Methods and uses associated with liquid compositions

Abstract

Methods, systems, and uses for providing a lipid nanoparticle composition with advantageous nanoparticle properties are provided.

Description

[0001] Title

[0002] Methods and uses associated with liquid compositions

[0003] Background

[0004] The present disclosure relates to improvements associated with liquid compositions, in particular lipid nanoparticle compositions and their manufacture.

[0005] Nucleic acids represent an important therapeutic modality. Lipid nanoparticle technologies have proven to be particularly useful for the delivery of nucleic acid therapeutics, specifically including RNA therapeutics or DNA therapeutics, such as mRNA therapeutics (RNA = ribonucleic acid, mRNA = messenger RNA, DNA = deoxyribonucleic acid).

[0006] Hence, providing lipid nanoparticle compositions comprising or consisting of lipid nanoparticles (LNPs) is a key aspect for nucleic acid therapeutics. Properties of the LNPs which are provided may influence the stability or quality of the therapeutic or intermediate products and / or have decisive influences on the yield during the production process.

[0007] It is an aim of the present disclosure to provide improvements associated with liquid compositions, particularly associated with lipid nanoparticle technology, e.g. associated with the method of forming, providing, or producing lipid nanoparticle compositions. The improvements may relate to the method of providing or producing liquid compositions, e.g. lipid nanoparticle compositions, as such, to components, e.g. components configured to be used in the method or configured to be used in the method, to uses associated with the method and / or preparations, e.g. comprising lipid nanoparticles, such as lipid nanoparticle compositions obtainable or obtained with the method.

[0008] These and / or other aims are achieved by subject-matter disclosed herein and / or by subject-matter set forth in the appended independent claims as will become apparent from the following description.

[0009] Advantageous embodiments and refinements, inter alia, are subject to dependent claims.

[0010] Summary

[0011] One aspect of the present disclosure relates to a method of forming, providing or producing a liquid composition, e.g. by mixing a first liquid and a second liquid. Another aspect of the present disclosure relates to a use of a mixing component for forming, providing or producing a liquid composition, e.g. by mixing a first liquid and a second liquid and / or with the method(s) described herein. Yet another aspect of the present disclosure relates to a preparation comprising lipid nanoparticles, e.g. particles of the liquid composition obtainable or obtained with the method and / or with the use of the mixing component. The preparation may be the liquid composition or be obtained or obtainable from the liquid composition.

[0012] It is noted that features which are disclosed herein in connection with the method also apply for the use and features which are disclosed herein for the use also apply for the method. In general, features disclosed in connection with different aspects, examples or embodiments can be combined with one another, even if such a combination is not explicitly described herein. Unless expressly stated otherwise, features disclosed herein above and below apply for all aspects, examples or embodiments of the disclosure, e.g. for the method and the use. Features relating to the liquid composition or the components, methods or uses associated therewith also apply for the preparation and vice versa.

[0013] In an embodiment, the method and / or the use comprises:

[0014] - guiding a first flow of a first liquid along a first flow path into a mixing chamber, e.g. a region in the mixing component,

[0015] - guiding a second flow of a second liquid along a second flow path into the mixing chamber;

[0016] - mixing the first liquid and the second liquid in the mixing chamber for the liquid composition, e.g. to form or provide the liquid composition.

[0017] In an embodiment, the liquid composition is a lipid nanoparticle (LNP) composition. The composition expediently comprises lipid nanoparticles, e.g. within a carrier liquid, such as a liquid comprising water and / or ethanol.

[0018] In an embodiment, the liquid composition is a nucleic acid-LNP composition, e.g. an RNA-LNP composition or a DNA-LNP composition.

[0019] In an embodiment, the mixing chamber is provided in a mixing component, the mixing component having a first inlet in fluid communication with the mixing chamber and a second inlet in fluid communication with the mixing chamber. The first and second inlets may be fluidically separated from one another. Thus, the first and second liquid may be separated from one another until they meet in the mixing chamber. The mixing chamber may be that region of the mixing component where the two liquids meet.

[0020] In an embodiment, the mixing chamber and / or the mixing component has an outlet. The outlet of the mixing chamber may be a passage where the liquid composition flow, after mixing, enters a section of a flow path or conduit with constant cross sectional area or diameter. The cross sectional area (or cross section) may be less than or equal to the (maximum, minimum and / or average) cross sectional area or diameter of the mixing chamber. The outlet of the mixing component may be the passage to a region of the flow path of the liquid composition downstream of the mixing chamber where the cross section or diameter of the flow path increases (e.g. as compared to the outlet of the mixing chamber). Alternatively or additionally the outlet of the mixing component may be located at an interface between the mixing component and another component, e.g. a tubing. The cross section or diameter of the outlet of the mixing component may be equal to the cross section of the outlet of the mixing chamber. The flow path from the mixing chamber outlet to the mixing component outlet may have a constant cross section or diameter.

[0021] In an embodiment, the method is performed such that the flow of the liquid composition away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of less than or equal to 10000 and / or greater than or equal to 800.

[0022] In an embodiment, the mixing component is used to provide a liquid composition, e.g. a lipid nanoparticle (LNP) composition, by mixing a first liquid and a second liquid in a mixing chamber of the mixing component. The mixing component may be used to provide a liquid flow, e.g. away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component, with a Reynolds number of greater than or equal to 800 and / or less than or equal to 10000 at an outlet of the mixing chamber or of the mixing component. The liquid flow may be a flow of the liquid composition.

[0023] Reynolds numbers are used to classify a liquid flow. The Reynolds number R of a liquid flow can be calculated by using the following formula:

[0024] R = V * D / Vis _kin, where V is the velocity of the liquid flow in m / s (meters per second), D is a characteristic distance (e.g. the diameter of the flow path guiding the liquid flow, e.g. the inner diameter of a conduit) in m (meter) and Vis_kin is the kinematic viscosity in m2 / s. The kinematic viscosity results from the (dynamic) viscosity (Vis_dyn) of the liquid in Pascal seconds, Pa s, divided by the density D_L of the liquid, e.g. in kg / m3. The velocity V can be derived from the flow rate (e.g. specified in ml / min, i.e. milliliters per minute) by dividing the flow rate by the cross-sectional area of the flow path guiding the liquid flow. The cross section is taken perpendicular to the flow direction. For a circular cross-section the cross-sectional area is (ID / 2)2* n, with ID being the inner diameter of the flow path, e.g. of an outlet, conduit or tubing.

[0025] For determining the Reynolds number of the liquid composition flow away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component characteristic values of the first and second liquids can be used (if applicable weighted with a factor determining the contribution of the flow rate of the first and second liquid into the mixing chamber to the total flow rate of the first and second liquids). Thus, the respective Reynolds number for the liquid composition flow discussed herein may relate to Reynolds numbers based on values for the relevant quantities which are calculated as set forth below or based on values for the relevant quantities which have been measured.

[0026] For the liquid composition, i.e. after the liquids have been mixed, the Reynolds number may be calculated by using:

[0027] V = (F_l + F_2) / ((D / 2)2* it), with

[0028] D being the inner diameter of the flow path at the relevant location, e.g. at the outlet of the mixing chamber or of the mixing component,

[0029] F_1 being the flow rate of the first liquid into the mixing chamber, and

[0030] F_2 being the flow rate of the second liquid into the mixing chamber (the sum of F_1 and F_2_being the flow rate of the liquid composition at the outlet of the mixing chamber).

[0031] Vis_dyn = F_1 / (F_l + F_2) * Vis_l + F_21 (F_l + F_2) * Vis_2, with

[0032] Vis_l being the (dynamic) viscosity of the first liquid, Vis_2 being the dynamic viscosity of the second liquid.

[0033] D_L = F_1 / (F_l + F_2) * D_1 + F_2 / (F_l + F_2) * D_2, with

[0034] D_1 being the density of the first liquid

[0035] D_2 being the density of the second liquid

[0036] Vis_kin = Vis_dyn / D_L

[0037] The Reynolds number then results from:

[0038] R = V * D / Vis_kin Reynolds numbers are dimensionless quantities. The Reynolds number can be used to qualify a liquid flow without having to specify dimensions of the conduit or other values which are characteristic for the flow like the flow rate, viscosity, density, etc..

[0039] When investigating the formation of LNPs, particularly nucleic acid-LNPs, by mixing two liquids it has been found that having a flow of the liquid composition after the liquids have been mixed with a Reynolds number of less than or equal to 10000 (which is a flow which is turbulent but not yet too turbulent to form advantageous lipid nanoparticles) and / or of greater than or equal to 800 (which is a laminar flow) results in nanoparticles with advantageous properties. For example, nanoparticles in the LNP composition with particular low average diameters (e.g. lower than particles formed under equivalent conditions with a flow having higher Reynolds numbers) and / or with low polydispersity index can be provided when staying below 10000.

[0040] The inventors attribute the positive effects for the nanoparticles to the liquid composition flow having Reynolds numbers less than 10000 and / or greater than 800 (e.g. right after the mixing of the first and second liquids, such as in the mixing chamber, at the outlet of the mixing chamber or at the outlet of the mixing component and / or before another substance is being added to the composition) when the mixture is in a state in which the nanoparticles are being formed from ingredients of the first liquid and the second liquid or the formation is being initiated. Having the liquid flow during the (initial) formation stage of the nanoparticles in the specified Reynolds number range resulted in the formation of advantageous nanoparticles.

[0041] Reynolds numbers of 2000 and above or 2500 and above, e.g. up to 4000, 5000, 6000 or 6500, 7000, 8000 or 8500, may characterize liquid flow in a transitional regime between laminar flow and turbulent flow or mildly turbulent flow (usually the transition region between laminar and turbulent flow is around 2500). A Reynolds number of 800 characterizes a laminar flow. 10000 characterizes a turbulent but not yet very turbulent flow. Hence, the range of 800 to 10000 covers laminar flow as well as its transition to turbulent and mild turbulent flow. In some embodiments, the liquid flow after mixing is maintained in the relevant Reynolds number range or the Reynolds number is changed after the outlet, e.g. due to an increase in diameter.

[0042] In an embodiment, the method and / or the use is performed such that the flow of the liquid composition away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of less than or equal to any one of the following: 9950, 9900, 9850, 9800, 9750, 9700, 9650, 9600, 9550, 9500, 9450, 9400, 9350, 9300, 9250, 9200, 9150, 9100, 9050, 9000, 8950, 8900, 8850, 8800, 8750, 8700, 8650, 8600, 8550, 8500, 8450, 8400, 8350, 8300, 8250, 8200, 8150, 8100, 8050, 8000, 7950, 7900, 7850, 7800, 7750, 7700, 7650, 7600, 7550, 7500, 7450, 7400, 7350, 7300, 7250, 7200,

[0043] 7150, 7100, 7050, 7000, 6950, 6900, 6850, 6800, 6750, 6700, 6650, 6600, 6550, 6500, 6450, 6400, 6350,

[0044] 6300, 6250, 6200, 6150, 6100, 6050, 6000, 5950, 5900, 5850, 5800, 5750, 5700, 5650, 5600, 5550, 5500,

[0045] 5450, 5400, 5350, 5300, 5250, 5200, 5150, 5100, 5050, 5000, 4950, 4900, 4850, 4800, 4750, 4700, 4650,

[0046] 4600, 4550, 4500, 4450, 4400, 4350, 4300, 4250, 4200, 4150, 4100, 4050, 4000, 3950, 3900, 3850, 3800,

[0047] 3750, 3700, 3650, 3600, 3550, 3500, 3450, 3400, 3350, 3300, 3250, 3200, 3150, 3100, 3050, 3000, 2950,

[0048] 2900, 2850, 2800, 2750, 2700, 2650, 2600, 2550, 2500, 2450, 2400, 2350, 2300, 2250, 2200, 2150, 2100,

[0049] 2050, 2000, 1950, 1900, 1850, 1800, 1750, 1700, 1650, 1600, 1550, 1500, 1450, 1400, 1350, 1300, 1250,

[0050] 1200, 1150, 1100, 1050, 1000, 950, 900, 850.

[0051] In an embodiment, the method and / or the use is performed such that the flow of the liquid composition away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of greater than or equal to any one of the following: 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900,

[0052] 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750,

[0053] 2800, 2850, 2900, 2950, 3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600,

[0054] 3650, 3700, 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450,

[0055] 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950, 5000, 5050, 5100, 5150, 5200, 5250, 5300,

[0056] 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 5950, 6000, 6050, 6100, 6150,

[0057] 6200, 6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000,

[0058] 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450, 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850,

[0059] 7900, 7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700,

[0060] 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550,

[0061] 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950.

[0062] As noted above, Reynolds numbers below 10000 and / or above 800 (or any other sub-range thereof between 800 to 10000 formed from the disclosed values) can yield advantageous lipid nanoparticles.

[0063] In an embodiment, the method and / or the use is performed such that the flow of the liquid composition away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between any one of the following Reynolds number pairs: 800 and 8500, 800 and 6500, 800 and 5000, 1000 and 8500, 1000 and 6500, 1000 and 5000, 2000 and 8500, 2000 and 6500, 2000 and 5000, 3000 and 8500, 3000 and 6500, 3000 and 5000, 4000 and 8500, 4000 and 6500, 4000 and 5000.

[0064] In an embodiment, the first liquid and / or the second liquid is guided into the mixing chamber and / or into the mixing component with a flow rate of greater than or equal to any one of the following: 10 ml / min, 20 ml / min, 30 ml / min, 40 ml / min, 50 ml / min, 60 ml / min, 70 ml / min, 80 ml / min, 90 ml / min, 100 ml / min, 110 ml / min, 120 ml / min, 130 ml / min, 140 ml / min, 150 ml / min, 160 ml / min, 170 ml / min, 180 ml / min, 190 ml / min, 200 ml / min, 210 ml / min, 220 ml / min.

[0065] In an embodiment, the first liquid and / or the second liquid is guided into the mixing chamber and / or into the mixing component with a flow rate of less than or equal to any one of the following: 660 ml / min, 650 ml / min, 640 ml / min, 630 ml / min, 620 ml / min, 610 ml / min, 600 ml / min, 590 ml / min, 580 ml / min, 570 ml / min, 560 ml / min, 550 ml / min, 540 ml / min, 530 ml / min, 520 ml / min, 510 ml / min, 500 ml / min, 490 ml / min, 480 ml / min, 470 ml / min, 460 ml / min, 450 ml / min, 440 ml / min, 430 ml / min, 420 ml / min, 410 ml / min, 400 ml / min, 390 ml / min, 380 ml / min, 370 ml / min, 360 ml / min, 350 ml / min, 340 ml / min, 330 ml / min, 320 ml / min, 310 ml / min, 300 ml / min, 290 ml / min, 280 ml / min, 270 ml / min, 260 ml / min, 250 ml / min, 240 ml / min, 230 ml / min, 220 ml / min, 210 ml / min, 200 ml / min, 190 ml / min, 180 ml / min, 170 ml / min, 160 ml / min, 150 ml / min, 140 ml / min, 130 ml / min, 120 ml / min, 110 ml / min, 100 ml / min, 90 ml / min, 80 ml / min, 70 ml / min, 60 ml / min, 50 ml / min, 40 ml / min, 30 ml / min, 20 ml / min, 10 ml / min.

[0066] Thus, the flow rate of the first liquid and / or the flow rate of the second liquid may be between 10 and 660 ml / min. Arbitrary sub-ranges may be formed by the disclosed values.

[0067] In an embodiment, the flow may be driven by an associated flow driver, e.g. a pump. One flow driver may be assigned to each liquid, i.e. the first liquid or the second liquid. The liquid composition may be driven by the flow drivers in combination.

[0068] In an embodiment, the flow rate with which the first liquid is guided or driven into the mixing chamber is different from, e.g. greater than, the flow rate with which the second liquid is guided or driven into the mixing chamber. The ratio between the flow rate of the first liquid and the flow rate of the second liquid may be less than or equal to any one of the following: 5, 4, 3. The ratio may be greater than 1 or greater than 2, e.g. 3.

[0069] In an embodiment, the liquid composition is guided or driven away from the mixing chamber and / or leaves the mixing chamber or the mixing component via the respective outlet with a flow rate of greater than or equal to any one of the following: 10 ml / min, 20 ml / min, 30 ml / min, 40 ml / min, 50 ml / min, 60 ml / min, 70 ml / min, 80 ml / min, 90 ml / min, 100 ml / min, 110 ml / min, 120 ml / min, 130 ml / min, 140 ml / min, 150 ml / min, 160 ml / min, 170 ml / min, 180 ml / min, 190 ml / min, 200 ml / min, 210 ml / min, 220 ml / min, 230 ml / min, 240 ml / min, 250 ml / min, 260 ml / min, 270 ml / min, 280 ml / min, 290 ml / min, 300 ml / min, 310 ml / min, 320 ml / min, 330 ml / min, 340 ml / min, 350 ml / min, 360 ml / min, 370 ml / min, 380 ml / min, 390 ml / min, 400 ml / min, 410 ml / min, 420 ml / min, 430 ml / min, 440 ml / min, 450 ml / min, 460 ml / min, 470 ml / min, 480 ml / min, 490 ml / min, 500 ml / min, 510 ml / min, 520 ml / min, 530 ml / min, 540 ml / min, 550 ml / min, 560 ml / min, 570 ml / min, 580 ml / min, 590 ml / min, 600 ml / min, 610 ml / min, 620 ml / min, 630 ml / min, 640 ml / min, 650 ml / min, 660 ml / min, 670 ml / min, 680 ml / min, 690 ml / min, 700 ml / min, 710 ml / min, 720 ml / min, 730 ml / min, 740 ml / min, 750 ml / min, 760 ml / min, 770 ml / min, 780 ml / min, 790 ml / min, 800 ml / min, 810 ml / min, 820 ml / min, 830 ml / min, 840 ml / min, 850 ml / min, 860 ml / min, 870 ml / min, 880 ml / min, 890 ml / min, 900 ml / min, 950 ml / min, 1000 ml / min.

[0070] As noted, the flow rate of the liquid composition away from the mixing chamber or at its outlet may be defined by, e.g. equal to, the sum of the flow rates with which the first liquid and the second liquid enter the mixing chamber. Thus, the same flow drivers may be used to drive the first and second liquid flow and also the liquid composition flow.

[0071] In an embodiment, the liquid composition is guided or driven away from the mixing chamber and / or leaves the mixing chamber or the mixing component via the outlet with a flow rate of less than or equal to any one of the following: 1000 ml / min, 950 ml / min, 900 ml / min, 890 ml / min, 880 ml / min, 870 ml / min, 860 ml / min, 850 ml / min, 840 ml / min, 830 ml / min, 820 ml / min, 810 ml / min, 800 ml / min, 790 ml / min,

[0072] 780 ml / min, 770 ml / min, 760 ml / min, 750 ml / min, 740 ml / min, 730 ml / min, 720 ml / min, 710 ml / min,

[0073] 700 ml / min, 690 ml / min, 680 ml / min, 670 ml / min, 660 ml / min, 650 ml / min, 640 ml / min, 630 ml / min,

[0074] 620 ml / min, 610 ml / min, 600 ml / min, 590 ml / min, 580 ml / min, 570 ml / min, 560 ml / min, 550 ml / min,

[0075] 540 ml / min, 530 ml / min, 520 ml / min, 510 ml / min, 500 ml / min, 490 ml / min, 480 ml / min, 470 ml / min,

[0076] 460 ml / min, 450 ml / min, 440 ml / min, 430 ml / min, 420 ml / min, 410 ml / min, 400 ml / min, 390 ml / min,

[0077] 380 ml / min, 370 ml / min, 360 ml / min, 350 ml / min, 340 ml / min, 330 ml / min, 320 ml / min, 310 ml / min,

[0078] 300 ml / min, 290 ml / min, 280 ml / min, 270 ml / min, 260 ml / min, 250 ml / min, 240 ml / min, 230 ml / min,

[0079] 220 ml / min, 210 ml / min, 200 ml / min, 190 ml / min, 180 ml / min, 170 ml / min, 160 ml / min, 150 ml / min,

[0080] 140 ml / min, 130 ml / min, 120 ml / min, 110 ml / min, 100 ml / min, 90 ml / min, 80 ml / min, 70 ml / min, 60 ml / min, 50 ml / min, 40 ml / min, 30 ml / min, 20 ml / min, 10 ml / min.

[0081] Thus, the flow rate of the liquid composition may be between 10 ml / min and 1000 ml / min or be in any sub-range derived from the values stated above.

[0082] In an embodiment, the nanoparticles of the lipid nanoparticle composition have a size of less than or equal to any one of the following: 195 nm, 190 nm, 185 nm, 180 nm, 175 nm, 170 nm, 165 nm, 160 nm, 155 nm, 150 nm, 145 nm, 140 nm, 135 nm, 130 nm, 125 nm, 120 nm, 115 nm, 110 nm, 105 nm, 100 nm, 95 nm, 90 nm, 85 nm, 80 nm, 75 nm, 70 nm, 65 nm, 60 nm, 55 nm, 50 nm, 45 nm, 40 nm.

[0083] In an embodiment, the nanoparticles of the lipid nanoparticle composition have a size of greater than or equal to any one of the following: 20 nm, 25 nm, 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, 150 nm, 155 nm, 160 nm, 165 nm, 170 nm, 175 nm, 180 nm, 185 nm,

[0084] 190 nm, 195 nm

[0085] In an embodiment, the nanoparticles of the lipid nanoparticle composition have a size, e.g. an average size, of greater than or equal to any one of the following: 20 nm, 21 nm, 22 nm, 23 nm, 24 nm, 25 nm, 26 nm, 27 nm, 28 nm, 29 nm, 30 nm, 31 nm, 32 nm, 33 nm, 34 nm, 35 nm, 36 nm, 37 nm, 38 nm, 39 nm, 40 nm, 41 nm, 42 nm, 43 nm, 44 nm, 45 nm, 46 nm, 47 nm, 48 nm, 49 nm, 50 nm (nm: nanometers).

[0086] In an embodiment, the nanoparticles of the lipid nanoparticle composition have a size, e.g. an average size, of less than or equal to any one of the following: 100 nm, 99 nm, 98 nm, 97 nm, 96 nm, 95 nm, 94 nm, 93 nm, 92 nm, 91 nm, 90 nm, 89 nm, 88 nm, 87 nm, 86 nm, 85 nm, 84 nm, 83 nm, 82 nm, 81 nm, 80 nm, 79 nm, 78 nm, 77 nm, 76 nm, 75 nm, 74 nm, 73 nm, 72 nm, 71 nm, 70 nm, 69 nm, 68 nm, 67 nm, 66 nm, 65 nm, 64 nm, 63 nm, 62 nm, 61 nm, 60 nm, 59 nm, 58 nm, 57 nm, 56 nm, 55 nm, 54 nm, 53 nm, 52 nm, 51 nm, 50 nm.

[0087] The size may be defined by the diameter of the nanoparticles, e.g. based on the maximum, minimum or average diameter of the particles.

[0088] The size of the nanoparticles may be between 20 nm and 195 nm or be in any sub-range derived from the values stated above, e.g. between 40 nm and 100 nm.

[0089] We note that the size depends on whether and what substance the nanoparticles encapsulate. The greater the substance, the greater the nanoparticles, of course.

[0090] In an embodiment, the outlet of the mixing chamber or of the mixing component has a diameter of greater than or equal to any one of the following: 0.1 mm, 0.15 mm, 0.2 mm, 0.25 mm, 0.3 mm, 0.35 mm, 0.4 mm, 0.45 mm, 0.5 mm (mm: millimeters).

[0091] The respective diameters for inlets, openings or flow paths specified herein are expediently inner diameters. In case the diameter of the flow path or conduit varies, e.g. azimuthally or circumferentially, the diameter at a certain position of the flow path may be the maximum, minimum or average diameter at the certain position.

[0092] In an embodiment, the outlet of the mixing chamber or of the mixing component has a diameter of less than or equal to any one of the following: 4 mm, 3.5 mm, 3 mm, 2.5 mm, 2 mm, 1.5 mm, 1 mm, 0.95 mm, 0.9 mm, 0.85 mm, 0.8 mm, 0.75 mm, 0.7 mm, 0.65 mm, 0.6 mm, 0.55 mm, 0.5 mm. The outlet of the mixing chamber or of the mixing component may have a diameter of between 0.1 mm and 4 mm or be in any sub-range derived from the values stated above.

[0093] In an embodiment, the first inlet and / or the second inlet of the mixing chamber or of the mixing component has a diameter of greater than or equal to any one of the following: 0.1 mm, 0.15 mm, 0.2 mm, 0.25 mm, 0.3 mm, 0.35 mm, 0.4 mm, 0.45 mm, 0.5 mm.

[0094] In an embodiment, the first inlet and / or the second inlet of the mixing chamber or of the mixing component has a diameter of less than or equal to any one of the following: 4 mm, 3.5 mm, 3 mm, 2.5 mm, 2 mm, 1.5 mm, 1 mm, 0.95 mm, 0.9 mm, 0.85 mm, 0.8 mm, 0.75 mm, 0.7 mm, 0.65 mm, 0.6 mm, 0.55 mm, 0.5 mm.

[0095] The first inlet of the mixing chamber or of the mixing component may have a diameter of between 0.1 mm and 4 mm or be in any sub-range derived from the values stated above.

[0096] The second inlet of the mixing chamber or of the mixing component may have a diameter of between 0.1 mm and 4 mm or be in any sub-range derived from the values stated above.

[0097] The first inlet and the second inlet may have the same or different diameters.

[0098] The outlet may have the same diameter as one of or both of the inlets. The outlet may have a diameter which is different from the diameter of the first and the second inlets.

[0099] In an embodiment, a viscosity of the first liquid and / or of the second liquid is greater than or equal to any one of the following values: 0.5 cP, 0.6 cP, 0.7 cP, 0.8 cP, 0.9 cP, 1.0 cP, 1.1 cP (cP: centi-Poise = mPa s, milliPascal seconds).

[0100] In an embodiment, a viscosity of the first liquid and / or or the second liquid is less than or equal to any one of the following values: 1.8 cP, 1.7 cP, 1.6 cP, 1.5cP, 1.4 cp, 1.3 cP, 1.2 cP, 1.1 cP, 1.0 cP, 0.9 cP.

[0101] The viscosity of the first liquid and / or the second liquid may be between 0.5 cP and 1.8 cP or be in any sub-range derived from the values stated above.

[0102] In an embodiment a viscosity of the liquid composition is less than or equal to any one of the following values: 1.8 cP, 1.7 cP, 1.6 cP, 1.5cP, 1.4 cp, 1.3 cP, 1.2 cP, 1.1 cP, 1.0 cP. In an embodiment a viscosity of the liquid composition is greater than or equal to any one of the following values: 0.5 cP, 0.6 cP, 0.7 cP, 0.8 cP, 0.9 cP.

[0103] The viscosity of the liquid composition may be between 0.5 cP and 1.8 cP or be in any sub-range derived from the values stated above.

[0104] In an embodiment, the viscosity of the first liquid is lower than the one of the second liquid.

[0105] In case of doubt, measurements of quantities mentioned herein may be performed according to what is specified in an associated standard, e.g. a DIN standard or EN standard, or documents having standard character. Taking the viscosity as an example, standards which are related to the determination of viscosities are: DIN 1319, DIN 1342, DIN 53019-1 or DIN 53019-2.

[0106] In an embodiment, a density of the first liquid and / or of the second liquid is less than or equal to any one of the following values: 1200 kg / m3, 1190 kg / m3, 1180 kg / m3, 1170 kg / m3, 1160 kg / m3, 1150 kg / m3, 1140 kg / m3, 1130 kg / m3, 1120 kg / m3, 1110 kg / m3, 1100 kg / m3, 1090 kg / m3, 1080 kg / m3, 1070 kg / m3, 1060 kg / m3, 1050 kg / m3, 1040 kg / m3, 1030 kg / m3, 1020 kg / m3, 1010 kg / m3, 1000 kg / m3, 990 kg / m3, 980 kg / m3, 970 kg / m3, 960 kg / m3, 950 kg / m3, 940 kg / m3, 930 kg / m3, 920 kg / m3, 910 kg / m3, 900 kg / m3, 890 kg / m3, 880 kg / m3, 870 kg / m3, 860 kg / m3, 850 kg / m3, 840 kg / m3, 830 kg / m3, 820 kg / m3, 810 kg / m3, 800 kg / m3, 790 kg / m3.

[0107] In an embodiment, a density of the first liquid and / or of the second liquid is greater than or equal to any one of the following values: 500 kg / m3, 510 kg / m3, 520 kg / m3, 530 kg / m3, 540 kg / m3, 550 kg / m3, 560 kg / m3, 570 kg / m3, 580 kg / m3, 590 kg / m3, 600 kg / m3, 610 kg / m3, 620 kg / m3, 630 kg / m3, 640 kg / m3, 650 kg / m3, 660 kg / m3, 670 kg / m3, 680 kg / m3, 690 kg / m3, 700 kg / m3, 710 kg / m3, 720 kg / m3, 730 kg / m3, 740 kg / m3, 750 kg / m3, 760 kg / m3, 770 kg / m3, 780 kg / m3, 790 kg / m3, 800 kg / m3, 810 kg / m3, 820 kg / m3, 830 kg / m3, 840 kg / m3, 850 kg / m3, 860 kg / m3, 870 kg / m3, 880 kg / m3, 890 kg / m3, 900 kg / m3, 910 kg / m3, 920 kg / m3, 930 kg / m3, 940 kg / m3, 950 kg / m3.

[0108] The density of the first liquid may be greater than the one of the second liquid.

[0109] The density of the first liquid may be between 500 kg / m3and 1200 kg / m3or be in any sub-range derived from the values stated above.

[0110] The density of the second liquid may be between 500 kg / m3and 1200 kg / m3or be in any sub-range derived from the values stated above. The specified densities and / or viscosities are typical for liquids suitable for LNP formation when mixing the liquids.

[0111] In an embodiment, the lipid nanoparticle composition has a polydispersity index (PDI) of the nanoparticles of less than or equal to any one of the following: 0.3, 0.29, 0.28, 0.27, 0.26, 0.25, 0.24, 0.23, 0.22, 0.21, 0.2, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06.

[0112] In an embodiment, the lipid nanoparticle composition has a polydispersity index (PDI) of the nanoparticles of greater than or equal to any one of the following: 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22.

[0113] The polydispersity index (PDI) is a heterogeneity index. The smaller the PDI, the less the variations in particle size in the nanoparticles in the LNP composition. An associated industry standard may be: ISO 22412:2017 (relating to the particle size analysis and dynamic light scattering). In case of doubt, the system available as Malvern Zetasizer Ultra can be used to determine the size and / or the PDI of the LNPs.

[0114] The polydispersity index of the liquid composition may be between 0.008 and 0.3 or be in any sub-range derived from the values stated above.

[0115] In some embodiments, lipid nanoparticles, e.g. nucleic acid-LNPs, may be formed in the liquid composition with a flow rate of the composition after mixing or at the outlet of the mixing chamber or mixing component of greater than or equal to 50 ml / min, 60 ml / min, 70 ml / min, 80 ml / min, 90 ml / min, 100 ml / min, e.g. of 200 ml / min or more. The PDI of the nanoparticles may be 0.13 or less, 0.12 or less, or 0.11 or less. The size of the nanoparticles may be 65 nm or less, or 60 nm or less.

[0116] In an embodiment, the first inlet is used for the first liquid or the second liquid. The second inlet may be used for the other liquid not being guided through the first inlet into the mixing chamber. It has been noted that particles with advantageous properties can be provided regardless of which inlet is used for the first liquid and which inlet is used for the second liquid.

[0117] In an embodiment, the mixing component is an impingement jet mixer. The impinging jets in the mixer may provide for some turbulence or agitation in the mixing chamber to enhance or promote mixing of the first and second liquids.

[0118] In an embodiment, the mixing component is a T-mixer. The T-mixer may be used for impingement jet mixing. Alternatively, a dedicated impingement jet mixing unit may be used. The T-mixer may have its mixing chamber at the location where the three flow path sections (as defined by the "T") meet. The first and second liquid may enter the T-mixer through the opposite inlets. The flows of the first and second liquid may be oppositely directed in the T-mixer, may meet one another in the mixing chamber where the liquids can be mixed. The liquid composition leaves the mixing chamber and / or the T-mixer with a flow direction at an angle, e.g. about 90° or 90°, with respect to the flow direction of the first and / or second liquid into the mixing chamber.

[0119] In an embodiment, the mixing component is configured to provide a linear flow and / or spatially nonoscillating flow at the outlet of the mixing component.

[0120] In an embodiment, the mixing component is a static mixer. Static mixers, such as T-mixers, do not require, and preferably do not use, additional energy, e.g. mechanical energy, for the mixing process in addition to the energy provided by the flow of the first liquid and the second liquid into the mixing chamber. For example, shaking or stirring is not required.

[0121] In an embodiment, the first liquid comprises RNA or DNA.

[0122] In an embodiment, the first liquid is an aqueous phase or an aqueous solution.

[0123] In an embodiment, the first liquid has a pH-value below 7 and / or greater than or equal to 2. The first liquid may have a pH-value of 4 or more, e.g. between 4 and 6. The first liquid may be an acidic liquid. The pH-value may be adjusted to the proper range by adding citric acid and / or citrate or acetic acid and / or acetate.

[0124] In an embodiment, the second liquid comprises one or more lipids.

[0125] In an embodiment, the second liquid comprises one or more or all of: a cationic lipid, a non-cationic lipid or helper lipid, a PEG-lipid (sometimes also termed: PEGylated lipid or PEG-conjugated lipid) or a non- PEG-lipid, and cholesterol. A second liquid with such a configuration is particularly suitable for lipid nanoparticle formation, and, especially, for RNA-LNPs. The second liquid, in this case, may also be referred to as a four-component system e.g. it may consist of the components mentioned.

[0126] In an embodiment, the second liquid comprises one or more or all of: a cationic lipid, a non-cationic lipid or helper lipid, an anionic lipid (e.g. dimyristoylglycerolhemisuccinate (DMGS)), and cholesterol. A second liquid with such a configuration is particularly suitable for lipid nanoparticle formation, and, especially, for RNA-LNPs. The second liquid, in this case, may also be referred to as a four-component system e.g. it may consist of the components mentioned. LNPs obtained with such a second liquid may be referred to as aLNPs, where "a" hints to the anionic lipid in the second liquid. In an embodiment, the second liquid comprises one or more or all of: a cationic lipid, a non-cationic lipid or helper lipid, and cholesterol. The second liquid, in this case, may also be referred to as a three- component system, e.g. it may consist of the components mentioned. The second liquid, in this case may be free or substantially free of anionic lipids and / or free of PEG-lipids. A second liquid with such a configuration is particularly suitable for lipid nanoparticle formation, and, especially, for RNA-LNPs.

[0127] In an embodiment, the second liquid comprises one or more or all of: a cationic lipid, a non-cationic lipid, a stealth lipid, and cholesterol. The stealth lipid may be a PEG lipid, a pSAR lipid or a pAEEA lipid. A second liquid with such a configuration is particularly suitable for lipid nanoparticle formation, and, especially, for RNA-LNPs.

[0128] In an embodiment, the second liquid comprises a cationic lipid, a non-cationic lipid and cholesterol. The second liquid may further comprise a stealth lipid, an anionic lipid, and / or a PEG-lipid. Alternatively or additionally, the second liquid may be free or substantially free of PEG-lipids.

[0129] In an embodiment, the second liquid is an organic phase.

[0130] In an embodiment, the second liquid comprises an organic solvent.

[0131] In an embodiment, the organic solvent is selected from the group of ethanol, propanol, isopropanol and acetone.

[0132] In an embodiment, the first liquid comprises

[0133] - RNA, the second liquid comprises

[0134] - a cationic lipid, a non-cationic lipid or helper lipid, a PEG-lipid, and cholesterol, wherein the first liquid and the second liquid are mixed in the mixing chamber to provide the liquid composition, the liquid composition having a flow rate of greater than or equal to 65 ml / min and optionally less than or equal to 300 ml / min at an outlet of the mixing chamber or of a mixing component comprising the mixing chamber, wherein a diameter of the flow path at the outlet is greater than or equal to 0.15 mm and, optionally, less than or equal to 1 mm or less than or equal to 0.85 mm.

[0135] In an embodiment, the liquid composition comprises lipid nanoparticles, the respective lipid nanoparticle encapsulating nucleic acid, e.g. RNA or DNA. In an embodiment, the liquid composition is a dispersion. The liquid composition may be a homogeneous dispersion. That is to say, the dispersed phase (e.g. the nanoparticles) is homogeneous, e.g. with a low PDI, such as below 0.13, or below 0.12 or below 0.11.

[0136] In an embodiment, the first liquid is a solution and / or the second liquid is a solution.

[0137] Another aspect of the disclosure relates to a method of processing a liquid composition obtainable or obtained with the method of providing or forming the liquid composition described further above. The processed liquid composition still comprises the LNPs. The processed liquid composition may be the preparation set forth below. The processed liquid composition may be a drug product and / or a pharmaceutical product.

[0138] In an embodiment, a third liquid is added to the liquid composition downstream of the mixing chamber.

[0139] In an embodiment, a further mixing chamber, e.g. in a further mixing component, e.g. a T-mixer, is used for mixing the liquid composition and the third liquid.

[0140] In an embodiment, the length of a flow path fluidly connecting the outlet of the mixing chamber or the mixing component and an inlet of the further mixing chamber or of the further mixing component, the inlet being provided for the liquid composition, is greater than or equal to one of the following: 5 cm, 6 cm, 7 cm, 8 cm, 9 cm, 10 cm, 11 cm, 12 cm, 13 cm, 14 cm, 15 cm, 16 cm, 17 cm, 18 cm, 19 cm, 20 cm (cm: centimeters). The liquid composition may enter the further mixing chamber or mixing component through the inlet.

[0141] In an embodiment, the length of a flow path fluidly connecting the outlet of the mixing chamber or the mixing component and an inlet of the further mixing chamber or of the further mixing component, the inlet being provided for the liquid composition, is less than or equal to one of the following: 40 cm, 39 cm, 38 cm, 37 cm, 36 cm, 35 cm, 34 cm, 33 cm, 32 cm, 31 cm, 30 cm, 29 cm, 28 cm, 27 cm, 26 cm, 25 cm, 24 cm, 23 cm, 22 cm, 21 cm, 20 cm.

[0142] Thus, the length of the flow path may be between 5 cm and 40 cm. Arbitrary sub-ranges may be formed by the disclosed values.

[0143] In an embodiment, the third liquid is a buffer and / or provided to provide quenching for the liquid composition. The third liquid may be a buffer, e.g. a citrate buffer, sodium triphosphate pentabasic (also termed "3P" herein) or Tris buffer. 3P may be particularly suitable for a second liquid which is a three- component system as set forth further above. Tris buffer may be used for systems using non-PEG lipids in the second liquid and / or for aLNPs, for example. The citrate buffer may be used for four component systems, e.g. with a PEG lipid.

[0144] In an embodiment, the liquid composition, e.g. the processed or unprocessed liquid composition, is filtered through a filter. The filter may be a 0.2 pm filter, i.e. a filter which is designed to allow particles with a size or diameter below 200 nm to pass through the filter. In other words, the pore size may be 0.2 pm.

[0145] In an embodiment, a filter area of the filter is less than or equal to A cm2per gram of RNA in the lipid nanoparticles, where A is any one of the following values: 180, 170, 160, 150, 140, 130, 120. In this case, the first liquid comprises RNA, of course.

[0146] In an embodiment, a filter area of the filter is greater than or equal to A cm2per gram of RNA in the lipid nanoparticles, where A is any one of the following values: 80, 90, 100, 110, 120.

[0147] Thus, A may be between 80 and 180. Arbitrary sub-ranges may be formed by the disclosed values.

[0148] In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition deviates from the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition by less than or equal to any one of: 25 %, 24%, 23 %, 22 %, 21 %, 20 %, 19 %, 18 %, 17 %, 16 %, 15 %, 14 %, 13 %, 12 %, 11 %, 10 %, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, 1 %, 0.5 %.

[0149] In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition is equal to or lower than the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition.

[0150] In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition and / or the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition is less than or equal to any one of the following: 0.2, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06. Hence, particles with advantageously low PDI can be obtained and maintained at low PDI throughout different process steps.

[0151] In an embodiment, an absolute value of the difference between the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition and the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition is less than or equal to any one of: 0.030, 0.025, 0.020, 0.015, 0.010, 0.009, 0.008, 0.007, 0.006, 0.005. In an embodiment, the liquid composition, e.g. the filtered or unfiltered liquid composition, is frozen to a predetermined temperature, e.g. to - 20 °C or - 70 °C. The frozen liquid composition may be thawed, e.g. until the thawed liquid composition has reached room temperature. The frozen liquid may be thawed after a predetermined time. That is to say, the liquid composition is kept frozen for the predetermined time. After that time, the frozen composition may be allowed to thaw at room temperature, e.g. without applying additional heat.

[0152] In an embodiment, the predetermined time is greater than or equal to any one of: one week, two weeks, three weeks, four weeks, five weeks, six weeks, one month, two months, three months, six months, twelve months, 24 months.

[0153] In an embodiment, the predetermined time is less than or equal to any one of: one week, two weeks, four weeks, five weeks, six weeks, one month, two months, three months, six months, twelve months, 24 months, 36 months.

[0154] In an embodiment, multiple freeze and thaw cycles, e.g. more than 2 such as 5, are conducted with the liquid composition, e.g. in the predetermined time. When having thawed at the end of one freeze and thaw cycle (e.g. up to room temperature), the liquid composition may be frozen again until a predetermined number of cycles has been completed, e.g. frozen x times and thawed x times; x may be 3, 4, or 5, for example. The freeze and thaw cycles may be performed between - 20° C and room temperature or between - 70°C and room temperature, for example. For one set of multiple freeze and thaw cycles the temperature to which the liquid composition is frozen is kept constant between different cycles of the same set.

[0155] In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which has been thawed after the predetermined time or after the last thawing process of the multiple freeze and thaw cycles has been completed, deviates from the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition by less than or equal to any one of: 25 %, 24%, 23 %, 22 %, 21%, 20 %, 19 %, 18 %, 17 %, 16 %, 15 %, 14 %, 13 %, 12 %, 11 %, 10 %, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, 1 %, 0.5 %.

[0156] In an embodiment, an absolute value of the difference between the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which has been thawed after the predetermined time or after the last thawing process of the multiple freeze and thaw cycles has been completed, and the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition is less than or equal to any one of: 0.030, 0.025, 0.020, 0.015, 0.010, 0.009, 0.008, 0.007, 0.006, 0.005. In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which may be thawed after the predetermined time or may be thawed in the last one of the multiple freeze and thaw cycles, is equal to or lower than the poly dispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition.

[0157] In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which may be thawed after the predetermined time or may be thawed in the last one of the multiple freeze and thaw cycles, and / or the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition, e.g. directly before the (first) freeze cycle or in a fully processed liquid composition, is less than or equal to any one of the following: 0.2, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06. Hence, particles with advantageously low PDI can be obtained and maintained at low PDI throughout different process steps.

[0158] In an embodiment, the polydispersity index of the nanoparticles in the thawed liquid composition, which may be thawed after the predetermined time or may be thawed in the last one of the multiple freeze and thaw cycles, is less than or equal to any one of the following: 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06, 0.55, 0.05, 0.45, 0.04, 0.35, 0.03.

[0159] The respective deviation or difference mentioned above may be greater than zero or zero.

[0160] The respective deviation in percentage shown above may be determined by (PDI_1 - PDI_2) / PDI_1 x 100 %. If the value is negative, the absolute value is used to yield a positive result.

[0161] Thus, processing steps like filtering, freezing and / or thawing may not change the PDI significantly or lower the PDI, when the processes, uses and / or components proposed herein are applied. This suggests very homogenously configured lipid nanoparticles in the composition before it is filtered already or advantageous characteristics of the lipid nanoparticles which favors a particularly low PDI. The composition may be the one with or without addition of the third liquid or a further processed composition.

[0162] In an embodiment, the liquid composition, e.g. before filtering, may be purified and / or the organic solvent may be reduced or removed.

[0163] Another aspect of the present disclosure relates to a preparation, e.g. a pharmaceutical preparation, the preparation comprising lipid nanoparticles, the lipid nanoparticles or the preparation being obtainable or obtained with any one of the methods described herein above or below or with the use as described herein above or below. Hence, features described for any one of the methods above or below or the use also apply to the preparation and vice versa. The preparation may be the (unprocessed or processed) liquid composition. Hence, features described for the composition or its nanoparticles also apply for the preparation and its nanoparticles.

[0164] In an embodiment, the mixing component used herein does not introduce spatial oscillations in the fluid flow.

[0165] Certain Definitions

[0166] About or Approximately: The term “about” or “approximately”, when used herein in reference to a value, refers to a value that is similar, in context to a stated reference value. In general, those skilled in the art, familiar with the context, will appreciate the relevant degree of variance encompassed by “about” or “approximately” in that context. For example, in some embodiments, the term “about” or “approximately” may encompass a range of values that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value.

[0167] Administration: As used herein, the term “administration” typically refers to the administration of a composition to a subject or system. Those of ordinary skill in the art will be aware of a variety of routes that may, in appropriate circumstances, be utilized for administration to a subject, for example a human. For example, in some embodiments, administration may be ocular, oral, parenteral, topical, etc. In some particular embodiments, administration may be bronchial (e.g., by bronchial instillation), buccal, dermal (which may be or comprise, for example, one or more of topical to the dermis, intradermal, intradermal, transdermal, etc.), enteral, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, within a specific organ (e. g. intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), vaginal, vitreal, etc. In some embodiments, administration may be intramuscular. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and / or periodic (e.g. , individual doses separated by a common period of time) dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time.

[0168] Agent: In general, the term “agent”, as used herein, is used to refer to an entity (e.g. , for example, a lipid, metal, nucleic acid, polypeptide, polysaccharide, small molecule, etc., or complex, combination, mixture or system [e.g., cell, tissue, organism] thereof), or phenomenon (e.g., heat, electric current or field, magnetic force or field, etc.). In appropriate circumstances, as will be clear from context to those skilled in the art, the term may be utilized to refer to an entity that is or comprises a cell or organism, or a fraction, extract, or component thereof. Alternatively or additionally, as context will make clear, the term may be used to refer to a natural product in that it is found in and / or is obtained from nature. In some instances, again as will be clear from context, the term may be used to refer to one or more entities that is man-made in that it is designed, engineered, and / or produced through action of the hand of man and / or is not found in nature. In some embodiments, an agent may be utilized in isolated or pure form; in some embodiments, an agent may be utilized in crude form. In some embodiments, potential agents may be provided as collections or libraries, for example that may be screened to identify or characterize active agents within them. In some cases, the term “agent” may refer to a compound or entity that is or comprises a polymer; in some cases, the term may refer to a compound or entity that comprises one or more polymeric moieties. In some embodiments, the term “agent” may refer to a compound or entity that is not a polymer and / or is substantially free of any polymer and / or of one or more particular polymeric moieties. In some embodiments, the term may refer to a compound or entity that lacks or is substantially free of any polymeric moiety.

[0169] Analog: As used herein, the term “analog” refers to a substance that shares one or more particular structural features, elements, components, or moieties with a reference substance. Typically, an “analog” shows significant structural similarity with the reference substance, for example sharing a core or consensus structure, but also differs in certain discrete ways. In some embodiments, an analog is a substance that can be generated from the reference substance, e.g.. by chemical manipulation of the reference substance. In some embodiments, an analog is a substance that can be generated through performance of a synthetic process substantially similar to (e.g., sharing a plurality of steps with) one that generates the reference substance. In some embodiments, an analog is or can be generated through performance of a synthetic process different from that used to generate the reference substance.

[0170] Antibody agent: As used herein, the term "antibody agent" refers to an agent that specifically binds to a particular antigen. In some embodiments, the term encompasses any polypeptide or polypeptide complex that includes immunoglobulin structural elements sufficient to confer specific binding. Exemplary antibody agents include, but are not limited to monoclonal antibodies or polyclonal antibodies. In some embodiments, an antibody agent may include one or more constant region sequences that are characteristic of mouse, rabbit, primate, or human antibodies. In some embodiments, an antibody agent may include one or more sequence elements are humanized, primatized, chimeric, etc., as is known in the art. In many embodiments, the term "antibody agent" is used to refer to one or more of the art-known or developed constructs or formats for utilizing antibody structural and functional features in alternative presentation. For example, embodiments, an antibody agent utilized in accordance with the present disclosure is in a format selected from, but not limited to, intact IgA, IgG, IgE or IgM antibodies; bi- or multi- specific antibodies (e.g., Zybodies®, etc.); antibody fragments such as Fab fragments, Fab' fragments, F(ab')2 fragments, Fd' fragments, Fd fragments, and isolated complementarity determining regions (CDRs) or sets thereof; single chain Fvs; polypeptide -Fc fusions; single domain antibodies (e.g., shark single domain antibodies such as IgNAR or fragments thereof); cameloid antibodies; masked antibodies (e.g., Probodies®); Small Modular ImmunoPharmaceuticals ("SMIPsTM"); single chain or Tandem diabodies (TandAb®); VHHs; Anticalins®; Nanobodies® minibodies; BiTE®s; ankyrin repeat proteins or DARPINs®; Avimers®; DARTs; TCR-like antibodies; Adnectins®; Affilins®; Transbodies®; Affibodies®; TrimerX®; MicroProteins; Fynomers®, Centyrins®; and KALBITOR®s. In some embodiments, an antibody may lack a covalent modification (e.g., attachment of a glycan) that it would have if produced naturally. In some embodiments, an antibody may contain a covalent modification (e.g. , attachment of a glycan, a payload [e.g., a detectable moiety, a therapeutic moiety, a catalytic moiety, etc.}, or other pendant group [e.g., poly-ethylene glycol, etc.}. In many embodiments, an antibody agent is or comprises a polypeptide whose amino acid sequence includes one or more structural elements recognized by those skilled in the art as a complementarity determining region (CDR); in some embodiments an antibody agent is or comprises a polypeptide whose amino acid sequence includes at least one CDR (e.g., at least one heavy chain CDR and / or at least one light chain CDR) that is substantially identical to one found in a reference antibody. In some embodiments an included CDR is substantially identical to a reference CDR in that it is either identical in sequence or contains between 1-5 amino acid substitutions as compared with the reference CDR. In some embodiments an included CDR is substantially identical to a reference CDR in that it shows at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the reference CDR. In some embodiments, an included CDR is substantially identical to a reference CDR in that it shows at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the reference CDR. In some embodiments an included CDR is substantially identical to a reference CDR in that at least one amino acid within the included CDR is deleted, added, or substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical with that of the reference CDR. In some embodiments an included CDR is substantially identical to a reference CDR in that 1-5 amino acids within the included CDR are deleted, added, or substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical to the reference CDR. In some embodiments, an included CDR is substantially identical to a reference CDR in that at least one amino acid within the included CDR is substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical with that of the reference CDR. In some embodiments, an included CDR is substantially identical to a reference CDR in that 1-5 amino acids within the included CDR are deleted, added, or substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical to the reference CDR. In some embodiments, an antibody agent is or comprises a polypeptide whose amino acid sequence includes structural elements recognized by those skilled in the art as an immunoglobulin variable domain. In some embodiments, an antibody agent is a polypeptide protein having a binding domain which is homologous or largely homologous to an immunoglobulin-binding domain. Antibody agents can be made by the skilled person using methods and commercially available services and kits known in the art. For example, methods of preparation of monoclonal antibodies are well known in the art and include hybridoma technology and phage display technology. Further antibodies suitable for use in the present disclosure are described, for example, in the following publications: Antibodies A Laboratory Manual, Second edition. Edward A. Greenfield. Cold Spring Harbor Laboratory Press (September 30, 2013); Making and Using Antibodies: A Practical Handbook, Second Edition. Eds. Gary C. Howard and Matthew R. Kaser. CRC Press (July 29, 2013); Antibody Engineering: Methods and Protocols, Second Edition (Methods in Molecular Biology). Patrick Chames. Humana Press (August 21,

[0171] 2012); Monoclonal Antibodies: Methods and Protocols (Methods in Molecular Biology). Eds. Vincent Ossipow and Nicolas Fischer. Humana Press (February 12, 2014); and Human Monoclonal Antibodies: Methods and Protocols (Methods in Molecular Biology). Michael Steinitz. Humana Press (September 30,

[0172] 2013)).

[0173] Antibodies may be produced by standard techniques, for example by immunization with the appropriate polypeptide or portion(s) thereof, or by using a phage display library. If polyclonal antibodies are desired, a selected mammal (e.g., mouse, rabbit, goat, horse, etc.) is immunized with an immunogenic polypeptide bearing a desired epitope(s), optionally haptenized to another polypeptide. Depending on the host species, various adjuvants may be used to increase immunological response. Such adjuvants include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface-active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Serum from the immunized animal is collected and treated according to known procedures. If serum containing polyclonal antibodies to the desired epitope contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography or any other method known in the art. Techniques for producing and processing polyclonal antisera are well known in the art.

[0174] Antigen-. The term “antigen”, as used herein, refers to an agent that elicits an immune response; and / or (ii) an agent that binds to a T cell receptor (e.g., when presented by an MHC molecule) or to an antibody. In some embodiments, an antigen elicits a humoral response (e.g., including production of antigenspecific antibodies); in some embodiments, an antigen elicits a cellular response (e.g., involving T-cells whose receptors specifically interact with the antigen). In some embodiments, an antigen binds to an antibody and may or may not induce a particular physiological response in an organism. In general, an antigen may be or include any chemical entity such as, for example, a small molecule, a nucleic acid, a polypeptide, a carbohydrate, a lipid, a polymer (in some embodiments other than a biologic polymer [e.g., other than a nucleic acid or amino acid polymer) etc. In some embodiments, an antigen is or comprises a polypeptide. In some embodiments, an antigen is or comprises a glycan. Those of ordinary skill in the art will appreciate that, in general, an antigen may be provided in isolated or pure form, or alternatively may be provided in crude form (e.g., together with other materials, for example in an extract such as a cellular extract or other relatively crude preparation of an antigen-containing source). In some embodiments, antigens utilized in accordance with the present disclosure are provided in a crude form. In some embodiments, an antigen is a recombinant antigen.

[0175] Binding'. It will be understood that the term “binding”, as used herein, typically refers to a non-covalent association between or among two or more entities. “Direct” binding involves physical contact between entities or moieties; indirect binding involves physical interaction by way of physical contact with one or more intermediate entities. Binding between two or more entities can typically be assessed in any of a variety of contexts - including where interacting entities or moieties are studied in isolation or in the context of more complex systems (e.g., while covalently or otherwise associated with a carrier entity and / or in a biological system or cell).

[0176] Bioreactor'. The term “bioreactor” as used herein refers to a vessel used for in vitro transcription described herein. A bioreactor can be of any size so long as it is useful for in vitro transcription. For example, in some embodiments, a bioreactor can be at least 0.5 liter, including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 liters or more, or any volume in between. The internal conditions of the bioreactor, including, but not limited to pH and temperature, are typically controlled during in vitro transcription. The bioreactor can be composed of any material that is suitable for in vitro transcription under the conditions as described herein, including glass, plastic or metal. One of ordinary skill in the art will be aware of and will be able to choose suitable bioreactor volume for use in practicing in vitro transcription.

[0177] Cap: As used herein, the term “cap” refers to a structure comprising or essentially consisting of a nucleoside-5 '-triphosphate that is typically joined to a 5'-end of an uncapped RNA (e.g., an uncapped RNA having a 5'- diphosphate). In some embodiments, a cap is or comprises a guanine nucleotide. In some embodiments, a cap is or comprises a naturally-occurring RNA 5’ cap, including, e.g., but not limited to a N7-methylguanosine cap, which has a structure designated as "m7G." In some embodiments, a cap is or comprises a synthetic cap analog that resembles an RNA cap structure and possesses the ability to stabilize RNA if attached thereto, including, e.g., but not limited to anti-reverse cap analogs (ARCAs) known in the art). Those skilled in the art will appreciate that methods for joining a cap to a 5’ end of an RNA are known in the art. For example, in some embodiments, a capped RNA may be obtained by in vitro capping of RNA that has a 5' triphosphate group or RNA that has a 5' diphosphate group with a capping enzyme system (including, e.g., but not limited to vaccinia capping enzyme system or Saccharomyces cerevisiae capping enzyme system). Alternatively, a capped RNA can be obtained by in vitro transcription (IVT) of a DNA template, wherein, in addition to the GTP, an IVT system also contains a cap analog, e.g., as known in the art. Non-limiting examples of a cap analog include a m7GpppG cap analog or an N7-methyl-, 2’-O- methyl -GpppG ARCA cap analog or an N7-methyl-, 3'- O-methyl-GpppG ARCA cap analog, or any commercially available cap analogs, including, e.g., CleanCap (Trilink), EZ Cap, etc.. In some embodiments, a cap analog is or comprises a trinucleotide cap analog.

[0178] Comparable: As used herein, the term “comparable” refers to two or more agents, entities, situations, sets of conditions, etc., that may not be identical to one another but that are sufficiently similar to permit comparison there between so that one skilled in the art will appreciate that conclusions may reasonably be drawn based on differences or similarities observed. In some embodiments, comparable sets of conditions, circumstances, individuals, or populations are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, etc. to be considered comparable. For example, those of ordinary skill in the art will appreciate that sets of circumstances, individuals, or populations are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under or with different sets of circumstances, individuals, or populations are caused by or indicative of the variation in those features that are varied.

[0179] Complementary: As used herein, the term “complementary” is used in reference to oligonucleotide hybridization related by base -pairing rules. For example, the sequence “C-A-G-T” is complementary to the sequence “G-T-C-A.” Complementarity can be partial or total. Thus, any degree of partial complementarity is intended to be included within the scope of the term “complementary” provided that the partial complementarity permits oligonucleotide hybridization. Partial complementarity is where one or more nucleic acid bases is not matched according to the base pairing rules. Total or complete complementarity between nucleic acids is where each and every nucleic acid base is matched with another base under the base pairing rules.

[0180] Detecting: The term “detecting” is used broadly herein to include appropriate means of determining the presence or absence of an entity of interest or any form of measurement of an entity of interest in a sample. Thus, “detecting” may include determining, measuring, assessing, or assaying the presence or absence, level, amount, and / or location of an entity of interest. Quantitative and qualitative determinations, measurements or assessments are included, including semi-quantitative. Such determinations, measurements or assessments may be relative, for example when an entity of interest is being detected relative to a control reference, or absolute. As such, the term “quantifying” when used in the context of quantifying an entity of interest can refer to absolute or to relative quantification. Absolute quantification may be accomplished by correlating a detected level of an entity of interest to known control standards (e.g., through generation of a standard curve). Alternatively, relative quantification can be accomplished by comparison of detected levels or amounts between two or more different entities of interest to provide a relative quantification of each of the two or more different entities of interest, i.e.. relative to each other.

[0181] Determine: Those of ordinary skill in the art, reading the present specification, will appreciate that a step of “determining” can utilize or be accomplished through use of any of a variety of techniques available to those skilled in the art, including for example specific techniques explicitly referred to herein. In some embodiments, determining involves manipulation of a physical sample. In some embodiments, determining involves consideration and / or manipulation of data or information, for example utilizing a computer or other processing unit adapted to perform a relevant analysis. In some embodiments, determining involves receiving relevant information and / or materials from a source. In some embodiments, determining involves comparing one or more features of a sample or entity to a comparable reference.

[0182] Dosage form or unit dosage form: Those skilled in the art will appreciate that the term “dosage form” may be used to refer to a physically discrete unit of an active agent (e.g. , a therapeutic or diagnostic agent) for administration to a subject. Typically, each such unit contains a predetermined quantity of active agent. In some embodiments, such quantity is a unit dosage amount (or a whole fraction thereof) appropriate for administration in accordance with a dosing regimen that has been determined to correlate with a desired or beneficial outcome when administered to a relevant population (i.e., with a therapeutic dosing regimen). Those of ordinary skill in the art appreciate that the total amount of a therapeutic composition or agent administered to a particular subject is determined by one or more attending physicians and may involve administration of multiple dosage forms.

[0183] Encapsulate: The term “encapsulate” or “encapsulation” is used herein to refer to at least a portion of a component is enclosed or surrounded by another material or another component in a composition. In some embodiments, a component can be fully enclosed or surrounded by another material or another component in a composition.

[0184] Excipient: As used herein, the term “excipient” refers to a non-therapeutic agent that may be included in a pharmaceutical composition, for example to provide or contribute to a desired property or effect (e.g. , desired consistency, delivery, and / or stabilizing effect, etc.). In some embodiments, suitable pharmaceutical excipients to be added to a LNP composition may include, for example, salts, starch, glucose, lactose, sucrose, gelatin, sodium chloride, glycerol, propylene, glycol, water, ethanol and the like. Encode: As used herein, the term “encode” or “encoding” refers to sequence information of a first molecule that guides production of a second molecule having a defined sequence of nucleotides (e.g., mRNA) or a defined sequence of amino acids. For example, a DNA molecule can encode an RNA molecule (e.g., by a transcription process that includes a DNA-dependent RNA polymerase enzyme). An RNA molecule can encode a polypeptide (e.g., by a translation process). Thus, a gene, a cDNA, or a single-stranded RNA (e.g., an mRNA) encodes a polypeptide if transcription and translation of mRNA corresponding to that gene produces the polypeptide in a cell or other biological system. In some embodiments, a coding region of a single-stranded RNA encoding a target polypeptide agent refers to a coding strand, the nucleotide sequence of which is identical to the mRNA sequence of such a target polypeptide agent. In some embodiments, a coding region of a single-stranded RNA encoding a target polypeptide agent refers to a non-coding strand of such a target polypeptide agent, which may be used as a template for transcription of a gene or cDNA.

[0185] Expression: As used herein, “expression” of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5’ cap formation, and / or 3’ end formation); (3) translation of an RNA into a polypeptide or protein; and / or (4) post-translational modification of a polypeptide or protein.

[0186] Fed-batch process: The term “fed-batch process” as used herein refers to a process in which one or more components are introduced into a vessel, e.g., a bioreactor, at some time subsequent to the beginning of a reaction. In some embodiments, one or more components are introduced by a fed-batch process to maintain its concentration low during a reaction. In some embodiments, one or more components are introduced by a fed-batch process to replenish what is depleted during a reaction.

[0187] Five prime untranslated region: As used herein, the terms "five prime untranslated region" or "5' UTR" refer to a sequence of an mRNA molecule that begins at the transcription start site and ends one nucleotide (nt) before the start codon (usually AUG) of the coding region of an RNA.

[0188] Functional: As used herein, a “functional” biological molecule is a biological molecule in a form in which it exhibits a property and / or activity by which it is characterized. In some embodiments, a biological molecule may have two functions (i.e., bifunctional) or many functions (i.e., multifunctional).

[0189] Gene: As used herein, the term “gene” refers to a DNA sequence in a chromosome that codes for a product (e.g., an RNA product and / or a polypeptide product). In some embodiments, a gene includes coding sequence (i.e., sequence that encodes a particular product); in some embodiments, a gene includes non-coding sequence. In some particular embodiments, a gene may include both coding (e.g., exonic) and non-coding (e.g., intronic) sequences. In some embodiments, a gene may include one or more regulatory elements that, for example, may control or impact one or more aspects of gene expression (e.g., cell-type -specific expression, inducible expression, etc.).

[0190] Gene product or expression product: As used herein, the term “gene product” or “expression product” generally refers to an RNA transcribed from the gene (pre-and / or post-processing) or a polypeptide (pre- and / or post-modification) encoded by an RNA transcribed from the gene.

[0191] Homology: As used herein, the term “homology” or “homolog” refers to the overall relatedness between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are considered to be “homologous” to one another if their sequences are at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. In some embodiments, polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are considered to be “homologous” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar (e.g., containing residues with related chemical properties at corresponding positions). For example, as is well known by those of ordinary skill in the art, certain amino acids are typically classified as similar to one another as "hydrophobic" or “hydrophilic” amino acids, and / or as having “polar” or “non-polar” side chains. Substitution of one amino acid for another of the same type may often be considered a “homologous” substitution.

[0192] Host cell'. As used herein, refers to a cell into which exogenous material (e.g., DNA such as recombinant or otherwise) has been introduced. Persons of skill upon reading this disclosure will understand that such terms refer not only to the particular subject cell, but also to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein. In some embodiments, host cells include prokaryotic and eukaryotic cells selected from any of the Kingdoms of life that are suitable for expressing an exogenous DNA (e.g., a recombinant nucleic acid sequence). Exemplary cells include those of prokaryotes and eukaryotes (single-cell or multiple-cell), bacterial cells (e.g., strains of E. coli, Bacillus spp., Streptomyces spp., etc.), mycobacteria cells, fungal cells, yeast cells (e.g., 5. cerevisiae, S. pombe, P. pastoris, P. methanolica, etc.), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, Trichoplusia ni, etc.), non-human animal cells, human cells, or cell fusions such as, for example, hybridomas or quadromas. In some embodiments, a host cell is a human, monkey, ape, hamster, rat, or mouse cell. In some embodiments, a host cell is eukaryotic. For example, an eukaryotic host cell may be CHO (e.g., CHO KI, DXB-1 1 CHO, Veggie -CHO), COS (e.g., COS-7), retinal cell, Vero, CV1, kidney (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, BHK), HeLa, HepG2, WI38, MRC 5, Colo205, HB 8065, HL-60, (e.g., BHK21), Jurkat, Daudi, A431 (epidermal), CV-1, U937, 3T3, L cell, C127 cell, SP2 / 0, NS-0, MMT 060562, Sertoli cell, BRL 3 A cell, HT1080 cell, myeloma cell, tumor cell, or a cell line derived from an aforementioned cell.

[0193] Identity. As used herein, the term “identity” refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CAB IOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.

[0194] Improved, increased or reduced: As used herein, these terms, or grammatically comparable comparative terms, indicate values that are relative to a comparable reference measurement. For example, in some embodiments, an assessed value achieved with an agent of interest may be “improved” relative to that obtained with a comparable reference agent. Alternatively or additionally, in some embodiments, an assessed value achieved in a subject or system of interest may be “improved” relative to that obtained in the same subject or system under different conditions (e.g., prior to or after an event such as administration of an agent of interest), or in a different, comparable subject (e.g., in a comparable subject or system that differs from the subject or system of interest in presence of one or more indicators of a particular disease, disorder or condition of interest, or in prior exposure to a condition or agent, etc.). In some embodiments, comparative terms refer to statistically relevant differences (e.g., that are of a prevalence and / or magnitude sufficient to achieve statistical relevance). Those skilled in the art will be aware, or will readily be able to determine, in a given context, a degree and / or prevalence of difference that is required or sufficient to achieve such statistical significance.

[0195] In vitro: The term “in vitro” as used herein refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel (e.g., a bioreactor), in cell culture, etc., rather than within a multi-cellular organism.

[0196] In vitro transcription: As used herein, the term "in vitro transcription" or "IVT" refers to the process whereby transcription occurs in vitro in a non-cellular system to produce a synthetic RNA product for use in various applications, including, e.g., production of protein or polypeptides. Such synthetic RNA products can be translated in vitro or introduced directly into cells, where they can be translated. Such synthetic RNA products include, e.g., but not limited to mRNAs, antisense RNA molecules, shRNA molecules, long non-coding RNA molecules, ribozymes, aptamers, guide RNAs (e.g., for CRISPR), ribosomal RNAs, small nuclear RNAs, small nucleolar RNAs, and the like. An IVT reaction typically utilizes a DNA template (e.g., a linear DNA template) as described and / or utilized herein, ribonucleotides (e.g., non-modified ribonucleotide triphosphates or modified ribonucleotide triphosphates), and an appropriate RNA polymerase.

[0197] In vitro transcription RNA composition: As used herein, the term “in vitro transcription RNA composition” refers to a composition comprising target RNA synthesized by in vitro transcription. In some embodiments, such a composition can comprise excess in vitro transcription reagents (including, e.g., ribonucleotides and / or capping agents), nucleic acids or fragments thereof such as DNA templates or fragments thereof, polypeptides or fragments thereof such as recombinant enzymes or host cell proteins or fragments thereof, and / or other impurities. In some embodiments, an in vitro transcription RNA composition may have been treated and / or processed prior to a purification processes that ultimately produces an RNA transcript preparation comprising RNA transcript at a desired concentration in an appropriate buffer for formulation and / or further manufacturing and / or processing. For example, in some embodiments, an in vitro transcription RNA composition may have been treated to remove or digest DNA template (e.g., using a DNase). In some embodiments, an in vitro transcription RNA composition may have been treated to remove or digest polypeptides (e.g. , enzymes such as RNA polymerases, RNase inhibitors, etc.) present in an in vitro transcription reaction (e.g., using a protease).

[0198] In vivo: As used herein, the term “in vivo” refers to events that occur within a multi-cellular organism, such as a human and a non-human animal. Nanoparticle: As used herein, the term “nanoparticle” refers to a particle having a diameter of less than 1000 nanometers (nm). In some embodiments, a nanoparticle has a diameter of less than 300 nm, as defined by the National Science Foundation. In some embodiments, a nanoparticle has a diameter of less than 100 nm as defined by the National Institutes of Health. In some embodiments, a nanoparticle has a diameter of less than 80 nm as defined by the National Institutes of Health. In some embodiments, a nanoparticle comprises one or more enclosed compartments, separated from the bulk solution by a membrane, which surrounds and encloses a space or compartment.

[0199] Nucleic acid / Polynucleotide: As used herein, the term “nucleic acid” refers to a polymer of at least 2 nucleotides or more, including, e.g., at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, or more . In some embodiments, a nucleic acid is or comprises DNA. In some embodiments, a nucleic acid is or comprises RNA. In some embodiments, a nucleic acid is or comprises peptide nucleic acid (PNA). In some embodiments, a nucleic acid is or comprises a single stranded nucleic acid. In some embodiments, a nucleic acid is or comprises a double-stranded nucleic acid. In some embodiments, a nucleic acid comprises both single and double-stranded portions. In some embodiments, a nucleic acid comprises a backbone that comprises one or more phosphodiester linkages. In some embodiments, a nucleic acid comprises a backbone that comprises both phosphodiester and non-phosphodiester linkages. For example, in some embodiments, a nucleic acid may comprise a backbone that comprises one or more phosphorothioate or 5'-N-phosphoramidite linkages and / or one or more peptide bonds, e.g., as in a “peptide nucleic acid”. In some embodiments, a nucleic acid comprises one or more, or all, natural residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytidine, deoxyguanosine, deoxy thymidine, guanine, thymine, uracil). In some embodiments, a nucleic acid comprises on or more, or all, non-natural residues. In some embodiments, a non-natural residue comprises a nucleoside analog (e.g., 2- aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5 -methylcytidine, C- 5 propynyl-cytidine, 1-methyl-pseudouridine, C-5 propynyl -uridine, 2-aminoadenosine, C5- bromouridine, C5 -fluorouridine, C5 -iodouridine, C5-propynyl-uridine, C5 -propynyl-cytidine, C5- methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8- oxoguanosine, 6-O-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a non-natural residue comprises one or more modified sugars (e.g., 2'- fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) as compared to those in natural residues. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or polypeptide. In some embodiments, a nucleic acid has a nucleotide sequence that comprises one or more introns. In some embodiments, a nucleic acid may be prepared by isolation from a natural source, enzymatic synthesis (e.g., by polymerization based on a complementary template, e.g., in vivo or in vitro, reproduction in a recombinant cell or system, or chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, or 20,000 or more residues or nucleotides long.

[0200] Pharmaceutical grade: The term “pharmaceutical grade” as used herein refers to standards for chemical and biological drug substances, drug products, dosage forms, compounded preparations, excipients, medical devices, and dietary supplements, established by a recognized national or regional pharmacopeia (e.g., The United States Pharmacopeia and The Formulary (USP-NF)).

[0201] Polypeptide: The term “polypeptide”, as used herein, typically has its art-recognized meaning of a polymer of at least three amino acids or more. Those of ordinary skill in the art will appreciate that the term “polypeptide” is intended to be sufficiently general as to encompass not only polypeptides having a complete sequence recited herein, but also to encompass polypeptides that represent functional, biologically active, or characteristic fragments, portions or domains (e.g., fragments, portions, or domains retaining at least one activity) of such complete polypeptides. In some embodiments, polypeptides may contain L-amino acids, D-amino acids, or both and / or may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. In some embodiments, polypeptides may comprise natural amino acids, nonnatural amino acids, synthetic amino acids, and combinations thereof (e.g., may be or comprise peptidomimetics). In some embodiments, a polypeptide may be or comprise an enzyme. In some embodiments, a polypeptide may be or comprise a polypeptide antigen. In some embodiments, a polypeptide may be or comprise an antibody agent. In some embodiments a polypeptide may be or comprise a cytokine.

[0202] Pure or Purified: As used herein, an agent or entity is “pure” or “purified” if it is substantially free of other components. For example, a preparation that contains more than about 90% of a particular agent or entity is typically considered to be a pure preparation. In some embodiments, an agent or entity is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% pure in a preparation.

[0203] Ribonucleotide: As used herein, the term “ribonucleotide” encompasses unmodified ribonucleotides and modified ribonucleotides. For example, unmodified ribonucleotides include the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). Modified ribonucleotides may include one or more modifications including, but not limited to, for example, (a) end modifications, e.g., 5' end modifications (e.g., phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (e.g., conjugation, inverted linkages, etc.), (b) base modifications, e.g. , replacement with modified bases, stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, and (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages. The term “ribonucleotide” also encompasses ribonucleotide triphosphates including modified and non-modified ribonucleotide triphosphates.

[0204] Ribonucleic acid (RNA): As used herein, the term “RNA” refers to a polymer of ribonucleotides. In some embodiments, an RNA is single stranded. In some embodiments, an RNA is double stranded. In some embodiments, an RNA comprises both single and double stranded portions. In some embodiments, an RNA can comprise a backbone structure as described in the definition of “Nucleic acid / Polynucleotide” above. An RNA can be a regulatory RNA (e.g., siRNA, microRNA, etc.), or a messenger RNA (mRNA). In some embodiments, an RNA is a mRNA. In some embodiments, where an RNA is a mRNA, a RNA typically comprises at its 3’ end a poly(A) region. In some embodiments where an RNA is a mRNA, an RNA typically comprises at its 5’ end, an art-recognized cap structure, e.g., for recognizing and attachment of a mRNA to a ribosome to initiate translation. In some embodiments, an RNA is a synthetic RNA. Synthetic RNAs include RNAs that are synthesized in vitro (e.g., by enzymatic synthesis methods and / or by chemical synthesis methods). In some embodiments, an RNA is a singlestranded RNA. In some embodiments, a single-stranded RNA may comprise self-complementary elements and / or may establish a secondary and / or tertiary structure. One of ordinary skill in the art will understand that when a single -stranded RNA is referred to as “encoding,” it can mean that it comprises a nucleic acid sequence that itself encodes or that it comprises a complement of the nucleic acid sequence that encodes. In some embodiments, a single-stranded RNA can be a self-amplifying RNA (also known as self-replicating RNA).

[0205] Recombinant', as used herein, is intended to refer to polypeptides that are designed, engineered, prepared, expressed, created, manufactured, and / or or isolated by recombinant means, such as polypeptides expressed using a recombinant expression vector transfected into a host cell; polypeptides isolated from a recombinant, combinatorial human polypeptide library; polypeptides isolated from an animal (e.g., a mouse, rabbit, sheep, fish, etc.) that is transgenic for or otherwise has been manipulated to express a gene or genes, or gene components that encode and / or direct expression of the polypeptide or one or more component(s), portion / s), element(s), or domain(s) thereof; and / or polypeptides prepared, expressed, created or isolated by any other means that involves splicing or ligating selected nucleic acid sequence elements to one another, chemically synthesizing selected sequence elements, and / or otherwise generating a nucleic acid that encodes and / or directs expression of the polypeptide or one or more component / s), portion / s), element / s), or domain / s) thereof. In some embodiments, one or more of such selected sequence elements is found in nature. In some embodiments, one or more of such selected sequence elements is designed in silico. In some embodiments, one or more such selected sequence elements results from mutagenesis (e.g., in vivo or in vitro) of a known sequence element, e.g., from a natural or synthetic source such as, for example, in the germline of a source organism of interest (e.g., of a human, a mouse, etc.).

[0206] Reference: As used herein, the term “reference” describes a standard or control relative to which a comparison is performed. For example, in some embodiments, an agent, animal, individual, population, sample, sequence or value of interest is compared with a reference or control agent, animal, individual, population, sample, sequence or value. In some embodiments, a reference or control is tested and / or determined substantially simultaneously with the testing or determination of interest. In some embodiments, a reference or control is a historical reference or control, optionally embodied in a tangible medium. Typically, as would be understood by those skilled in the art, a reference or control is determined or characterized under comparable conditions or circumstances to those under assessment. Those skilled in the art will appreciate when sufficient similarities are present to justify reliance on and / or comparison to a particular possible reference or control.

[0207] RNA polymerase: As used herein, the term “RNA polymerase” refers to an enzyme that catalyzes polyribonucleotide synthesis by addition of ribonucleotide units to a nucleotide chain using DNA or RNA as a template. The term refers to either a complete enzyme as it occurs in nature, or an isolated, active catalytic or functional domain, or fragment thereof. In some embodiments, an RNA polymerase enzyme initiates synthesis at the 3'-end of a primer or a nucleic acid strand, or at a promoter sequence, and proceeds in the 5'-direction along the target nucleic acid to synthesize a strand complementary to the target nucleic acid until synthesis terminates.

[0208] RNA transcript preparation -. The term “RNA transcript preparation” as used herein refers to a preparation comprising RNA transcript that is purified from an in vitro transcription RNA composition described herein. In some embodiments, an RNA transcript preparation is a preparation comprising pharmaceutical-grade RNA transcript. In some embodiments, an RNA transcript preparation is a preparation comprising RNA transcript, which its one or more product quality attributes are characterized and determined to meet a release and / or acceptance criteria (e.g., as described herein). Examples of such product quality attributes include, but are not limited to appearance, RNA length, identity of drug substance as RNA, RNA integrity, RNA sequence, RNA concentration, pH, osmolality, residual DNA template, residual double stranded RNA, bacterial endotoxins, bioburden, and combinations thereof. Room temperature: As used herein, the term “room temperature” refers to an ambient temperature. In some embodiments, a room temperature is about 18°C-30°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C.

[0209] Sample: As used herein, the term “sample” typically refers to an aliquot of material obtained or derived from a source of interest, e.g. , as described herein. In some embodiments, a source of interest is a biological or environmental source. In some embodiments, a source of interest may be or comprise a cell or an organism, such as a microbe, a plant, or an animal (e.g., a mouse). In some embodiments, a source of interest is or comprises biological tissue or fluid. In some embodiments, a biological fluid may be or comprise an intracellular fluid, an extracellular fluid, an intravascular fluid (blood plasma), an interstitial fluid, a lymphatic fluid, and / or a transcellular fluid. In some embodiments, a biological tissue or sample may be obtained, for example, by aspirate, biopsy (e.g., fine needle or tissue biopsy), swab (e.g., oral, nasal, skin, or vaginal swab), scraping, surgery, washing or lavage (e.g., brocheoalvealar, ductal, nasal, ocular, oral, uterine, vaginal, or other washing or lavage). In some embodiments, a sample is or comprises cells obtained from a subject. In some embodiments, a sample is a “primary sample” obtained directly from a source of interest by any appropriate means. In some embodiments, as will be clear from context, the term “sample” refers to a preparation that is obtained by processing (e.g., by removing one or more components of and / or by adding one or more agents to) a primary sample. For example, a “processed sample” may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to one or more techniques such as amplification or reverse transcription of nucleic acid, isolation and / or purification of certain components, etc.

[0210] Stable: The term “stable,” when applied to nucleic acids and / or compositions comprising nucleic acids, e.g., encapsulated in lipid nanoparticles, means that such nucleic acids and / or compositions maintain one or more aspects of their characteristics (e.g., physical and / or structural characteristics, function, and / or activity) over a period of time under a designated set of conditions (e.g., pH, temperature, light, relative humidity, etc.). In some embodiments, such stability is maintained over a period of time of at least about one hour; in some embodiments, such stability is maintained over a period of time of about 5 hours, about 10 hours, about one (1) day, about one (1) week, about two (2) weeks, about one (1) month, about two (2) months, about three (3) months, about four (4) months, about five (5) months, about six (6) months, about eight (8) months, about ten (10) months, about twelve (12) months, about twenty-four (24) months, about thirty-six (36) months, or longer. In some embodiments, such stability is maintained over a period of time within the range of about one (1) day to about twenty-four (24) months, about two (2) weeks to about twelve (12) months, about two (2) months to about five (5) months, etc. In some embodiments, such stability is maintained under an ambient condition (e.g., at room temperature and ambient pressure). In some embodiments, such stability is maintained under a physiological condition (e.g., in vivo or at about 37 °C for example in serum or in phosphate buffered saline). In some embodiments, such stability is maintained under cold storage (e.g., at or below about 4 °C, including, e.g., -20 °C, or -70 °C). In some embodiments, such stability is maintained when nucleic acids and / or compositions comprising the same are protected from light (e.g., maintaining in the dark).

[0211] As an example, in some embodiments, the term “stable” is used in reference to a nanoparticle composition (e.g., a lipid nanoparticle composition). In such embodiments, a stable nanoparticle composition (e.g., a stable nanoparticle composition) and / or component(s) thereof maintain one or more aspects of its characteristics (e.g., physical and / or structural characteristics, function(s), and / or activity) over a period of time under a designated set of conditions. For example, in some embodiments, a stable nanoparticle composition (e.g. , a lipid nanoparticle composition) is characterized in that average particle size, particle size distribution, and / or polydispersity of nanoparticles is substantially maintained (e.g., within 10% or less, as compared to the initial characteristic(s)) over a period of time (e.g., as described herein) under a designated set of conditions (e.g., as described herein). In some embodiments, a stable nanoparticle composition (e.g. , a lipid nanoparticle composition) is characterized in that no detectable amount of degradation products (e.g., associated with hydrolysis and / or enzymatic digestion) is present after it is maintained under a designated set of conditions (e.g., as described herein) over a period of time.

[0212] Stealth moiety or stealth agent: As used herein, the terms "stealth moiety" or “stealth agent” describe a chemical moiety or an agent that prevents that the moiety itself or the agent itself, or that a compound bound to the moiety or the agent or that a particle, such as a particle described herein (e.g. an LNP), bound to the moiety or the agent is detected and then sequestered and / or degraded, or is hardly detected and then sequestered and / or degraded, and / or is detected and then sequestered and / or degraded late, by the immune system of the host to which they are administered. Macrophages constitute one of the most important components of the immune system and play a predominant role in eliminating foreign particles, including liposomes and other colloidal particles, from the blood circulation. At the molecular level, the clearance of particles takes place in two steps: opsonization by the depositing of serum proteins (or "opsonins") at the surface of the particles followed by recognition and capture of the opsonized particles by macrophages. The stealth moiety or the stealth agent may be a polymer (“stealth polymer”), such as a polyethylene glycol (PEG), a polysarcosine (pSAR) or a poly-(2-(2-(2-aminoethoxy)ethoxy)acetic acid) (pAEEA).

[0213] Stealth lipid: As used herein, the term “stealth lipid” is a lipid covalently bonded to a stealth moiety or a stealth agent. In one embodiment, a stealth lipid comprises a lipid bound to PEG (PEGylated lipid or PEG lipid), a lipid bound to pSAR (pSarcosylated lipid or pSAR lipid) or a lipid bound to pAEEA (pAEEA lipid). When an LNP comprises a stealth lipid, the stealth lipid can provide stealth properties to the LNP. Synthetic: As used herein, the term “synthetic” refers to an entity that is artificial, or that is made with human intervention, or that results from synthesis rather than naturally occurring. For example, in some embodiments, a synthetic nucleic acid or polynucleotide refers to a nucleic acid molecule that is chemically synthesized, e.g., in some embodiments by solid-phase synthesis. In some embodiments, the term “synthetic” refers to an entity that is made outside of biological cells. For example, in some embodiments, a synthetic nucleic acid or polynucleotide refers to a nucleic acid molecule (e.g., an RNA) that is produced by in vitro transcription using a template.

[0214] Three prime untranslated region: As used herein, the terms "three prime untranslated region" or "3' UTR" refer to the sequence of an mRNA molecule that begins following the stop codon of the coding region of an open reading frame sequence. In some embodiments, the 3' UTR begins immediately after the stop codon of the coding region of an open reading frame sequence. In other embodiments, the 3' UTR does not begin immediately after stop codon of the coding region of an open reading frame sequence

[0215] Threshold level (e.g., acceptance criteria) : As used herein, the term “threshold level” refers to a level that are used as a reference to attain information on and / or classify the results of a measurement, for example, the results of a measurement attained in an assay. For example, in some embodiments, a threshold level means a value measured in an assay that defines the dividing line between two subsets of a population (e.g. a batch that satisfy quality control criteria vs. a batch that does not satisfy quality control criteria). Thus, a value that is equal to or higher than the threshold level defines one subset of the population, and a value that is lower than the threshold level defines the other subset of the population. A threshold level can be determined based on one or more control samples or across a population of control samples. A threshold level can be determined prior to, concurrently with, or after the measurement of interest is taken. In some embodiments, a threshold level can be a range of values.

[0216] Vector : As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA into which additional DNA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g. , non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors.” Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g.. electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), which is incorporated herein by reference for any purpose.

[0217] Brief description of the drawings

[0218] Figure 1 illustrates a system for and a method of forming or providing a liquid composition comprising lipid nanoparticles.

[0219] Figure 2 illustrates a system for and a method of forming or providing a liquid composition comprising lipid nanoparticles using a T-mixer as mixing component.

[0220] Figures 3A and 3B depict results obtained for the setting shown in figure 2 for different flow rates and two different first liquids.

[0221] Figure 4 depicts an exemplary process flow charts of manufacturing an RNA (e.g., for encapsulation in LNPs).

[0222] Figure 5 depicts an overview of an exemplary LNP drug product manufacturing process.

[0223] Figure 6 depicts an overview of an exemplary process of DNA template manufacture via a PCR-based process.

[0224] Figure 7 depicts an exemplary LNP manufacturing process.

[0225] Figure 8 depicts an exemplary process by which a drug product composition can be filled / finished.

[0226] Figure 9 depicts a Pareto effects chart illustrating relative influences of various factors on LNP particle size and stability.

[0227] Figure 10 depicts an exemplary process for LNP manufacturing (e.g., of RNA-LNPs), according to aspects of the present embodiments. Figure 11 depicts an exemplary system for LNP manufacturing (e.g., of RNA-LNPs), according to aspects of the present embodiments.

[0228] Figures 12 A to 12 C depict images of LNP samples, the images being obtained by transmission electron microscopy (TEM), particularly Cryo-TEM.

[0229] Figure 13 illustrates results obtained for compositions during LNP manufacturing, i.e. PDI and Vmax.

[0230] Detailed description

[0231] Advantageous Reynolds number regime for the lipid nanoparticle composition

[0232] Figure 1 schematically illustrates an embodiment of a system 300 for forming or providing a liquid composition comprising lipid nanoparticles. The system is expediently provided for conducting the methods described herein above and below. The system 300 comprises a mixing chamber 302. The mixing chamber has a first inlet 304 and a second inlet 306. The inlets 304 and 306 are provided to permit entry of a first liquid 308 and a second liquid 310 into the mixing chamber. The liquids may be provided in associated reservoirs which are in fluid communication with the associated inlet, e.g. via associated flow paths or the system may be connectable to such reservoirs. A first reservoir 312 in the depicted embodiment holds the first liquid 308 and a second reservoir 314 holds the second liquid 310. A first flow path 309 guides the first liquid 308 and a second flow path 311 guides the second liquid 310 towards the respective inlet. The respective flow path may be defined by one or more conduits, tubings and / or other structures limiting the flow path laterally with respect to the flow direction (e.g. by the mixing component mentioned below).

[0233] The mixing chamber 302 is part of a mixing component, device or unit 316. The respective inlet (first or second inlet) of the mixing chamber 302 may coincide with the inlet of the mixing component or an associated inlet of the mixing component (e.g. first inlet 318 or second inlet 320) may be arranged upstream of the mixing chamber (i.e. closer to the associated reservoir as seen along the flow path counter to the flow direction). Thus, the first liquid 308 can enter the mixing chamber or component via the first inlet (304, 318) and the second liquid (310) can enter the mixing chamber or component via the second inlet (306, 320). A first flow driver 322 may be provided to move the first liquid 308 into the mixing chamber 302 or the component 316. A second flow driver 324 may be provided to move the second liquid 310 into the mixing chamber 302 or the component 316. The respective flow driver may be a pump. The flow of the first liquid 308 towards and into the mixing chamber 302 or the mixing component 316 is highlighted by arrow 326, the flow of the second liquid 310 towards and into the mixing chamber 302 or the mixing component 316 is highlighted by arrow 328. The flow of the first and second liquids may be continuously driven into the mixing chamber. In the mixing chamber 302, the first and second liquids can mix for the liquid composition 330. The liquid composition 330 leaves the mixing chamber 302 via an outlet 332 of the mixing chamber. The outlet of the mixing component 316 may coincide with the outlet of the mixing chamber or be arranged downstream of the outlet 332 of the mixing chamber 302 (see outlet 334, for example).

[0234] The flow rate of the liquid composition 330 at the respective outlet may be defined by the flow rates of the first liquid and the second liquid into the mixing chamber 302, e.g. be equal to the sum of these flow rates.

[0235] After having left the mixing chamber and / or the mixing component, the liquid composition as indicated by arrow 336 continues its flow and can be further processed, e.g. buffered, purified, filtered and / or diluted. As an example, a further liquid 338 (third liquid) may be added to the flow of the liquid composition downstream of the mixing component or mixing chamber, e.g. a buffer, such as a quench buffer. The third liquid may be a citrate buffer. The third liquid 338 can be added to the liquid composition flow 336 at an angle to the liquid composition flow 336, e.g. less than 160°, such as about 90°. The liquid flow of the third liquid 338 is illustrated by arrow 340. The third liquid can be continuously guided into the liquid flow. The flow rate of the third liquid may be less than the one for the first liquid and / or the second liquid or less than the sum of these flow rates. The processed lipid nanoparticle composition flow 342 may be guided towards a further processing step or unit and / or leave the system 300 via a system outlet (not explicitly shown).

[0236] The first and second liquids entering the mixing chamber 302 are chosen so as to, when mixed, provide a lipid nanoparticle composition comprising lipid nanoparticles, expediently lipid nanoparticles encapsulating a pharmaceutically active substance, e.g. comprising RNA, such as mRNA. The respective liquids (first, second and / or third liquid) may be solutions. The lipid nanoparticle composition expediently is a dispersed phase or, in other words, a dispersion with lipid nanoparticles being the dispersed phase in a liquid. Both, the nanoparticles and the liquid expediently result from mixing the first liquid and the second liquid with one another in the mixing chamber. A preparation may comprise the processed lipid nanoparticle composition or the unprocessed lipid nanoparticle composition.

[0237] The first liquid 308 comprises the entity to be encapsulated by the nanoparticles, e.g. RNA, such as mRNA. The first liquid expediently has a pH of between 2 and 7, e.g. between 4 and 7 or between 4 and 6 (e.g. adjusted via citric acid or acetic acid). The first liquid may be an aqueous phase or solution. More detailed examples on the first liquid are given further below.

[0238] The second liquid 310 expediently comprises further ingredients for the nanoparticle formation. For example, the second liquid comprises one of, more of, or all of: a cationic lipid, a non-cationic or second cationic lipid or helper lipid, a PEG-lipid (sometimes also termed: PEGylated lipid), and cholesterol. More detailed examples on the second liquid are given further below. The second liquid 310 may be an organic phase and / or comprise an organic solvent, e.g. ethanol, propanol, isopropanol or acetone.

[0239] Surprisingly, it has been found that, when performing the mixing process such that at the outlet 334 or 332 the flow of the liquid composition is in a range of Reynolds numbers less than 10000 and optionally greater than 800, lipid nanoparticles encapsulating RNA, i.e. RNA-LNPs, with advantageous properties were formed. For example, the (average) size of the nanoparticles could be decreased (as compared to regimes with higher Reynolds numbers) and / or homogeneity of the dispersion with the nanoparticles could be increased (e.g. as the nanoparticles are more uniform in size which entails a smaller PDI). Having smaller particles and / or a more homogeneous particle size distribution facilitates further processing of any preparation comprising the nanoparticles formed. For example, less particles are lost during a filtration step or finer filters can be used.

[0240] In connection with the following figures this is explained in more detail.

[0241] Figure 2 shows a setting which is very similar to the one shown in figure 1 but with more details on the flow paths and some associated data. Hence, features described in conjunction with figure lalso apply for figure 2 and vice versa. Features from figure 1 are not repeated here.

[0242] In figure 2, a T-mixer (also referenced as "A" in the figure) is used as mixing component 316 for obtaining the liquid composition. "V" and "D" specify the viscosity (V) and density (D) of the respective liquid or the liquid composition. For the addition of the third liquid another T-mixer is used (designated as B). Also, the inner diameters of the flow path sections (e.g. provided by tube sections or the respective T-mixer) are specified as well as their lengths.

[0243] The flow rate of the first liquid may be greater than the flow rate of the second liquid. A ratio of the flow rate of the first liquid to the one of the second liquid may be less than or equal to one of the following: 7, 6, 5, 4, 3. For example, the flow rate of the first liquid is about or equal to 3 times the flow rate of the second liquid. The combined flow rate of the first and second liquids into the mixing chamber may then determine the flow rate of the liquid composition away from the mixing chamber 302. In the setting shown in figure 2, the first and second liquids are mixed using a T-mixer in an impingement liquid setting. The flow directions of the liquid flows are diametrically opposite and the liquids hit one another (frontally) in the mixing chamber. The two impinging liquid streams may create some turbulences which may enhance the mixing in the chamber. However laminar flow in the mixing chamber may also be possible. The liquid composition leaves the mixing component 316 at its outlet 334 in a flow direction which is at an angle of 90° or about 90° relative to the flow directions of the first and second liquid into the mixing chamber. The densities (denoted "D" in kg / m3) and viscosities (denoted "V" in centipoise) specified in figure 2 are typical values occurring when forming lipid nanoparticle compositions from mixing two liquids. The diameters of the inlets and the outlet of the mixing chamber or the mixing component are equal. However, it is also conceivable that the inlets have different diameters. For example, the inlet for the first liquid may have a greater diameter than the inlet for the second liquid. The outlet may have a greater or smaller diameter than at least one of the inlets, e.g. greater than the first inlet and / or the second inlet. Instead of the T-mixer "A" it is also conceivable to use a dedicated impingement jet mixing unit for mixing the first and second liquid as is described further below.

[0244] Figures 3A and 3B show results obtained for the setting shown in figure 2 for different flow rates and two different first liquids (with RNA). The first liquids employed differed only in the additives or buffers used, i.e. for Liquid 1 citric acid and / or citrate (e.g. natrium citrate) was used (the liquid comprises citrate, indicated by (Ci)) and for Liquid 2 acetic acid and / or acetate (e.g. natrium acetate) was used (the liquid comprises acetate, indicated by (Ac)). The flow rate of the liquid composition with the nanoparticles encapsulating RNA at the outlet of the mixing chamber or of the mixing component was varied between 100 ml / min (via adjusting the flow rates for the first and second liquid appropriately while keeping their ratio at 3:1) and 300 ml / min.

[0245] Measurements were made to determine the (average) size of the nanoparticles in the liquid composition and their polydispersity index (PDI). As is apparent, for Reynolds numbers at the outlet 334 of the mixing component 316 below about 10000, the PDI is consistently below about 0.13 and the size is below about 70 nm, 65 nm and / or 60 nm for flow rates greater than 100 ml / min. As noted above, the flow rate in combination with the cross-sectional area of the (inner bore of the) outlet of the mixing component determines the velocity required for the Reynolds number calculation.

[0246] The measurements for the PDI and the average particle size were made using dynamic light scattering, e.g. using a Zetasizer available from Malvern. The Zetasizer calculates the PDI and the average particle size.

[0247] As noted, the data relating to PDI and size were obtained using a Malvern Zetasizer Ultra, which is a system designed to measure and calculate particle properties, such as by using dynamic light scattering. The (colloidal) parameters size and polydispersity (descriptive of the width of the size distribution) of LNPs produced were analyzed by dynamic light scattering (DLS) in the Malvern Panalytical Zetasizer Ultra. Samples were diluted to 2 pg / mL in phosphate-buffered saline (PBS) and were measured in PMMA cuvettes by back-scattering (173°) at 25 °C. The cuvette was set as ZEN0040, material was set as protein (refractive index RI 1.45, absorption 0.001) and RI and viscosity for PBS were 1.34 and 0.91 cP, respectively. Choice of all other measurement parameters was set to "automatic". Measurement of each sample was repeated three times. Cumulants fit with the model “General Purpose” was used for data evaluation. The “general purpose model” is a model which needs to be selected as a pre-setting for measurement of a “standard, non-deviating, known and expected” sample of nanoparticles and uses a certain cumulant fit for calculation of size and distribution in the Zetasizer defined by the software of the Zetasizer. The investigations were performed using the following versions of the firmware and the software of the Malvern Panalytical Zetasizer Ultra: Firmware 1.02.042 and Software 2.2.0.147. In case of doubt, these can be used in the Malvern Zetasizer Ultra for determining PDI and / or size of nanoparticles described herein.

[0248] The results depicted in figure 3A result from the data points shown in the following table:

[0249] The data point at 240 ml / min with the Reynolds number of 9949 was qualified as likely resulting from an irregularity during the measurement.

[0250] The results depicted in figure 3B resulted from the data points shown in the following table: The results shown in Figures 3A and 3B give a clear indication that staying in the Reynolds number regime of below 10000 has advantageous effects on particle size (which was below 60 nm for both first liquids) and / or on the PDI. This was achieved at comparatively high flow rates of the liquid composition after mixing which indicates a suitability of the proposed process for mass production.

[0251] The advantageous effects for the formed nanoparticles were achieved independent from the buffer used for the first liquid (citrate and acetate were used for Liquids 1 and 2, respectively) and also independent from the flow drivers which were used. For Liquid 1 a syringe pump system or SPS was used (e.g. available from Cetoni), whereas for Liquid 2 a piston pump system (e.g. available from Knauer) was used.

[0252] Further examples for LNP compositions and associated processes, for which the proposed concepts having a Reynolds number of the liquid composition flow (particularly after the initial mixing of the first and second liquids and / or before the liquid composition is further processed, e.g. before the third liquid is added) of 10000 and below are advantageous are set forth below.

[0253] Further processing of the liquid composition, e.g. the unprocessed composition or the one to which the third liquid has been added or an even further processed liquid composition, with nanoparticles, may include filtering using a 0.2 pm filter, e.g. a Sartopore 2 filter. A filter area of the filter can be less than or equal to A m2per gram of lipid nanoparticles in the liquid composition, where A is 120, for example.

[0254] LNP production and related processes

[0255] Nucleic acid therapeutics, and particularly RNA therapeutics represent a particularly promising class of therapies for treatment and prevention of various diseases such as cancer, infectious diseases, and / or diseases or disorders associated with overabundance or deficiency in certain proteins.

[0256] RNA therapeutics in particular have proven remarkably effective as vaccines to address the COVID 19 pandemic. Particularly given the promise of this technology, and its adaptability to a wide variety of clinical contexts, including massively large scale (e.g., vaccination and / or treatment on a global scale such as is under development for SARS-CoV-2), improvements to manufacturing technologies, especially those applicable to large-scale production, are especially valuable.

[0257] Development of effective delivery technologies has been central to the success of nucleic acid therapeutics, and lipid nanoparticle technologies have proven to be particularly effective (reviewed in, for example, Cullis et al. Molecular Therapy 25:1467, July 5, 2017; See also, US Patent 8058069), specifically including for RNA therapeutics (reviewed in, for example, Hou et al., Nat. Rev. Mater doi.org / 10.1038 / s41578-021-00358-0, August 10, 2021).

[0258] Technologies provided herein are useful, among other things, to achieve particularly effective and / or efficient production, e.g., on commercial scale and / or under commercial conditions, of pharmaceutical grade LNP preparations and / or compositions (e.g., nucleic acid-LNP preparations, and specifically RNA- LNP preparations). For example, in various embodiments, provided technologies permit and / or facilitate achievement of requirements unique to pharmaceutical-grade (and / or scale) production such as, for example, batch size and / or rate of production, pre -determined in-process controls and / or lot release specifications (e.g., high purity, integrity, potency, and / or stability, etc.), etc..

[0259] The present disclosure provides technologies for manufacturing LNP compositions (e.g., including RNA, e.g., therapeutic RNA such as therapeutic mRNA). In some embodiments, provided technologies are useful for manufacturing pharmaceutical-grade RNA-LNP therapeutics.

[0260] In some embodiments, provided technologies are useful for large scale manufacturing of LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) therapeutics, e.g., pharmaceutical-grade therapeutics. For example, in some such embodiments, technologies provided herein can be used to produce a pharmaceutical-grade batch throughput of at least 10,000 vials of LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) therapeutics (including, e.g., at least 20,000 vials, at least 30,000 vials, at least 40,000 vials, at least 50,000 vials, at least 60,000 vials, at least 70,000 vials, at least 80,000 vials, at least 90,000 vials, at least 100,000 vials, at least 200,000 vials, at least 300,000 vials, at least 400,000 vials, at least 500,000 vials, or more). For example, in some such embodiments, technologies provided herein can be used to produce a pharmaceutical-grade batch throughput of at least 50 L of LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) therapeutics (including e.g., at least 50L, at least 60L, at least 70L, at least 80L, at least 100L, at least 110 L, at least 120 L, at least 130 L, at least 140 L, at least 150 L or more. In some embodiments, each vial can comprise an RNA drug product in an amount of 0.01 mg to 0.5 mg (e.g., 0.01 mg, 0.02 mg, 0.03 mg, 0.04 mg, 0.05 mg, 0.06 mg, 0.07 mg, 0.08 mg, 0.09 mg, 0.1 mg, 0.15 mg, 0.2 mg, 0.25 mg, 0.3 mg, 0.35 mg, 0.4 mg, 0.45 mg, 0.5 mg).

[0261] Technologies described herein can be useful for manufacturing LNP (e.g., nucleic acid-LNP, e.g., RNA- LNP) compositions for treatment and / or prevention of a disease, disorder, or condition (e.g., cancer, infectious diseases, diseases associated with protein deficiency, etc.). In some embodiments, technologies described herein can be useful for manufacturing LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) compositions that comprise or deliver (e.g., by comprising and / or delivering a nucleic acid, such as an RNA, that encodes it) a polypeptide. In some particular embodiments, technologies described herein can be useful for manufacturing LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) compositions for inducing an immune response to an antigen. In some embodiments, technologies described herein can be useful for manufacturing LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) compositions for treatment and / or prevention of coronavirus infection, e.g., SARS-CoV-2 infection, as described in Walsh et al. “RNA-based COVID-19 vaccine BNT162b2 selected for a pivotal efficacy study” medRxiv preprint (2020), which is online accessible at: https: / / doi.org / 10. ] 101 / 2020.08.17.20176651; and Milligan et al. “Phase I / II study of COVID-19 RNA vaccine BNT162bl in adults” Nature (2020 August), which is online accessible at: https: / / doi.org / 10. l()38 / s41586-02()-2639-4, the contents of each of which are incorporated by reference in their entirety.

[0262] Lipid Nanoparticles

[0263] Those skilled in the art are aware that lipid nanoparticles have achieved successful clinical delivery of a wide range of therapeutic agents including, for example, small molecules, and various nucleic acids - e.g., oligonucleotides, siRNAs, and mRNAs (reviewed, for example, in Hu et al., Nat. Rev. Mater. https: / / doi.org / 10. 1038 / s41578-021-()0358-0, August 10, 2021).

[0264] Various routes of administration for lipid nanoparticle compositions have been proposed and / or tested; those skilled in the art will be aware of appropriate routes for particular compositions (e.g., depending on agent being delivered). To give but a few examples, in some embodiments, LNPs are parenterally administered; most clinical studies have utilized parenteral administration, and particularly intravenous, subcutaneous, intradermal, intravitreal, intratumoral, or intramuscular injection. Intrautero injection has also been described. In some embodiments, topical administration is utilized. In some embodiments, intranasal administration is utilized.

[0265] In some embodiments, administered LNPs are delivered to or accumulate in the liver. Given that the liver is naturally effective at producing and secreting proteins, liver delivery can prove useful for achieving delivery of an LNP-encapsulated agent (and / or, in the case of a nucleic acid agent such as an RNA agent, a polypeptide encoded thereby) into the bloodstream. Such liver delivery has been proposed to be particularly useful, for example, for expression of proteins that are missing in certain metabolic or hematological disorders, or that are effective in provoking immune responses (e.g., particularly antibody responses), for example against infectious agents or cancer cells.

[0266] In some embodiments, administered LNPs are delivered to and / or taken up by antigen-presenting cells (e.g., as may be present in skin, muscle, mucosal tissues, etc. f, such administration may be particularly useful or effective for induction of T cell immunity (e.g., for treatment of infectious diseases and / or cancers).

[0267] In various embodiments, lipid nanoparticles can have an average size (e.g., mean diameter) of about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 50 nm to about 130 nm, about 50 nm to about 110 nm, about 50 nm to about 100 nm, about 50 to about 90 nm, or about 60 nm to about 80 nm, or about 60 nm to about 70 nm. In some embodiments, lipid nanoparticles that may be useful in accordance with the present disclosure can have an average size (e.g., mean diameter) of about 50 nm to about 100 nm. In some embodiments, lipid nanoparticles may have an average size (e.g. , mean diameter) of less than 80 nm, less than 75 nm, less than 70 nm, less than 65 nm, less than 60 nm, less than 55 nm, less than 50 nm, or less than 45 nm. In some embodiments, lipid nanoparticles that may be useful in accordance with the present disclosure can have an average size (e.g., mean diameter) of about 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm.

[0268] In some embodiments, lipids that form lipid nanoparticles described herein comprise: a polymer - conjugated lipid; a cationic lipid; and a helper neutral lipid. In some such embodiments, total polymer- conjugated lipid may be present in about 0.5-5 mol%, about 0.7-3.5 mol%, about 1-2.5 mol%, about 1.5-2 mol%, or about 1.5-1.8 mol% of the total lipids. In some embodiments, total polymer-conjugated lipid may be present in about 1-2.5 mol% of the total lipids. In some embodiments, the molar ratio of total cationic lipid to total polymer-conjugated lipid (e.g., PEG-conjugated lipid) may be about 100:1 to about 20:1, or about 50:1 to about 20:1, or about 40:1 to about 20:1, or about 35:1 to about 25:1. In some embodiments, the molar ratio of total cationic lipid to total polymer-conjugated lipid may be about 35:1 to about 25:1.

[0269] In some embodiments involving a polymer-conjugated lipid, a cationic lipid, and a helper neutral lipid in lipid nanoparticles described herein, total cationic lipid is present in about 35-65 mol%, about 40-60 mol%, about 41-49 mol%, about 41-48 mol%, about 42-48 mol%, about 43-48 mol%, about 44-48 mol%, about 45-48 mol%, or about 46-49 mol% of the total lipids. In certain embodiments, total cationic lipid is present in about 47.0, 47.1, 47.2, 47.3, 47.4, 47.5, 47.6, 47.7, 47.8, 47.9 or 48.0 mol% of the total lipids.

[0270] In some embodiments involving a polymer-conjugated lipid, a cationic lipid, and a helper neutral lipid in lipid nanoparticles described herein, total neutral lipid is present in about 35-65 mol%, about 40-60 mol%, about 45-55 mol%, or about 47-52 mol% of the total lipids. In some embodiments, total neutral lipid is present in 35-65 mol% of the total lipids. In some embodiments, total non-steroid neutral lipid (e.g., DPSC) is present in about 5-15 mol%, about 7-13 mol%, or 9-11 mol% of the total lipids. In some embodiments, total non-steroid neutral lipid is present in about 9.5, 10 or 10.5 mol% of the total lipids. In some embodiments, the molar ratio of the total cationic lipid to the non-steroid neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0, from about 4.5: 1.0 to about 4.8: 1.0, or from about 4.7: 1.0 to 4.8: 1.0. In some embodiments, total steroid neutral lipid (e.g., cholesterol) is present in about 35- 50 mol%, about 39-49 mol%, about 39-46 mol%, about 39- 44 mol%, or about 39-42 mol% of the total lipids. In certain embodiments, total steroid neutral lipid (e.g., cholesterol) is present in about 39, 40, 41, 42, 43, 44, 45, or 46 mol% of the total lipids. In certain embodiments, the molar ratio of total cationic lipid to total steroid neutral lipid is about 1.5:1 to 1: 1.2, or about 1.2: 1 to 1: 1.2.

[0271] In some embodiments, a lipid composition comprising a cationic lipid, a polymer-conjugated lipid, and a neutral lipid can have individual lipids present in certain molar percents of the total lipids, or in certain molar ratios (relative to each other) as described in WO 2018 / 081480, the entire contents of each of which are incorporated herein by reference for the purposes described herein.

[0272] In some embodiments, lipids that form the lipid nanoparticles comprise: a polymer-conjugated lipid (e.g., PEG-conjugated lipid); a cationic lipid; and a neutral lipid, wherein the polymer-conjugated lipid is present in about 1-2.5 mol% of the total lipids; the cationic lipid is present in 35-65 mol% of the total lipids; and the neutral lipid is present in 35-65 mol% of the total lipids. In some embodiments, lipids that form the lipid nanoparticles comprise: a polymer-conjugated lipid (e.g., PEG-conjugated lipid); a cationic lipid; and a neutral lipid, wherein the polymer-conjugated lipid is present in about 1-2 mol% of the total lipids; the cationic lipid is present in 45-48.5 mol% of the total lipids; and the neutral lipid is present in 45-55 mol% of the total lipids. In some embodiments, lipids that form the lipid nanoparticles comprise: a polymer-conjugated lipid (e.g., PEG-conjugated lipid); a cationic lipid; and a neutral lipid comprising a non-steroid neutral lipid and a steroid neutral lipid, wherein the polymer-conjugated lipid is present in about 1-2 mol% of the total lipids; the cationic lipid is present in 45-48.5 mol% of the total lipids; the non-steroid neutral lipid is present in 9-11 mol% of the total lipids; and the steroid neutral lipid is present in about 36-44 mol% of the total lipids. In many of such embodiments, a PEG-conjugated lipid is or comprises a structure as described in WO

[0273] 2017 / 075531 (also described above), or a derivative thereof. In some embodiments, a PEG-conjugated lipid is or comprises 2- [(polyethylene glycol )-2000|-JV, A'-ditctradccylacctamidc. In many of such embodiments, a cationic lipid is or comprises a chemical structure selected from 1-1 to I- 10 of Table 1 herein or a derivative thereof. In some embodiments, a cationic lipid is or comprises ((4- hydroxybutyl)azanediyl)bis(hexane-6,l-diyl)bis(2-hexyldecanoate). In many of such embodiments, a neutral lipid comprises DSPC (l,2-distearoyl-sn-glycero-3-phosphocholine) and cholesterol, wherein DSPC is a non-steroid neutral lipid and cholesterol is a steroid neutral lipid.

[0274] In some embodiments, lipid nanoparticles include one or more cationic lipids (e.g., ones described herein). In some embodiments, cationic lipid nanoparticles may comprise at least one cationic lipid, at least one polymer -conjugated lipid, and at least one helper lipid (e.g., at least one neutral lipid).

[0275] 1. Helper lipids

[0276] In some embodiments, a lipid nanoparticle described herein comprises at least one helper lipid, which may be a neutral lipid, a positively charged lipid, or a negatively charged lipid. In some embodiments, a helper lipid is a lipid that are useful for increasing the effectiveness of delivery of lipid-based particles such as cationic lipid-based particles to a target cell. In some embodiments, a helper lipid may be or comprise a structural lipid with its concentration chosen to optimize LNP particle size, stability, and / or encapsulation.

[0277] In some embodiments, a lipid nanoparticle described herein comprises a neutral helper lipid. Examples of such neutral helper lipids include, but are not limited to phosphotidylcholines such as 1 ,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), l,2-Dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC), 1,2- Dimyristoyl-sn-glycero-3-phosphocholine (DMPC), l-palmitoyl-2-oleoyl-sn-glycero-3 -phosphocholine (POPC), 1 ,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), phophatidylethanolamines such as 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), sphingomyelins (SM), ceramides, cholesterol, steroids such as sterols and their derivatives. Neutral lipids may be synthetic or naturally derived. Other neutral helper lipids that are known in the art, e.g., as described in WO 2017 / 075531 and WO 2018 / 081480, the entire contents of each of which are incorporated herein by reference for the purposes described herein, can also be used in lipid nanoparticles described herein. In some embodiments, a lipid nanoparticle for delivery of RNA(s) described herein comprises DSPC and / or cholesterol.

[0278] In some embodiments, a lipid nanoparticle described herein comprises at least two helper lipids (e.g., ones described herein). In some such embodiments, a lipid nanoparticle may comprise DSPC and cholesterol.

[0279] 2. Cationic lipids

[0280] In some embodiments, a lipid nanoparticle described herein comprises a cationic lipid. A cationic lipid is typically a lipid having a net positive charge. In some embodiments, a cationic lipid may comprise one or more amine group(s) which bear a positive charge. In some embodiments, a cationic lipid may comprise a cationic, meaning positively charged, headgroup. In some embodiments, a cationic lipid may have a hydrophobic domain (e.g., one or more domains of a neutral lipid or an anionic lipid) provided that the cationic lipid has a net positive charge. In some embodiments, a cationic lipid comprises a polar headgroup, which in some embodiments may comprise one or more amine derivatives such as primary, secondary, and / or tertiary amines, quaternary ammonium, various combinations of amines, amidinium salts, or guanidine and / or imidazole groups as well as pyridinium, piperizine and amino acid headgroups such as lysine, arginine, ornithine and / or tryptophan. In some embodiments, a polar headgroup of a cationic lipid comprises one or more amine derivatives. In some embodiments, a polar headgroup of a cationic lipid comprises a quaternary ammonium. In some embodiments, a headgroup of a cationic lipid may comprise multiple cationic charges. In some embodiments, a headgroup of a cationic lipid comprises one cationic charge. Examples of monocationic lipids include, but are not limited to 1,2-dimyristoyl-sn- glycero-3-ethylphosphocholine (DMEPC), 1 ,2-di-O-octadecenyl- 3 -trimethylammonium propane (DOTMA) and / or 1 ,2-dioleoyl-3 -trimethylammonium propane (DOTAP), l,2-dimyristoyl-3- trimethylammonium propane (DMTAP), 2,3- di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium bromide (DMRIE), didodecyl(dimethyl)azanium bromide (DDAB), 1 ,2-dioleyloxypropyl-3 -dimethyl - hydroxyethyl ammonium bromide (DORIE), 3P-[N-(N\N'-dimethylamino- ethane)carbamoyl] cholesterol (DC-Choi) and / or dioleyl ether phosphatidylcholine (DOEPC).

[0281] In some embodiments, a positively charged lipid structure described herein may also include one or more other components that may be typically used in the formation of vesicles (e.g. for stabilization). Examples of such other components includes, without being limited thereto, fatty alcohols, fatty acids, and / or cholesterol esters or any other pharmaceutically acceptable excipients which may affect the surface charge, the membrane fluidity and assist in the incorporation of the lipid into the lipid assembly. Examples of sterols include cholesterol, cholesteryl hemisuccinate, cholesteryl sulfate, or any other derivatives of cholesterol. Preferably, the at least one cationic lipid comprises DMEPC and / or DOTMA.

[0282] In some embodiments, a cationic lipid is ionizable such that it can exist in a positively charged form or neutral form depending on pH. Such ionization of a cationic lipid can affect the surface charge of the lipid particle under different pH conditions, which in some embodiments may influence plasma protein absorption, blood clearance, and / or tissue distribution as well as the ability to form endosomolytic non- bilayer structures. Accordingly, in some embodiments, a cationic lipid may be or comprise a pH responsive lipid. In some embodiments a pH responsive lipid is a fatty acid derivative or other amphiphilic compound which is capable of forming a lyotropic lipid phase, and which has a pKa value between pH 5 and pH 7.5. This means that the lipid is uncharged at a pH above the pKa value and positively charged below the pKa value. In some embodiments, a pH responsive lipid may be used in addition to or instead of a cationic lipid for example by binding one or more RNAs to a lipid or lipid mixture at low pH. pH responsive lipids include, but are not limited to, 1,2- dioieyioxy-3 -dimethylamino- propane (DODMA).

[0283] In some embodiments, a lipid nanoparticle may comprise one or more cationic lipids as described in WO 2016 / 176330, WO 2017 / 075531 (e.g., as presented in Tables 1 and 3 therein) and WO 2018 / 081480 (e.g., as presented in Tables 1-4 therein), the entire contents of each of which are incorporated herein by reference for the purposes described herein.

[0284] In some embodiments, a cationic lipid that may be useful in accordance with the present disclosure is an amino lipid comprising a titratable tertiary amino head group linked via ester bonds to at least two saturated alkyl chains, which ester bonds can be hydrolyzed easily to facilitate fast degradation and / or excretion via renal pathways. In some embodiments, such an amino lipid has an apparent pKaof about 5.5-6.5 (e.g., in one embodiment with an apparent pKaof approximately 6.1), resulting in an essentially fully positively charged molecule at an acidic pH (e.g., pH 5). In some embodiments, such an amino lipid, when incorporated in LNP, can confer distinct physicochemical properties that regulate particle formation, cellular uptake, fusogenicity and / or endosomal release of RNA(s). In some embodiments, introduction of an aqueous RNA solution to a lipid mixture comprising such an amino lipid at pH 4.0 can lead to an electrostatic interaction between the negatively charged RNA backbone and the positively charged cationic lipid. Without wishing to be bound by any particular theory, such electrostatic interaction leads to particle formation coincident with efficient encapsulation of RNA drug substance. After RNA encapsulation, adjustment of the pH of the medium surrounding the resulting LNP to a more neutral pH (e.g. , pH 7.4) results in neutralization of the surface charge of the LNP. When all other variables are held constant, such charge-neutral particles display longer in vivo circulation lifetimes and better delivery to hepatocytes compared to charged particles, which are rapidly cleared by the reticuloendothelial system. Upon endosomal uptake, the low pH of the endosome renders LNP comprising such an amino lipid fusogenic and allows the release of the RNA into the cytosol of the target cell.

[0285] In some embodiments, a cationic lipid that may be useful in accordance with the present disclosure has one of the structures disclosed in WO 2017 / 075531, some of which are set forth in Table 1 below:

[0286] Table 1: Exemplary cationic lipids

[0287]

[0288] In certain embodiments, a cationic lipid that may be useful in accordance with the present disclosure is or comprises a chemical structure selected from 1-1 to I- 10 as shown in Table 1 above. In some embodiments, a cationic lipid is or comprises a chemical structure of 1-3 shown in Table 1 above. In some embodiments, a cationic lipid is or comprises ((4-hydroxybutyl)azanediyl)bis(hexane-6,l-diyl)bis(2- hexy Idee ano ate) . In certain embodiments, a cationic lipid that may be useful in accordance with the present disclosure is or comprises a chemical structure selected from A-F as shown in Table 2 below. In some embodiments, a cationic lipid is or comprises a chemical structure of B shown in Table 2 above. In some embodiments, a cationic lipid is or comprises a chemical structure of D shown in Table 2 above.

[0289] In certain embodiments, a cationic lipid that may be useful in accordance with the present disclosure is an ionizable lipid-like material (lipidoid). In some embodiments, such a lipidoid is C12-200, which has the following structure:

[0290] Cationic lipids may be used alone or in combination with neutral lipids, e.g., cholesterol and / or neutral phospholipids, or in combination with other known lipid assembly components.

[0291] 3. Polymer-conjugated lipids

[0292] In some embodiments, a lipid nanoparticle may comprise at least one polymer-conjugated lipid. A polymer-conjugated lipid is typically a molecule comprising a lipid portion and a polymer portion conjugated thereto.

[0293] In some embodiments, a polymer-conjugated lipid is a PEG-conjugated lipid. In some embodiments, a PEG-conjugated lipid is designed to sterically stabilize a lipid particle by forming a protective hydrophilic layer that shields the hydrophobic lipid layer. In some embodiments, a PEG-conjugated lipid can reduce its association with serum proteins and / or the resulting uptake by the reticuloendothelial system when such lipid particles are administered in vivo.

[0294] Various PEG-conjugated lipids are known in the art and include, but are not limited to pegylated diacylglycerol (PEG-DAG) such as l-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG- DMG), a pegylated phosphatidylethanoloamine (PEG-PE), a PEG succinate diacylglycerol (PEG-S- DAG) such as 4-O-(2' ,3 ’-di(tetradecanoyloxy)propyl-l-O-(a>-methoxy(polyethoxy)ethyl) butanedioate (PEG-S-DMG), a pegylated ceramide (PEG-cer), or a PEG dialkoxypropylcarbamate such as ro- methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyl-N- (a> methoxy(polyethoxy)ethyl)carbamate, and the like.

[0295] Certain PEG-conjugated lipids (also known as PEGylated lipids) were clinically approved with safety demonstrated in clinical trials. PEG-conjugated lipids are known to affect cellular uptake, a prerequisite to endosomal localization and payload delivery. The present disclosure, among other things, provides an insight that the pharmacology of encapsulated nucleic acid can be controlled in a predictable manner by modulating the alkyl chain length of a PEG-lipid anchor. In some embodiments, the present disclosure, among other things, provides an insight that such PEG-conjugated lipids may be selected for an RNA / LNP drug product formulation to provide optimum delivery of RNAs to the liver. In some embodiments, such PEG-conjugated lipids may be designed and / or selected based on reasonable solubility characteristics and / or its molecular weight to effectively perform the function of a steric barrier. For example, in some embodiments, such a PEGylated lipid does not show appreciable surfactant or permeability enhancing or disturbing effects on biological membranes. In some embodiments, PEG in such a PEG-conjugated lipid can be linked to diacyl lipid anchors with a biodegradable amide bond, thereby facilitating fast degradation and / or excretion. In some embodiments, a LNP comprising a PEG- conjugated lipid retain a full complement of a PEGylated lipid. In the blood compartment, such a PEGylated lipid dissociates from the particle over time, revealing a more fusogenic particle that is more readily taken up by cells, ultimately leading to release of the RNA payload.

[0296] In some embodiments, a lipid nanoparticle may comprise one or more PEG-conjugated lipids or pegylated lipids as described in WO 2015 / 199952, WO 2017 / 075531 and WO 2018 / 081480, the entire contents of each of which are incorporated herein by reference for the purposes described herein. For example, in some embodiments, a PEG-conjugated lipid that may be useful in accordance with the present disclosure can have a structure as described in WO 2017 / 075531, or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein: Rs and R9 are each independently a straight or branched, saturated or unsaturated alkyl chain containing from 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds; and w has a mean value ranging from 30 to 60. In some embodiments, R8 and R9 are each independently straight, saturated alkyl chains containing from 12 to 16 carbon atoms. In some embodiments, w has a mean value ranging from 43 to 53. In other embodiments, the average w is about 45. In some embodiments, a PEG-conjugated lipid is or comprises 2- [(polyethylene glycol) -2000] -N,N- ditetradecylacetamide.

[0297] Nucleic Acids

[0298] Those skilled in the art are aware that LNP technologies are useful for formulating (e.g., encapsulating) and / or otherwise assisting delivery of a variety of nucleic acid agents. In some embodiments, a nucleic acid agent may be single stranded; in some embodiments, a nucleic acid agent may be double stranded. In some embodiments, a nucleic acid agent may be or comprise DNA; in some embodiments, a nucleic acid agent may be or comprise RNA. As those skilled in the art are aware, in some embodiments, nucleic acids may include one or more non-natural features (e.g., residues, modifications, intra-nucleoside linkages, etc.). In some embodiments, a nucleic acid is a non-coding in that its nucleotide sequence does not include an open reading frame (or complement thereof). In some embodiments, a nucleic acid has a nucleotide sequence that is or includes a sequence that encodes (or is the complement of a sequence that encodes) a polypeptide as described herein. In some embodiments, a nucleic acid (e.g., and RNA) is or comprises a coding strand for at least one open reading frame (“ORF”); in some embodiments, a nucleic acid is or comprises an antisense strand (or portion thereof).

[0299] In some embodiments, a relevant nucleic acid includes a polypeptide -encoding portion. In some particular embodiments, such a portion may encode a polypeptide that is or comprises an antigen (or an epitope thereof), a cytokine, an enzyme, etc. In some embodiments, an encoded polypeptide may be or include one or more neoantigens or neoepitopes associated with a tumor. In some embodiments, an encoded polypeptide may be or include an antigen (or epitope thereof) of an infectious agent (e.g., a bacterium, fungus, virus, etc.). In certain embodiments, an encoded polypeptide may be a variant of a wild type polypeptide

[0300] In some embodiments, technologies described herein may utilize a nucleic acid having a length of at least 500 residues (such as, e.g., at least 600 residues, at least 700 residues, at least 800 residues, at least 900 residues, at least 1000 residues, at least 1250 residues, at least 1500 residues, at least 1750 residues, at least 2000 residues, at least 2500 residues, at least 3000 residues, at least 3500 residues, at least 4000 residues, at least 4500 residues, at least 5000 residues, or longer). In some embodiments, technologies described herein may utilize a nucleic acidhaving a length of about 1000 residues to 5000 residues.

[0301] In certain embodiments, nucleic acids (e.g., RNAs), when present in provided lipid nanoparticles, are resistant in aqueous solution to degradation with a nuclease.

[0302] RNAs

[0303] In some particular embodiments, the present disclosure relates to production and / or use (e.g., handling, processing, transporting, etc.) of LNP compositions that include RNA.

[0304] In some embodiments, an RNA amenable to technologies described herein is a single-stranded RNA. In some embodiments, an RNA as disclosed herein is a linear RNA. In some embodiments, a singlestranded RNA is a non-coding RNA in that its nucleotide sequence does not include an open reading frame (or complement thereof). In some embodiments, a single-stranded RNA has a nucleotide sequence that encodes (or is the complement of a sequence that encodes) a polypeptide or a plurality of polypeptides (e.g., epitopes) of the present disclosure. In many embodiments, a relevant RNA is an mRNA.

[0305] In some embodiments, an RNA includes unmodified uridine residues; an RNA that includes only unmodified uridine residues may be referred to as a “uRNA”. In some embodiments, an RNA includes one or more modified uridine residues; in some embodiments, such an RNA (e.g., an RNA including entirely modified uridine residues) is referred to as a “modRNA”. In some embodiments, an RNA may be a self-amplifying RNA (saRNA). In some embodiments, an RNA may be a trans-amplifying RNA (see, for example, WO2017 / 162461).

[0306] In some embodiments, technologies described herein may be particularly useful for production of an RNA (e.g., a single stranded RNA) having a length of at least 500 ribonucleotides (such as, e.g., at least 600 ribonucleotides, at least 700 ribonucleotides, at least 800 ribonucleotides, at least 900 ribonucleotides, at least 1000 ribonucleotides, at least 1250 ribonucleotides, at least 1500 ribonucleotides, at least 1750 ribonucleotides, at least 2000 ribonucleotides, at least 2500 ribonucleotides, at least 3000 ribonucleotides, at least 3500 ribonucleotides, at least 4000 ribonucleotides, at least 4500 ribonucleotides, at least 5000 ribonucleotides, or longer). In some embodiments, technologies described herein may be particularly useful for synthesizing a single-stranded RNA having a length of about 800 ribonucleotides to 5000 ribonucleotides.

[0307] In some embodiments, a relevant RNA includes a polypeptide -encoding portion or a plurality of polypeptide -encoding portions. In some particular embodiments, such a portion or portions may encode a polypeptide or polypeptides that is or comprises an antigen (or an epitope thereof), a cytokine, an enzyme, etc. In some embodiments, an encoded polypeptide or polypeptides may be or include one or more neoantigens or neoepitopes associated with a tumor. In some embodiments, an encoded polypeptide or polypeptides may be or include one or more antigens (or epitopes thereof) of an infectious agent (e.g., a bacterium, fungus, virus, etc.). In certain embodiments, an encoded polypeptide may be a variant of a wild type polypeptide.

[0308] In some embodiments, a single-stranded RNA (e.g., mRNA) may comprise a secretion signal-encoding region (e.g., a secretion signal-encoding region that allows an encoded target entity or entities to be secreted upon translation by cells). In some embodiments, such a secretion signal-encoding region may be or comprise a non-human secretion signal. In some embodiments, such a secretion signal-encoding region may be or comprise a human secretion signal.

[0309] In some embodiments, a single-stranded RNA (e.g., mRNA) may comprise at least one non-coding sequence element (e.g., to enhance RNA stability and / or translation efficiency). Examples of non-coding sequence elements include but are not limited to a 3’ untranslated region (UTR), a 5’ UTR, a cap structure for co-transcriptional capping of mRNA, a poly adenine (poly A) tail, and any combinations thereof.

[0310] Formats

[0311] At least four formats useful for RNA pharmaceutical compositions (e.g., immunogenic compositions or vaccines) have been developed, namely non-modified uridine containing mRNA (uRNA), nucleosidemodified mRNA (modRNA), self-amplifying mRNA (saRNA), and trans-amplifying RNAs.

[0312] Features of a non-modified uridine platform may include, for example, one or more of intrinsic adjuvant effect, good tolerability and safety, and strong antibody and T cell responses.

[0313] Features of modified uridine (e.g., pseudouridine) platform may include reduced adjuvant effect, blunted immune innate immune sensor activating capacity and thus augmented antigen expression, good tolerability and safety, and strong antibody and CD4-T cell responses. As noted herein, the present disclosure provides an insight that such strong antibody and CD4 T cell responses may be particularly useful for vaccination.

[0314] Features of self-amplifying platform may include, for example, long duration of polypeptide (e.g., protein) expression, good tolerability and safety, higher likelihood for efficacy with very low vaccine dose.

[0315] In some embodiments, a self-amplifying platform (e.g., RNA) comprises two nucleic acid molecules, wherein one nucleic acid molecule encodes a replicase (e.g., a viral replicase) and the other nucleic acid molecule is capable of being replicated (e.g., a rep I icon) by said replicase in trans (trans- re plication system). In some embodiments, a self-amplifying platform (e.g., RNA) comprises a plurality of nucleic acid molecules, wherein said nucleic acids encode a plurality of replicases and / or replicons.

[0316] In some embodiments, a trans-replication system comprises the presence of both nucleic acid molecules in a single host cell.

[0317] In some such embodiments, a nucleic acid encoding a replicase (e.g., a viral replicase) is not capable of self-replication in a target cell and / or target organism. In some such embodiments, a nucleic acid encoding a replicase (e.g., a viral replicase) lacks at least one conserved sequence element important for (- ) strand synthesis based on a (+) strand template and / or for (+) strand synthesis based on a (-) strand template. In some embodiments, a self-amplifying RNA comprises a 5’-cap. Without wishing to be bound by any one theory, it has been found that a 5’ -cap is important for high level expression of a gene of interest in trans. In some embodiments, a 5’ -cap drives expression of a replicase.

[0318] In some embodiments, a self-amplifying RNA does not comprise an Internal Ribosomal Entry Site (IRES) element. In some such embodiments, translation of a gene of interest and / or replicase is not driven by an IRES element. In some embodiments, an IRES element is substituted by a 5 ’-cap. In some such embodiments, substitution by a 5 ’-cap does not affect the sequence of a polypeptide encoded by an RNA.

[0319] In some embodiments, a self-amplifying platform does not require propagation of virus particles (e.g., is not associated with undesired virus-particle formation). In some embodiments, a self-amplifying platform is not capable of forming virus particles.

[0320] 5’-Cap

[0321] In some embodiments, a polynucleotide (e.g., RNA) utilized in accordance with the present disclosure comprises a 5 ’-cap. RNA capping is well researched and is described, e.g., in Decroly E et al. (2012) Nature Reviews 10: 51-65; and in Ramanathan A. et al., (2016) Nucleic Acids Res; 44(16): 7511-7526, the entire contents of each of which is hereby incorporated by reference. In some embodiments, a 5 ’-cap structure which may be suitable in the context of the present disclosure is a capO (methylation of the first nucleobase, e.g. m7GpppN), capl (additional methylation of the ribose of the adjacent nucleotide of m7GpppN), cap2 (additional methylation of the ribose of the 2nd nucleotide downstream of the m7GpppN), cap3 (additional methylation of the ribose of the 3rd nucleotide downstream of the m7GpppN), cap4 (additional methylation of the ribose of the 4th nucleotide downstream of the m7GpppN), ARCA (anti-reverse cap analogue), modified ARCA (e.g. phosphothioate modified ARCA, e.g., beta-S-ARCA), inosine, N1 -methyl-guanosine, 2’ -fluoro-guanosine, 7-deaza-guanosine, 8-oxo- guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0322] In some embodiments, a utilized 5’ caps is a Cap-0 (also referred herein as “CapO”), a Cap-1 (also referred herein as “Capl”), or Cap-2 (also referred herein as “Cap2”). See, e.g., Figure 1 of Ramanathan A et al., and Figure 1 of Decroly E et al.

[0323] The term "5'-cap" as used herein refers to a structure found on the 5'-end of an RNA, e.g., mRNA, and generally includes a guanosine nucleotide connected to an RNA, e.g., mRNA, via a 5'- to 5'-triphosphate linkage (also referred to as Gppp or G(5')ppp(5')). In some embodiments, a guanosine nucleoside included in a 5’ cap may be modified, for example, by methylation at one or more positions (e.g., at the 7- position) on a base (guanine), and / or by methylation at one or more positions of a ribose. In some embodiments, a guanosine nucleoside included in a 5’ cap comprises a 3’0 methylation at a ribose (3’0MeG). In some embodiments, a guanosine nucleoside included in a 5’ cap comprises methylation at the 7-position of guanine (m7G). In some embodiments, a guanosine nucleoside included in a 5’ cap comprises methylation at the 7-position of guanine and a 3’ O methylation at a ribose (m7(3’OMeG)).

[0324] In some embodiments, providing an RNA with a 5'-cap disclosed herein or a 5'-cap analog may be achieved by in vitro transcription, in which a 5'-cap is co-transcriptionally expressed into an RNA strand, or may be attached to an RNA post-transcriptionally using capping enzymes. In some embodiments, co- transcriptional capping with a cap disclosed herein, e.g., with a capl or a capl analog, improves the capping efficiency of an RNA compared to co-transcriptional capping with an appropriate reference comparator. In some embodiments, improving capping efficiency can increase a translation efficiency and / or translation rate of an RNA, and / or increase expression of an encoded polypeptide.

[0325] In some embodiments, an RNA described herein comprises a 5’-cap or a 5’ cap analog, e.g. , a CapO, a Capl or a Cap2. In some embodiments, a provided RNA does not have uncapped 5'-triphosphates. In some embodiments, an RNA may be capped with a 5'- cap analog. In some embodiments, an RNA described herein comprises a CapO. In some embodiments, an RNA described herein comprises a Capl, e.g., as described herein. In some embodiments, an RNA described herein comprises a Cap2. In some embodiments, alterations to polynucleotides generates a non-hydrolyzable cap structure which can, for example, prevent decapping and increase RNA half-life.

[0326] In some embodiments, a CapO structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G). In some embodiments, a CapO structure is connected to an RNA via a 5'- to 5'- triphosphate linkage and is also referred to herein as m7Gppp or m7G(5')ppp(5').

[0327] In some embodiments, a Capl structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G or7mG) and a 2'0 methylated first nucleotide in an RNA (2'0MeNi or Nj2'0Me or Ni20Me). In some embodiments, a Capl structure is connected to an RNA via a 5'- to 5 '-triphosphate linkage; in some embodiments, a Capl structure may be represented asm7Gppp(Ni2OMe) orm7G(5')ppp(5')(Ni2OMe) or7mG(5')ppp(5')Ni2 0Me). In some embodiments, Ni is chosen from A, C, G, or U. In some embodiments, Nj is A. In some embodiments, Ni is C. In some embodiments, Ni is G. In some embodiments, Ni is U.

[0328] Those skilled in the art will appreciate that methylation of one or more positions in a cap structure may impact or reflect mode of incorporation (e.g., co-transcriptional vs post-transcriptional), as presence of a methyl group (e.g., a 2'OMe group) at certain positions (e.g., Ni) may interfere with elongation, e.g., by a particular polymerase (e.g., T7), as underlies the ARCA technology. In some embodiments, am7G(5')ppp(5')(Ni2OMe) Capl structure comprises a second nucleotide, Nz which is a cap proximal A, G, C, or U at position +2. In some embodiments, such Capl structures are represented as (m7G(5')ppp(5')(Ni2OMe)pNz). In some embodiments, Nzis A. In some embodiments, Nzis C. In some embodiments, Nzis G. In some embodiments, Nzis U.

[0329] In some embodiments, a Capl structure is or comprisesm7G(5')ppp(5')(A i20Me)pGz wherein Ai is a cap proximal A at position +1 and Gz is a cap proximal G at position +2. and has the following structure:

[0330] In some embodiments, a Capl structure is or comprisesm7G(5')ppp(5')(Ai2OMe)pUz wherein Ai is a cap proximal A at position +1 and Uz is a cap proximal U at position +2, and has the following structure:

[0331] In some embodiments, a Capl structure is or comprisesm7G(5')ppp(5')(Gi2OMe)pGz wherein Gi is a cap proximal G at position +1 and Gz is a cap proximal G at position +2, and has the following structure:

[0332] In some embodiments, a Capl structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G) and one or more additional modifications, e.g., methylation on a ribose, and a 2'0 methylated first nucleotide in an RNA. In some embodiments, a Capl structure comprises a guanosine nucleoside methylated at the 7-position of guanine and a 3'0 methylation at a ribose (m7G3'OMe) or7mG3'OMe);anja2'Q methylated first nucleotide in an RNA (Ni20Me). In some embodiments, a Capl structure is connected to an RNA via a 5'- to 5 '-triphosphate linkage and is also referred to herein as (m7G3'OMe)ppp(2'OMeNi) or (m7G3 OMi:)(5')ppp(5')(2'OMeNi). In some embodiments, Ni is chosen from A, C, G, or U. In some embodiments, Ni is A. In some embodiments, Ni is C. In some embodiments, Ni is G. In some embodiments, Ni is U.

[0333] In some embodiments, a (m7G3 OMc)(5')ppp(5')(Nj2OMe) Capl structure comprises a second nucleotide, Ni which is a cap proximal nucleotide at position 2 and is chosen from A, G, C, or U (m7G3 OMe)(5')ppp(5')(Ni2OMe)pN2). In some embodiments, Niis A. In some embodiments, N?is C. In some embodiments, N, is G. In some embodiments, Ni is U.

[0334] In some embodiments, a Capl structure is or comprises (m7G3 OMe)(5')ppp(5')(Ai2OMe)pG2 wherein Ai is a cap proximal A at position +1 and G2 is a cap proximal G at position +2. and has the following structure:

[0335]

[0336] In some embodiments, a Capl structure is or comprises (m7G3 OMe)(5,)ppp(5')(Gi2OMe)pG2 wherein Gi is a cap proximal G at position +1 and G2 is a cap proximal G at position +2. and has the following structure:

[0337] In some embodiments, a second nucleotide in a Capl structure can comprise one or more modifications, e.g., methylation. In some embodiments, a Capl structure comprising a second nucleotide comprising a 2'0 methylation is a Cap2 structure.

[0338] In some embodiments, an RNA polynucleotide comprising a Capl structure has increased translation efficiency, increased translation rate and / or increased expression of an encoded payload relative to an appropriate reference comparator. In some embodiments, an RNA polynucleotide comprising a Capl structure having (m7G3 OMe)(5')ppp(5')(Ai2OMe)pG2 wherein Ai is a cap proximal nucleotide at position +1 and G2 is a cap proximal nucleotide at position +2. has increased translation efficiency relative to an RNA polynucleotide comprising a Capl structure having (m7G3OMe)(5')ppp(5')(Gi2OMe)pG2 wherein Gi is a cap proximal nucleotide at position 1 and G2is a cap proximal nucleotide at position 2. In some embodiments, increased translation efficiency is assessed upon administration of an RNA polynucleotide to a cell or an organism. In some embodiments, a cap analog used in an RNA polynucleotide ism7G3'OMeGppp(m12’-OMe)ApG (also sometimes referred to as m27,3'-OMeG(5’)ppp(5’)m2’-OMeApG or (m7G3'OMe)(5')ppp(5')(A2'OMe)pG), which has the following structure: . Below is an exemplary Cap1 RNA, which comprises RNA and m27,3`OMeG(5’)ppp(5’)m2’-OMeApG: . Below is another exemplary Cap1 RNA:

[0339] 5’-UTR and Proximal Sequences

[0340] In some embodiments, a nucleic acid (e.g., DNA, RNA) utilized in accordance with the present disclosure comprises a 5'-UTR. In some embodiments, 5’-UTR may comprise a plurality of distinct sequence elements; in some embodiments, such plurality may be or comprise multiple copies of one or more particular sequence elements (e.g., as may be from a particular source or otherwise known as a functional or characteristic sequence element). In some embodiments, a 5’ UTR comprises multiple different sequence elements. The term "untranslated region" or "UTR" is commonly used in the art to a region in a DNA molecule which is transcribed but is not translated into an amino acid sequence, or to the corresponding region in an RNA polynucleotide, such as an mRNA molecule. An untranslated region (UTR) can be present 5' (upstream) of an open reading frame (5'-UTR) and / or 3' (downstream) of an open reading frame (3'- UTR). A 5'-UTR, if present, is located at the 5' end, upstream of the start codon of a polypeptide- (e.g., protein)-encoding region. A 5'-UTR is downstream of the 5'-cap (if present), e.g., directly adjacent to the 5'-cap.

[0341] In some embodiments of the disclosure, a 5' UTR is a heterologous 5’ UTR, i.e., is a 5’ UTR found in nature associated with a different ORF. In another embodiment, a 5' UTR is a synthetic 5’ UTR, i.e., does not occur in nature. In some embodiments, aynthetic 5’ UTR may be utilized, such as a 5’ UTR whose sequence has been altered relative to a parental reference 5’ UTR. Those skilled in the art will be aware of various 5’ UTR sequence alterations that, for example, may have been reported to increase expression of an ORF with which the variant 5’ UTR is associated.

[0342] To give but a few examples, in some embodiments, a utilized 5' UTRs may be or comprise a 5’ UTR from a gene such as: a-globin or p- globin, such as Xenopus or human a-globin, p- globin, or oc-globin (e.g., as described, for example, in US Patent 8278063 and / or US Patent 9012219) genes, human cytochrome b- 245 a polypeptide, hydroxysteroid (17b) dehydrogenase, Tobacco etch virus (e.g., as described, for example, in US Patent 8278063and / or US Patent 9012219). CMV immediate -early 1 (IE 1 ) gene (e.g., as described, for example, in US2014 / 0206753, W02013 / 185069); HSD17B4, RPL32, ASAHI , ATP5A1, MP68, NDUFA4, NOSIP, RPL31 , SLC7A3, TUBB4B, UBQLN2, PSMB3, RPS9, CASP1, COX6B1, NDUFA1, Rpl31, GNAS, ALB7. In some embodiments, a 5’ UTR is or comprises a 5’ UTR from an a- globin gene, or a variant thereof.

[0343] In some embodiments, embodiment utilized 5' UTR is a 5’ UTR of a TOP gene, for example a 5' UTR of a TOP gene lacking the 5' TOP motif (the oligopyrimidine tract) (e.g., as described, for example, in WO / 2015 / 101414, W02015 / 101415, WO / 2015 / 062738, WO2015 / 024667, WO2015 / 024667); a 5' UTR element of a ribosomal protein Large 32 (L32) gene (e.g., as described, for example, in WO / 2015 / 101414, W02015 / 101415, WO / 2015 / 062738), a 5' UTR element of an hydroxysteroid (17-P) dehydrogenase 4 gene (HSD17B4) (e.g., as described, for example, in WO2015 / 024667), or a 5' UTR element of ATP5A1 (e.g., as described, for example, in WO2015 / 024667) can be used.

[0344] In some embodiments, an internal ribosome entry site (IRES) is used instead of or in addition to a 5' UTR. In some embodiments, a 5’ UTR utilized in accordance with the present disclosure is or comprises a sequence: gggaaauaag agagaaaaga agaguaagaa gaaauauaag accccggcgc cgccacc. In some embodiments, a 5’ UTR utilized in accordance with the present disclosure is or comprises a sequence: gggaaauaag agagaaaaga agaguaagaa gaaauauaag agccacc. In some embodiments, a 5’ UTR may be or comprise a sequence GGGAUCCUACC (see, e.g., WO2014 / 144196). In some embodiments, a 5’ UTR may be or comprise a sequence as set forth in one of SEQ ID NOs: 231-252, or 22848-22875 of WO2021 / 156267, or a fragment or a variant of any of the foregoing. In some embodiments, a 5’ UTR may be or comprise a sequence as set forth in claim 9 of and / or of one or more of SEQ ID NOs: 1 -20 of W02019 / 077001 Al, or a fragment or variant of any of the foregoing. In some embodiments, a 5’ UTR may be or comprise one set forth in W02013 / 143700, for example one or more of SEQ ID NOs: 1 -1363, SEQ ID NO: 1395, SEQ ID NO: 1421 and SEQ ID NO: 1422 of W02013 / 143700, or a fragment or variant of any of the foregoing. In some embodiments, a 5’-UTR is or comprises a 5’ UTR as described in WO2016 / 107877, for example in SEQ ID NOs: 25-30 or 319-382 of WO2016 / 107877, or fragments or variants of any of the foregoing. In some embodiments, a 5 ’-UTR is or comprises a 5’ UTR as described in W02017 / 036580 for example in SEQ ID NOs: 1 -151 of W02017 / 036580, or fragments or variants of any of the foregoing. In some embodiments, a 5’ UTR is or comprises a 5’-UTR as described in WO2016 / 022914, for example in SEQ ID NOs: 3-19 of WO2016 / 022914, or fragments or variants of any of the foregoing In some embodiments, a 5' UTR may comprise a first polynucleotide fragment and a second polynucleotide fragment from the source and / or from different sources (see, for example, the 5' UTRs described in US Patent Application Publication No.2010 / 0293625 and PCT / US2014 / 069155). In some embodiments, a 5’ UTR utilized in accordance with the present disclosure comprises a cap proximal sequence, e.g., as disclosed herein. In some embodiments, a cap proximal sequence comprises a sequence adjacent to a 5’ cap. In some embodiments, a cap proximal sequence comprises nucleotides in positions +1, +2, +3, +4, and / or +5 of an RNA polynucleotide.

[0345] In some embodiments, a Cap structure comprises one or more polynucleotides of a cap proximal sequence. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +1 (Nl) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +2 (N2) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotides +1 and +2 (Nl and N2) of an RNA polynucleotide.

[0346] Those skilled in the art, reading the present disclosure, will appreciate that, in some embodiments, one or more residues of a cap proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) may be included in an RNA by virtue of having been included in a cap entity that (e.g., a Capl structure, etc.); alternatively, in some embodiments, at least some of the residues in a cap proximal sequence may be enzymatically added (e.g., by a polymerase such as a T7 polymerase). For example, in certain exemplified embodiments where a m27,3°Gppp(ml2°)ApG cap is utilized, +1 and +2 are the (ml2°)A and G residues of the cap, and +3, +4, and +5 are added by polymerase (e.g., T7 polymerase).

[0347] In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure, wherein Nl and N2 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A. In some embodiments, Nl is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.

[0348] In some embodiments, N1 is A and N2 is A. In some embodiments, Nl is A and N2 is C. In some embodiments, N1 is A and N2 is G. In some embodiments, Nl is A and N2 is U.

[0349] In some embodiments, N1 is C and N2 is A. In some embodiments, Nl is C and N2 is C. In some embodiments, N1 is C and N2 is G. In some embodiments, Nl is C and N2 is U.

[0350] In some embodiments, N1 is G and N2 is A. In some embodiments, N1 is G and N2 is C. In some embodiments, N1 is G and N2 is G. In some embodiments, N1 is G and N2 is U.

[0351] In some embodiments, N1 is U and N2 is A. In some embodiments, N1 is U and N2 is C. In some embodiments, N1 is U and N2 is G. In some embodiments, N1 is U and N2 is U.

[0352] In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure and N3, N4 and N5, wherein Nl to N5 correspond to positions +1, +2, +3, +4, and / or +5 of an RNA polynucleotide.

[0353] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is A.

[0354] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is A.

[0355] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is A. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is A.

[0356] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is G.

[0357] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is G.

[0358] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is G.

[0359] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is G.

[0360] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is C.

[0361] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is C.

[0362] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is C.

[0363] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is C. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is U.

[0364] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is U.

[0365] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is U.

[0366] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is U.

[0367] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is A.

[0368] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is A.

[0369] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is A.

[0370] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is A.

[0371] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is G. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is G.

[0372] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is G.

[0373] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is G.

[0374] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is C.

[0375] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is C.

[0376] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is C.

[0377] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is C.

[0378] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is U.

[0379] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is U. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is U.

[0380] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is U.

[0381] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is A.

[0382] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is A.

[0383] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is A.

[0384] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is A.

[0385] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is G.

[0386] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is G.

[0387] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is G. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is G.

[0388] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is C.

[0389] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is C.

[0390] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is C.

[0391] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is C.

[0392] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is U.

[0393] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is U.

[0394] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is U.

[0395] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is U. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is A.

[0396] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is A.

[0397] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is A.

[0398] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is A.

[0399] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is G.

[0400] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is G.

[0401] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is G.

[0402] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is G.

[0403] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is C. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is C.

[0404] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is C.

[0405] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is C.

[0406] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is U.

[0407] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is U.

[0408] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is U.

[0409] In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is U.

[0410] In some embodiments, a 5’ UTR disclosed herein comprises a cap proximal sequence, e.g., as disclosed herein. In some embodiments, a cap proximal sequence comprises a sequence adjacent to a 5’ cap. In some embodiments, a cap proximal sequence comprises nucleotides in positions +1, +2, +3, +4, and / or +5 of an RNA polynucleotide.

[0411] In some embodiments, a Cap structure comprises one or more polynucleotides of a cap proximal sequence. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +1 (Nl) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +2 (N2) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotides +1 and +2 (N1 and N2) of an RNA polynucleotide.

[0412] In some embodiments, N1 and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.

[0413] In some embodiments, N1 and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.

[0414] In some embodiments, N1 is A and N2 is A. In some embodiments, N1 is A and N2 is C. In some embodiments, N1 is A and N2 is G. In some embodiments, N1 is A and N2 is U.

[0415] In some embodiments, N1 is C and N2 is A. In some embodiments, N1 is C and N2 is C. In some embodiments, N1 is C and N2 is G. In some embodiments, N1 is C and N2 is U.

[0416] In some embodiments, N1 is G and N2 is A. In some embodiments, N1 is G and N2 is C. In some embodiments, N1 is G and N2 is G. In some embodiments, N1 is G and N2 is U.

[0417] In some embodiments, N1 is U and N2 is A. In some embodiments, N1 is U and N2 is C. In some embodiments, N1 is U and N2 is G. In some embodiments, N1 is U and N2 is U.

[0418] In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising: A3A4X5. In some embodiments, N1 and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is chosen from A, C, G or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.

[0419] In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising: C3A4X5. In some embodiments, N1 and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is chosen from A, C, G or U.

[0420] In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U. In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure, and a sequence comprising X3Y4X5. In some embodiments, Nl and N2 are each independently chosen from: A, C, G, or U. In some embodiments, Nl is A and N2 is G. In some embodiments, X3 and X5 is each independently chosen from A, C, G or U. In some embodiments, X3 and / or X5 is A. In some embodiments, X3 and / or X5 is C. In some embodiments, X3 and / or X5 is G. In some embodiments, X3 and / or X5 is U. In some embodiments, Y4 is not C. In some embodiments, Y4 is A. In some embodiments, Y4 is G. In some embodiments, Y4 is U.

[0421] In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure, and a sequence comprising X3Y4X5. In some embodiments, Nl and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 is each independently chosen from A, C, G or U. In some embodiments, X3 and / or X5 is A. In some embodiments, X3 and / or X5 is C. In some embodiments, X3 and / or X5 is G. In some embodiments, X3 and / or X5 is U. In some embodiments, Y4 is not G. In some embodiments, Y4 is A. In some embodiments, Y4 is C. In some embodiments, Y4 is U.

[0422] In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure, and a sequence comprising A3C4A5. In some embodiments, Nl and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0423] In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure, and a sequence comprising A3U4G5. In some embodiments, Nl and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0424] In some embodiments, a Cap structure comprises one or more polynucleotides of a cap proximal sequence. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +1 (Nl) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +2 (N2) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotides +1 and +2 (Nl and N2) of an RNA polynucleotide.

[0425] In some embodiments, Nl and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, Nl is A. In some embodiments, Nl is C. In some embodiments, Nl is G. In some embodiments, Nl is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.

[0426] In some embodiments, Nl and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, Nl is A. In some embodiments, Nl is C. In some embodiments, Nl is G. In some embodiments, Nl is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.

[0427] In some embodiments, N1 is A and N2 is A. In some embodiments, N1 is A and N2 is C. In some embodiments, N1 is A and N2 is G. In some embodiments, N1 is A and N2 is U.

[0428] In some embodiments, N1 is C and N2 is A. In some embodiments, N1 is C and N2 is C. In some embodiments, N1 is C and N2 is G. In some embodiments, N1 is C and N2 is U.

[0429] In some embodiments, N1 is G and N2 is A. In some embodiments, N1 is G and N2 is C. In some embodiments, N1 is G and N2 is G. In some embodiments, N1 is G and N2 is U.

[0430] In some embodiments, N1 is U and N2 is A. In some embodiments, N1 is U and N2 is C. In some embodiments, N1 is U and N2 is G. In some embodiments, N1 is U and N2 is U.

[0431] In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising: A3A4X5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is chosen from A, C, G or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.

[0432] In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising: C3A4X5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is any nucleotide, e.g., A, C, G or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.

[0433] In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising X3Y4X5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 is any nucleotide, e.g., A, C, G or U. In some embodiments, X3 and / or X5 is A. In some embodiments, X3 and / or X5 is C. In some embodiments, X3 and / or X5 is G. In some embodiments, X3 and / or X5 is U. In some embodiments, Y4 is not C. In some embodiments, Y4 is A. In some embodiments, Y4 is G. In some embodiments, Y4 is U.

[0434] In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising X3Y4X5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 is any nucleotide, e.g., A, C, G or U. In some embodiments, X3 and / or X5 is A. In some embodiments, X3 and / or X5 is C. In some embodiments, X3 and / or X5 is G. In some embodiments, X3 and / or X5 is U. In some embodiments, Y4 is not G. In some embodiments, Y4 is A. In some embodiments, Y4 is C. In some embodiments, Y4 is U.

[0435] In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising A3C4A5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0436] In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising A3U4G5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0437] Exemplary 5’ UTRs include a human alpha globin (hAg) 5’UTR or a fragment thereof, a TEV 5’ UTR or a fragment thereof, a HSP70 5’ UTR or a fragment thereof, or a c-Jun 5’ UTR or a fragment thereof.

[0438] In some embodiments, an RNA disclosed herein comprises a hAg 5’ UTR or a fragment thereof.

[0439] 3’ UTR

[0440] In some embodiments, an RNA as described herein comprises a 3'-UTR. A “3 ’-untranslated region” or “3’-UTR” or “3’-UTR element” will be recognized and understood by the person of ordinary skill in the art. As is known in the art, a 3’ UTR typically is a part of a nucleic acid molecule that is located 3’ (i.e. downstream) of a coding sequence and is not translated into protein. In some embodiments, a 3 ’-UTR may located between a coding sequence and an (optional) terminal poly(A) sequence. In some embodiments, a 3’-UTR may comprise elements for controlling gene expression, such a what may be referred to as regulatory elements. Such regulatory elements may be or comprise, e.g., ribosomal binding sites, miRNA binding sites etc..

[0441] A 3'-UTR, if present, is located at the 3' end, downstream of the termination codon of a polypeptide- (e.g., protein-) encoding region, but the term "3'-UTR" does preferably not include the poly(A) sequence. Thus, the 3'-UTR is upstream of the poly(A) sequence (if present), e.g. directly adjacent to the poly(A) sequence.

[0442] In some embodiments, an RNA disclosed herein comprises a 3’ UTR comprising an F element and / or an I element. In some embodiments, a 3’ UTR or a proximal sequence thereto comprises a restriction site. In some embodiments, a restriction site is a BamHI site. In some embodiments, a restriction site is a Xhol site. In some embodiments, an RNA construct comprises an F element. In some embodiments, a F element sequence is a 3’-UTR of amino-terminal enhancer of split (AES).

[0443] In some embodiments, an RNA disclosed herein comprises a 3’ UTR having 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to a 3’ UTR with the sequence comprising: CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUC CCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUA GUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACC CCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUA CUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC (SEQ ID NO: 15). In some embodiments, an RNA disclosed herein comprises a 3’ UTR provided in SEQ ID NO: 15.

[0444] In some embodiments, a 3’UTR is an FI element as described in W02017 / 060314.

[0445] To give but a few examples, in some embodiments, a utilized 3’UTR may be or comprise a 3’UTR from a gene such as globin UTRs, including Xenopus 0-globin UTRs and human 0-globin UTRs are known in the art (see, for example, 8278063, 9012219, US2011 / 0086907). In some embodiments, a modified 0- globin construct with enhanced stability in some cell types may be utilized; such a construct has been reported as having been made by cloning two sequential human 0-globin 3'UTRs head to tail (US2012 / 0195936, W02014 / 071963). In addition cc2-globin, od-globin, UTRs and variants thereof are also known in the art (W02015 / 101415, W02015 / 024667). Exemplary 3' UTRs described in the mRNA constructs in the non-patent literature include those from CYBA (Ferizi et al., 2015) and albumin (Thess et al., 2015). In some embodiments, exemplary 3' UTRs include that of bovine or human growth hormone (wild type or modified) (W02013 / 185069, US2014 / 0206753, W02014152774), rabbit 0 globin and hepatitis B virus (HBV), a-globin 3' UTR and Viral VEEV 3' UTR sequences are also known in the art. In some embodiments, the sequence UUUGAAUU (W02014 / 144196) is used. In some embodiments, 3' UTRs of human and / or mouse ribosomal protein are used. In some embodiments, examples include rps9 3’UTR (W02015 / 101414), FIG4 (W02015 / 101415), and human albumin 7 (W02015 / 101415). In some embodiments, a nucleic acid comprises at least one heterologous 3’-UTR, wherein the at least one heterologous 3 ’-UTR comprises a nucleic acid sequence derived from a 3 ’-UTR of a gene selected from PSMB3, ALB7, alpha-globin (referred to as “muag”), CASP1 , COX6B1 , GNAS, NDUFA1 and RPS9, or from a homolog, a fragment or variant of any one of these genes.

[0446] In some embodiments, a utilized 3’UTR may be as exemplified, for example, in published PCT application W02019 / 077001 Al , in particular, claim 9 of W02019 / 077001 Al . In some embodiments, a 3’ UTR may be or comprise one of SEQ ID NOs: 23-34 of W02019 / 077001 Al , or a fragment or variant thereof). In some embodiments, a 3’ UTR utilized in accordance with the present disclosure comprises a sequence: ugauaauagg cuggagccuc gguggccuag cuucuugccc cuugggccuc cccccagccc cuccuccccu uccugcaccc guacccccgu ggucuuugaa uaaagucuga gugggcggc. In some embodiments, a 3’ UTR of the present disclosure comprises a sequence: ugauaauagg cuggagccuc gguggccaug cuucuugccc cuugggccuc cccccagccc cuccuccccu uccugcaccc guacccccgu ggucuuugaa uaaagucuga gugggcggc. In some embodiments, a nucleic acid may comprise a 3’-UTR as described in WO2016 / 107877In some embodiments, suitable 3’-UTRs are SEQ ID NOs: 1-24 and SEQ ID NOs: 49-318 of WO2016 / 107877, or fragments or variants of these sequences. In some embodiments, a 3 ’-UTR as described in W02017 / 036580 may be utilized. In some embodiments, suitable 3’-UTRs are SEQ ID NOs: 152-204 of W02017 / 036580, or fragments or variants of these sequences. In some embodiments a 3’ -UTR as described in WO2016 / 022914 is utilized. In some embodiments, a 3’-UTRs is or comprises a sequence according to SEQ ID NOs: 20-36 of WO2016 / 022914, or fragments or variants of these sequences.

[0447] PolyA

[0448] In some embodiments, a polynucleotide (e.g., DNA, RNA) disclosed herein comprises a polyadenylate (PolyA) sequence, e.g., as described herein. In some embodiments, a PolyA sequence is situated downstream of a 3'-UTR, e.g., adjacent to a 3'-UTR.

[0449] As used herein, the term "poly(A) sequence" or "poly-A tail" refers to an uninterrupted or interrupted sequence of adenylate residues which is typically located at the 3'-end of an RNA polynucleotide. Poly(A) sequences are known to those of skill in the art and may follow the 3 ’-UTR in the RNAs described herein. An uninterrupted poly(A) sequence is characterized by consecutive adenylate residues. In nature, an uninterrupted poly(A) sequence is typical. In some embodiments, polynucleotides disclosed herein comprise an uninterrupted Poly(A) sequence. In some embodiments, polynucleotides disclosed herein comprise interrupted Poly(A) sequence. In some embodiments, RNAs disclosed herein can have a poly(A) sequence attached to the free 3'-end of the RNA by a template-independent RNA polymerase after transcription or a poly(A) sequence encoded by DNA and transcribed by a template -dependent RNA polymerase.

[0450] It has been demonstrated that a poly (A) sequence of about 120 A nucleotides has a beneficial influence on the levels of RNA in transfected eukaryotic cells, as well as on the levels of polypeptide (e.g., protein) that is translated from an open reading frame that is present upstream (5’) of the poly(A) sequence (Holtkamp et al., 2006, Blood, vol. 108, pp. 4009-4017).

[0451] In some embodiments, a poly (A) sequence in accordance with the present disclosure is not limited to a particular length; in some embodiments, a poly(A) sequence is any length. In some embodiments, a poly(A) sequence comprises, essentially consists of, or consists of at least 10, at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 1000, up to 500, up to 400, up to 300, up to 200, or up to 150 A nucleotides, and, in particular, about 120 A nucleotides. In this context, "essentially consists of' means that most nucleotides in the poly(A) sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% by number of nucleotides in the poly(A) sequence are A nucleotides, but permits that remaining nucleotides are nucleotides other than A nucleotides, such as U nucleotides (uridylate), G nucleotides (guanylate), or C nucleotides (cytidylate). In this context, "consists of" means that all nucleotides in the poly(A) sequence, i.e., 100% by number of nucleotides in the poly(A) sequence, are A nucleotides. The term "A nucleotide" or "A" refers to adenylate.

[0452] In some embodiments, a poly(A) sequence is attached during RNA transcription, e.g., during preparation of in vitro transcribed RNA, based on a DNA template comprising repeated dT nucleotides (deoxythymidylate) in the strand complementary to the coding strand. The DNA sequence encoding a poly(A) sequence (coding strand) is referred to as poly(A) cassette.

[0453] In some embodiments, the poly(A) cassette present in the coding strand of DNA essentially consists of dA nucleotides, but is interrupted by a random sequence of the four nucleotides (dA, dC, dG, and dT). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length. Such a cassette is disclosed in WO 2016 / 005324 Al, hereby incorporated by reference. Any poly(A) cassette disclosed in WO 2016 / 005324 Al may be used in accordance with the present disclosure. A poly(A) cassette that essentially consists of dA nucleotides, but is interrupted by a random sequence having an equal distribution of the four nucleotides (dA, dC, dG, dT) and having a length of e.g., 5 to 50 nucleotides shows, on DNA level, constant propagation of plasmid DNA in E. coli and is still associated, on RNA level, with the beneficial properties with respect to supporting RNA stability and translational efficiency is encompassed. In some embodiments, the poly(A) sequence contained in an RNA polynucleotide described herein essentially consists of A nucleotides, but is interrupted by a random sequence of the four nucleotides (A, C, G, U). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length.

[0454] In some embodiments, no nucleotides other than A nucleotides flank a poly(A) sequence at its 3'-end, i.e., the poly(A) sequence is not masked or followed at its 3'-end by a nucleotide other than A.

[0455] In some embodiments, the poly(A) sequence may comprise at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence may essentially consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence may consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence comprises at least 100 nucleotides. In some embodiments, the poly(A) sequence comprises about 150 nucleotides. In some embodiments, the poly(A) sequence comprises about 120 nucleotides.

[0456] In some embodiments, a poly A tail comprises a specific number of Adenosines, such as about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 120, or about 150 or about 200. In some embodiments a poly A tail of a string construct may comprise 200 A residues or less. In some embodiments, a poly A tail of a string construct may comprise about 200 A residues. In some embodiments, a poly A tail of a string construct may comprise 180 A residues or less. In some embodiments, a poly A tail of a string construct may comprise about 180 A residues. In some embodiments, a poly A tail may comprise 150 residues or less.

[0457] In some embodiments, the poly(A) sequence may comprise about 10 to about 500 adenosine nucleotides, about 10 to about 200 adenosine nucleotides, about 40 to about 200 adenosine nucleotides, or about 40 to about 150 adenosine nucleotides. In some embodiments, the length of the poly(A) sequence may be at least about or even more than about 10, 50, 64, 75, 100, 200, 300, 400, or 500 adenosine nucleotides.

[0458] In some embodiments, the nucleic acid comprises at least one poly(A) sequence comprising about 30 to about 200 adenosine nucleotides. In some embodiments, the poly(A) sequence comprises about 64 adenosine nucleotides (A64). In some embodiments, the poly(A) sequence comprises about 100 adenosine nucleotides (A100). In some embodiments, the poly(A) sequence comprises about 150 adenosine nucleotides.

[0459] In some embodiments, the nucleic acid comprises at least one poly (A) sequence comprising about 100 adenosine nucleotides, wherein the poly(A) sequence is interrupted by non-adenosine nucleotides, preferably by 10 non adenosine nucleotides (A30-N10-A70).

[0460] Open Reading Frames

[0461] In some embodiments, an RNA produced in accordance with technologies provided herein comprises an Open Reading Frame (ORF), e.g., encoding a polypeptide of interest or encoding a plurality of polypeptides of interest. In some embodiments, an RNA produced in accordance with technologies provided herein comprises a plurality of ORFs (e.g., encoding a plurality of polypeptides). In some embodiments, an RNA produced in accordance with technologies herein comprises a single ORF that encodes a plurality of polypeptides. In some such embodiments, polypeptides are or comprise antigens or epitopes thereof (e.g., relevant antigens).

[0462] To give but some examples, in some embodiments, an encoded polypeptide may be or comprise an antigen or epitope thereof, so that, when expressed in a subject to which a provided RNA is administered, an immune response (e.g., characterized by antibodies and / or T cells specifically directed to the antigen or one or more epitopes thereof); in some such embodiments, an encoded polypeptide may be polyepitopic, for example including multiple polypeptide elements, each of which includes at least one epitope, linked to one another and optionally separated by linkers. As is understood in the art, in some embodiments, a polyepitopic construct may include individual epitopes found in different portions of the same protein in nature. Alternatively or additionally, in some embodiments, a polyepitopic construct may include individual epitopes found in different proteins in nature. Those skilled in the art will be aware of a variety of considerations relevant to selection of desirable polyepitopic constructs, and / or antigens and / or epitopes for inclusion therein, useful in accordance with the present disclosure (see, for example, WO2014082729, WO2012159754, WO2017173321, WO2014180659, WO20161283762, W02017194610, WO2011143656, WO2015103037, Nielsen JS, et al. J Immunol Methods. 2010 Aug 31 ;360(l-2): 149-56. , “Polyepitope Vaccine Technology.” Polyepitope Vaccine Technology - Creative Biolabs, www.creative-biolabs.com / vaccine / polyepitope-vaccine-technology.htm., Li, L. et al. Genome Med 13, 56 (2021)., Cafri G. et al. Journal of Clinical Investigation 130, 5976-5988 (2020), Khairkhah N. et al. (2020) PLOS ONE 15(10): e0240577.).

[0463] In some embodiments, a relevant antigen may be or comprise comprise an infectious antigen (i.e., an antigen associated with an infectious agent such as an infectious virus, a bacterium, a fungus, etc.) and / or a cancer antigen (e.g., an antigen associated with a class of tumors or a specific tumor; in some embodiments, a cancer-associated antigen may be or comprise a neoantigen or neoepitope), or epitope thereof.

[0464] Alternatively or additionally, in some embodiments, an ORF may encode, for example, an antibody or portion (e.g., antigen-binding portion) thereof, an enzyme, a cytokine, a therapeutic protein, etc. (see, for example, 02017186928, WO2017191274, US10669322, Dammes et al Trens Pharmacol Sci 4:755, 2020-10-01, Wang et al Nature Reviews Drug Discovery 19, 441-442 (2020), Damase et al Front. Bioeng. Biotechnol., 18 March 2021).

[0465] In some embodiments, an ORF for use in accordance with the present disclosure encodes a polypeptide that includes a signal sequence, e.g., that is functional in mammalian cells. In some embodiments, a utilized signal sequence is “intrinsic” in that it is , in nature, it is associated with (e.g., linked to) the encoded polypeptide.

[0466] In some embodiments, a utilized signal sequence is heterologous to the encoded polypeptide - e.g., is not naturally part of a polypeptide (e.g., protein) whose sequences are included in the encoded polypeptide.

[0467] In some embodiments, signal peptides are sequences, which are typically characterized by a length of about 15 to 30 amino acids.

[0468] In many embodiments, signal peptides are positioned at the N-terminus of an encoded polypeptide as described herein, without being limited thereto. In some embodiments, signal peptides preferably allow the transport of the polypeptide encoded by RNAs of the present disclosure with which they are associated into a defined cellular compartment, preferably the cell surface, the endoplasmic reticulum (ER) or the endosomal-lysosomal compartment.

[0469] In some embodiments, a signal sequence is selected from an S1S2 signal peptide (aa 1-19), an immunoglobulin secretory signal peptide (aa 1-22), an HSV-1 gD signal peptide (MGGAAARLGAVILFVVIVGLHGVRSKY), an HSV-2 gD signal peptide (MGRLTSGVGTAALLVVAVGLRVVCA); a human SPARC signal peptide, a human insulin isoform 1 signal peptide, a human albumin signal peptide, etc. Those skilled in the art will be aware of other secretory signal peptides such as, for example, as disclosed in W02017 / 081082 (e.g., SEQ ID NOs: 1- 1115 and 1728, or fragments variants thereof) and W02019008001.

[0470] In some embodiments, an RNAsequence encodes an epitope that may comprise or otherwise be linked to a signal sequence (e.g., secretory sequence), such as those listed in Table 1, or at least a sequence having 1, 2, 3, 4, or 5 amino acid differences relative thereto. In some embodiments, a signal sequence such as MFVFLVLLPLVSSQCVNLT, or at least a sequence having 1, 2, 3, 4, or at the most 5 amino acid differences relative thereto is utilized. In some embodiments, a sequence such as MFVFLVLLPLVSSQCVNLT, or a sequence having 1, 2, 3, 4, or at the most 5 amino acid differences relative thereto, is utilized.

[0471] In some embodiments, a signal sequence is selected from those included in the Table 1 below and / or those encoded by the sequences in Table 2 below:

[0472] Table 1: Exemplary signal sequences

[0473] Table 2: Exemplary nucleotide sequences encoding signal sequences

[0474] In some embodiments, an RNAutilized as described herein encodes a multimerization element (e.g., a heterologous multimerization element). In some embodiments, a heterologous multimerization element comprises a dimerization, trimerization or tetramerization element.

[0475] In some embodiments, a multimerization element is one described in W02017 / 081082 (e.g., SEQ ID NOs: 1116-1167, or fragments or variants thereof).

[0476] Exemplary trimerization and tetramerization elements include, but are not limited to, engineered leucine zippers, fibritin foldon domain from enterobacteria phage T4, GCN4pll, GCN4-pll, and p53.

[0477] In some embodiments, a provided encoded polypeptide(s) is able to form a trimeric complex. For example, a utilized encoded polypeptide(s) may comprise a domain allowing formation of a multimeric complex, such as for example particular a trimeric complex of an amino acid sequence comprising an encoded polypeptide(s) as described herein. In some embodiments, a domain allowing formation of a multimeric complex comprises a trimerization domain, for example, a trimerization domain as described herein.

[0478] In some embodiments, an encoded polypeptide(s) can be modified by addition of a T4-fibri tin-derived “foldon” trimerization domain, for example, to increase its immunogenicity.

[0479] In some embodiments, an RNAas described herein encodes a membrane association element (e.g., a heterologous membrane association element), such as a transmembrane domain. A transmembrane domain can be N-terminal, C-terminal, or internal to an encoded polypeptide. A coding sequence of a transmembrane element is typically placed in frame (i.e., in the same reading frame), 5', 3', or internal to coding sequences of sequences (e.g., sequences encoding polypeptide(s)) with which it is to be linked.

[0480] In some embodiments, a transmembrane domain comprises or is a transmembrane domain of Hemagglutinin (HA) of Influenza virus, Env of HIV- 1, equine infectious anaemia virus (EIAV), murine leukaemia virus (MLV), mouse mammary tumor virus, G protein of vesicular stomatitis virus (VSV), Rabies virus, or a seven transmembrane domain receptor.

[0481] In some embodiments, an ORF encoding polypeptide of the disclosure is codon optimized. Various codon optimization methods are known in the art. For example, an ORF of any one or more of the sequences provided herein may be codon optimized. Codon optimization, in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove polypeptide trafficking sequences; remove / add post translation modification sites in encoded polypeptide (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the polypeptide to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art - non limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and / or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using optimization algorithms.

[0482] In some embodiments, a codon optimized sequence shares less than 95% sequence identity to a naturally - occurring or wild-type sequence ORF (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares less than 90% sequence identity to a naturally-occurring or wild- type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares less than 85% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wildtype mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares less than 80% sequence identity to a naturally -occurring or wild-type sequence (e.g., a naturally- occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares less than 75% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares between 65% and 85% (e.g., between about 67% and about 85% or between about 67% and about 80%) sequence identity to a naturally-occurring or wild- type sequence (e.g., a naturally -occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares between 65% and 75% or about 80% sequence identity to a naturally -occurring or wild-type sequence (e.g. , a naturally-occurring or wild-type mRNA sequence encoding a polypeptide).

[0483] In some embodiments, a codon-optimized sequence encodes polypeptide (e.g., an antigen) that is as immunogenic as, or more immunogenic than (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% more), than a polypeptide encoded by a non-codon- optimized sequence.

[0484] In some embodiments, when transfected into mammalian host cells, the modified mRNAs have a stability of between 12-18 hours, or greater than 18 hours, e.g., 24, 36, 48, 60, 72, or greater than 72 hours and are capable of being expressed by the mammalian host cells.

[0485] In some embodiments, a codon optimized RNA may be one in which the levels of G / C are enhanced and / or A / U are enhanced. In some embodiments, the G / C-content of nucleic acid molecules (e.g., mRNA) may influence the stability of the RNA. RNA having an increased amount of guanine (G) and / or cytosine (C) residues may be functionally more stable than RNA containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides. As an example, WO02 / 098443 discloses a pharmaceutical composition containing an mRNA stabilized by sequence modifications in the translated region. In some embodiments, due to the degeneracy of the genetic code, the modifications work by substituting existing codons for those that promote, for example greater RNA stability, without changing the resulting amino acid. In some embodiments, the approach is limited to coding regions of the RNA.

[0486] The present disclosure specifically exemplifies use of RNAs encoding viral antigen(s) (and / or epitope(s) thereof), for example coronavirus antigen(s) and / or epitope(s). For example, in some embodiments, the present disclosure exemplifies use of a single-stranded RNA whose nucleotide sequence encodes a coronavirus polypeptide or a variant thereof. In some embodiments, a single-stranded RNA comprises a nucleotide sequence that encodes a prefusion coronavirus spike protein, e.g., as described in WO 2018081318, the entire contents of which are incorporated herein by reference for purposes described herein. In some embodiments, an RNA for use in accordance with the present disclosure encodes a SARS-CoV-2 spike protein with K986P and V978P mutations.

[0487] In some embodiments, a single-stranded RNA comprises a nucleotide sequence that encodes a SARS- CoV-2 polypeptide (including, e.g., a spike (S) protein, a nucleocapsid (N) protein, envelope (E) protein, and a membrane (M) protein) or an immunogenic fragment thereof. In some embodiments, a singlestranded RNA comprises a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide or an immunogenic fragment thereof (e.g., a receptor binding domain of a S protein). In some embodiments, such a SARS-CoV-2 S polypeptide or an immunogenic fragment thereof may be a mutant protein. In some embodiments, such a SARS-CoV-2 S protein or an immunogenic fragment thereof may be one as described in Walsh et al. “RNA-based COVID-19 vaccine BNT162b2 selected for a pivotal efficacy study” medRxiv preprint (2020), which is online accessible at: https: / / doi.org / 10.1 101 / 2020.08.17.20176651 ; and Milligan et al. “Phase I / II study of COVID-19 RNA vaccine BNT162bl in adults” Nature (2020 August), which is online accessible at: https: / / doi.org / 10.1038 / s41586-020-2639-4, the contents of each of which are incorporated by reference in their entirety.

[0488] In some embodiments, a single-stranded RNA comprises a nucleotide sequence that encodes a SARS- CoV-2 polypeptide as shown in Example 10.

[0489] In some embodiments, a single-stranded RNA (e.g., mRNA as described herein) may comprise a secretion signal-encoding region (e.g., a secretion signal-encoding region that allows an encoded target entity to be secreted upon translation by cells). In some embodiments, such a secretion signal-encoding region may be or comprise a non-human secretion signal. In some embodiments, such a secretion signalencoding region may be or comprise a human secretion signal.

[0490] In some embodiments, a single-stranded RNA (e.g., mRNA as described herein) may comprise at least one non-coding sequence element (e.g., to enhance RNA stability and / or translation efficiency). Examples of non-coding sequence elements include but are not limited to a 3’ untranslated region (UTR), a 5’ UTR, a cap structure for co-transcriptional capping of mRNA, a poly adenine (poly A) tail, and any combinations thereof.

[0491] UTRs (S’ UTRs and / or 3’UTRs): In some embodiments, a single-stranded RNA can comprise a nucleotide sequence that encodes a 5 ’UTR of interest and / or a 3’ UTR of interest. One of skill in the art will appreciate that untranslated regions (e.g., 3’ UTR and / or 5’ UTR) of a mRNA sequence can contribute to mRNA stability, mRNA localization, and / or translational efficiency.

[0492] In some embodiments, a single-stranded RNA can comprise a 5’ UTR nucleotide sequence and / or a 3’ UTR nucleotide sequence. In some embodiments, such a 5’ UTR sequence can be operably linked to a 3’ of a coding sequence (e.g. , encompassing one or more coding regions). Additionally or alternatively, in some embodiments, a 3’ UTR sequence can be operably linked to 5’ of a coding sequence (e.g., encompassing one or more coding regions). In some embodiments, 5' and 3' UTR sequences included in a single-stranded RNA can consist of or comprise naturally occurring or endogenous 5' and 3' UTR sequences for an open reading frame of a gene of interest. Alternatively, in some embodiments, 5’ and / or 3’ UTR sequences included in a singlestranded RNA are not endogenous to a coding sequence (e.g., encompassing one or more coding regions); in some such embodiments, such 5’ and / or 3’ UTR sequences can be useful for modifying the stability and / or translation efficiency of an RNA sequence transcribed. For example, a skilled artisan will appreciate that AU-rich elements in 3' UTR sequences can decrease the stability of mRNA. Therefore, as will be understood by a skilled artisan, 3' and / or 5’ UTRs can be selected or designed to increase the stability of the transcribed RNA based on properties of UTRs that are well known in the art.

[0493] For example, one skilled in the art will appreciate that, in some embodiments, a nucleotide sequence consisting of or comprising a Kozak sequence of an open reading frame sequence of a gene or nucleotide sequence of interest can be selected and used as a nucleotide sequence encoding a 5’ UTR. As will be understood by a skilled artisan, Kozak sequences are known to increase the efficiency of translation of some RNA transcripts, but are not necessarily required for all RNAs to enable efficient translation. In some embodiments, a single-stranded RNA can comprise a nucleotide sequence that encodes a 5' UTR derived from an RNA virus whose RNA genome is stable in cells. In some embodiments, various modified ribonucleotides (e.g., as described herein) can be used in the 3' and / or 5' UTRs, for example, to impede exonuclease degradation of the transcribed RNA sequence.

[0494] In some embodiments, a 5’ UTR included in a single-stranded RNA may be derived from human a- globin mRNA combined with Kozak region. In some embodiments, a 5’ UTR comprises the nucleotide sequence of SEQ ID NO: 12 as shown in Example 10.

[0495] In some embodiments, a single-stranded RNA may comprise one or more 3 ’UTRs. For example, in some embodiments, a single-stranded RNA may comprise two copies of 3'-UTRs derived from a globin mRNA, such as, e.g., alpha2-globin, alpha 1 -globin, beta-globin (e.g., a human beta-globin) mRNA. In some embodiments, two copies of 3’ UTR derived from a human beta-globin mRNA may be used, e.g. , in some embodiments which may be placed between a coding sequence of a single-stranded RNA and a poly(A)-tail, to improve protein expression levels and / or prolonged persistence of an mRNA. In some embodiments, a 3’ UTR included in a single-stranded RNA may be or comprise one or more (e.g., 1, 2, 3, or more) of the 3 ’UTR sequences disclosed in WO 2017 / 060314, the entire content of which is incorporated herein by reference for the purposes described herein. In some embodiments, a 3‘-UTR may be a combination of at least two sequence elements (FI element) derived from the "amino terminal enhancer of split" (AES) mRNA (called F) and the mitochondrial encoded 12S ribosomal RNA (called I). These were identified by an ex vivo selection process for sequences that confer RNA stability and augment total protein expression (see WO 2017 / 060314, herein incorporated by reference). In some embodiments, an FI element comprises the nucleotide sequence of SEQ ID NO: 13 as shown in Example 10.

[0496] PolyA tail'. In some embodiments, a single-stranded RNA can comprise a polyA tail. A polyA tail is a nucleotide sequence comprising a series of adenosine nucleotides, which can vary in length (e.g., at least 5 adenine nucleotides) and can be up to several hundred adenosine nucleotides. In some embodiments, a polyA tail is a nucleotide sequence comprising at least 30 adenosine nucleotides or more, including, e.g., at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, or more adenosine nucleotides. In some embodiments, a polyA tail is or comprises a polyA homopolymeric tail. In some embodiments, a polyA tail may comprise one or more modified adenosine nucleosides, including, but not limited to, cordycepin and 8-azaadenosine. In some embodiments, a polyA tail may comprise one or more non-adenosine nucleotides. In some embodiments, a polyA tail may be or comprise a disrupted or modified polyA tail as described in WO 2016 / 005324, the entire content of which is incorporated herein by reference for the purpose described herein. For example, in some embodiments, a polyA tail included in a single-stranded RNA described herein may be or comprise a modified polyA sequence comprising: a linker sequence; a first sequence of at least 20 consecutive A nucleotides, which is 5’ of the linker sequence; and a second sequence of at least 20 consecutive A nucleotides, which is 3’ of the linker sequence. In some embodiments, a modified polyA sequence may comprise: a linker sequence comprising at least ten nucleotides (e.g., U, G, and / or C nucleotides); a first sequence of at least 30 consecutive A nucleotides, which is 5’ of the linker sequence; and a second sequence of at least 70 consecutive A nucleotides, which is 3’ of the linker sequence. In some embodiments, a polyA tail comprises the nucleotide sequence of SEQ ID NO: 14 as shown in Example 10.

[0497] 5’ cap: In some embodiments, a single-stranded RNA described herein may comprise a 5’ cap, which may be incorporated into such a single-stranded RNA during transcription, or joined to such a singlestranded RNA post-transcription. In some embodiments, a single-stranded RNA may comprise a 5’ cap structure for co-transcriptional capping of mRNA. Examples of a cap structure for co-transcriptional capping are known in the art, including, e.g., as described in WO 2017 / 053297, the entire content of which is incorporated herein by reference for the purposes described herein. In some embodiments, a 5’ cap included in a single-stranded RNA described herein is or comprises a capl structure. For example, in some embodiments, a capl structure may be or comprise m7G(5')ppp(5')(2'OMeA)pG, also known asm 27’ °G pppOn i2’ °) A pG .

[0498] In some embodiments, a single-stranded RNA described herein may comprise at least one modified ribonucleotide, for example, in some embodiments to increase the stability of such a single-stranded RNA and / or to decrease cytotoxicity of such a single -stranded RNA. For example, in some embodiments, at least one of A, U, C, and G ribonucleotide of a single-stranded RNA may be replaced by a modified ribonucleotide. For example, in some embodiments, some or all of cytidine residues present in a singlestranded RNA may be replaced by a modified cytidine, which in some embodiments may be, e.g. , 5- methylcytidine. Alternatively or additionally, in some embodiments, some or all of uridine residues present in a single-stranded RNA may be replaced by a modified uridine, which in some embodiments may be, e.g., pseudouridine, such as, e.g., 1 -methylpseudouridine. In some embodiments, all uridine residues present in a single-stranded RNA is replaced by pseudouridine, e.g., 1 -methylpseudouridine.

[0499] In vitro Transcription

[0500] In some embodiments, technologies provided by the present disclosure achieve production of RNA preparations (e.g., pharmaceutical-grade RNA preparations, including large batch preparations) that include, for example (i) synthesizing RNA by in vitro transcription e.g., in a bioreactor, to produce an in vitro transcription RNA composition; and (ii) removing one or more components (e.g., undesired components) from the in vitro transcription RNA composition, thereby producing an RNA transcript preparation; in some embodiments, such the RNA transcript is present in such RNA transcript preparation at a concentration (i.e., an adjusted concentration, in light of the removing) of at least 1 mg / mL (including, e.g., at least 1.5 mg / mL, at least 2 mg / mL, at least 2.5 mg / mL, at least 3 mg / mL, at least 3.5 mg / mL, at least 4 mg / mL, at least 4.5 mg / mL, at least 5 mg / mL, at least 6 mg / mL, or higher). In some embodiments, the RNA may be present at a concentration of 1.5 mg / mL to 5 mg / mL or 2 mg / mL to 4 mg / mL. In some embodiments, all unit operations described herein are performed at room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C), unless specified otherwise.

[0501] (I) Synthesis

[0502] In some embodiments, RNA (e.g., single-stranded RNA as described herein) can be synthesized from a DNA template by in vitro RNA transcription, e.g., in the presence of appropriate reagents comprising, e.g., at least one RNA-polymerase and appropriate ribonucleotide triphosphates or variants thereof (e.g., modified ribonucleotide triphosphates), e.g., in a bioreactor. In some embodiments, a bioreactor that is useful for in vitro transcription is large enough for an in vitro transcription reaction volume of at least 1 liter, including, e.g., at least 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50 liters or more. In some embodiments, a bioreactor that is particularly useful for commercial-scale in vitro transcription is large enough for an in vitro transcription reaction volume of at least 20 liters, including, e.g., at least 25, 30, 35, 40, 45, 50 liters, or more. Exemplary starting materials

[0503] DNA template

[0504] One of ordinary skill in the art will understand that a DNA template is used to direct synthesis of RNA (e.g., single-stranded RNA). In some embodiments, a DNA template is a linear DNA molecule. In some embodiments, a DNA template is a circular DNA molecule. DNA can be obtained or generated using methods known in the art, including, e.g., gene synthesis, recombinant DNA technology, or a combination thereof. In some embodiments, a DNA template comprises a nucleotide sequence coding for a transcribed region of interest (e.g. , coding for a RNA described herein) and a promoter sequence that is recognized by an RNA polymerase selected for use in in vitro transcription. Various RNA polymerases are known in the art, including, e.g., DNA dependent RNA polymerases (e.g., a T7 RNA polymerase, a T3 RNA polymerase, a SP6 RNA polymerase, a N4 virion RNA polymerase, or a variant or functional domain thereof). A skilled artisan will readily understand that an RNA polymerase utilized herein may be a recombinant RNA polymerase, and / or a purified RNA polymerase, i.e.. not as part of a cell extract, which contains other components in addition to the RNA polymerases. One skilled in the art will recognize an appropriate promoter sequence for the selected RNA polymerase. In some embodiments, a DNA template can comprise a promoter sequence for a T7 RNA polymerase.

[0505] In some embodiments, a DNA template comprises a nucleotide sequence coding for an RNA described herein (e.g. , comprising a nucleotide sequence coding for an antigen of interest and optionally comprising one or more nucleotide sequences coding for characteristic elements of an RNA described herein, including, e.g., polyA tail, 3’ UTR, and / or 5’ UTR, etc.). In some embodiments, such a coding sequence may be generated by gene synthesis. In some embodiments, such a coding sequence may be inserted into a vector by cold fusion cloning.

[0506] In some embodiments, a DNA template may further comprise one or more of a recognition sequence for an appropriate restriction endonuclease (e.g., utilized for linearization), an appropriate resistance gene, and / or an appropriate origin of replication. In some embodiments, a DNA template may further comprise a recognition sequence for an appropriate restriction endonuclease (e.g., utilized for linearization such as, e.g., but not limited to a Class II restriction endonuclease), an appropriate resistance gene (e.g., but not limited to a kanamycin resistance gene), and an appropriate origin of replication.

[0507] In some embodiments, a DNA template may be amplified via polymerase chain reaction (PCR) from a plasmid DNA. In some embodiments, a plasmid DNA may be obtained, e.g., from bacterial cells (e.g., Escherichia coli (E. coli)) followed by an endotoxin- and animal product-free plasmid isolation procedure. In some embodiments, a DNA template may be a linearized plasmid DNA (pDNA) template in the absence of PCR-based amplification. In some such embodiments, a cell bank or a cell stock for a pDNA of interest (e.g., as described herein) may be established. For example, in some embodiments, such a cell bank or a cell stock may comprise a frozen stock of bacterial cells (e.g., E. coli cells, such as DH10B E. coli cells) that are genetically engineered to comprise a pDNA template of interest (e.g., as described herein) with pre -determined specifications. In some embodiments, a pDNA contains a promoter sequence (e.g. T7 RNA polymerase). In some embodiments, a pDNA contains a recognition sequence for an endonuclease (e.g., for linearization). In some embodiments, a pDNA contains a resistance gene. In some embodiments, a pDNA contains an origin of replication. In some embodiments, a pDNA contains one or more of a promoter sequence, a recognition sequence for an endonuclease, a resistance gene, and / or an origin of replication.

[0508] In some embodiments, a master cell bank or a master cell stock may be established. A cell bank or cell stock may be established, for example, by transforming a stock of competent bacterial cells (e.g., E. coli cells) with a pDNA of interest. A pure culture of transformed cells may be produced, for example, by growth on selective medium. Subsequently, a single colony isolate may be selected and grown in liquid culture and, in some embodiments, used to inoculate larger cultures volumes. In some embodiments, culture growth is stopped at a predetermined threshold (e.g., optical density (OD) threshold). In some embodiments, cryoprotectant (e.g., glycerol) is added to the culture. In some embodiments, the cell suspension is aliquoted into a container (e.g., tubes, vials, cryovials, etc.) and frozen using a controlled rate freezer. In some embodiments, cell bank aliquots are stored at least at -100°C, -125°C, -150°C, or colder (e.g., in the vapor phase of a liquid nitrogen freezer or dewar).

[0509] In some embodiments, quality control testing is performed on a master cell bank or cell stock, for example, by evaluating one or more of culture purity, presence of lytic bacteriophage, presence of lysogenic bacteriophage, host cell identity, viability, plasmid retention, restriction map analysis, plasmid copy number, and / or DNA sequencing. In some embodiments, a vial from a master cell bank or cell stock may be thawed to inoculate a culture (e.g., a working cell bank). In some embodiments, working cell bank culture growth may be stopped at a particular predetermined threshold. In some embodiments, a cryoprotectant is added. In some embodiments, a working cell bank is aliquoted, stored, and / or evaluated for quality (e.g., as described for a master cell bank). In some embodiments, master cell bank and working cell banks are monitored for quality over time (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 years or more after release) until the cell bank is depleted and / or no longer used.

[0510] A pDNA can be amplified by first thawing and subsequent fermentation of the genetically engineered bacterial cells (e.g., E. coli cells from a cell bank), followed by purification of the pDNA (e.g., by filtration, chromatography, etc.), linearization (e.g., by an endonuclease), and optionally a polishing step as appropriate, thereby generating a linearized pDNA. In some embodiments, a resulting linearized pDNA is assessed for a set of relevant specifications, including, for example, DNA concentration, purity, appearance, residual host cell DNA and / or RNA, residual selection drug, residual protein, pH, PolyA tail integrity and / or identity, linearization efficiency (e.g., least 75%, 80%, 85%, 90%, 95%, or more), identity of transcribed region, bioburden, and / or endotoxins. In some embodiments, linear DNA template is stored in water (e.g., high purity water). In some embodiments, linear DNA template is stored in buffer (e.g., HEPES, pH 7-9).

[0511] Ribonucleotides

[0512] Ribonucleotides for use in in vitro transcription may include at least two or more (e.g., at least three or more, at least four or more, at least five or more, at least six or more) different types of ribonucleotides, each type having a different nucleoside. Ribonucleotides for use in in vitro transcription can include unmodified and / or modified ribonucleotides. Unmodified ribonucleotides include the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). In some embodiments, all four types of unmodified ribonucleotides may be used for in vitro transcription.

[0513] In some embodiments, at least one type of ribonucleotide included in in vitro transcription is a modified ribonucleotide. Modified ribonucleotides may include one or more modifications including, but not limited to, for example, (a) end modifications, e.g., 5' end modifications (e.g., phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (e.g., conjugation, inverted linkages, etc.), (b) base modifications, e.g. , replacement with modified bases, stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, and (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages. To the extent that such modifications interfere with translation (e.g., results in a reduction of 50% or more in translation relative to the absence of the modification - e.g., as characterized using a rabbit reticulocyte in vitro translation assay), such modified ribonucleotides, in some embodiments, are not desirable for use in systems and methods described herein.

[0514] In some embodiments, a modified ribonucleotide may have at least one nucleoside ("base") modification or substitution. Various nucleoside modifications or substitutions are known in the art; one of skill in the art will appreciate that modified nucleosides include, for example, but not limited to synthetic and natural nucleobases such as inosine, xanthine, hypoxanthine, nubularine, isoguanisine, tubercidine, 2- (halo)adenine, 2-(alkyl)adenine, 2-(propyl)adenine, 2- (amino)adenine, 2-(aminoalkyll)adenine, 2- (aminopropyl)adenine, 2-(methylthio)-N6-(isopentenyl)adenine, 6-(alkyl)adenine, 6- (methyl) adenine, 7- (deaza)adenine, 8-(alkenyl)adenine, 8-(alkyl)adenine, 8-(alkynyl)adenine, 8-(amino)adenine, 8- (halo)adenine, 8-(hydroxyl)adenine, 8-(thioalkyl)adenine, 8-(thiol)adenine, N6-(isopentyl)adenine, N6- (methyl) adenine, N6, N6-(dimethyl)adenine, 2-(alkyl)guanine, 2- (propyl)guanine, 6-(alkyl)guanine, 6- (methyl)guanine, 7-(alkyl)guanine, 7-(methyl)guanine, 7-(deaza)guanine, 8-(alkyl)guanine, 8- (alkenyl)guanine, 8-(alkynyl)guanine, 8-(amino)guanine, 8-(halo)guanine, 8-(hydroxyl)guanine, 8- (thioalkyl)guanine, 8-(thiol)guanine, N-(methyl)guanine, 2-(thio)cytosine, 3-(deaza)-5- (aza)cytosine, 3- (alkyl)cytosine, 3-(methyl)cytosine, 5-(alkyl)cytosine, 5-(alkynyl)cytosine, 5-(halo)cytosine, 5- (methyl)cytosine, 5-(propynyl)cytosine, 5-(propynyl)cytosine, 5-(trifluoromethyl)cytosine, 6- (azo)cytosine, N4-(acetyl)cytosine, 3-(3 amino-3 carboxypropyl)uracil, 2-(thio)uracil, 5-(methyl)-2- (thio)uracil, 5- (methylaminomethyl)-2 (thio)uracil, 4-(thio)uracil, 5-(methyl)-4 (thio)uracil, 5- (methylaminomethyl)-4 (thio)uracil, S-(methyl) -2,4-(dithio)uracil, 5-(methylaminomethyl)-2,4 (dithio)uracil, 5-(2-aminopropyl)uracil, 5-(alkyl)uracil, 5-(alkynyl)uracil, 5-(allylamino)uracil, 5- (aminoallyl)uracil, 5-(aminoalkyl)uracil, 5-(guanidiniumalkyl)uracil, 5-(l,3-diazole-l-alkyl)uracil, 5- (cyanoalkyl)uracil, 5-(dialkylaminoalkyl)uracil, 5 -(dimethylaminoalky l)uracil, 5-(halo)uracil, 5- (methoxy)uracil, uracil-5-oxyacetic acid, 5-(methoxycarbonylmethyl)-2-(thio)uracil, 5- (methoxycarbonyl-methyl)uracil, 5-(propynyl)uracil, 5-(propynyl)uracil, 5-(trifluoromethyl)uracil, 6- (azo)uracil, dihydrouracil, N3- (methyl)uracil, 5-uracil (7.e.. pseudouracil), 2- (thio)pseudouracil,4- (thio)pseudouracil, 2,4-(dithio)psuedouracil,5-(alkyl)pseudouracil, 5-(methyl)pseudouracil, 5-(alkyl)- 2- (thio)pseudouracil, 5-(methyl)-2-(thio)pseudouracil, 5-(alkyl)-4 (thio)pseudouracil, 5-(methyl)-4 (thio)pseudouracil, 5-(alkyl)-2,4 (dithio)pseudouracil, 5-(methyl)-2,4 (dithio)pseudouracil, 1 -substituted pseudouracil (e.g., 1-methyl-pseudouridine), C-5 propynyl-uridine, 2-aminoadenosine, C5 -bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, l-substituted-2(thio)-pseudouracil, 1-substituted 4 (thio)pseudouracil, 1-substituted 2, 4-(dithio)pseudouracil, l-(aminocarbonylethylenyl)-pseudouracil, 1- (aminocarbonylethylenyl)-2(thio)-pseudouracil, 1 (aminocarbonylethylenyl)-4 (thio)pseudouracil, 1- (aminocarbonylethylenyl)-2,4-(dithio)pseudouracil, 1 - (arninoalkylaminocarbonylethylenyl)- pseudouracil, 1 (aminoalkylamino-carbonylethylenyl)-2(thio)-pseudouracil, 1- (arninoalkylaminocarbonylethylenyl)-4 (thio)pseudouracil, l-(arninoalkylaminocarbonylethylenyl)- 2,4- (dithio)pseudouracil, l,3-(diaza)-2-(oxo)-phenoxazin-l-yl, l-(aza)-2-(thio)-3-(aza)-phenoxazin-l- yl, 1,3- (diaza)-2-(oxo)-phenthiazin-l-yl, l-(aza)-2-(thio)-3-(aza)-phenthiazin-l-yl, 7-substituted 1,3- (diaza)-2- (oxo)-phenoxazin-l-yl, 7-substituted l-(aza)-2-(thio)-3-(aza)-phenoxazin-l-yl, 7-substituted l,3-(diaza)-2- (oxo)-phenthiazin-l-yl, 7-substituted l-(aza)-2-(thio)-3-(aza)-phenthiazin-l-yl, 7- (aminoalkylhydroxy)-l,3- (diaza)-2-(oxo)-phenoxazin-l-yl, 7-(aminoalkylhydroxy)-l-(aza)-2-(thio)-3- (aza)-phenoxazin-l-yl, 7- (aminoalkylhydroxy)-l,3-(diaza)-2-(oxo)-phenthiazin-l-yl, 7- (aminoalkylhydroxy)-l-(aza)-2-(thio)-3- (aza)-phenthiazin-l-yl, 7-(guanidiniumalkylhydroxy)-l,3- (diaza)-2-(oxo)-phenoxazin-l-yl, 7- (guanidiniumalkylhydroxy)-l-(aza)-2-(thio)-3-(aza)-phenoxazin-l-yl, 7-(guanidiniumalkyl -hydroxy)- 1,3- (diaza)-2-(oxo)-phenthiazin-l -yl, 7- (guanidiniumalkylhydroxy)-l -(aza)-2-(thio)-3-(aza)-phenthiazin-l - yl, 1 ,3,5-(triaza)-2,6-(dioxa)- naphthalene, inosine, xanthine, hypoxanthine, nubularine, tubercidine, isoguanisine, inosinyl, 2-aza- inosinyl, 7-deaza-inosinyl, nitroimidazolyl, nitropyrazolyl, nitrobenzimidazolyl, nitroindazolyl, aminoindolyl, pyrrolopyrimidinyl, 3-(methyl)isocarbostyrilyl, 5- (methyl)isocarbostyrilyl, 3-(methyl)- 7-(propynyl)isocarbostyrilyl, 7-(aza)indolyl, 6-(methyl)-7- (aza)indolyl, imidizopyridinyl, 9-(methyl)- imidizopyridinyl, pyrrolopyrizinyl, isocarbostyrilyl, 7- (propynyl)isocarbostyrilyl, propynyl-7- (aza)indolyl, 2,4,5-(trimethyl)phenyl, 4-(methyl)indolyl, 4,6- (dimethyl)indolyl, phenyl, napthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenyl, tetracenyl, pentacenyl, difluoro tolyl, 4-(fluoro)-6- (methyl)benzimidazole, 4-(methyl)benzimidazole, 6- (azo)thymine, 2-pyridinone, 5 nitroindole, 3 nitropyrrole, 6-(aza)pyrimidine, 2 (amino)purine, 2,6- (diamino)purine, 5 substituted pyrimidines, N2- substituted purines, N6-substituted purines, 06- substituted purines, substituted 1,2,4-triazoles, pyrrolo-pyrimidin-2-on-3-yl, 6-phenyl-pyrrolo-pyrimidin- 2-on-3-yl, para-substituted-6-phenyl- pyrrolo-pyrimidin-2-on-3-yl, ortho-substituted-6-phenyl-pyrrolo- pyrimidin-2-on-3-yl, bis-ortho- substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl, para- (aminoalkylhydroxy)- 6-phenyl-pyrrolo- pyrimidin-2-on-3-yl, ortho-(aminoalkylhydroxy)- 6-phenyl- pyrrolo-pyrimidin-2-on-3-yl, bis-ortho — (aminoalkylhydroxy)- 6-phenyl-pyrrolo-pyrimidin-2-on-3-yl, pyridopyrimidin-3-yl, 2-oxo-7-amino- pyridopyrimidin-3-yl, 2-oxo-pyridopyrimidine-3-yl, or any Ci- alkylated or N-alkylated derivatives thereof.

[0515] In some embodiments, a modified nucleotide utilized in IVT systems and / or methods described herein may disrupt binding of an RNA to one or more mammalian (e.g. , human) endogenous RNA sensors (e.g. , innate immune RNA sensors), including, e.g., but not limited to toll-like receptor (TLR)3, TLR7, TLR8, retinoic acid-inducible gene I (RIG-I), melanoma differentiation-associated gene 5 (MDA5), protein kinase R (PKR), 2’ -5’ oligoadenylate synthetase (OAS), and laboratory of genetics and physiology 2 (LGP2), and combinations thereof. In some embodiments, such modified ribonucleotides may include modifications as described in US 9,334,328, the contents of which are incorporated herein by reference in their entireties for the purposes described herein. Modified nucleosides are typically desirable to be translatable in a host cell (e.g., presence of a modified nucleoside does not prevent translation of an RNA sequence into a respective protein sequence). Effects of modified nucleotides on translation can be assayed, by one of ordinary skill in the art using, for example, a rabbit reticulocyte lysate translation assay.

[0516] In some embodiments, a modified ribonucleotide may include a modified internucleoside linkage. Various such modified internucleoside linkages are known in the art; one of skill in the art will appreciate that non-limiting examples of modified intemucleoside linkages that may be used in technologies provided herein include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalky Iphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. Modified internucleoside linkages that do not include a phosphorus atom therein may have internucleoside linkages that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.

[0517] In some embodiments, a modified ribonucleotide may include one or more substituted sugar moieties. Various such modified sugar moieties are known in the art; one of skill in the art will appreciate that, in some embodiments, a sugar moiety of a ribonucleotide may include one of the following at the 2' position: H (deoxyribose); OH (ribose); F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted. In some embodiments, a sugar moiety of a ribonucleotide may include a 2' methoxyethoxy (2'-O- CH2CH2OCH3, also known as 2'-O-(2 -methoxyethyl) or 2-MOE), 2'- dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMA0E, and 2'- dimethylaminoethoxyethoxy (also known in the art as 2'0-dimethylaminoethoxyethyl or 2'- DMAEOE), i.e. , 2'-O-CH2-O-CH2-N(CH2)2; 2'- methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions, for example, at the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked nucleotides and the 5' position of 5' terminal nucleotide.

[0518] In some embodiments, a mixture of ribonucleotides that are useful for an in vitro transcription reaction may comprise ATP, CTP, GTP, and Nl-methylpseudouridine-5’ triphosphate (ml TTP). In some embodiments, the ratio of ATP, CTP, GTP, and ml TTP for an in vitro transcription reaction is 1:1:1: 1. In some embodiments, the ratio of ATP, CTP, GTP, and ml TTP for an in vitro transcription is optimized such that relative proportions of nucleotides correspond to fractions of the respective nucleotides in an mRNA molecule, e.g., as described in the International Patent Publication No. WO 2015188933.

[0519] Exemplary in vitro transcription reaction mixture

[0520] One of ordinary skill in the art will understand materials and reagents for a typical in vitro transcription. In some embodiments, an individual reaction component or components are thawed prior to their addition to an in vitro transcription reaction mixture. For example, an in vitro transcription reaction mixture typically includes a DNA template (e.g. , as described herein), ribonucleotides (e.g. , as described herein), a RNA polymerase (e.g., DNA dependent RNA polymerases), and an appropriate reaction buffer for a selected RNA polymerase. In some embodiments, an in vitro transcription reaction mixture may further comprise an RNase inhibitor. In some embodiments, an in vitro transcription reaction mixture may further comprise a pyrophosphatase (e.g., an inorganic pyrophosphatase). In some embodiments, an in vitro transcription reaction mixture may further comprise one or more salts (e.g. , monovalent salts and / or divalent salts), a reducing agent (e.g., dithithreitol, 2-mercaptoethanol, etc.), spermidine, or combinations thereof. In some embodiments, certain reaction components are added in a specific order (e.g., pyrophosphatase and polymerase added last). In some embodiments, agitation rate is increased following the addition of specific reaction components (e.g., pyrophosphatase, polymerase).

[0521] Various RNA polymerases that are suitable for in vitro transcription are known in the art, including, e.g., but not limited to DNA dependent RNA polymerases (e.g., a T7 RNA polymerase, a T3 RNA polymerase, a SP6 RNA polymerase, a N4 virion RNA polymerase, or a variant or functional domain thereof). A skilled artisan will understand that an RNA polymerase utilized herein may be a recombinant RNA polymerase, and / or a purified RNA polymerase, i.e., not as part of a cell extract, which contains other components in addition to the RNA polymerases. In some embodiments, an RNA polymerase that is useful for commercial-scale in vitro transcription is a T7 RNA polymerase. In some embodiments, an inorganic pyrphosphatase may be added to improve the yield of in vitro transcription reaction (e.g., in some embodiments catalyzed by T7 RNA polymerase).

[0522] Transcription buffer is typically optimized for a selected RNA polymerase. For example, in some embodiments, a transcription buffer may comprise Tris-HCl, HEPES, or other appropriate buffer. In some embodiments, a transcription buffer can comprise 20-60 mM HEPES, 20-60 mM divalent salt (e.g., magnesium salts, such as magnesium chloride, magnesium acetate, etc.), 5-15 mM reducing agent (e.g., dithiothreitol, 2-mercaptoethanol, etc.) and 0.5 - 3 mM spermidine. In some embodiments, a transcription buffer has a pH of 7-9 (e.g., about 7.1, 7.2, 7.3, 7.4, 7.5, 7.6 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0).

[0523] 5’ cap

[0524] In some embodiments, an RNA produced by technologies described herein may comprise a cap at its 5’ end. Those skilled in the art will appreciate that addition of a 5' cap to an RNA (e.g., mRNA) can facilitate recognition and attachment of the RNA to a ribosome to initiate translation and enhances translation efficiency. Those skilled in the art will also appreciate that a 5' cap can also protect an RNA product from 5' exonuclease mediated degradation and thus increases half-life. Methods for capping are known in the art; one of ordinary skill in the art will appreciate that in some embodiments, capping may be performed after in vitro transcription in the presence of a capping system (e.g., an enzyme -based capping system such as, e.g., capping enzymes of vaccinia virus). In some embodiments, a capped RNA may be obtained by in vitro capping of RNA that has a 5' triphosphate group or RNA that has a 5' diphosphate group with a capping enzyme system (including, e.g., but not limited to vaccinia capping enzyme system or Saccharomyces cerevisiae capping enzyme system). In some embodiments, a capping agent may be introduced into an in vitro transcription reaction mixture (e.g., ones as described herein), along with a plurality of ribonucleotides such that a cap is incorporated into an RNA during transcription (also known as co-transcriptional capping). While it may be desirable to include, in some embodiments, a 5' cap in an RNA, an RNA, in some embodiments, may not have a 5’ cap.

[0525] In some embodiments, a 5’ capping agent can be added to an in vitro transcription reaction mixture. In some embodiments, a 5’ capping agent may comprise a modified nucleotide, for example, a modified guanine nucleotide. In some embodiments, a 5’ capping agent may comprise, for example, a methyl group or groups, glyceryl, inverted deoxy abasic moiety, 4’5’ methylene nucleotide, l-(beta-D-erythrofuranosyl) nucleotide, 4’ thio nucleotide, carbocyclic nucleotide, 1 ,5-anhydrohexitol nucleotide, L-nucleotides, alpha-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5 dihydroxypentyl nucleotide, 3 '-3 '-inverted nucleotide moiety, 3'-3'-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3 '-2 '-inverted abasic moiety, 1 ,4- butanediol phosphate, 3'-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 3'phosphorothioate, phosphorodi thioate, or bridging or non-bridging methylphosphonate moiety, inosine, Nl-methyl-guanosine, 2’-fluoro-guanosine, 7’deaza-guanosine, 8 -oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine. In some embodiments, a 5’ capping agent may be or comprise a dinucleotide cap analog (including, e.g., a m7GpppG cap analog or an N7-methyl, 2’-O- methyl -GpppG anti-reverse cap analog (ARCA) cap analog or an N7-methyl, 3'-O-methyl-GpppG ARCA cap analog). In some embodiments, a 5’ capping agent comprises a 5' N7-Methyl-3'-O-Methylguanosine structure, e.g., CleanCap® Reagents (Trilink BioTechnologies). In some embodiments, a 5’-capping agent is added in excess to a particular ribonucleotide or ribonucleotides (e.g., GTP, ATP, UTP, CTP, or modified version thereof) to enable incorporation of the 5’ -cap as the first addition to the RNA transcript.

[0526] In vitro transcription reaction conditions

[0527] In some embodiments, an in vitro transcription reaction is conducted, e.g., in a bioreactor described herein (selected for a certain in vitro transcription reaction volume, e.g., as described herein) for a period of time. In some embodiments, the period of time is at least 20 minutes, including, e.g., at least 25 minutes, at least 30 minutes, at least 40 minutes, at least 55 minutes, at least 60 minutes, at least 75 minutes, at least 90 minutes, at least 105 minutes, at least 120 minutes, at least 135 minutes, at least 150 minutes, at least 165 minutes, or at least 180 minutes. In some embodiments, the period of time is 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, or 180 minutes. In some embodiments, the period of time is about 1.5-3 hours. In some embodiments, the period of time is about 25-35 minutes.

[0528] In some embodiments, an in vitro transcription reaction is conducted, e.g., in a bioreactor described herein for a period of time (e.g., as described herein) at a temperature at which a selected RNA polymerase is functionally active. While typical phage RNA polymerases (e.g., T7 polymerases) that carry out in vitro transcription reactions are usually not active at elevated temperatures (e.g., above 45°C), thermostable RNA polymerases (e.g., thermostable variants of T7 RNA polymerases such as ones as described in US10519431, the contents of which are incorporated by reference for purposes described herein) can show increased stability at elevated temperatures. In some embodiments, in vitro transcription is performed at a temperature of approximately 25°C or higher, including, e.g., 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C, or 45°C. In some embodiments, in vitro transcription is performed at a temperature of approximately 45°C or higher, including, e.g., 46°C, 47°C, 48°C , 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C or higher.

[0529] In some embodiments, an in vitro transcription is conducted e.g., in a bioreactor described herein at a pH of about 6, 6.5, 7, 7.5, 8, or 9. In some embodiments, a suitable pH for an in vitro transcription may be approximately 7.5 -8.5.

[0530] In some embodiments, in vitro transcription reactions performed in accordance with the present disclosure (e.g., in a bioreactor as described herein) may be performed as continuous feed reactions; in some embodiments, they may be performed as batch-fed reactions. In some embodiments, one or more nucleotides may be added to an in vitro transcription reaction in a step-wise manner (e.g. at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more bolus feeds). In some embodiments, an agitation rate is selected such that a particular blend time to enable rapid mixing of bolus additions to ensure optimal availability of modified nucleotide solution and one or more other nucleotide solutions during RNA synthesis is achieved.

[0531] UTP limitation and / or supplementation: In some embodiments, an in vitro transcription reaction comprises UTP or a functional thereof at a limiting concentration in combination with at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof. In some embodiments, a functional analog of UTP is or comprises Nl- methylpseudouridine-5 ’ triphosphate (ml TTP). Without wishing to be bound by any particular theory, maintaining a low concentration of UTP or functional analog thereof can be useful for reducing generation of double-stranded RNA. In some embodiments, UTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that limits the rate of transcription. In some embodiments, UTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that is lower than the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof. In some embodiments, the starting concentration of UTP or a functional analog thereof is at least 30% lower (including, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof. In some embodiments, the ratio of the starting concentration of UTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof is about 1:1.3 or lower, including, e.g., 1:1.4; 1:1.5; 1:2, 1:2.5; 1:3; 1:3.5; 1:4; 1:4.5; 1:5; 1:6; 1:7; 1:8, 1:9; 1:10; 1:11; 1:12; 1:13; 1:14; 1:15; 1:16; 1:17; 1:18; 1:19; 1:20, or lower. In some embodiments, the ratio of the starting concentration of UTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof is about 1:1.3 to about 1:20, or about 1:1.5 to about 1:15, or about 1:5 to about 1:15, or about 1:8 to about 1:12. In some such embodiments, the starting concentration of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof may be the same.

[0532] In some embodiments, an in vitro transcription reaction is supplemented at least once with UTP or a functional analog thereof over the course of the reaction. In some embodiments, an in vitro transcription reaction is supplemented multiple times (e.g., at least 2 or more, including, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) with UTP or a functional analog thereof over the course of the transcription reaction. In some embodiments, supplementation of UTP or a functional analog thereof is performed when its concentration in the reaction mixture is near depletion. In some embodiments, supplementation of UTP or a functional analog thereof is performed when its concentration in the reaction mixture is less than 100 uM, 90 uM, 80 uM, 70 uM, 60 uM, 50 uM, 40 uM, 30 uM, 20 uM, 10 uM, 5 uM, 3 uM, 2, uM, 1 uM, 500 nM, 250 nM, 200 nM, 100 nM, 50 nM, 25 nM, or lower.

[0533] In some embodiments, UTP (or a functional analog thereof) supplementation may be performed continuously during the course of the transcription reaction. For example, in some embodiments, UTP (or a functional analog thereof) supplementation may be performed in a continuous manner at a rate that is comparable to (e.g., within 10% or lower) of its consumption rate. In some embodiments, UTP (or a functional analog thereof) supplementation may be performed at a rate such that after such supplementation, UTP or functional analog thereof is present in the reaction at a concentration lower than that of one or more, and in some embodiments, all of ATP or functional analog thereof, GTP or functional analog thereof, and / or CTP or functional analog thereof.

[0534] In some embodiments, UTP (or a functional analog thereof) supplementation may be performed periodically during the course of the transcription reaction. In some embodiments, UTP (or a functional analog thereof) supplementation may be performed in a periodic manner such that after each addition, UTP or functional analog thereof is present in the reaction at a concentration lower than that of one or more, and in some embodiments, all of ATP or functional analog thereof, GTP or functional analog thereof, and / or CTP or functional analog thereof. In some embodiments, such periodic supplementation may be performed as one or more bolus or batch addition(s), including, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more bolus or batch addition(s). In some embodiments, such periodic supplementation may be performed by a fed-batch process.

[0535] In some embodiments, the concentration of UTP or a functional analog thereof added during supplementation is same as the starting concentration of UTP or a functional analog thereof. In some embodiments, the concentration of UTP or a functional analog thereof added during supplementation is lower than the starting concentration of UTP or a functional analog thereof, e.g., at least 10% lower (including, e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of UTP or a functional analog thereof.

[0536] In some embodiments, UTP (or a functional analog thereof) supplementation is performed at a concentration and / or at a rate or manner such that the ratio of the concentration of UTP or a functional analog thereof to the concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof (during the course of the reaction) is maintained substantially the same (e.g., within 10% or less) as the initial ratio of the concentration of UTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof (at the beginning of the reaction).

[0537] In some embodiments, UTP or a functional analog thereof is supplemented until the end of the transcription reaction.

[0538] In some embodiments, UTP or a functional analog thereof is present in an initial transcription reaction at a starting concentration of 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 rnM. In some embodiments, UTP or a functional analog thereof is maintained during the course of an in vitro transcription reaction at a concentration of 0.1 to 2 mM or 0.1 to 1.5 rnM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM. Optional additional non-UTP limitation and / or supplementation'. In some embodiments, at least one of non-UTP (or functional analog thereof) is provided at a limiting concentration (in addition to limited UTP or a functional analog thereof) at the initial in vitro transcription reaction (e.g., the beginning of the in vitro transcription reaction). For example, in some embodiments, at least one of ATP or a functional analog thereof, CTP or a functional analog thereof, or GTP or a functional analog thereof is provided at a limiting concentration (in addition to limited UTP or a functional analog thereof) at the initial in vitro transcription reaction (e.g., the beginning of the in vitro transcription reaction). In some embodiments, GTP or a functional analog thereof is provided at a limiting concentration (in addition to limited UTP or a functional analog thereof) at the initial in vitro transcription (e.g., the beginning of the in vitro transcription reaction).

[0539] In some embodiments, GTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that limits the rate of transcription. In some embodiments, GTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that is lower than the starting concentration of at least one or all of ATP or a functional analog thereof and / or CTP or a functional analog thereof. In some embodiments, the starting concentration of GTP or a functional analog thereof is at least 30% lower (including, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of at least one or all of ATP or a functional analog thereof and / or CTP or a functional analog thereof. In some embodiments, the ratio of the starting concentration of GTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof and / or CTP or a functional analog thereof is about 1:1.3 or lower, including, e.g., 1:1.4; 1:1.5; 1:2, 1:2.5; 1:3; 1:3.5; 1:4; 1:4.5; 1:5; 1:6; 1:7; 1:8, 1:9; 1:10; 1:11; 1:12; 1:13; 1:14; 1:15; 1:16; 1:17; 1:18; 1:19; 1:20, or lower. In some embodiments, the ratio of the starting concentration of GTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof and / or CTP or a functional analog thereof is about 1:1.3 to about 1:20, or about 1:1.5 to about 1:15, or about 1:5 to about 1:15, or about 1:8 to about 1:12. In some such embodiments, the starting concentration of ATP or a functional analog thereof and / or CTP or a functional analog thereof.

[0540] In some embodiments, an in vitro transcription reaction is supplemented at least once with GTP or a functional analog thereof over the course of the reaction. In some embodiments, an in vitro transcription reaction is supplemented multiple times (e.g., at least 2 or more, including, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) with GTP or a functional analog thereof over the course of the transcription reaction. In some embodiments, supplementation of GTP or a functional analog thereof is performed when its concentration in the reaction mixture is near depletion. In some embodiments, supplementation of GTP or a functional analog thereof is performed when its concentration in the reaction mixture is less than 100 uM, 90 uM, 80 uM, 70 uM, 60 uM, 50 uM, 40 uM, 30 uM, 20 uM, 10 uM, 5 uM, 3 uM, 2, uM, 1 uM, 500 nM, 250 nM, 200 nM, 100 nM, 50 nM, 25 nM, or lower.

[0541] In some embodiments, GTP (or a functional analog thereof) supplementation may be performed continuously during the course of the transcription reaction. For example, in some embodiments, GTP (or a functional analog thereof) supplementation may be performed in a continuous manner at a rate that is comparable to (e.g., within 10% or lower) of its consumption rate. In some embodiments, GTP (or a functional analog thereof) supplementation may be performed at a rate such that after such supplementation, GTP or functional analog thereof is present in the reaction at a concentration lower than that of ATP or functional analog thereof and / or CTP or functional analog thereof.

[0542] In some embodiments, GTP (or a functional analog thereof) supplementation may be performed periodically during the course of the transcription reaction. In some embodiments, GTP (or a functional analog thereof) supplementation may be performed in a periodic manner such that after each addition, GTP or functional analog thereof is present in the reaction at a concentration lower than that of one or more, and in some embodiments, all of ATP or functional analog thereof, and / or CTP or functional analog thereof. In some embodiments, such periodic supplementation may be performed as one or more bolus or batch addition(s), including, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more bolus or batch addition(s). In some embodiments, such periodic supplementation may be performed by a fed-batch process.

[0543] In some embodiments, the concentration of GTP or a functional analog thereof added during supplementation is same as the starting concentration of GTP or a functional analog thereof. In some embodiments, the concentration of GTP or a functional analog thereof added during supplementation is lower than the starting concentration of GTP or a functional analog thereof, e.g., at least 10% lower (including, e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of GTP or a functional analog thereof.

[0544] In some embodiments, GTP (or a functional analog thereof) supplementation is performed at a concentration and / or at a rate or manner such that the ratio of the concentration of GTP or a functional analog thereof to the concentration of ATP or a functional analog thereof, and / or CTP or a functional analog thereof (during the course of the reaction) is maintained substantially the same (e.g., within 10% or less) as the initial ratio of the concentration of GTP or a functional analog thereof to the starting concentration of ATP or a functional analog thereof and / or CTP or a functional analog thereof (at the beginning of the reaction). In some embodiments, GTP or a functional analog thereof is supplemented until the end of the transcription reaction.

[0545] In some embodiments, GTP or a functional analog thereof is present in an initial transcription reaction at a starting concentration of 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM. In some embodiments, GTP or a functional analog thereof is maintained during the course of an in vitro transcription reaction at a concentration of 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM.

[0546] In some embodiments, non-UTP supplementation does not include supplementation of CTP or functional analog thereof or ATP or functional analog thereof.

[0547] In some embodiments where non-UTP supplementation is performed, such non-UTP supplementation can be performed concurrently with UTP supplementation over the course of the reaction. In some embodiments, non-UTP or functional analog thereof and UTP or functional analog thereof can be added to a reaction mixture as a single composition. In some embodiments, non-UTP or functional analog thereof and UTP or functional analog thereof can be added to a reaction mixture as separate compositions, for example, each at the same or different concentrations and / or each introduced at the same or different flow rates to a reaction mixture). In some embodiments, such non-UTP supplementation and UTP supplementation can be performed by different methods, e.g., one is performed continuously (e.g., as described herein) while another is performed periodically (e.g., as described herein).

[0548] In some embodiments, in vitro transcription in accordance with the present disclosure is carried out, e.g., in a bioreactor as described herein, using a fed-batch process and the present disclosure teaches that such fed-batch process may have certain advantages including, for example, ability to maintain one or more reagents or components within a particular concentration range. For example, in some embodiments, a fed-batch process may involve multiple additions of a nucleotide that competes with a cap analog (a “competing nucleotide”) such as, e.g., a GTP, in the course of an in vitro transcription reaction, for example to maintain a low concentration of GTP (e.g., 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM) in order to effectively cap a synthesized RNA. In some embodiments, a fed- batch process may involve supplementation of an in vitro transcription reaction with a competing nucleotide at a ratio between about 1 : 1 and about 1 :50 relative to the concentration of a cap analog in the reaction, e.g., as described in the International Patent Publication No. WO 2006004648. In some embodiments, the concentration of a competing nucleotide in an in vitro transcription reaction is maintained at a level that is less than the concentration of a cap analog throughout the reaction but is not a limiting component. In some embodiments, a programmable pump may be used. In some embodiments, a programmable syringe pump may be used, for example, to automatically perform step-wise addition of one or more reaction components. Alternatively or additionally, in some embodiments, a monitor (e.g., a sensor) may be utilized to detect level(s) of one or more components; in some such embodiments, a monitor may communicate automatically with a pump, for example so that additional feeds may be released upon detection of a reduced amount of such component(s). In some embodiments, an in vitro transcription reaction is optimized such that relative proportions of nucleotides correspond to fractions of the respective nucleotides in an mRNA molecule, e.g., as described in the International Patent Publication No. WO 2015188933.

[0549] In some embodiments, following RNA transcription, a DNA template can be removed or separated from an in vitro transcription RNA composition, for example using methods known in the art, e.g., DNA hydrolysis. For example, in some embodiments, DNase (e.g., DNase I) may be added to remove or digest or fragment DNA template under appropriate conditions (e.g., in the presence of divalent salt such as a calcium salt and / or incubation at an optimum temperature for DNase). In some embodiments, DNA removal is performed for a period of 15-20 minutes, 15-25 minutes, 20-25 minutes, 20-30 minutes, 25-30 minutes, 25-35 minutes, 30-35 minutes, 30-40 minutes, 35-40 minutes, 35-45 minutes, 45-50 minutes, SO- 55 minutes, or 55-60 minutes. In some embodiments, DNA removal is performed at a temperature of approximately 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31 °C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C, or 45°C. In some embodiments, DNA removal is performed at a temperature of 30-40 °C. In some embodiments, agitation rate is maintained during DNA removal (e.g., DNA hydrolysis) from the previous IVT step.

[0550] In some embodiments, an RNase inhibitor may be added during DNA removal or digestion to protect RNA from potential degradation. In some embodiments, a chelating agent may be added to a DNase- treated transcription mixtures to complex with divalent ions that may be added during in vitro transcription reaction. An exemplary chelating agent may be or comprise ethylenediaminetetraacetic acid (EDTA). In some embodiments, upon addition of chelating agent, the temperature may be shifted at least 1°C (including e.g., at least 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C or more).

[0551] In some embodiments, following RNA transcription, an in vitro transcription RNA composition (e.g., in some embodiments after DNA removal and / or digestion) can be subjected to a protein digestion or fragmentation process. In some embodiments, an exemplary protein digestion or fragmentation may comprise use of a proteinase (e.g., but not limited to proteinase K). In some embodiments, protein digestion utilizes a relative amount of enzyme (e.g., proteinase) to starting IVT volume, for example, at least 0.5 mL / L, at least 0.75 mL / L, at least 1 mL / L, at least 1.25 mL / L, or more. In some embodiments, protein digestion is conducted at a particular temperature (e.g., at least 30°C, at least 31 °C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, or higher) for a particular duration of time (e.g., at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, or longer). In some embodiments, RNA concentration, bioburden, and / or endotoxins are assessed and / or monitored after protein digestion.

[0552] In some embodiments, an in vitro transcription RNA composition following in vitro transcription and optional pre-purification processing (e.g., DNA and / or protein removal and / or digestion) may be maintained at 2-8°C for a period of time before further processing (e.g. , removal of impurities). In some embodiments, the maintained period of time may be at least 6 hours or longer, including, e.g., at least 12 hours, at least 18 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or longer.

[0553] In some embodiments, a RNA preparation may be held in a container, for example, a bag, tube, vial, etc. In some embodiments, the container is a polymer-based container (e.g., polyethylene, ethylene vinyl acetate).

[0554] In some embodiments, in process-controls and / or monitoring of an in vitro transcription can be conducted. For example, RNA concentration and / or integrity may be monitored during or after in vitro transcription. In some embodiments, RNA concentration may be assessed following purification of an aliquot of a transcription mixture with a commercial kit after in vitro transcription. In some embodiments, RNA concentration and / or integrity of a produced RNA solution after in vitro transcription may be assessed before maintaining at 2-8°C for a period of time (e.g., as described herein).

[0555] (II) Exemplary methods for removing one or more impurities

[0556] After an in vitro transcription RNA composition is produced by in vitro transcription, one or more components (e.g., added reagents, reaction by products, and / or impurities) can be removed by one or more purification and / or separation processes known in the art. For example, without limitation, an in vitro transcription RNA composition can be purified using phenol-chloroform extraction, enzymatic digestions of undesired components (e.g., protein components), precipitation, chromatography, spin column purification, membrane filtration, and / or affinity-based purification (e.g., in the form of a solid substrate, e.g., but not limited to magnetic beads or particles). In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and / or protein removal and / or digestion) can be purified by an affinity-based purification method, chromatography-based purification methods (e.g., size exclusion chromatography (SEC), high-performance liquid chromatography (HPLC), ion exchange chromatography (EC)), and / or filtration methods (e.g., centrifugal ultrafiltration, membrane filtration, etc.').

[0557] In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and / or protein removal and / or digestion) can be purified by an affinity-based purification method. In some embodiments, such an affinity -based purification method may be performed with a solid substrate known in the art. It will be apparent to one skilled in the art that a variety of solid substrates may be used, including, without limitation, membranes; beads; tubes; wells; microtiter plates or wells; slides; discs; columns; beads (including, e.g., polymeric beads, magnetic beads); membranes; films; chips; and composites thereof. For example, in some embodiments, a solid substrate (e.g., magnetic beads or particles) coated with a substance or composition that has a high binding affinity for high-molecular weight nucleic acids can be useful in accordance with the present disclosure such that RNA will bind to the solid substrate, while any other undesirable components present in an RNA transcription mixture, including, e.g., short hydrolyzed DNA fragments, free nucleotide triphosphates (NTPs), 5’ capping agent, proteins, divalent ions complexed with a chelating agent, will remain in solution. In some such embodiments, a silicate -coated solid substrate (e.g. , particles or magnetic beads) may be used. In some such embodiments, a carboxylate-coated solid substrate (e.g., particles or magnetic beads) may be used. In some embodiments, an RNA transcription mixture may be divided into a plurality of (e.g., at least two, at least three, at least four, or more) portions such that they can be purified in parallel (e.g., in batch mode).

[0558] In some embodiments, magnetic bead- or particle-based purification (e.g., as described herein) is carried out at room temperature (e.g. , about 18°C-3O°C, e.g. , about 18°C-25°C, or about 20°C-25°C, or about 20- 30°C, or about 23-27°C or about 25°C). In some embodiments, magnetic bead- or particle-based purification is performed under a suitable binding condition (e.g., in the presence of salt and organic solvent (e.g., ethanol)). In some embodiments, magnetic beads or particles (e.g., ones described herein) may be added to an RNA transcription mixture with a magnetic bead or particle -to-RNA ratio of approximately 1:1 to 1:5, or 1:1 to 1:3 under a suitable binding condition.

[0559] In some embodiments, after RNA binding to a solid substrate (e.g., coated magnetic beads or particles as described herein), the solid substrate can be separated from supernatant. For example, a magnet can be used to retain RNA-bound magnetic beads in a batch reaction vessel, while supernatant is subsequently removed. The RNA is then eluted from the magnetic beads under a suitable eluting condition (e.g., in the presence of a buffer and / or a chelating agent at a suitable pH). In some embodiments, such bind-and-elute process may be performed for a number of cycles (e.g. , at least two, at least three, at least four or more cycles).

[0560] In some embodiments, an in vitro transcription RNA composition is divided into aliquots. In some embodiments, such RNA aliquots are purified in parallel in batch mode with wash steps prior to the elution of purified RNA. In some embodiments one, two, three, four, five, or six wash steps are carried out. In some embodiments, different buffers are utilized in different wash steps. In some embodiments, the same solution is utilized in initial wash step or steps and a different solution is utilized in a final wash step. In some embodiments, RNA bound magnetic beads can be washed in multiple steps (e.g., three consecutive steps) with a first wash buffer comprising an organic solvent (e.g., ethanol) and a salt (e.g., sodium salt). In some embodiments, such a first wash buffer may comprise a 20-40% (v / v) ethanol / O.lM- 1M NaCl. In some embodiments, RNA bound magnetic beads can be further subjected to a final wash with an organic solvent (e.g., 80% ethanol).

[0561] In some embodiments, RNA that is bound on magnetic beads is subsequently eluted (e.g., after wash steps) by addition of an elution buffer. In some embodiments, an elution buffer comprises a chelating agent to complex and thus remove residual divalent ions (e.g., magnesium and / or calcium ions) that may be added during RNA synthesis process. In some embodiments, an elution buffer may comprise EDTA. While a skilled artisan will be able to select an appropriate buffer for elution, in some embodiments, an elution buffer may comprise HEPES buffer. In some embodiments, an elution buffer is a buffer selected for use in a pharmaceutical-grade composition comprising RNA.

[0562] In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and / or protein removal and / or digestion) can be purified by a chromatography method. In some embodiments, such a chromatography purification method may be performed with a chromatographic method known in the art (e.g. HPLC, SEC, IEC, etc.), wherein components of a mixture travel through a stationary phase at different speeds, resulting in separation from one another. It will be apparent to one skilled in the art that a variety of solid substrates (e.g., beads, particles, microspheres, resins, etc.) may be used, comprising, without limitation and / or in combination, silica, dextran polymers, agarose, polyacrylamide, etc. For example, in some embodiments, a solid substrate has properties such that, in accordance with the present disclosure, permits a different retention time for RNA relative to any other undesirable components present in an RNA transcription mixture, including, e.g., short hydrolyzed DNA fragments, free nucleotide triphosphates (NTPs), 5’ capping agent, proteins, divalent ions complexed with a chelating agent.

[0563] In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and / or protein removal and / or digestion) can be purified by high performance liquid chromatography (HPLC). In some embodiments, RNA is purified by HPLC using a column matrix of alkylated non- porous polystyrene -divinvylbenzene copolymer microspheres, e.g., in triethylammonium acetate (TEAA) buffers, e.g., as described in Kariko et al. “Generating the optimal mRNA for therapy: HPLC purification eliminates immune activation and improves translation of nucleoside-modified, protein-encoding mRNA” Nucleic Acids Res. 2011 ;39(21):el42. doi: 10.1093 / nar / gkr695. In some embodiments, a TEAA buffer is supplemented with acetonitrile. In some embodiments, RNA content from desired fractions is concentrated and / or desalted (e.g., in some embodiments, using centrifugal filtration). In some embodiments, RNA is recovered by precipitation. In some embodiments, RNA is purified by HPLC using a diethylaminoethyl anion exchange column, e.g., as described in Anderson et al. “HPLC purification of RNA for crystallography and NMR” RNA. 1996;2(2): 110-117. In some embodiments, buffer comprising salt and sodium acetate is used for RNA elution. In some embodiments, RNA from RNA containing fractions is precipitated (e.g., by ethanol precipitation) and dried to a powder. In some embodiments, a dried powder comprising RNA is re-suspended, for example, in water.

[0564] In some embodiments, HPLC is not used to purify an in vitro transcription RNA composition. In some embodiments, precipitation is not used to purify an in vitro transcription RNA composition.

[0565] In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and / or protein removal and / or digestion) can be purified by size exclusion chromatography (SEC). In some embodiments, RNA is purified by using a gel filtration matrix, e.g., as described in Lukavsky and Puglisi. “Large-scale preparation and purification of polyacrylamide-free RNA oligonucleotides” RNA. 2004;10(5):889-893. doi:10.1261 / rna.5264804. In some embodiments, fractions are collected and / or analyzed by denaturing polyacrylamide gel electrophoresis. In some embodiments, RNA-containing fractions are combined. In some embodiments, RNA-containing fractions are concentrated, for example, using centrifugal filtration. In some embodiments, filtered RNA is washed twice with buffer (e.g. , 10 mM sodium phosphate, pH 6.4). In some embodiments, RNA is concentrated a second time. In some embodiments, following a second RNA concentration process (e.g., centrifugal filtration), RNA is washed again (e.g., 1 additional wash, 2 additional washes, 3 additional washes, etc.) with buffer (e.g., 10 mM sodium phosphate, pH 6.4). In some embodiments, a final concentration step is conducted using centrifugal filtration.

[0566] In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and / or protein removal and / or digestion) can be purified by ion-exchange chromatography (IEC). In some embodiments, RNA is purified by applying a transcription reaction mixture to a pre-equilibrated column and eluted using a linear salt gradient (e.g., using sodium chloride), e.g., as described in Koubek et al. “Strong anion-exchange fast performance liquid chromatography as a versatile tool for preparation and purification of RNA produced by in vitro transcription” RNA. 2013; 19(10): 1449-1459. doi:10.1261 / rna.038117.113) . In some embodiments, fractions are collected. In some embodiments, RNA is purified by directly applying a transcription reaction mixture to a Sepharose column (e.g. , a diethylaminoethanol (DEAE) Sepharose column).

[0567] In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and / or protein removal and / or digestion) can be purified by membrane filtration. Membrane filtration is a separation technique widely used in the life science separation / purification. Depending on membrane porosity, it can be classified as a microfiltration or ultrafiltration process. Microfiltration membranes, with pore sizes typically between 0.1 pm and 10 pm, are generally used for clarification, sterilization, and / or removal of microparticulates, while ultrafiltration membranes, with much smaller pore sizes between 0.001 and 0.1 pm, can be useful for removing, concentrating and / or desalting dissolved molecules (proteins, peptides, nucleic acids, carbohydrates, and other biomolecules), exchanging buffers, and gross fractionation. In some embodiments, ultrafiltration membranes are typically classified by molecular weight cutoff (MWCO) rather than pore size. A skilled artisan will...

Claims

Claims1. A method of providing a liquid composition, comprising:- guiding a first flow of a first liquid along a first flow path into a mixing chamber,- guiding a second flow of a second liquid along a second flow path into the mixing chamber;- mixing the first liquid and the second liquid in the mixing chamber for the liquid composition, wherein the liquid composition is a lipid nanoparticle (LNP) composition, wherein the mixing chamber is provided in a mixing component, the mixing component having a first inlet in fluid communication with the mixing chamber and a second inlet in fluid communication with the mixing chamber, wherein one of the first inlet and the second inlet is used for guiding the first liquid to the mixing chamber and the other one of the first inlet and the second inlet is used for guiding the second liquid to the mixing chamber, and wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and / or at an outlet of the mixing chamber or of the mixing component has a Reynolds number of less than or equal to 10000.

2. The method of claim 1, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of greater than or equal to 800.

3. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 1000 and 10000.

4. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 1000 and 8500.

5. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 1000 and 6500.

6. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 2000 and 10000.

7. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 2000 and 8500.

8. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and / or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 2000 and 6500.

9. The method of any one of the preceding claims, wherein the liquid composition is guided away from the mixing chamber and / or leaves the mixing chamber or the mixing component via the outlet with a flow rate of greater than or equal to any one of the following: 10 ml / min, 20 ml / min, 30 ml / min, 40 ml / min, 50 ml / min, 60 ml / min, 70 ml / min, 80 ml / min, 90 ml / min, 100 ml / min, 110 ml / min, 120 ml / min, 130 ml / min, 140 ml / min, 150 ml / min, 160 ml / min, 170 ml / min, 180 ml / min, 190 ml / min, 200 ml / min, 210 ml / min, 220 ml / min.

10. The method of any one of the preceding claims, wherein the liquid composition is guided away from the mixing chamber and / or leaves the mixing chamber or the mixing component via the outlet with a flow rate of less than or equal to any one of the following: 600 ml / min, 590 ml / min, 580 ml / min, 570 ml / min, 560 ml / min, 550 ml / min, 540 ml / min, 530 ml / min, 520 ml / min, 510 ml / min, 500 ml / min, 490 ml / min, 480 ml / min, 470 ml / min, 460 ml / min, 450 ml / min, 440 ml / min, 430 ml / min, 420 ml / min, 410 ml / min, 400 ml / min, 390 ml / min, 380 ml / min, 370 ml / min, 360 ml / min, 350 ml / min, 340 ml / min, 330 ml / min, 320 ml / min, 310 ml / min, 300 ml / min, 290 ml / min, 280 ml / min, 270 ml / min, 260 ml / min, 250 ml / min, 240 ml / min, 230 ml / min.

11. The method of any one of the preceding claims, wherein the nanoparticles of the lipid nanoparticle composition have a size of less than or equal to: 100 nm, 95 nm, 90 nm, 85 nm, 80 nm, 75 nm, 70 nm, 65 nm, 60 nm, 55 nm, 50 nm.

12. The method of any one of the preceding claims, wherein the outlet of the mixing chamber or of the mixing component has a diameter of greater than or equal to any one of the following: 0.1 mm, 0.15 mm, 0.2 mm, 0.25 mm, 0.3 mm, 0.35 mm, 0.4 mm, 0.45 mm, 0.5 mm.

13. The method of any one of the preceding claims, wherein the outlet of the mixing chamber or of the mixing component has a diameter of less than or equal to any one of the following: 4 mm, 3.5 mm, 3 mm, 2.5 mm, 2 mm, 1.5 mm, 1 mm, 0.95 mm, 0.9 mm, 0.85 mm, 0.8 mm, 0.75 mm, 0.7 mm, 0.65 mm, 0.6 mm, 0.55 mm, 0.5 mm.

14. The method of any one of the preceding claims, wherein a viscosity of the first liquid and / or of the second liquid is greater than or equal to any one of the following values: 0.5 cP, 0.6 cP, 0.7 cP, 0.8 cP, 0.9 cP, 1.0 cP, 1.1 cP.

15. The method of any one of the preceding claims, wherein the viscosity of the first liquid and / or or the second liquid is less than or equal to any one of the following values: 1.8 cP, 1.7 cP, 1.6 cP, 1.5cP, 1.4 cp, 1.3 cP, 1.2 cP, 1.1 cP, 1.0 cP, 0.9 cP.

16. The method of any one of the preceding claims, wherein the lipid nanoparticle composition has a polydispersity index (PDI) of the nanoparticles of less than or equal to any one of the following: 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09.

17. The method of any one of the preceding claims, wherein the lipid nanoparticle composition has a polydispersity index (PDI) of the nanoparticles of greater than or equal to any one of the following: 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22.

18. The method of any one of the preceding claims, wherein the viscosity of the first liquid is lower than the one of the second liquid.

19. The method of any one of the preceding claims, wherein the first inlet is used for the first liquid or the second liquid.

20. The method of any one of the preceding claims, wherein the mixing component is an impingement jet mixer.

21. The method of any one of the preceding claims, wherein the mixing component is a T-mixer.

22. The method of any one of the preceding claims, wherein the liquid composition is a nucleic acid-LNP composition, e.g. an RNA-LNP composition or a DNA-LNP composition.

23. The method of any one of the preceding claims, wherein the first liquid comprises RNA.

24. The method of any one of the preceding claims, wherein the first liquid is an aqueous phase.

25. The method of any one of the preceding claims, wherein the first liquid has a pH below 7 and / or greater than 4, e.g. between 4 and 6.

26. The method of any one of the preceding claims, wherein the second liquid comprises lipids.

27. The method of any one of the preceding claims, wherein the second liquid comprises a) at least a cationic lipid, a non-cationic lipid, a PEG lipid and cholesterol, b) at least a cationic lipid, a non-cationic lipid, an anionic lipid and cholesterol, or c) at least a cationic lipid, a non-cationic lipid, and cholesterol, or d) at least a cationic lipid, a non-cationic lipid, a stealth lipid, and cholesterol.

28. The method of any one of the preceding claims 1 to 26, wherein the second liquid comprises a cationic lipid, a non-cationic lipid and cholesterol.

29. The method of claim 28, wherein the second liquid further comprises a stealth lipid.

30. The method of claim 28 or 29, wherein the second liquid further comprises an anionic lipid.

31. The method of any one of claims 28 to30, wherein the second liquid further comprises a PEG-lipid.

32. The method of any one of the preceding claims, wherein the second liquid is an organic phase.

33. The method of any one of the preceding claims, wherein the second liquid comprises an organic solvent.

34. The method of any one of the preceding claims, wherein the organic solvent is selected from the group of ethanol, propanol, isopropanol and acetone.

35. The method of any one of the preceding claims, wherein the liquid composition comprises lipid nanoparticles, the respective lipid nanoparticle encapsulating nucleic acid, e.g. RNA or DNA.

36. The method of any one of the preceding claims, wherein the liquid composition is a dispersion.

37. The method of any one of the preceding claims, wherein the liquid composition is a homogeneous dispersion.

38. The method of any one of the preceding claims, wherein the first liquid and / or the second liquid is a solution.

39. A method of processing a liquid composition obtainable or obtained with the method of any one of claims 1 to 38.

40. The method of any one of the preceding claims, wherein a third liquid is added to the liquid composition downstream of the mixing chamber.

41. The method of claim 40, wherein the third liquid is a buffer and / or provided for quenching for the liquid composition.

42. The method of any one of the preceding claims, wherein the liquid composition is filtered through a filter.

43. The method of claim 42, wherein the filter is a 0.2 pm filter.

44. The method of claim 42 or 43, wherein a filter area of the filter is less than or equal to 130 cm2per gram of RNA in the lipid nanoparticles.

45. The method of any one of claims 42 to 44, wherein the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition deviates from the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition by less than or equal to any one of: 20 %, 19 %, 18 %, 17 %, 16 %, 15 %, 14 %, 13 %, 12 %, 11 %, 10 %, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, 1 %, 0.5 %.

46. The method of any one of claims 42 to 45, wherein the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition is equal to or lower than the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition.

47. The method of any one of claims 42 to 46, wherein the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition and the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition is less than or equal to any one of the following: 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06.

48. The method of any one of claims 42 to 47, wherein an absolute value of the difference between the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition and the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition is less than or equal to any one of: 0.020, 0.015, 0.010, 0.009, 0.008, 0.007, 0.006, 0.005.

49. The method of any one of the preceding claims, wherein the liquid composition, e.g. the filtered or unfiltered liquid composition, is frozen to a predetermined temperature, e.g. to - 20 °C or - 70 °C.

50. The method of claim 49, wherein the frozen liquid composition is thawed after a predetermined time.

51. The method of claim 50, wherein the predetermined time is greater than or equal to: one week, two weeks, four weeks, five weeks, six weeks, one month, two months, three months, six months, twelve months, 24 months.

52. The method of any one of claims 49 to 51, wherein multiple freeze and thaw cycles are conducted with the liquid composition, e.g. between -20°C or -70°C and room temperature.

53. The method of any one of claims 49 to 52, wherein the poly dispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which is thawed after the predetermined time or thawed in the last one of the multiple freeze and thaw cycles, deviates from the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition by less than or equal to any one of: 20 %, 19 %, 18 %, 17 %, 16 %, 15 %, 14 %, 13 %, 12 %, 11 %, 10 %, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, 1 %, 0.5 %.

54. The method of any one of claims 49 to 53, wherein an absolute value of the difference between the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which is thawed after the predetermined time or thawed in the last one of the multiple freeze and thaw cycles, and the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition is less than or equal to any one of: 0.020, 0.015, 0.010, 0.009, 0.008, 0.007, 0.006, 0.005.

55. The method of any one of claims 49 to 54, wherein the poly dispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which is thawed after the predetermined time or is thawed in the last one of the multiple freeze and thaw cycles, is equal to or lower than the poly dispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition.

56. The method of any one of claims 49 to 55, wherein the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which may be thawed after the predetermined time or may be thawed in the last one of the multiple freeze and thaw cycles, and the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition, e.g. directly before freezing or in a fully processed liquid composition, is less than or equal to any one of the following: 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06.

57. The method of claim 45 or 53, wherein the deviation is determined by (PDI_1 - PDI_2) I PDI_1 x 100 %.

58. A method of providing a liquid composition, comprising:- guiding a first flow of a first liquid along a first flow path into a mixing chamber,- guiding a second flow of a second liquid along a second flow path into the mixing chamber;- mixing the first liquid and the second liquid in the mixing chamber for the liquid composition, wherein the liquid composition is a lipid nanoparticle (LNP) composition, wherein the first liquid comprises- RNA, the second liquid comprises- a cationic lipid, a non-cationic lipid or helper lipid, and cholesterol, wherein the first liquid and the second liquid are mixed in the mixing chamber to provide the liquid composition, the liquid composition having a flow rate of greater than or equal to 65 ml / min and optionally less than or equal to 300 ml / min at an outlet of the mixing chamber or of a mixing component comprising the mixing chamber, wherein a diameter of the flow path at the outlet is greater than or equal to 0.15 mm and, optionally, less than or equal to 1 mm or less than or equal to 0.85 mm.

59. The method of claim 58, wherein the second liquid further comprises a PEG lipid, an anionic lipid, and / or a stealth lipid.

60. A use of a mixing component to provide a lipid nanoparticle (LNP) composition by mixing a first liquid and a second liquid in a mixing chamber of the mixing component, wherein the mixing component is used to provide a liquid flow with a Reynolds number of greater than or equal to 800 and less than or equal to 10000 at an outlet of the mixing chamber or of the mixing component.

61. A preparation comprising lipid nanoparticles, the lipid nanoparticles or the preparation being obtainable or obtained with the method of any one of claims 1 to 59 or with the use of claim 60.

Images