47 (AY064480.1) gene, wheat GST 19E50 (AY064481.1) , wheat GST28E45 (AY479764.1) , maize ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI, maize GSTIII, maize GSTIV, maize GST5 or maize GST7 gene, respectively;(13) the level of the new gene expression is up-regulated relative to the corresponding endogenous gene;(14) the new gene is a fish endogenous high expression GH1 gene.13.Use of the new gene obtainable by the method according to any one of claims 1-11 in the field of animal and plant breeding.14.Use of the new gene according to claim 12 in the following aspects, respectively:(1) in the improvement of the resistance or tolerance to a corresponding inhibition of HPPD, inhibition of EPSPS, inhibition of PPO, inhibition of ALS, inhibition of ACCase, inhibition of GS, inhibition of PDS, inhibition of DHPS, inhibition of DXPS, inhibition of HST, inhibition of SPS, inhibition of cellulose synthesis, inhibition of VLCFAS, inhibition of fatty acid thioesterase, inhibition of serine threonine protein phosphatase or inhibition of lycopene cyclase herbicide in a plant cell, a plant tissue, a plant part or a plant;(2) in enhancing biological detoxification capability, stress tolerance or secondary metabolic ability;(3) in the improvement of the resistance or tolerance of rice or corn to a herbicide;(4) in the improvement of maize yield;(5) in the improvement of cold tolerance in rice;(6) in enhancing biological detoxification capability or stress tolerance;(7) in enhancing plant stress tolerance or plant yield;(8) in enhancing plant stress tolerance or regulating plant growth and development;(9) in regulating the growth and development of rice;(10) in regulating the growth and development of organism;(11) in enhancing biological detoxification capability or stress tolerance;(12) in the improvement of the resistance or tolerance of wheat or maize to a herbicide;(13) in rice breeding;(14) in fish breeding.15.The method according to claim 1, characterized in that the combination of different protein domains is selected from any of the following:(a) one element is a wheat endogenous protein chloroplast localization signal domain, and the other is a wheat mature protein coding region of cytoplasmic localization phosphoglucose isomerase (PGIc) ;(b) one element is a rice protein chloroplast localization signal domain (CTP) , and the other is the mature protein coding region of OsGLO3, OsOXO3 or OsCATC.16.A new gene created by the method according to claim 15, characterized in that the new genes formed by any one of the combinations of the different protein domains (a) - (b) respectively have the following characters:(a) the new gene locates the phosphoglucose isomerase gene relative to the coding cytoplasm and its mature protein is located in the chloroplast.(b) the mature protein of the new gene is located in chloroplast different from OsGLO3, OsOXO3 or OsCATC.17.Use of the new gene according to claim 16 in the following aspects, respectively:(a) in the improvement of wheat yield;(b) in improving the photosynthetic efficiency of rice.18.A chloroplast localized protein OsCACT, the nucleotide encoding the protein has a sequence selected from the group consisting of:(1) the nucleic acid sequence as shown in SEQ ID NO: 28 or a portion thereof or a complementary sequence thereof;(2) asequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.19.A chloroplast localized protein OsGLO3, the nucleotide encoding the protein has a sequence selected from the group consisting of:(1) the nucleic acid sequence as shown in SEQ ID NO: 29 or a portion thereof or a complementary sequence thereof;(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.20.Use of the protein according to claim 18 or 19 inimproving the photosynthetic efficiency of rice.21.An editing method for regulating the gene expression level of a target endogenous gene in an organism, which is independent of an exogenous DNA donor fragment, which comprises the following steps:simultaneously generating DNA breaks separately at selected sites between the promoter and the coding region of each of the target endogenous gene and an optional endogenous inducible or tissue-specific expression gene with a desired expression pattern; ligating the DNA breaks to each other by means of non-homologous end joining (NHEJ) or homologous repair, thereby generating an in vivo fusion of the coding region of the target endogenous gene and the optional inducible or tissue-specific expression promoter to form a new gene with expected expression patterns, the target endogenous gene and the optional endogenous inducible or tissue-specific expression gene with a desired expression pattern are located on the same chromosome or on different chromosomes; preferably, the target endogenous gene is yeast ERG9 gene, the endogenous inducible expression gene is HXT1 gene, and the inducible expression promoter is HXT1 in response to glucose concentration.22.A yeast endogenous inducible ERG9 gene obtainable by the editing method according to claim 21.23.Use of the yeast endogenous inducible ERG9 gene in synthetic biology according to claim 22.24.A highly-expressing rice endogenous HPPD gene, which has a sequence selected from the group consisting of:(1) the nucleic acid sequence as shown in SEQ ID NO: 27 or a portion thereof or a complementary sequence thereof;(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.25.A highly-expressing rice endogenous PPO2 gene, which has a sequence selected from the group consisting of:(1) the nucleic acid sequence as shown in SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO:  37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46 or SEQ ID NO: 47 or a portion thereof or a complementary sequence thereof;(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.26.A highly-expressing maize endogenous PPO2 gene, which has a sequence selected from the group consisting of:(1) the nucleic acid sequence as shown in SEQ ID NO: 48 or SEQ ID NO: 49 or a portion thereof or a complementary sequence thereof;(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.27.A highly-expressing wheat endogenous PPO2 gene, which has a sequence selected from the group consisting of:(1) the nucleic acid sequence as shown in SEQ ID NO: 50, SEQ ID NO: 5, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55 or SEQ ID NO: 56 or a portion thereof or a complementary sequence thereof;(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.28.A highly-expressing oilseed rape endogenous PPO2 gene, which has a sequence selected from the group consisting of:(1) the nucleic acid sequence as shown in SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60 or SEQ ID NO: 61 or a portion thereof or a complementary sequence thereof;(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.29.Use of the gene according to any one of claims 24-28 in the improvement of the  resistance or tolerance to a corresponding inhibitory herbicide in a plant cell, a plant tissue, a plant part or a plant.30.A plant or a progeny derived therefrom regenerated from the plant cell which comprises the gene (1) (3) or (12) described in claim 12 or according to any one of claims 24-28.31.A method for producing a plant with an increased resistance or tolerance to an herbicide, which comprises regenerating the plant cell which comprises the gene (1) (3) or (12) described in claim 12 or according to any one of claims 24-28 into a plant or a progeny derived therefrom; preferably, the plant with an increased resistance or tolerance to an herbicide is a non-transgenic strain obtainable by crossing a plant regenerated from the plant host cell with a wild-type plant to remove the exogenous transgenic components through genetic segregation.32.A rice resistant to a herbicide, which comprises one or a combination of two or more of the rice new gene (3) described in claim 12, the highly-expressing rice endogenous HPPD gene according to claim 24, and the highly-expressing rice PPO2 gene according to claim 25; preferably the rice is non-transgenic.33.A maize, wheat or oilseed rape resistant to a herbicide, which comprises one or a combination of two or more of the maize new gene (3) described in claim 12, the wheat or maize new gene (12) described in claim 12, the highly-expressing maize PPO2 gene according to claim 26, the highly-expressing wheat PPO2 gene according to claim 27, and the highly-expressing oilseed rape PPO2 gene according to claim 28; preferably the maize, wheat or oilseed rape is non-transgenic.34.A method for controlling a weed in a cultivation site of a plant, wherein the plant is selected from the group consisting of a plant prepared by the method according to claim 31, wherein the method comprises applying to the cultivation site one or more corresponding inhibitory herbicides in an amount for effectively controlling the weed.35.The use according to claim 14 or 29, the method according to claim 31 or 34, characterized in that the herbicide comprises one or a combination of two or more ofinhibition of HPPD, inhibition of EPSPS, inhibition of PPO, inhibition of ALS, inhibition of ACCase, inhibition of GS, inhibition of PDS, inhibition of DHPS, inhibition of DXPS, inhibition of HST, inhibition of SPS, inhibition of cellulose synthesis, inhibition of VLCFAS, inhibition of fatty acid thioesterase, inhibition of serine threonine protein phosphatase or inhibition of lycopene cyclase herbicides.36.An editing method for knocking up the expression of an endogenous WAK gene or CNGC gene in a plant, characterized in that it comprises fusing the coding region of the WAK gene or CNGC gene with a strong endogenous promoter of a plant in vivo to form a new highly-expressing plant endogenous WAK gene or CNGC gene, respectively; preferably, it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the WAK gene or CNGC gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the WAK gene or CNGC gene and the optional strong endogenous promoter to form a new  highly-expressing WAK gene or CNGC gene.37.A highly-expressing plant endogenous WAK gene or CNGC gene obtainable by the editing method according to claim 36.38.A highly-expressing rice WAK gene, which has a sequence selected from the group consisting of:(1) the nucleic acid sequence as shown inSEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67 or SEQ ID NO: 68 or a portion thereof or a complementary sequence thereof;(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.39.A highly-expressing rice CNGC gene, which has a sequence selected from the group consisting of:(1) the nucleic acid sequence as shown inSEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 or SEQ ID NO: 72 or a portion thereof or a complementary sequence thereof;(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%or at least 99%to any one of the sequences as defined in (1) ; or(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.40.Use of the gene according to claim 38 or 39 in conferring or improving a resistance to rice blast in a rice.41.A rice resistant to rice blast, which comprises one or a combination of two or more of the highly-expressing rice WAK gene according to claim 38, and the highly-expressing rice CNGC gene according to claim 39; preferably the rice is non-transgenic.42.An editing method for knocking up the expression of an endogenous GH1 gene in a fish, characterized in that it comprises fusing the coding region of the GH1 gene with a strong endogenous promoter of a fish in vivo to form a new highly-expressing fish endogenous GH1 gene; preferably, it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the GH1 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the GH1gene and the optional strong endogenous promoter to form a new highly-expressing GH1 gene; the strong promoter is preferably the corresponding fish ColIA1a (Collagen type I alpha 1a) gene promoter, RPS15A (ribosomal protein S15a) gene promoter, Actin promoter or DDX5 [DEAD (Asp-Glu-Ala-Asp) box helicase 5] gene promoter.43.An editing method for knocking up the expression of an endogenous IGF2 (Insulin-like  growth factor 2) gene in a pig, characterized in that it comprises fusing the coding region of the IGF2 gene with a strong endogenous promoter of a pig in vivo to form a new highly-expressing pig endogenous IGF2 gene; preferably, it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the IGF2 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the IGF2 gene and the optional strong endogenous promoter to form a new highly-expressing IGF2 gene; the strong promoter is preferably one of the pig TNNI2 and TNNT3 gene promoter.44.An editing method for knocking up the expression of an endogenous IGF1 (Insulin-like growth factor 1) gene in a chicken embryo fibroblast, characterized in that it comprises fusing the coding region of the IGF1 gene with a strong endogenous promoter of a chicken in vivo to form a new highly-expressing chicken endogenous IGF1 gene; preferably, it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the IGF1 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the IGF1 gene and the optional strong endogenous promoter to form a new highly-expressing IGF1 gene; the strong promoter is preferably chicken MYBPC1 (myosin binding protein C) gene promoter.45.A highly-expressing fish endogenous GH1 gene, a highly-expressing pig endogenous IGF2 gene or a highly-expressing chicken endogenous IGF1 gene obtainable by the editing method according to claim 42, 43 or 44.46.Use of the highly-expressing fish endogenous GH1 gene, the highly-expressing pig endogenous IGF2 gene or the highly-expressing chicken endogenous IGF1 gene according to claim 45 in the corresponding biological breeding, respectively.47.An editing method for knocking up the expression of an endogenous EPO (Erythropoietin) or p53 gene in an animal cell, characterized in that it comprises fusing the coding region of the EPO or p53 gene with a strong endogenous promoter of an animal in vivo to form a new highly-expressingendogenous EPO or p53 gene; preferably, it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the EPO or p53 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the EPO or p53 gene and the optional strong endogenous promoter to form a new highly-expressing EPO or p53 gene.48.A highly-expressing animal endogenous EPO or p53 gene obtainable by the editing method according to claim 47.49.Use of the highly-expressing animal endogenous EPO gene according to claim 48 in  animal breeding or the highly-expressing animal endogenous p53 gene according to claim 48 in animal breeding or cancer prevention.50.The method according to any one of claims 1-11, 21, 36, 42-44 and 47, characterized in that said DNA breaks are achieved by delivering a nuclease with targeting property into a cell of the organism to contact with the specific sites of the genomic DNA; preferably, said nuclease with targeting property is selected from the group consisting of Meganuclease, Zinc finger nuclease, TALEN, and CRISPR / Cas system (such as Cas9 nuclease system or Cas12 nuclease system) ; more preferably, the nuclease with targeting property exists in the form of DNA, or in the form of mRNA or protein, but not DNA.51.The method according to claim 50, characterized in that the nucleases with targeting property are delivered into the cell by: 1) a PEG-mediated cell transfection method; 2) a liposome-mediated cell transfection method; 3) an electric shock transformation method; 4) a microinjection; 5) a gene gun bombardment; 6) an Agrobacterium-mediated transformation method; 7) viral vector-mediated transformation method; or 8) nanomagnetic bead mediated transformation method.52.A DNA containing the gene according to any one of claims 12, 16, 22, 24-28, 37-39, 45 and 48.53.A protein encoded by the gene according to any one of claims 12, 16, 22, 24-28, 37-39, 45 and 48, or a biologically active fragment thereof.54.A recombinant expression vector, which comprises the gene according to any one of claims 12, 16, 22, 24-28, 37-39, 45 and 48 and a promoter operably linked thereto.55.An expression cassette comprising the gene according to any one of claims 12, 16, 22, 24-28, 37-39, 45 and 48.56.A host cell, which comprises the expression cassette according to claim 55; which is preferably a plant cell, an animal cell or a fungal cell.57.An organism regenerated from the host cell according to claim 56.58.A composition, which comprises:(a) a promoter of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene;(b) a promoter to a 5' untranslated region of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene;(c) a localization signal region of one of the two protein coding genes with different subcellular localizations and a mature protein coding region of the other gene;(d) DNA regions coding two different functional domains that come from two different functional protein-coding genes; wherein, the combination of gene elements said is not naturally exist, but a joined chromosome segment as designed and stable inheritance;preferably, which is fused in vivo; more preferably, the different expression patterns are different levels of gene expression, different tissue-specific of gene expression, or different developmental stage-specificities of gene expression; or the different subcellular locations are selected from the group consisting of nuclear location, cytoplasmic location, cell membrane location, chloroplast location, a mitochondrial location, an endoplasmic reticulum membrane  location, and any combination thereof; or the different biological functions are selected from the group consisting of recognition of specific DNA or RNA conserved sequence, activation of gene expression, binding to protein ligand, binding to small molecular signal, binding to an ion, specific enzymatic reaction, and any combination thereof.