Combination therapies for the treatment of cancer

EP4615431A1Pending Publication Date: 2025-09-17ASTRAZENECA AB
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023805920
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-11-11
Filing Date
2023-11-10
Publication Date
2025-09-17

AI Technical Summary

Technical Problem

Current cancer treatments, particularly for breast cancer, face challenges in maintaining efficacy due to tumor resistance, necessitating new approaches that target specific pathways like the PI3K/AKT/PTEN pathway to overcome drug resistance.

Method used

Combining AKT, PI3K-a, or mTOR inhibitors with a KDM5C inhibitor to enhance anti-proliferative effects and delay or prevent resistance, using compounds such as capivasertib, alpelisib, or everolimus in conjunction with KDM5C inhibitors like CPI-48, to sensitize cancer cells and maintain treatment effectiveness.

Benefits of technology

This combination therapy effectively inhibits cancer cell proliferation, promotes apoptosis, and prolongs survival by sensitizing cancer cells to AKT, PI3K-a, or mTOR inhibitors, thereby overcoming resistance and enhancing treatment outcomes in breast cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 1.1
    Figure 1.1
Patent Text Reader

Abstract

The present specification relates to the use of an AKT inhibitor, a PI3K-α inhibitor or an mTOR (such as mTORC1) inhibitor in combination with a KDM5C inhibitor to treat cancer, for example breast cancer. Also described is a pharmaceutical composition comprising a compound, a KDM5C inhibitor, and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K-α inhibitor or an mTOR inhibitor
Need to check novelty before this filing date? Find Prior Art

Description

[0001] COMBINATION THERAPIES FOR THE TREATMENT OF CANCER

[0002] Field

[0003] The specification relates to the use of an AKT inhibitor, a PI3K-a inhibitor or an mTOR (such as mTORCl) inhibitor in combination with a KDM5C inhibitor to treat cancer, for example breast cancer.

[0004] Background

[0005] Breast cancer remains a major cause of death. Although effective treatments (especially endocrine therapies such as aromatase inhibitors and selective estrogen modulators) have been developed over the last 50 years, they may not be effective in all cancer types, or may lose potency over time due to the development of tumour resistance. As such, new ways to treat cancer (and particularly advanced or metastatic breast cancer) are still needed.

[0006] One modern approach to treating breast cancer relies on the use of targeted therapies - such as receptor tyrosine kinase inhibitors (TKIs) - to deal with cancers not managed under current paradigms or to overcome the pathways by which cancer cells evolve resistance. For example, AKT is a serine / threonine- specific protein kinase that operates as part of the PI3K / AKT / PTEN pathway, playing a key role in multiple cellular processes such as glucose metabolism, apoptosis, cell proliferation, transcription, and cell migration. Mammalian cells express three closely related AKT isoforms encoded by different genes: AKT1 (protein kinase Ba), AKT2 (protein kinase BP), and AKT3 (protein kinase By). Capivasertib (also known as AZD5363, and by the chemical name of (S)-4-amino-N-(l-(4-chlorophenyl)-3-hydroxypropyl)-l-(7H- pyrrolo[2,3-d]pyrimidin-4-yl)piperidine-4-carboxamide) is a selective inhibitor of all three AKT isoforms. Capivasertib is currently being evaluated in clinical studies for use in treating cancers, including breast cancer, where (among other applications) it might be used to overcome drug resistance. However, the evolutionary nature of cancer means that resistance to capivasertib treatment itself is likely to develop over time, reducing its efficacy.

[0007] The KDM5C gene encodes lysine-specific demethylase 5C, an enzyme member of the alpha- ketoglutarate-dependent hydroxylase superfamily. From genome-scale CRISPR screens, KDM5C has been identified as a gene that when "knocked out" increases sensitivity to capivasertib in estrogen receptor positive (ER+) breast cancer cell lines. The present specification therefore discloses that KDM5C inhibition can further sensitise certain types of cancer cell to inhibition with AKT, potentially providing a way to increase the efficacy of drugs such as capivasertib both up-front and after resistance to earlier capivasertib-based therapy has developed.

[0008] As well as for AKT inhibitors, similarly beneficial effects are also disclosed when KDM5C inhibitors are combined with two other drug classes which target the PI3K / AKT / PTEN and mTOR pathways: PI3K-a inhibitors (such as selective PI3K-a inhibitors, or specific PI3K-a inhibitors) and mTOR inhibitors (such as selective mTORCl inhibitors). It has therefore been determined that treatment with a KDM5C inhibitor may overcome resistance, re-sensitizing cancer to the therapeutic effects of inhibiting AKT, PI3K-a or mTOR. As such, combinations of AKT, PI3K-a or mTOR inhibitors and a KDM5C inhibitor may act synergistically together in therapy to prevent resistance or delay its onset.

[0009] Summary

[0010] The present specification provides a means for enhancing the anti-proliferative effects of AKT, PI3K-a and mTOR treatment in cancer (for example breast cancer) utilising KDM5C inhibitors in combination with AKT, PI3K-a and mTOR inhibitors.

[0011] In an aspect, there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, and the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0012] In an aspect, there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, and the compound is an AKT inhibitor.

[0013] In an aspect, there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, and the compound is a PI3K-a inhibitor.

[0014] In an aspect, there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, and the compound is an mTOR inhibitor.

[0015] The terms "treat," "treating," and "treatment" refer to at least partially alleviating, inhibiting, preventing and / or ameliorating a condition, disorder, or disease, such as breast cancer. The term "treatment of cancer" includes both in vitro and in vivo treatments, including in warm-blooded animals such as humans. The effectiveness of treatment of cancer can be assessed in a variety of ways, including but not limited to: inhibiting cancer cell proliferation (including the reversal of cancer growth); promoting cancer cell death (e.g., by promoting apoptosis or another cell death mechanism); improvement in symptoms; duration of response to the treatment; delay in progression of disease; and prolonging survival. Treatments can also be assessed with regard to the nature and extent of side effects associated with the treatment. Furthermore, effectiveness can be assessed with regard to biomarkers, such as levels of expression or phosphorylation of proteins known to be associated with particular biological phenomena. Other assessments of effectiveness are known to those of skill in the art.

[0016] The phrase "in combination with" and similar terms encompass administration of two or more active pharmaceutical ingredients to a subject and include simultaneous administration in separate compositions, administration at different times in separate compositions, or administration in a composition in which two or more active pharmaceutical ingredients are present. In embodiments, administration of the compound and the KDM5C inhibitor is separate, sequential, or simultaneous.

[0017] In embodiments, administration of the compound and the KDM5C inhibitor is separate.

[0018] In embodiments, administration of the compound and the KDM5C inhibitor is sequential.

[0019] In embodiments, administration of the compound and the KDM5C inhibitor is simultaneous.

[0020] In a further aspect, there is provided the use of a compound in the manufacture of a medicament for the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, and where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0021] In a further aspect, there is provided a method of treating cancer in a patient in need of such a treatment, comprising administering to the patient a therapeutically effective amount of a compound, where the compound is administered in combination with a therapeutically effective amount of a KDM5C inhibitor, and where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0022] The term "therapeutically effective amount" refers to that amount of a compound or combination of compounds as described herein that is sufficient to effect the intended application including, but not limited to, disease treatment. A therapeutically effective amount may vary depending upon the intended application (in vitro or in vivo), or the subject and disease condition being treated (e.g., the weight, age and gender of the subject), the severity of the disease condition, the manner of administration, etc. which can readily be determined by one of ordinary skill in the art. The term also applies to a dose that will induce a particular response in target cells (e.g. the amount of apoptosis). The specific dose will vary depending on the particular compounds chosen, the dosing regimen to be followed, whether the compound is administered in combination with other compounds, timing of administration, the tissue to which it is administered, and the physical delivery system in which the compound is carried.

[0023] In a further aspect, there is provided a method of treating cancer in a patient in need of such a treatment, comprising administering to the patient a first amount of a compound, and a second amount of a KDM5C inhibitor, where the first amount and the second amount together comprise a therapeutically effective amount, and where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0024] In a further aspect, there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K- a inhibitor or an mTOR inhibitor.

[0025] The term "pharmaceutically acceptable" is used to specify that an object (for example a salt, dosage form [such as a tablet or capsule] or excipient [such as a diluent or carrier]) is suitable for use in patients. An example list of pharmaceutically acceptable salts can be found in the "Handbook of Pharmaceutical Salts: Properties, Selection and Use", P. H. Stahl and C. G. Wermuth, editors, Weinheim / Zurich:Wiley- VCH / VFiCA, 2002 or subsequent editions. Pharmaceutically acceptable acid addition salts can be formed with inorganic acids and organic acids. Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid and phosphoric acid. Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid and salicylic acid. Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases. Inorganic bases from which salts can be derived include, for example, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese and aluminium. Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins. Examples include isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine.

[0026] List of Figures

[0027] Figure 1: KDM5C identified as capivasertib sensitizer in genome-scale CRISPR screens. KDM5C, but none of the other KDM5 demethylases, were identified as capivasertib sensitizers in MCF7, T47D and CAMA- 1 ER+ breast cancer cell lines.

[0028] [For figures 2-19; ns = P > 0.05, * = P < 0.05, ** = P < 0.01],

[0029] Figure 2: Cellular proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to capivasertib in PIK3CA-mut estrogen receptor positive (ER+) breast cancer.

[0030] Figure 3: End of study confluence from a cellular proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to capivasertib in PIK3CA-mut ER+ breast cancer.

[0031] Figure 4: Cellular proliferation assay in an MCF7 KDM5C KO clonal cell line. KDM5C KO increases sensitivity to capivasertib in PIK3CA-mut ER+ breast cancer.

[0032] Figure 5: End of study confluence from a cellular proliferation assay in an MCF7 KDM5C KO clonal cell line. KDM5C KO increases sensitivity to capivasertib in PIK3CA-mut ER+ breast cancer.

[0033] Figure 6: Cellular proliferation assay in an MCF7 KDM5C KO clonal cell line. KDM5C KO increases sensitivity to a combination of fulvestrant and capivasertib in PIK3CA-mut ER+ breast cancer.

[0034] Figure 7: Cellular proliferation assay in an MCF7 KDM5C KO clonal cell line. KDM5C KO increases sensitivity to a combination of camizestrant and capivasertib in PIK3CA-mut ER+ breast cancer.

[0035] Figure 8: End of study confluence from a cellular proliferation assay in an MCF7 KDM5C KO clonal cell line. KDM5C KO increases sensitivity to a combination of fulvestrant and capivasertib in PIK3CA-mut ER+ breast cancer. Figure 9: Cellular proliferation assay in CAMA-1 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to capivasertib in PTEN-null ER+ breast cancer.

[0036] Figure 10: End of study confluence from a cellular proliferation assay in CAMA-1 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to capivasertib in PTEN-null ER+ breast cancer.

[0037] Figure 11: Cellular proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to alpelisib in PIK3CA-mut ER+ breast cancer.

[0038] Figure 12: End of study confluence from a cellular proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to alpelisib in PIK3CA-mut ER+ breast cancer.

[0039] Figure 13: Cellular proliferation assay in an MCF7 KDM5C KO clonal cell line. KDM5C KO increases sensitivity to alpelisib in PIK3CA-mut ER+ breast cancer.

[0040] Figure 14: End of study confluence from a cellular proliferation assay in an MCF7 KDM5C KO clonal cell line. KDM5C KO increases sensitivity to alpelisib in PIK3CA-mut ER+ breast cancer.

[0041] Figure 15: Cellular proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to everolimus in PIK3CA-mut ER+ breast cancer.

[0042] Figure 16: End of study confluence from a cellular proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to everolimus in PIK3CA-mut ER+ breast cancer.

[0043] Figure 17: Acute KDM5C KO increases sensitivity to capivasertib and its combination with fulvestrant in PIK3CA-mut ER+ breast cancer (MCF7 cells).

[0044] Figure 18: End of study confluence from the Figure 17 study.

[0045] Figure 19: Acute KDM5C KO increases sensitivity to capivasertib in PTEN-null ER+ breast cancer (CAMA1 cells).

[0046] [For figures 20-30, ns = P > 0.05, * = P < 0.05, ** = P < 0.01, *** = P < 0.001],

[0047] Figure 20: Combination study in MCF7 (PIK3CA-mut) cells. KDM5 inhibitor combines with capivasertib in PIK3CA-mut ER+ breast cancer.

[0048] Figure 21: Combination study in CAMA-1 (PTEN null) cells. KDM5 inhibitor combines with capivasertib in PTEN-null ER+ breast cancer.

[0049] Figure 22: Combination study in MCF7 ESRI Y537S cells. KDM5 inhibitor combines with capivasertib in PIK3CA-mut ER+ breast cancer cells harboring ESRI mutation.

[0050] Figure 23: Combination study in MCF7 100F P2 cells. KDM5 inhibitor combines with capivasertib in PIK3CA-mut ER+ breast cancer cells less sensitive to fulvestrant.

[0051] Figure 24: Combination study in T47D 100F1P Pl cells. KDM5 inhibitor combines with capivasertib in PIK3CA-mut ER+ breast cancer cells resistant to fulvestrant.

[0052] Figure 25: Combination study in T47D 100F1P P2 cells. KDM5 inhibitor combines with capivasertib in PIK3CA-mut ER+ breast cancer cells resistant to fulvestrant + palbociclib. Figure 26: Combination study in T47D 1OOF1P Pl cells. KDM5 inhibitor combines with alpelisib in PIK3CA- mut ER+ breast cancer cells resistant to fulvestrant.

[0053] Figure 27: Combination study in T47D 1OOF1P P2 cells. KDM5 inhibitor combines with alpelisib in PIK3CA- mut ER+ breast cancer cells resistant to fulvestrant + palbociclib.

[0054] Figure 28: Combination study in T47D 1OOF1P P2 cells. KDM5 inhibitor combines with everolimus in PIK3CA-mut ER+ breast cancer cells resistant to fulvestrant + palbociclib.

[0055] Figure 29: Control study showing effect of fulvestrant in resistant PIK3CA-mut MCF7 ER+ breast cancer cells.

[0056] Figure 30: Control study showing effect of fulvestrant in resistant PIK3CA-mut T47D ER+ breast cancer cells.

[0057] Detailed Description

[0058] Cancer Treatment

[0059] In embodiments, the treatment of cancer is treatment of an animal cancer (for example a mammalian cancer such as a human cancer).

[0060] In embodiments, the cancer is hormone-sensitive cancer (for example estrogen-sensitive cancer or androgen-sensitive cancer). "Estrogen or androgen-sensitive" means that growth of the cancer is at least partially driven by the respective hormonal pathway, such that blocking the hormone attenuates growth and effects treatment.

[0061] In embodiments, the cancer is breast cancer (for example advanced breast cancer or metastatic breast cancer).

[0062] In embodiments, the cancer is advanced breast cancer.

[0063] In embodiments, the cancer is metastatic breast cancer.

[0064] In embodiments the cancer is hormone-sensitive breast cancer.

[0065] In embodiments the cancer is estrogen-sensitive breast cancer.

[0066] In embodiments, the cancer is ovarian cancer.

[0067] In embodiments the cancer is estrogen-sensitive ovarian cancer.

[0068] In embodiments, the cancer is endometrial cancer.

[0069] In embodiments the cancer is estrogen-sensitive endometrial cancer.

[0070] In embodiments the cancer is prostate cancer.

[0071] In embodiments the cancer is androgen-sensitive prostate cancer.

[0072] Patient selection and diagnostic methods

[0073] In embodiments, the patient is a human patient or animal (e.g. mammalian) patient. In embodiments, the patient is a human patient.

[0074] In embodiments, the cancer is estrogen receptor positive (ER+) breast cancer.

[0075] "Estrogen receptor positive" cancer comprises tumours having the estrogen receptor (e.g. in at least 1%, at least 10%, at least 20%, or at least 50% of tumour cells) and are able to metabolise estrogen to grow. ER+ status can be determined by methods known in the art, for example by IHC tests.

[0076] In embodiments, the cancer is PTEN deficient (e.g. comprises a cancerous cell (e.g. a population of cancerous cells, such as the majority of cancerous cells in a given population) with a reduction in the normal amount [e.g. compared to a non-cancerous cell of the same patient] or function of the PTEN tumour suppression protein). PTEN status can be determined by methods known in the art.

[0077] In embodiments, the cancer comprises a PIK3CA mutation (for example a gain of function mutation, or a deletion, substitution or insertion mutation, such as a PIK3CAE542K, PIK3CAE545K, PIK3CAQ546R, PIK3CA1047Lor PIK3CAH1047Rmutation). PIK3CA mutation status can be determined by methods known in the art.

[0078] In embodiments the PIK3CA mutation is selected from one or more of R88Q, N345K, C420R, E542K, E545A, E545D, E545Q, E545K, E545G, Q546E, Q546K, Q546R, Q546P, M1043V, M1043I, H1047Y, H1047R, H1047L and G1049R.

[0079] In embodiments the PI K3CA mutation is E545K.

[0080] In embodiments, the patient is a post-menopausal woman or a pre-menopausal woman.

[0081] A woman is an adult human female of the sex designed to produce large gametes (eggs).

[0082] In embodiments, the patient is a post-menopausal woman.

[0083] In embodiments, the patient is a pre-menopausal woman.

[0084] In embodiments, the patient has previously received treatment with a selective estrogen receptor degrader (SERD), a selective estrogen receptor modulator (SERM) or an aromatase inhibitor (Al).

[0085] In embodiments, the patient's cancer has reached the stage of maximal response (minimal residual disease) during or after treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator or an aromatase inhibitor.

[0086] In embodiments, the cancer is resistant to treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator or an aromatase inhibitor.

[0087] In embodiments, the patient's cancer has progressed during or after previous treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator and / or an aromatase inhibitor. When a cancer's growth has "progressed", its growth is no longer suitably controlled by the therapy in question.

[0088] In embodiments, the patient has previously received treatment with a CDK4 / 6 inhibitor.

[0089] In embodiments, the patient's cancer has reached the stage of maximal response (minimal residual disease) during or after treatment with a CDK4 / 6 inhibitor. In embodiments, the cancer is resistant to treatment with a CDK4 / 6 inhibitor.

[0090] In embodiments, the patient's cancer has progressed during or after previous treatment with a CDK4 / 6 inhibitor.

[0091] Triplet and Quadruplet Combinations

[0092] In one embodiment there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor and a SERD, and the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0093] In embodiments, administration of the compound, the KDM5C inhibitor and the SERD is separate, sequential, or simultaneous.

[0094] In embodiments, administration of the compound, the KDM5C inhibitor and the SERD is separate.

[0095] In embodiments, administration of the compound, the KDM5C inhibitor and the SERD is sequential.

[0096] In embodiments, administration of the compound, the KDM5C inhibitor and the SERD is simultaneous.

[0097] In one embodiment there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor and fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0098] In one embodiment there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor and fulvestrant or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0099] In one embodiment there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor and camizestrant or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0100] In one embodiment there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, a SERD, and a CDK4 / 6 inhibitor, and the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0101] In embodiments, administration of the compound, the KDM5C inhibitor, the SERD and the CDK4 / 6 inhibitor is separate, sequential, or simultaneous.

[0102] In embodiments, administration of the compound, the KDM5C inhibitor, the SERD and the CDK4 / 6 inhibitor is separate.

[0103] In embodiments, administration of the compound, the KDM5C inhibitor, the SERD and the CDK4 / 6 inhibitor is sequential. In embodiments, administration of the compound, the KDM5C inhibitor, the SERD and the CDK4 / 6 inhibitor is simultaneous.

[0104] In one embodiment there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof, and palbociclib or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0105] AKT Inhibitors

[0106] In embodiments, the AKT inhibitor is any molecule which binds to and inhibits the activity of one or more AKT isoforms (for example having a plC5o of >4.5, >5, >6, >7, >8 or >9 vs. the isoform in question when tested in a standard potency assay, for example as described in W02009 / 047563).

[0107] In embodiments the AKT inhibitor is a proteolysis targeting chimera (PROTAC).

[0108] In embodiments, the AKT inhibitor is selected from miransertib (ARQ-092) or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, borussertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib (GSK2110183) or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof and ipatasertib (GDC-0068) or a pharmaceutically acceptable salt thereof.

[0109] In embodiments, the AKT inhibitor is selected from capivasertib or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof and ipatasertib or a pharmaceutically acceptable salt thereof. In embodiments, the AKT inhibitor is selected from capivasertib or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib (GSK2110183) or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof and ipatasertib (GDC-0068) or a pharmaceutically acceptable salt thereof.

[0110] In embodiments, the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof.

[0111] Capivasertib has the following chemical structure:

[0112] The free base of capivasertib is known by the chemical name (S)-4-amino-N-(l-(4-chlorophenyl)-3- hydroxypropyl)-l-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)piperidine-4-carboxamide). Capivasertib is disclosed in W02009 / 047563, which discloses capivasertib (in Example 9) and describes its synthesis.

[0113] Perifosine has the following chemical structure:

[0114] Perifosine is known by the chemical name l,l-Dimethylpiperidinium-4-yl octadecyl phosphate.

[0115] Perifosine is disclosed in US8383607.

[0116] MK-2206 has the following chemical structure:

[0117] The free base of MK-2206 is known by the chemical name 8-[4-(l-Aminocyclobutyl)phenyl]-9- phenyl[l,2,4]triazolo[3,4-f][l,6]naphthyridin-3(2H)-one. MK-2206 is disclosed in W02008070016. GSK690693 has the following chemical structure:

[0118] The free base of GSK690693 is known by the chemical name 4-(2-(4-Amino-l,2,5-oxadiazol-3-yl)-l-ethyl- 7-{[(3S)-3-piperidinylmethyl]oxy}-lH-imidazo[4,5-c]pyridin-4-yl)-2-methyl-3-butyn-2-ol. GSK690693 is disclosed in W02007058850.

[0119] Afuresertib (GSK2110183) has the following chemical structure:

[0120] The free base of afuresertib is known by the chemical name N-[(lS)-2-amino-l-[(3- fluorophenyl)methyl]ethyl]-5-chloro-4-(4-chloro-l-methyl-lH-pyrazol-5-yl)-2-thiophenecarboxamide. Afuresertib is disclosed in W02008098104.

[0121] Uprosertib (GSK2141795) has the following chemical structure: The free base of uprosertib is known by the chemical name N-[(lS)-2-amino-l-[(3,4- difluorophenyl)methyl]ethyl]-5-chloro-4-(4-chloro-l-methyl-lH-pyrazol-5-yl)-2-furancarboxamide. Uprosertib is disclosed in W02008098104.

[0122] Ipatasertib has the following chemical structure:

[0123] The free base of ipatasertib is known by the chemical name 2-(4-chlorophenyl)-l-(4-((5R,7R)-7-hydroxy- 5-methyl-6,7-dihydro-5H-cyclopenta[d]pyrimidin-4-yl)piperazin-l-yl)-3-(isopropylamino)propan-l-one. Ipatasertib is disclosed in W02008006040.

[0124] PI3K-a Inhibitors

[0125] In embodiments, the PI3K-a inhibitor is any molecule which binds to and inhibits the activity of PI3K-a (for example having a plC5o of >4.5, >5, >6, >7, >8 or >9 vs. PI3K-a when tested in a standard potency assay, for example as described in W02010029082).

[0126] In embodiments, the PI3K-a inhibitor is a PI3K-a selective inhibitor. A PI3K-a selective inhibitor has greater activity (for example >10-fold, >100-fold or >1000-fold activity) against PI3K-a than against any other PI3K isoform.

[0127] In embodiments, the PI3K-a inhibitor is selective for one or more PI3K-a mutant isoforms (e.g. H1047X such as H1047R or H1047L) against any other PI3K-a isoform.

[0128] In embodiments, the PI3K-a inhibitor is a PI3K-a specific inhibitor. A PI3K-a specific inhibitor has activity against PI3K-a but no appreciable (e.g. measurable using standard potency assays, e.g. plC5o of <4.5) activity against any other PI3K isoform.

[0129] In embodiments, the PI3K-a inhibitor is selected from LOXO-783 or a pharmaceutically acceptable salt thereof, RLY-2608 or a pharmaceutically acceptable salt thereof, STX-478 or a pharmaceutically acceptable salt thereof, alpelisib (e.g. piqray®) or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof and serabelisib or a pharmaceutically acceptable salt thereof. In embodiments, the PI3K-a inhibitor is selected from alpelisib (e.g. piqray®) or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof and serabelisib or a pharmaceutically acceptable salt thereof.

[0130] Alpelisib has the following chemical structure:

[0131] The free base of alpelisib is known by the chemical name (2S)-l-A / -[4-methyl-5-[2-(l,l,l-trifluoro-2- methylpropan-2-yl)pyridin-4-yl]-l,3-thiazol-2-yl]pyrrolidine-l,2-dicarboxamide. Alpelisib is disclosed in W02010 / 029082.

[0132] Inavolisib has the following chemical structure:

[0133] The free base of inavolisib is known by the chemical name (2S)-2-[[2-[(4S)-4-(difluoromethyl)-2-oxo-l,3- oxazolidin-3-yl]-5,6-dihydroimidazo[l,2-d][ 1,4] benzoxazepin-9-yl]amino] propana mide. Inavolisib is disclosed in W02017001645.

[0134] Serabelisib (GDC-0077; RG6114) has the following chemical structure: The free base of serabelisib is known by the chemical name [6-(2-amino-l,3-benzoxazol-5- yl)imidazo[l,2-a]pyridin-3-yl](4-morpholinyl)methanone. Serabelisib is disclosed in WO2011022439.

[0135] In embodiments, the PI3K-a inhibitor is alpelisib or a pharmaceutically acceptable salt thereof.

[0136] In embodiments, the PI3K-a inhibitor is inavolisib or a pharmaceutically acceptable salt thereof. In embodiments, the PI3K-a inhibitor is serabelisib or a pharmaceutically acceptable salt thereof. mTOR Inhibitors

[0137] In embodiments, the mTOR inhibitor is any molecule which binds to and inhibits the activity of mTOR (for example having a plC5o of >4.5, >5, >6, >7, >8 or >9 vs. mTOR when tested in a standard potency assay). In embodiments, the mTOR inhibitor is an mTORCl inhibitor.

[0138] In embodiments, the mTOR inhibitor is an mTORCl selective inhibitor. An mTORCl selective inhibitor has greater activity (for example >10-fold, >100-fold or >1000-fold activity) against mTORCl than against any other mTOR complex.

[0139] In embodiments, the mTOR inhibitor is selected from everolimus (e.g. afinitor®) or a pharmaceutically acceptable salt thereof and temsirolimus (e.g. torisel®) or a pharmaceutically acceptable salt thereof.

[0140] Everolimus has the following chemical structure:

[0141] Everolimus is disclosed in W09409010.

[0142] Temsirolimus has the following chemical structure:

[0143]

[0144] Temsirolimus is disclosed in WO9528406.

[0145] In embodiments, the mTOR inhibitor is everolimus or a pharmaceutically acceptable salt thereof.

[0146] In embodiments, the mTOR inhibitor is temsirolimus or a pharmaceutically acceptable salt thereof.

[0147] KDM5C Inhibitors

[0148] In embodiments, the KDM5C inhibitor is any molecule which binds to and inhibits the activity of KDM5C (for example having a plC5o of >4.5, >5, >6, >7, >8 or >9 vs. KDM5C when tested in a standard potency assay, for example as described in W02015035062, WO2015135094 or WO2016057924).

[0149] In embodiments, the KDM5C inhibitor is selected from any compound disclosed in W02015035062, WO2015135094 or WO2016057924.

[0150] In embodiments, the KDM5C inhibitor is selected from C70 or a pharmaceutically acceptable salt thereof, KDOAM25 (Tumber et al., Cell Chemical Biology 2017, 24, 371-380) or a pharmaceutically acceptable salt thereof, CPI-455 (Vinogradova et al., Nature Chemical Biology 2016, 12, 531-538) or a pharmaceutically acceptable salt thereof, GS-701644 or a pharmaceutically acceptable salt thereof, GS- 5801 or a pharmaceutically acceptable salt thereof, and CPI-48 or a pharmaceutically acceptable salt thereof.

[0151] In embodiments, the KDM5C inhibitor is CPI-48 or a pharmaceutically acceptable salt thereof.

[0152] CPI-48 has the following chemical structure:

[0153] The free base of CPI-48 is known by the chemical name 5-(l-(tert-butyl)-lH-pyrazol-4-yl)-6-isopropyl-7- oxo-4, 7-dihydropyrazolo[l,5-a]pyrimidine-3-carbonitrile. CPI-48 is disclosed in Liang, J. et al., Bioorg. & Med. Chem. Lett. 2016, 26 (15), 4036-4041 (https: / / doi.Org / 10.1016 / i.bmcl.2016.06.078). CDK4 / 6 Inhibitors

[0154] In embodiments, the CDK4 / 6 inhibitor is any molecule which binds to and inhibits the activity of CDK4 and CDK6 (for example having a plC5o of >4.5, >5, >6, >7, >8 or >9 vs. CDK4 and CDK6 when tested in a standard potency assay, for example as described in WO03062236, W02010020675 or W02010075074). In embodiments, the CDK4 / 6 inhibitor is selected from palbociclib (e.g. ibrance®) or a pharmaceutically acceptable salt thereof, ribociclib (e.g. kisqali®) or a pharmaceutically acceptable salt thereof and abemaciclib (e.g. verzenois®) or a pharmaceutically acceptable salt thereof.

[0155] Palbociclib has the following chemical structure:

[0156] The free base of palbociclib is known by the chemical name 6-acetyl-8-cyclopentyl-5-methyl-2-{[5-(l- piperazinyl)-2-pyridinyl]amino}pyrido[2,3-d]pyrimidin-7(8H)-one. Palbociclib is disclosed in WO03062236.

[0157] Ribociclib has the following chemical structure:

[0158] The free base of ribociclib is known by the chemical name 7-cyclopentyl-N,N-dimethyl-2-{[5-(l- piperazinyl)-2-pyridinyl]amino}-7H-pyrrolo[2,3-d]pyrimidine-6-carboxamide. Ribociclib is disclosed in W02010020675.

[0159] Abemaciclib has the following chemical structure:

[0160] The free base of abemaciclib is known by the chemical name N-{5-[(4-ethyl-l-piperazinyl)methyl]-2- pyridinyl}-5-fluoro-4-(4-fluoro-l-isopropyl-2-methyl-lH-benzimidazol-6-yl)-2-pyrimidinamine.

[0161] Palbociclib is disclosed in W02010075074.

[0162] In embodiments, the CDK4 / 6 inhibitor is palbociclib or a pharmaceutically acceptable salt thereof. In embodiments, the CDK4 / 6 inhibitor is ribociclib or a pharmaceutically acceptable salt thereof.

[0163] In embodiments, the CDK4 / 6 inhibitor is abemaciclib or a pharmaceutically acceptable salt thereof.

[0164] Endocrine Therapies

[0165] "Selective estrogen degraders" (SERDs) bind to the estrogen receptor causing it to be degraded and therefore downregulated.

[0166] In embodiments, the SERD is selected from fulvestrant or a pharmaceutically acceptable salt thereof, amcenestrant of a pharmaceutically acceptable salt thereof, giredestrant or a pharmaceutically acceptable salt thereof, elacestrant or a pharmaceutically acceptable salt thereof, imlunestrant or a pharmaceutically acceptable salt thereof and camizestrant or a pharmaceutically acceptable salt thereof. Amcenestrant (SAR439859) has the following chemical structure:

[0167] The free base of amcenestrant is known by the chemical name 6-(2,4-dichlorophenyl)-5-[4-[(3S)-l-(3- fluoropropyl)pyrrolidin-3-yl]oxyphenyl]-8,9-dihydro-7H-benzo[7]annulene-2-carboxylic acid.

[0168] Amcenestrant is disclosed in WO2017140669.

[0169] Camizestrant (AZD9833) has the following chemical structure:

[0170] The free base of camizestrant is known by the chemical name N-(l-(3-fluoropropyl)azetidin-3-yl)-6- ((6S,8R)-8-methyl-7-(2,2,2-trifluoroethyl)-6,7,8,9-tetrahydro-3H-pyrazolo[4,3-f]isoquinolin-6-yl)pyridin- 3-amine. Camizestrant is disclosed in W02018077630A1. Elacestrant has the following chemical structure:

[0171] The free base of elacestrant is known by the chemical name (6R)-6-[2-(ethyl{4-[2- (ethylamino)ethyl]benzyl}amino)-4-methoxyphenyl]-5,6,7,8-tetrahydro-2-naphthalenol. Elacestrant is disclosed in W02008002490.

[0172] Imlunestrant (LY-3484356) has the following chemical structure:

[0173] The free base of imlunestrant is known by the chemical name (5R)-5-[4-[2-[3-(fluoromethyl)azetidin-l- yl]ethoxy]phenyl]-8-(trifluoromethyl)-5H-chromeno[4,3-c]quinolin-2-ol. Imlunestrant is disclosed in W02020014435.

[0174] Giredestrant (GDC-9545) has the following chemical structure:

[0175]

[0176] The free base of giredestrant is known by the chemical name 3-[(lR,3R)-l-[2,6-difluoro-4-[[l-(3- fluoropropyl)azetidin-3-yl]amino]phenyl]-3-methyl-l,3,4,9-tetrahydropyrido[3,4-b]indol-2-yl]-2,2- difluoropropan-l-ol. Giredestrant is disclosed in W02016097072A1.

[0177] In embodiments, the SERD is fulvestrant or a pharmaceutically acceptable salt thereof.

[0178] In embodiments, the SERD is amcenestrant or a pharmaceutically acceptable salt thereof.

[0179] In embodiments, the SERD is giredestrant or a pharmaceutically acceptable salt thereof.

[0180] In embodiments, the SERD is elacestrant or a pharmaceutically acceptable salt thereof.

[0181] In embodiments, the SERD is imlunestrant or a pharmaceutically acceptable salt thereof.

[0182] In embodiments, the SERD is camizestrant or a pharmaceutically acceptable salt thereof.

[0183] "Selective estrogen modulators" (SERMs) are compounds that agonise or antagonise the estrogen receptor, often differently depending on which tissue they act. In embodiments, the selective estrogen modulator has an anti-estrogenic effect on cancer. In embodiments, the selective estrogen receptor modulator is selected from tamoxifen (e.g. nolvadex®) or a pharmaceutically acceptable salt thereof, toremifene (e.g. fareston®) or a pharmaceutically acceptable salt thereof and raloxifene (e.g. evista®) or a pharmaceutically acceptable salt thereof.

[0184] In embodiments, the SERM is tamoxifen or a pharmaceutically acceptable salt thereof.

[0185] In embodiments, the SERM is toremifene or a pharmaceutically acceptable salt thereof.

[0186] In embodiments, the SERM is raloxifene or a pharmaceutically acceptable salt thereof.

[0187] "Aromatase inhibitors" are compounds that block the biosynthesis of estrogen. In embodiments, the aromatase inhibitor is selected from anastrozole (e.g. arimidex®) or a pharmaceutically acceptable salt thereof, letrozole (e.g. femara®) or a pharmaceutically acceptable salt thereof and exemestane (e.g. aromasin®) or a pharmaceutically acceptable salt thereof.

[0188] In embodiments the aromatase inhibitor is anastrozole or a pharmaceutically acceptable salt thereof. In embodiments the aromatase inhibitor is letrozole or a pharmaceutically acceptable salt thereof.

[0189] In embodiments the aromatase inhibitor is exemestane or a pharmaceutically acceptable salt thereof. Specific Combinations

[0190] In an aspect, there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor selected from C70 or a pharmaceutically acceptable salt thereof, KDOAM25 or a pharmaceutically acceptable salt thereof, CPI-455 or a pharmaceutically acceptable salt thereof, GS-701644 or a pharmaceutically acceptable salt thereof, GS-5801 or a pharmaceutically acceptable salt thereof and CPI-48 or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor selected from miransertib or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, borussertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT- 427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib or a pharmaceutically acceptable salt thereof, uprosertib or a pharmaceutically acceptable salt thereof, XL- 418 or a pharmaceutically acceptable salt thereof and ipatasertib or a pharmaceutically acceptable salt thereof, a PI3K-a inhibitor selected from LOXO-783 or a pharmaceutically acceptable salt thereof, RLY- 2608 or a pharmaceutically acceptable salt thereof, STX-478 or a pharmaceutically acceptable salt thereof, alpelisib or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof and serabelisib or a pharmaceutically acceptable salt thereof, or an mTOR inhibitor selected from everolimus or a pharmaceutically acceptable salt thereof and temsirolimus or a pharmaceutically acceptable salt thereof.

[0191] In an aspect, there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, and the compound is an AKT inhibitor selected from miransertib or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, borussertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A- 674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib or a pharmaceutically acceptable salt thereof, uprosertib or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof and ipatasertib or a pharmaceutically acceptable salt thereof.

[0192] In an aspect, there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, and the compound is a PI3K-a inhibitor selected from LOXO-783 or a pharmaceutically acceptable salt thereof, RLY-2608 or a pharmaceutically acceptable salt thereof, STX-478 or a pharmaceutically acceptable salt thereof, alpelisib or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof and serabelisib or a pharmaceutically acceptable salt thereof.

[0193] In an aspect, there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, and the compound is an mTOR inhibitor selected from everolimus or a pharmaceutically acceptable salt thereof and temsirolimus or a pharmaceutically acceptable salt thereof.

[0194] In an aspect, there is provided a compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor which is CPI-48 or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor which is capivasertib or a pharmaceutically acceptable salt thereof, a PI3K-a inhibitor which is alpelisib or a pharmaceutically acceptable salt thereof, or an mTOR inhibitor which is everolimus or a pharmaceutically acceptable salt thereof.

[0195] Pharmaceutical Compositions and Dosage Forms

[0196] In one embodiment there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K- a inhibitor or an mTOR inhibitor.

[0197] "Pharmaceutically acceptable excipients" include diluents, disintegrants or lubricants. In a further embodiment, the pharmaceutical composition comprises one or more pharmaceutical diluents, one or more pharmaceutical disintegrants or one or more pharmaceutical lubricants.

[0198] In one embodiment there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, a SERD, and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0199] In one embodiment there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0200] In one embodiment there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0201] In one embodiment there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0202] In one embodiment there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, a SERD, a CDK4 / 6 inhibitor and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0203] In one embodiment there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof, palbociclib or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0204] In one embodiment there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, palbociclib or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0205] In one embodiment there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof, palbociclib or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

[0206] In one embodiment there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof, palbociclib or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, where the compound is capivasertib or a pharmaceutically acceptable salt thereof.

[0207] In embodiments, the composition is an oral dosage form.

[0208] In embodiments, the composition is in the form of a tablet or capsule.

[0209] In the combinations disclosed in this specification, capivasertib, or a pharmaceutically acceptable salt thereof, is generally administered to the subject at a daily dosage from about 100 mg to about 1600 mg. In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 150 mg to about 1500 mg. In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 200 mg to about 1400 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 300 mg to about 1300 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 400 mg to about 1200 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 500 mg to about 1100 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 600 mg to about 1000 mg. In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the subject once daily (Q.D).

[0210] In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 100 mg to about 1000 mg once daily.

[0211] In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 150 mg to about 900 mg once daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 200 mg to about 850 mg once daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 250 mg to about 800 mg once daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 300 mg to about 750 mg once daily.

[0212] In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 350 mg to about 700 mg once daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 400 mg to about 650 mg once daily.

[0213] In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the subject twice daily (BID). In one embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 50 mg to about 900 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 100 mg to about 875 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 200 mg to about 850 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 250 mg to about 825 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 150 mg to about 250 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 250 mg to about 350 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 350 mg to about 450 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 450 mg to about 550 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 550 mg to about 650 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 650 mg to about 750 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 750 mg to about 850 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 160 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 200 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 240 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 280 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 320 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 360 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 400 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 440 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 480 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 520 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 560 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 600 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 640 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 680 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 720 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 760 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 800 mg twice daily.

[0214] In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule. In one embodiment, for example, capivasertib, or a pharmaceutically acceptable salt thereof, is administered for more than 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, or 56 days. In another embodiment, the dosing cycle is 28 days. Administration of capivasertib, or a pharmaceutically acceptable salt thereof, and repeat of the dosing cycle can continue as long as tolerable and beneficial for the subject.

[0215] In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily (Q.D) under a continuous dosing schedule. In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under a continuous dosing schedule at a dosage from about 100 mg to about 900 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under a continuous dosing schedule at a dosage from about 150 mg to about 875 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under a continuous dosing schedule at a dosage from about 175 mg to about 850 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under a continuous dosing schedule at a dosage from about 200 mg to about 825 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under a continuous dosing schedule at a dosage from about 225 mg to about 800 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under a continuous dosing schedule at a dosage from about 250 mg to about 750 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under a continuous dosing schedule at a dosage from about 275 mg to about 700 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under a continuous dosing schedule at a dosage from about 300 mg to about 650 mg. In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered twice daily (BID) under a continuous dosing schedule. In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 100 mg to about 800 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 150 mg to about 750 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 200 mg to about 700 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 225 mg to about 650 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 250 mg to about 650 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 300 mg to about 600 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 200 mg to about 300 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 300 mg to about 400 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 400 mg to about 500 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 500 mg to about 600 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 600 mg to about 700 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage from about 700 mg to about 800 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 160 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 200 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 240 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 280 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 320 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 360 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 400 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 440 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 480 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 520 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 580 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 600 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 640 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 680 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 720 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 760 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule at a dosage of about 800 mg twice daily. In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the subject on an intermittent dosage schedule. Administering capivasertib, or a pharmaceutically acceptable salt thereof, on an intermittent dosage schedule can, for example, have greater effectiveness and / or tolerability than on a continuous dosing schedule. In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 1 day on / 6 days off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for one day followed by a six-day holiday). In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 2 days on / 5 days off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for two days followed by a five-day holiday). In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 3 days on / 4 days off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for three days followed by a four-day holiday). In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 4 days on / 3 days off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for four days followed by a three-day holiday). In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 5 days on / 2 days off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for five days followed by a two-day holiday). In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 6 days on / 1 day off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for six days followed by a one-day holiday). The dosing cycle of such embodiments would then repeat as long as tolerable and beneficial for the subject. In embodiments, the dosing cycle is 7 days. In embodiments, the dosing cycle is 14 days. In another embodiment, the dosing cycle is 21 days. In another embodiment, the dosing cycle is 28 days. In another embodiment, the dosing cycle is two months. In another embodiment, the dosing cycle is six months. In another embodiment, the dosing cycle is one year.

[0216] In embodiments, the dosing cycle is 28 days, but capivasertib, or a pharmaceutically acceptable salt thereof, is not co-administered to the subject during the fourth week of the dosing cycle (i.e., there is a capivasertib, or a pharmaceutically acceptable salt thereof, drug holiday during the final week of the dosing cycle).

[0217] In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily (Q.D) under an intermittent dosing schedule. In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under an intermittent dosing schedule at a dosage from about 100 mg to about 900 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under an intermittent dosing schedule at a dosage from about 150 mg to about 850 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under an intermittent dosing schedule at a dosage from about 175 mg to about 800 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under an intermittent dosing schedule at a dosage from about 200 mg to about 750 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under an intermittent dosing schedule at a dosage from about 225 mg to about 725 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under an intermittent dosing schedule at a dosage from about 250 mg to about 700 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under an intermittent dosing schedule at a dosage from about 275 mg to about 675 mg. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered once daily under an intermittent dosing schedule at a dosage from about 300 mg to about 650 mg. In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered twice daily (BID) under an intermittent dosing schedule. In embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 100 mg to about 800 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 150 mg to about 750 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 200 mg to about 700 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 225 mg to about 675 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 250 mg to about 650 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 300 mg to about 625 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 200 mg to about 300 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 300 mg to about 400 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 400 mg to about 500 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 500 mg to about 600 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 600 mg to about 700 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage from about 700 mg to about 800 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 160 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 200 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 240 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 280 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 320 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 360 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 400 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 440 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 480 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 520 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 580 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 600 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 640 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 680 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 720 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 760 mg twice daily. In another embodiment, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under an intermittent dosing schedule at a dosage of about 800 mg twice daily.

[0218] In any embodiment where a marketed or approved drug is mentioned, the marketed or approved drug may be administered in accordance with its dosage leaflet (for example as approved by the United States FDA or any other similar regulatory agency).

[0219] In any embodiment where a drug that is being investigated in human trials is mentioned, the drug may be administered in accordance with the dosage regime described in any of its published clinical trial protocols (for example as described on clinicaltrials.gov or similar).

[0220] Examples

[0221] The specific Examples below, with reference to the accompanying Figures, are provided for illustrative purposes only and are not to be construed as limiting the teachings herein.

[0222] Example 1: Cell Line generation

[0223] 1A. HEK-293T cell line: HEK-293T is an epithelial-like cell line that was isolated from a human embryonic kidney and expresses large T antigen. This cell line was purchased from GeneHunter Corporation (Catalogue number Q401) and used for viral production. HEK-293T cells were routinely cultured in DMEM media supplemented with 10% Fetal Calf Serum (FCS) and 1% L-glutamine, and incubated at 37°C, 5% CO2.

[0224] IB Cas9 Lentivirus Generation. HEK-293T cells were plated in a 75cm2flask pre-coated with 0.1% of gelatin. Number of HEK-293T cells per 75 cm2flask: 8 million cells (1x75 cm2flask set up). The cells were cultured in DMEM media + 10% FCS + 2 mM glutamine (10% Glutamax). HEK-293T cells should be around 80-90% confluent on the day of transfection. On the day of transfection (Day 0), the Cas9 gRNA lentiviral vector (pKLV2-EFla-Cas9-Bsd-W), the packaging mix and PLUS into Opti-MEM were added into a 15 mL canonical tube (see table below for volumes) and then mixed either by pipetting or vortexing for 2 seconds. They were then incubated for 5 mins at room temperature. Table 1: Transfection Mixtures

[0225] Lipofectamine LTX was then added to the solution with DNA and mixed either by pipetting or vortexing for 2 seconds. The resultant solutions were incubated 30 minutes at room temperature. The old medium was aspirated, and cells washed once with 10 mL of Opti-MEM media. 7 mLof Opti-MEM was then added to the 75-cm2flask, followed by the addition of the DNA / Lipofectamine complex using a pipette and swirling very gently. Finally, the vessel contents were incubated at 37 °C for 6 hours and the transfection medium replaced with 30 mL of DMEM media containing 10% FCS and 2% glutamine. After 48 hours (Day 2), collection of Cas9 lentiviral supernatant was done with a 10 mL syringe (x3 syringes in total) and filtered with 0.45 pm filter cartridge. HEK-293T plate was discarded appropriately according to risk assessment. Cas9 lentiviral supernatant was aliquoted into 1.5 mL cryovials (400 pL per cryovial, 75 cryovials in total) for storage at -80°C.

[0226] 1C. T-47D stable cell lines expressing spCas9: T-47D is a cell line derived from pleural fluid / effusion obtained from a patient with breast ductal carcinoma (here also referred as T47D). The cell line was obtained from ATCC HTB-133 and harbours the activating mutation in PIK3CA E545K. T47D cells were routinely cultured in RPMI media (Gibco #11835-063) supplemented with 5% Fetal Calf Serum (FCS) and 1% L-glutamine, and incubated at 37°C, 5% CO2. T47D cells constitutively expressing spCas9 were prepared using the following protocol in a 6-well plate:

[0227] 1. Lentivirus was removed from -80°C freezer and thawed at room temperature.

[0228] 2. Viral transduction mixtures were prepared in 1.5 mL Eppendorf tubes. For each cell line, a Cas9 mixture and a no virus control mixture were prepared as described below.

[0229] Table 2. Table outlining the transduction volumes required per well. 3. 100,000 cells in a total volume of 1 mL media per well were seeded in a 6-well plate (set up three wells per cell line). Two wells per cell line (T47D) - one well labelled "Cas9" and the other well "no virus control".

[0230] 4. Immediately after plating cells, 1 mL transduction mixture (Cas9 or no virus control) was added to each well of cells. The 6-well plate was gently rocked to mix and plate in an incubator.

[0231] 5. 24 hours post-transduction, rvirus containing media was removed from each well and replaced with 3 mL of fresh media.

[0232] 6. 72 hours post-transduction all cells from each well (Cas9 or no virus control) were moved into a T75 flask with blasticidin selection (Use 40 pg / mL of blasticidin).

[0233] 7. Cells were selected with blasticidin until no viable cells remained in the no-virus control flask. If cells became confluent during selection, they were moved into a T175 and continue blasticin selection.

[0234] 8. After blasticin selection of the Cas9 cell line was complete, cells were expanded for at least one week before testing Cas9 activity.

[0235] Cas9 activity of new Cas9 cell lines was determined with a reporter assay. The Cas9 activity assay consists of two separate lentivi ruses vectors. A sgRNA targeting GFP is introduced into cell lines using a lentivirus (pKLV2-U6gRNA5(gGFP)- PGKBFP2AGFP-W) that is labelled with BFP and GFP. In the absence of functional Cas9 the cells transduced with this lentivirus will express both BFP and GFP. But in the presence of Cas9, the gRNA will target GFP and cells will no longer express GFP (BFP+ GFP-). The activity of Cas9 in the cells is the fraction of transduced cells that are BFP positive but GFP negative. Cas9 cells transduced with the control reporter virus (pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W) should express both BFP and GFP. Total number of transduced cells are determined as: BFP+-GFP+ double positive cells plus BFP+ cells. Cas9 activity in bulk population of cells (%) is determined from (BFP+ positive cells) / (total number of transduced cells). Cas9 activity in T-47D cells constitutively expressing spCas9 was determined in 6-well plates using the following protocol:

[0236] 1. Lentivirus was removed from -80°C freezer and thawed at room temperature.

[0237] 2. Viral transduction mixtures were prepared in 1.5 mL Eppendorf tubes as described in table 3. For each cell line, three separate mixtures were prepared: 1) BFP-GFP (empty), 2) BFP-GFP (gRNA GFP) and 3) no virus control. Table 3. Table outlining the transduction volumes required per well (in a 6-well plate)

[0238] 3. 100,000 cells in a total volume of 1 mL media per well were seeded in a 6-well plate (set up three wells per cell line).

[0239] 4. Immediately after plating cells, 1ml transduction mixture (BFP-GFP empty, BFP-GFP gRNA GFP and virus control) was added to each well of cells. The 6-well plate was gently rocked to mix and plate in an incubator.

[0240] 4. 24 hours post-transduction, the virus containing media was removed from each well and replaced with 3 mL of fresh media.

[0241] 5. 72 hrs post-transduction, cells were fixed and BFP-GFP expression (BFP-GFP empty, BFP-GFP gRNA GFP and virus control) was measured by flow cytometry on the MaxQuant VYB (Cambridge Institute Flow cytometry facility). The "no virus control" cells were used to gate for BFP-GFP negative cells.

[0242] 6. Cas9 activity was calculated for each cell line as: Cas9 activity in bulk population of cells (%) = (BFP+ positive cells) / (total number of transduced cells).

[0243] 7. Cell lines with a Cas9 activity above 75% were expanded to bank stocks.

[0244] ID. MCF7 stable cell lines expressing spCas9: MCF7 is a cell line derived from pleural fluid / effusion obtained from a patient with breast ductal carcinoma. The cell line was obtained from ATCC HTB-22 and harbours the activating mutation in PIK3CA E545K. MCF7 cells were routinely cultured in RPMI media (Gibco #11835-063) supplemented with 5% Fetal Calf Serum (FCS) and 1% L-glutamine, and incubated at 37°C, 5% CO2. The MCF7 cell line from ATCC HTB-22 was used in Figure 20. MCF7 stable cell lines expressing spCas9 were prepared by a method similar to that of IB, but cells were selected using 10 pg / mL blasticidin.

[0245] IE. CAMA-1 stable cell lines expressing spCas9: CAMA-1 is a cell line derived from pleural fluid / effusion obtained from a patient with breast adenocarcinoma. The cell line was obtained from ATCC HTB-21 and harbours loss of function mutations in PTEN D92H / F278fs. CAMA-1 cells were routinely cultured in RPMI media (Gibco #11835-063) supplemented with 5% Fetal Calf Serum (FCS) and 1% L-glutamine, and incubated at 37°C, 5% CO2. CAMA1 stable cell lines expressing spCas9 were prepared by a method similar to that of IB, but cells were selected using 25 pg / mL blasticidin. IF. MCF7 ESRI Y537S (mut / - / -) cell line: MCF7 ESRI Y537S (mut / - / -) cell line was generated from the parental ATCC HTB-22 stock. Cells were cultured as described in example ID. Cells were transfected with a sgRNA CAS9 T2A GFP vector and the donor vector with Neomycin cassette as a non-digested plasmid at a 2:1 ratio using Fugene (Promega). The gRNA sequence was ctccagcagcaggtcataga [SEQ_ID 35]. The donor cassette contained 800bp and lkb homology regions for incorporation of the Y537S mutation via homologous directed repair (HDR). Between the homology regions, the Neomycin resistance gene was encoded, which was expressed under the PKG promotor and used for selection of HDR events 48hrs post transfection. After two weeks of selection, single cell clones were generated and characterised. To confirm the knock-in, a digital droplet PCR was performed using ddPCR primers (Fwd: AAGGCATGGAGCATCTGT [SEQ_ID 1] & Rev: GCTAGTGGGCGCATGTA [SEQJD 2]) and specific probes (C{C}CTC{TAT}GACC{T}G [SEQJD 3] and CTC{T}AT{GGC}C{T}GC [SEQJD 4]). The location of the insertion was confirmed using junction PCR with the following primer pairs: Fwd TTAGATCATGCTGTAGGCCCTG [SEQJD 5] & Rev CTGGAACCCATGACCGGAAAG [SEQJD 6], Fwd GCAGATCCAGGGGGCATTTA [SEQ_I D 7] & Rev GATGTGGAATGTGTGCGAGC [SEQJD 8] and Fwd GGATCAATTCTCTAGAGCTCGC [SEQJ D 9] & Rev CTGGAACCCATGACCGGAAAG [SEQ._I D 6]. TIDE analysis was used to confirm the frame shift mutation of the 2nd ESRI allele. Targeted Locus Amplification (TLA) sequencing (de Vree et al. 2014) confirmed the genotype of the 3 ESRI alleles (knock-in, single base insertion knock-out and inactivating 48bp deletion; mut / - / -).

[0246] IG. MCF7 100F P2 cell line: MCF7 100F P2 cell line was generated from the parental ATCC HTB-22 stock. Cells were cultured as described in example ID. To set up the initial treatment flasks, the media was removed from a T175 flask, the cells washed with 10 mL DPBS and 2 mL trypsin added to detach the cells. Once detached, the cells were re-suspended in 10 mL of growth media, and counted using Trypan blue and the Countess™ Cell Counter (ThermoFisher). Then, 10 mL was added to 3x T25 flasks at 3.0 x 104 / mL cells, 1 to dose with DMSO to gage the growth of the resistant cell pools versus cells in the same % of DMSO and 2 flasks to be dosed with fulvestrant to generate the resistant pools. Cells were transferred to an incubator to adhere overnight. Cells were initially dosed with 30 nM fulvestrant with the aim to escalate to 100 nM once the cells start to grow out. The media in the flask was removed and replaced with 10 mL of the fulvestrant containing media (2.2 pL 300 pM fulvestrant stock was added to 22 mL growth media, 1:10,000 dilution to give 30 nM final). Cells were re-dosed twice weekly. After a week, cells started to grow up and fulvestrant concentration was increased to 100 nM. Cells were redosed twice weekly for 15 days. After that point, cells were expanded to generate stock for cryopreservation.

[0247] IH. T47D 1OOF1P Pl and T47D 1OOF1P P2 cell lines: T47D 100F1P Pl and P2 cell lines were generated from the parental ATCC HTB-133 stock. Cells were cultured as described in example 1C. To set up the initial treatment flasks, the media was removed from a T175 flask, the cells washed with 10 mL DPBS and 2ml trypsin added to detach the cells. Once detached, the cells were re-suspended in 10 mL of growth media, and counted using Trypan Blue and the Countess™ Cell Counter (ThermoFisher). Then, 10 mL was added to 3x T25 flasks at 2.0 x 104 / ml cells, 1 to dose with DMSO to gage the growth of the resistant cell pools versus cells in the same % of DMSO and 2 flasks to be dosed with 30 nM fulvestrant & 300 nM palbociclib to generate the resistant pools. Cells were transferred to an incubator to adhere overnight. The cells were initially dosed with 30 nM fulvestrant & 300 nM palbociclib with the aim to escalate to 100 nM fulvestrant / 1 pM palbociclib once the cells start to grow out. The media in the flask was removed and replaced with 10 mL of the fulvestrant / palbociclib containing media (fulvestrant: 2.2 pL 300 pM fulvestrant stock was added to 22 mL growth media, 1:10,000 dilution to give 30 nM final / palbociclib: 2.2 pL 3mM stock was added to 22 mL growth media, 1:10,000 dilution to give 300 nM final). Cells were re-dosed twice weekly and kept for 6 months as they grew slowly from a small surviving cell fraction. Cells were expanded to T75 flask and dose escalated to 100 nM fulvestrant + 1 pM palbociclib. Cells were expanded for the subsequent 40 days to generate stock for cryopreservation.

[0248] II. MCF7 KDM5C KO clone A9 cell line: KO of KDM5C was performed in parental MCF7 breast cancer cells. The KDM5C KO pool was established through RNP delivery of spCas9 protein and guides as follows:

[0249] 1. Guide RNA (gRNA) duplexes were prepared by combining the crRNA and tracrRNA in PCR tubes (table 4) incubated at 95C for 5 min in a thermocycler and allowed to cool to room temperature.

[0250] Table 4: Volumes for gRNA duplex preparation

[0251] 2. Recombinant spCas9 protein was diluted according to the following:

[0252] Table 5: Volumes for spCas9 preparation 3. The crRNA:tracrRNA:Cas9 RNP complex was generated by mixing the gRNA duplex and recombinant spCas9 in low binding tubes. The mixture was incubated at room temperature for 15 min until the solution became clear.

[0253] Table 6: Volumes for RNP complex preparation

[0254] 4. A single cell suspension of MCF7 cells was prepared for Neon electroporation as follows: cells were washed with PBS, detached with Accutase® solution and resuspend in media. 5xl05cells were re-suspended in Neon 10.8 pL buffer R for electroporation.

[0255] 5. Electroporation mix was prepared according to table 7. 10ml of mix was collected with a Neon lOul tip and placed it in the Neon™ transfection system (ThermoScientific), avoiding formation of bubbles. Program 1250 volts, 20 milliseconds, 2 pulses was used for electroporation.

[0256] Table 7: Volumes for electroporation reaction.

[0257] (*) Electroporation enhancer or carrier oligo - IDT enhancer CCA GCA GAA CAC CCC CAT CGG CGACGG CCC CGT GCT GCT GCC CGA CAACCA CTA CCT GAG CAC CCA GTC CGCCCT GAG CAA AGA CCC CAA CGA GA [SEQJD 11]

[0258] 6. After electroporation, cells were immediately placed on a 12 well tissue culture plate with lmL of media. A 100 mL aliquot was placed on a 24-well plate for genomic DNA extraction and KO validation by TIDE.

[0259] 7. After 48 hours, media was removed from the 24-well plate, cells were washed with PBS and DN Awas extracted with 80 mL of DirectPCR Lysis Buffer (Viagen BioTech) following the protocol of the manufacturer. 8. For generation of an amplicon suitable for TIDE analysis of KO efficiency, primers were designed around the guide RNA binding site (PCR product size 307bp). The PCR reaction was prepared using the following mix: 7.5 mL H2O, 10 mL 2x Phusion Mix, 0.5ml Forward Primer (5'- CGATCTGCCATACCCAGGAC-3', [SEQ.JD 12], 10 mM), 0.5 mL Reverse Primer (5'- AGCCCAGTCATTCCCTCTCT-3', [SEQ_ID 13], lOmM); 1.5 mL genomic DNA. Amplification was done using the following conditions: i. 98°C 1 minute, ii. cycle 30 times: 98°C 5 seconds, 65°C 5 seconds, 72°C 10 seconds, ill. 72°C 1 minute.

[0260] 9. PCR product was verified using a 1% agarose gel, purified using the GFX I llustra PCR Purification Kit (Cytiva), and Sanger sequenced using the forward primer. Gene editing efficiency in the target region was assessed using TIDE analysis (64.7% efficiency for the pool).

[0261] 10. Single cell cloning from MCF7 KDM5C KO pool was done using the cellenONE® platform (Scienion) 4 days after electroporation.

[0262] 11. A single cell suspension was obtained by washing cells with PBS and detaching them with 200 mL of Accutase® solution. 100 mL of single cell suspension was transferred into an Eppendorf tube and diluted with up to 500 mL of PBS. Cell suspension was mixed by pipetting up and down gently and 50 mL were loaded into a 384 well sciSourceplate (Scienion).

[0263] 12. Single cell clones were stamped into a 384-well tissue culture plate (Corning) with 50 mL of 30% conditioned media (dispensed in advance using a Multidrop Combi) as follows: sample was loaded into the cellenONE, mapped to determine the appropriate diameter / elongation parameters for sorting and stamped using the CellenONE Basic Destatic Target program.

[0264] 13. At time zero and then every 7 days clonal growth was analyzed using the Cell Metric (Solentin) and conditioned media was refreshed once per week.

[0265] 14. Single cell clones that grew we were validated for high percentage of KDM5C KO by performing TIDE analysis of Sanger sequencing traces as follows: PCR products with primers located around the guide RNA binding site were generated as described above and Sanger sequenced; sequencing traces were compared against the wilt-type sequence using TIDE.

[0266] 15. Clones with high TIDE efficiency (>85%) and no in-frame indels were then analysed for depletion of KDM5C protein by western blot using an anti-KDM5C antibody (Abeam, abl90180 - 1:1000 dilution) and an anti-Vinculin (Cell Signalling, #13907 - 1:1000 dilution) antibody as loading control

[0267] Example 2: Pooled CRISPR knockout screens

[0268] Experiments in this example have been carried out to identify genes that modulate response to capivasertib after genetic knockout in ER+ breast cancer cells. Whole genome pooled CRISPR knockout screens were conducted in MCF7, CAMA-1 and T47D stable cell lines expressing spCas9, which resulted in the identification of KDM5C as a capivasertib sensitiser across all three cell lines.

[0269] Cell lines were revived from frozen stocks prior to the screen, cultured with 1% Pen / Strep and reselected with blasticidin as described in examples 1C, ID and IE. A total of 120 million cells (T47D / MCF7) or 200 million cells (CAMA-1) were plated in 5-layers stacks (Corning #CLS3319-2EA) and transduced using polybrene with the Yusa V3 human lentiviral library at a multiplicity of infection (MOI) of ~0.3 and a coverage of at least 150x (Human Improved Genome-wide Knockout CRISPR Library) in two replicates. Media was changed the next day and cells cultured for 2 days. Transduced cells were then selected with puromycin (2 pg / mL) and expanded to maintain a representation of ~750x. Transduction efficiency was monitored by analysing % of BFP positive cells with FACS Melody. After selection, cells were pooled and counted with replicates kept separate. Each replicate was resuspended in batches of 100 million cells for MCF7 / T47D and 150 million cells for CAMA-1 in a total volume of 625 mL using 5- layers stacks. Batches were treated with either DMSO or capivasertib at 750 nM for MCF7 / T47D and 400 nM for CAMA-1. Pellets with ~50 million cells were also prepared and frozen as baseline measurements. Then, cells were cultured by consecutive passaging and reseeding at 100 million cells (MCF7 / T47D) and 150 million cells (CAMA-1) until the end of the screen. Cells were treated with fresh compound twice per week (or every 3-4 days). After, 24 days for MCF7, 23 days forT47D and 29 days for CAMA-1, cells were harvested and pelleted for genomic DNA extraction.

[0270] To prepare and generate Illumina® libraries for deep sequencing, genomic DNA was extracted using QiAMP Blood DNA MAxi kit (Qiagen, #51194) and sgRNA cassettes were amplified by PCR using Q5 Hot Start High-Fidelity 2 x Master Mix and primers specific to the sgRNA lentiviral CRISPR backbone. PCR products were purified with QIAquick PCR Purification kit. During this amplification step, Illumina 5' and 3' adapters were added to the 5' and 3' end of the sgRNA cassette. Ideally, we aimed to use an amount of DNA for the first PCR that corresponds to 200x coverage of the pooled sgRNA library (150 pg / sample for Yusa V3 CRISPR library). A second PCR was performed to add Illumina indexes to the gRNA libraries and allow pooling of individual samples for sequencing (barcodes for demultiplexing). This second PCR was performed using Kapa HiFi HotStart mix and ThruPLEX® DNA-seq 48 Dual index kit (Takara #R400406) with lllumina®-compatible dual indexes. PCR products were purified using AMPure XP beads. DNA concentration was measured using Qubit (HS ds DNA kit) according to the manufacturer's instructions, and quality confirmed in a Bioanalyzer with a high sensitivity DNA chip. Up to 6 libraries were pooled to a final concentration of 10-15 nM in a total volume 20 pL and submitted for sequencing. Results in figure 1 were generated from the sequencing data by determining the gRNA count in each sample for the 6x sgRNA in the Yusa V3 human library targeting KDM5A, B, C and D. The figure plots the fold change in gRNA count between cells treated with capivasertib and DMSO control. Data shows that gRNAs targeting KDM5C gene, but not KDM5A, B or D, are significantly depleted when MCF7, T47D and CAMA-1 cells are treated with capivasertib compared to DMSO. Thus, results indicate that loss of KDM5C sensitise MCF7, T47D and CAMA-1 cells to capivasertib.

[0271] Example 3: Arrayed CRISPR Knockout experiments

[0272] Experiments in this example have been carried out to validate KDM5C as a drug sensitizer in ER+ breast cancer cells. KDM5C was knocked out in ER+ breast cancer cell lines generated through different methodologies and proliferation assays were performed to determine whether loss of KDM5C reduces cell growth and increases the anti-proliferative effects of capivasertib, fulvestrant combined with capivasertib, alpelisib and everolimus.

[0273] 2A. CRISPR Knockout of KDM5C using gRNA lentiviral expression vectors. The experiment involves three main steps: (1) Cloning gRNAs targeting KDM5C into the expression vector to produce KDM5C gRNA lentivirus; (2) Generate and validate KDM5C knockout ER+ breast cancer cell lines (CAMA-1, T47D, MCF7) with the lentivirus; and then (3) performing proliferation assays comparing KDM5C knockout and wild-type ER+ breast cancer cell with DMSO (control), capivasertib, alpelisib and everolimus.

[0274] 1. Generation of CRISPR gRNA lentiviral expression vectors:

[0275] KDM5C guide RNAs (gRNAs) were cloned into the Yusa CRISPR lentiviral expression vector according to the following protocol, which describes how to synthesise and clone individual gRNAs into the CRISPR lentiviral single guide RNA (sgRNA) expression vector to target a single genomic locus. These vectors can then be transfected into HEK-293T cells to generate infectious sgRNA lentivirus, for transduction into human or mouse cells to generate a heterogenous population of cells with a mix of CRISPR-induced indels, known as a knockout cell pool. Knockout efficiencies in cell pools are typically 80-90%. Once knockout (KO) efficiency in the pool has been analysed, the cells can be used in assays right away while still in a heterogenous population.

[0276] Table 8: List of materials for the generation of lentiviral expression vector

[0277] Table 9: Lentiviral CRISPR sgRNA vectors gRNA and oligonucleotide design: 6 gRNAs targeting KDM5C gene were selected from the V3 Yusa CRISPR knockout gRNA library. gRNA oligonucleotide described in table 10 were ordered from IDT at 100 nM ready to use solution (standard desalting). Oligonucleotides for gRNAs were designed to have the following configuration: forward oligonucleotide: 5' CACCG — 19 bp gRNA — 3' reverse oligonucleotide: 5' AAAC — 19 bp gRNA — C 3'

[0278] Example:

[0279] Genome: 5'-tggcgtgTAAGAGAGCATCATGGGCCACGGcagagaa-3' [SEQ_ID 14]

[0280] Guide RNA: 5'-GAAGAGAGCATCATGGGCCA-3' [SEQJD 15]

[0281] Forward oligonucleotide: 5'-CACCGAAGAGAGCATCATGGGCCA-3' [SEQJ D 16]

[0282] Reverse oligonucleotide: 3'-CTTCTCTCGTAGTACCCGGTCAAA-5' [SEQJD 17]

[0283] The forward and reverse oligonucleotide pair with each other and result in two overhangs (5'CACC and 5'AAAC) that can be ligated to the linearized (Bbsl) gRNA expression vector. The two oligonucleotides were designed as a reverse complement because they were cloned into the vector as an annealed oligo pair.

[0284] Table 10: KDM5C gRNA seguences.

[0285] Vector linearization and gRNA cloning into the CRISPR lentiviral expression vector:

[0286] The CRISPR gRNA expression vector was linearized with the restriction enzyme Bbsl according to the manufacturer's instructions (New England Biolabs; NEB). Linearised vector was separated with an agarose gel, purified from the gel and quantified using a NanoDrop (Thermo Fisher). Concentration was adjusted to 20 ng / pL. gRNA oligonucleotides cloning was started by the phosphorylation and annealing of the forward and reverse oligonucleotides. To this end, the components described in table 11 were mixed in a PCR tubes strip. The strip was placed in a PCR machine to run the programme: started with 37 °C, 30 minutes; followed by 95 °C, 50 minutes; ramped down to 25 °C at 0.1 °C / second.

[0287] Table 11: Phosphorylation and annealing reaction for sgRNA oligonucleotides.

[0288] To ligate the double strand oligonucleotides (ds-oligos) to the vector, they were first diluted in EB buffer (Qiagen) on ice as follow:

[0289] • 1stdilution (142 fmol / pL): 139 pL EB buffer + 2 pL 10 pM ds-oligos

[0290] • 2nddilution (7.1 pmol / pL): 57 pL EB buffer + 3 pL 1stdilution

[0291] The ligation reaction was performed by mixing the volumes described in table 12 in a PCR tube on ice. Make a negative control (linearized CRISPR vector without annealed oligos) by adding 2 pL nuclease-free water instead of ds-oligo. The annealed oligos were ligated into the vector by incubating the linearized vector / oligo mixture at 16 °C for 4 hr to overnight. Table 13: ds-oligonucleotides ligation reaction to the vector.

[0292] To transform bacteria with the ligated vector, 5 pL of the ligation mixture was placed in a 1.5 mL microtube and keep it on ice. 50 pL of DH5a chemical competent cells was added to the tube and mixed with the ligation mixture with a vortex for 1 second. The mix was incubated for 10 minutes on ice and immediately placed in a heat shock at 42 °C for 30 seconds. Bacterial mix was then incubated on ice for an additional 2 minutes. Next, 400 pL of S.O.C. medium was added to the transformed bacteria and incubated in a shaking incubator at 37 °C for 30 minutes. Transformed bacteria were plated on LB agar plates with ampicillin antibiotic, and incubated overnight at 37°C. Next day, plates were inspected for colony growth and confirmed that there was no colony growth on the negative control plate (ligation of linearized CRISPR vector without annealed sgRNA oligos). Two colonies were picked up for each KDM5C gRNA construct using a sterile pipette and placed into 2 mL 2xTY medium (+am pici Ilin at 50 pg / ml) in a 15-ml falcon tube. Bacteria was incubated for 14-16 hours at 37°C in an orbital shaker. Then, bacterial cultures were centrifuged at 4000 rpm for 10 minutes and supernatant was discarded. Plasmids were isolated using a Qiagen mini-prep kit according to the manufacturer's instructions, and eluted into 50 pL of EB buffer. DNA concentration was determined using a NanoDrop (Thermo Fisher) and plasmids were stored at -20 °C.

[0293] 2. Production ofKDM5C gRNA expressing lentivirus in HEK-293T cell.

[0294] Infectious KDM5C gRNA lentiviral particles were produced for transduction into ER+ breast cancer cells according to the following procedure and materials described in table 14, 15 and 16.

[0295] Table 14: Lentiviral expressing HEK-293T cell production materials

[0296] Table 15: Backbone vectors

[0297] Table 16: KDM5C gRNA Vectors used to generate lentivirus

[0298] HEK-293T cells were cultured in DMEM medium with lx GlutaMAX and 10% Foetal Bovine Serum (FBS) at 37 -C with 5% CO2, and maintained according to the manufacturer's recommendation (GeneHunter; Cat no: Q401). To passage, the medium was aspirated, and cells rinsed by gently adding 5 mL of TrypLE to the side of a T225 flask to not dislodge the cells. TrypLE was removed and cells incubated in the flask for 4-5 min at 37 -C until they begun to detach. Next, 10 mL of warm culture media was added to the flask and cells were dissociated by pipetting them up and down gently. Cells were transferred to a 50-ml Falcon tube. HEK293T cells were passaged every 2 days at a ratio of 1:4 and never allowing cells to reach more than 70% confluency. For lentiviral production, cells were kept until a passage number less than 10.

[0299] On Day 0 HEK-293T cells were plated in 6-well plates and 8 x 105cells per well in the plate. Cells should be 80-90% confluent on the day of transfection and each well produced 3 mL of lentivirus. One Day 1 morning, the CRISPR gRNA lentiviral vector described in table 16, the packaging mix vectors (psPAX2 and pMG2.G) described in tables 15 and the PLUS reagent were mixed with Opti-MEM media in a 15 mL tube as described in table 17. The transfection mixture was mixed either by pipetting or vortexing for 2 seconds, and incubated for 5 mins at room temperature. Lipofectamine LTX was added and mixed either by pipetting or vortexing for 2 seconds, and incubated 30 minutes at room temperature. Old media in the wells was aspirates off and cells washed once with 2 mL of Opti-MEM media per well. Take care not to dislodge cells during this step since HEK-293T cells loosely adhere on culture vessels.1.5 mL of Opti- MEM media was added to each well. The DNA / Lipofectamine complex was added to each well drop wise using a pipette and swirl very gently. Cells were incubated with transfection solution at 37 °C for 5-7 hours. If cell were <80% confluent at the time of transfection, then reduce transfection incubation time to 5 hours to prevent excessive cell death. Medium was then replaced with 2.5 mL of fresh cell culture medium (DMEM GlutaMAX + 10% FBS).

[0300] Table 17: Volumes and amounts to be used for the transfection step

[0301] Prior to collecting the lentivirus, HEK-293T cells were inspected under a fluorescent microscope to detect BFP expression and assess transduction efficiency as well as successful viral production. On Day 3, 48h after transfecting the cells, the viral supernatant was collected with a 10 mL disposable syringe and filtered with a 0.45 pm filter cartridge. The plate of HEK-293T plate was discarded following the appropriate waste disposal route. The 1 mL of supernatant was aliquoted into labelled cryovials and stored at -80°C.

[0302] 3. Infection and generation of MCF7, T47D and CAMA-1 Cas9-expressing cell lines with KDM5C gRNA lentivirus.

[0303] The aim of this protocol is to generate a pooled KDM5C KO cell line from MCF7, T47D and CAMA-1 Cas9 stable lentiviral pools (Examples IB, 1C and ID). Each Cas9-expressing cell lines was transduced with the 3 different KDM5CgRNA lentiviruses (sequence 1, 2, 3) in a 6-well plate (each well of cells was transduced with a different KDM5C gRNA lentivirus). Cells were also transduced with lentivirus that does not contain a gRNA targeting KDM5C, empty vector pKLV-2. These are the wild-type cell lines used in the proliferation experiments. KDM5C gRNA lentivirus were thaw at room temperature, and the viral transduction mixtures prepared in 1.5 mL Eppendorf tubes as described in table 18. 250,000 cells were seeded in a total of 1 mL of media per well in a 6-well plate. Immediately after plating cells, 1ml transduction mixture was added to each well of cells, plates were gently mix and placed in the incubator. 24 hours posttransduction, virus containing media was removed from each well and replaced with 3 mL of fresh media. 72 hours post-transduction, cells were expanded from each well into a T75 flask with puromycin selection. The concentration of puromycin used for each cell line is shown in table 19. Cells were kept with puromycin selection until no viable cell remained in the no-virus control flask. After puromcycin selection of the KDM5C KO cell line was completed, cell lines were expanded for at least one week before testing KDM5C protein levels using western blot.

[0304] Table 18: Lentiviral expressing HEK-293T cell production materials

[0305] Table 19: Puromycin concentration used in cell lines Western Blotting was used to confirm that the KDM5C gene had been edited from the cell lines. Protein was extracted from cells in a T25 flask with 200 pL lysis buffer (25 mM Tris HCL, 3 mM EDTA, 3 mM EGTA, 50 mM NaF, 2 mM orthovanadate, 0.27 M sucrose, 10 mM p-glycerophosphate, 5 mM pyrophosphate, 0.5% Triton X-100, 0.1% p-mercaptoethanol, deionised water) supplemented with protease inhibitor cocktail. Lysate was clarified with centrifugation and quantified using BCA assay. Protein concentration was normalised across samples and prepared with NuPAGE LDS Sample Buffer (4X). Samples were boiled, loaded in a NuPAGE BisTris gel 4-12% gel and run Gel tanks (XCell Surelock™ Mini-Cell) with NuPAGE MOPS SDS Running Buffer for 1 hour to separate proteins via electrophoresis. Proteins in the gel were transferred onto a nitrocellulose membrane using Iblot2 dry blotting system according to manufacturer's instruction with the program P3 20V 10 minutes. Total protein in the membrane was assessed using Ponceau S staining, and membranes blocked with 5% non-fat dry milk in TBST buffer (TBS with 0.05% Tween). Membranes were stained with primary antibodies overnight at 4 degrees with rocking (KDM5C antibody: 1:250; Abeam ab34718; Vinculin antibody: 1:1000, Cell SignallingTechnology #4650). Next day, membranes were washed three times with TBST for 5 minute each time. Membranes were incubated with secondary antibodies coupled to HRP peroxidase (1:2000) from appropriate species for 1 hours are room temperature with rocking. Membranes were washed three times with TBST for 5 minute each time. Finally, membranes were incubated with a substrate detectable via chemiluminescence (Pierce Supersignal kit) and images were developed using a CCD camera in Sygene G box.

[0306] 4. Incucyte® proliferation assay with MCF7 and CAMA-1 KDM5C KO lentiviral pools. The following protocol was used to set up proliferation assays and analyse resultant data Figures 2, 3, 9-12, 15 and 16.

[0307] CAMA-1 cell lines: CAMA-1 WT (parental cell line) and KDM5C KO lentiviral pools were seeded at 25,000 cells / well in 48-well plates. Plates were placed in an incubator for cells to attach. After 24 hours, cells were treated with DMSO as vehicle control or 400 nM capivasertib, and plates were placed on the Incucyte® S3 (Day 0 reading) immediately after adding compounds. Cells were imaged at days 2, 5, 6, 7, 9, 12, 14, 16, 20 and 21 (end of the assay).

[0308] MCF7 cell lines: MCF7 WT (parental cell line) and KDM5C KO lentiviral pools were seeded at 60,000 cells / well and 90,000 cells / well in two duplicated 24-well plates. Plates were placed in an incubator for cells to attach. After 24 hours, cells were treated with DMSO as vehicle control, 750 nM capivasertib or 750 nM alpelisib, 10 nM everolimus. and plates were placed on the Incucyte® Zoom (Day 0 reading) immediately after adding compounds. Cells were imaged for 8 days every 4 hours.

[0309] For both cell lines, multiple fields of view were acquired per well and the mean % of cell confluency per well was quantified using the Incucyte® analysis software. Values from all timepoints were normalised to day 0. Normalised values were plotted as a line graph (X-axis = days proliferation, Y-Axis = % of cell confluence), while end point values (last day imaged) were plotted as a bar chart.

[0310] Figures 2, 3, 9, 10, 11, 12, 13 and 16 show that:

[0311] • Knockout of KDM5C impacts proliferation / growth of MCF7 cells.

[0312] • Knockout of KDM5C sensitises MCF7 cells to capivasertib, alpelisib or everolimus monotherapy.

[0313] • Knockout of KDM5C sensitises CAMA-1 cells to capivasertib monotherapy.

[0314] 2B. I ncucyte® proliferation assay with MCF7 KDM5C KO clonal cell line. The following protocol was used to set up proliferation assays and analyse resultant data from Figures 4 to 8, 13 and 14. MCF7 WT (parental cell line) and MCF7 KDM5C KO clone A9 were seeded in replicate 48-well plates at 50,000 cells / well (2 plates) and 75,000 cells / well (3 plates). Plates were placed in an incubator for cells to attach. After 24 hours, cells were treated with DMSO as vehicle control, capivasertib (500 nM or 1 pM), alpelisib (500 nM or 1 pM), fulvestrant (10 nM) and camizestrant (10 nM). Plates were placed on Incucyte® S3 or Zoom (Day 0 reading) immediately after adding compounds. Cells were imaged for 14 days, and imaged were acquired every 4 hours for plates seeded with 75,000 cells / well or at 4, 8, 10 and 14 day for plates seeded with 50,000 cells / well. Multiple fields of view were acquired per well and the mean % of cell confluency per well was quantified using the Incucyte® analysis software. Values from all timepoints were normalised to day 0. Normalised values were plotted as a line graph (X-axis = days proliferation, Y- Axis = % of cell confluence), while end point values (last day imaged) were plotted as a bar chart. Statistical analysis was performed on prism using data from multiple plates. Ns = P > 0.05; * = P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001 Significance was determined using two-tailed t-test.

[0315] Figures 4 to 8, 13 and 14 show that:

[0316] • Knockout of KDM5C impacts proliferation / growth of MCF7 cells.

[0317] • Knockout of KDM5C sensitises MCF7 cells to capivasertib and alpelisib monotherapy as well as combinations of capivasertib and fulvestrant or camizestrant.

[0318] 2C. Incucyte® proliferation assay with acute knockout (KO) of KDM5C. The following protocol was used to set up proliferation assays and analyse resultant data from Figures 2 to 19.

[0319] The acute KO of KDM5C was achieved by reverse transfecting a pool of 4x different synthetic single guide RNAs (sgRNAs) targeting KDM5C exon 3 in MCF7 and CAMA-1 cell lines stably expressing spCas9. A sgRNA targeting the safe harbour locus AAVS1 (Adeno-Associated Virus Integration Site 1) was used as a reference control.

[0320] Table 13: sgRNAs

[0321] Before starting the proliferation assays, 350 nL of pooled KDM5C sgRNAs or single AAVS1 sgRNA were dosed per well in 96-well plates (ThermoFisher Scientific #165305) using acoustic dispensing with an Echo® 650 (Beckman) to achieve a final concentration of 25 nM / well in 140 pL of final volume.

[0322] MCF7 and CAMA-1 cells were cultured in phenol red free RPMI supplemented with 5% Fetal Bovine Serum (FBS), IX Glutamax, 1 / 100 Pen / Strep (P / S), and incubate at 37 °C with 5% CO2. After dispensing sgRNAs in 96-well plates, cells were resuspended from a T25 or T75 flasks by washing them with PBS at room temperature and incubating them 5 minutes with Accutase™. Cell suspensions were collected in a falcon and counted using a Vi-CELL counter (Beckman). MCF7 cells were diluted to 85714.29 cells / ml with media to seed 9000 cells per well, while CAMA-1 cells were diluted to 100000 cells / ml with media to seed 7000 cells per well. Reverse transfection was started by incubating synthetic sgRNAs with Lipofectamine RNAiMAX (ThermoFisher Scientific #13778150). 35 pL of 1% Lipofectamine RNAiMAX diluted in serum free RPMI media was added in each well using the Multidrop™ Combi with standard cassette. The sgRNA:Lipofectamine mixture was incubated for 45 minutes at room temperature. Immediately after, 105 pL of cells suspension was added on top using the Multidrop™ Combi with standard cassette at low speed. Cells were dispensed in duplicated plates containing multiple replicated wells for each treatment. Edge wells in the plate were excluded (Rows A & H; Columns 1 & 12). After cell seeding, plates were placed on the Incucyte® Zoom within an incubator with scheduled brightfield imaging scans every 5 hours using a lOx objective. After 3 days, media was removed with a multi-channel aspirator and wells refilled with fresh media using a Multidrop™ Combi with standard cassette at low speed (140 pL final volume). Plates were dosed with different treatments using the Tecan D300 digital dispenser (HP). Dimethyl sulfoxide (DMSO) was used as a vehicle to dilute drugs and as a neutral control. MCF7 cells were treated with two concentrations of capivasertib (500 nM and 750 nM), and 100 nM fulvestrant combined with 500 nM capivasertib. Cells were placed back on the Incucyte® and imaged for the subsequent 10 days with drug treatments. Media was replaced for fresh cell media with drugs after 4 days. Media was removed from plates as described above and plates were re-dosed with the same starting concentrations using the Tecan D300 digital dispenser (HP). Media was replaced again after 3 days using the same procedure and kept until the end of the assay.

[0323] CAMA-1 cells were treated with 400 nM of capivasertib monotherapy. Cells were placed back on the Incucyte® and imaged for the subsequent 7 days with drug treatments. Media was replaced for fresh cell media with drugs after 3 days and kept until the end of the assay. Media was removed from plates as described above and plates were re-dosed with the same starting concentrations using the Tecan D300 digital dispenser (HP).

[0324] For both cell lines, four field of view were acquired per well and the mean % of cell confluency per well was quantified using the Incucyte® Zoom analysis software; starting from day 1 (24h after reverse transfection) until the end of the assay after 13 days (MCF7 cells) or 10 days (CAMA-1 cells). The % of cell confluency across timepoints was normalised to day 1 after reverse transfection.

[0325] Proliferation results plotted in either growth curve (Figure 17 and 19) or bar plot with the cell confluency at the end of the study (Figure 18) show that:

[0326] • Acute knockout of KDM5C impacts proliferation / growth of MCF7 cells.

[0327] • Acute knockout of KDM5C sensitises MCF7 cells (PIK3CA E545K) to capivasertib monotherapy as well as the combination of fulvestrant and capivasertib. Acute knockout of KDM5C sensitises CAMA-1 cells (PTEN-null) to capivasertib monotherapy.

[0328] Example 4: KDM5 inhibition and drug combination studies

[0329] Experiments in this example were carried out to validate the drug sensitisation effect of KDM5 inhibition with CPI-48 compound in PIK3CA-mut and PTEN-null ER+ breast cancer cell lines (MCF7 and CAMA-1) as well as PIK3CA-mut cell lines resistant to fulvestrant or fulvestrant+palbociclib (MCF7 and T47D).

[0330] Proliferation assays with KDM5 inhibitor CPI-48: The following protocol was used to set up proliferation assays and analyse resultant data from Figures 20 to 30.

[0331] All cell lines were cultured in phenol red free RPMI supplemented with 5% Fetal Bovine Serum (FBS), IX Glutamax, 1 / 100 Pen / Strep (P / S), and incubate at 37 °C with 5% CO2. First, cells were resuspended from a T75 flasks by washing them with PBS at room temperature and incubating them 5 minutes with 2 mL of Accutase™. Cell suspension was collected in a falcon and counted using a Vi-CELL counter (Beckman). Resuspended cells stocks were diluted to an appropriate cell density with media to seed 50 pL / well in 384-well plates (Greiner #781090) using a Multidrop™ Combi with standard cassette. The following cell numbers / well were seeded: MCF7 parental and MCF7 100F P2 (600 cells / well), MCF7 ESRI (Y537S / - / -) (500 cells / well), T47D 100F1P Pl and T47D 100F1P P2 (1000 cells / well), and CAMA-1 (2000 cells / well). Cells were seeded in columns (3 columns per cell line), and each plate was duplicated to have technical replicates. Edge wells in the plate were excluded (Rows A & P; Columns 1 & 24). Each cell line had at least six DMSO wells per plate (a total of twelve with two replicate plates), and at least triplicate samples for each drug treatment and plate. Only fulvestrant and fulvestrant with palbociclib comprised of at least 1 sample for each cell line and plate. After cell seeding, plates were placed into an incubator until drug treatments. T47D 100F1 P Pl (figures 24, 26 and 30), T47D 100F1P P2 (figures 25, 27, 28 and 30), and CAMA-1 (figure 21) cells were treated with drugs 36 hours after seeding. Dimethyl sulfoxide (DMSO) was used as a vehicle to dilute drugs and as a neutral control. Cells were dosed with different treatments using the Tecan D300 digital dispenser (HP). Cells were treated with a 4-points dose response of CPI-48 (1, 5, 10, 15 pM), two concentrations of capivasertib (T47D: 400 nM and 600 nM; CAMA-1: 200 nM and 400 nM), two concentrations of Alpelisib (300 nM and 500 nM), 10 nM Everolimus, 100 nM fulvestrant, and 100 nM fulvestrant combined with 400 nM palbociclib. Cells were placed back into incubators and grown for 10 days with drugs. Media was replaced for fresh media with drugs after 2 days. Media was removed from plates using a Bravo automated liquid handling platform (Agilent) and 50 pL of fresh media was add immediately afterwards using the Multidrop™ Combi with a standard cassette at low speed. Cells were then dosed again with fresh DMSO and drugs at the same starting concentrations stated above. After 4 days, media was replaced again for fresh media with drugs following the same procedure.

[0332] MCF7 (figures 20 and 29), MCF7 100F P2 (figures 23 and 29) and MCF7 ESRI (Y537S / - / -) (figures 22 and 29) cells were treated with drugs 20 hours after seeding. Dimethyl sulfoxide (DMSO) was used as a vehicle to dilute drugs and as a neutral control. Cells were dosed with different treatments using the Tecan D300 digital dispenser (HP). Cells were treated with a 4-points dose response of CPI-48 (1, 5, 10, 15 pM), two concentrations of capivasertib (500 nM and 750 nM), 100 nM fulvestrant, and 100 nM fulvestrant combined with 400 nM palbociclib. Media was replaced for fresh media with drugs twice, after 3 days and after 7 days from first dosing, as described above for T47D and CAMA-1 cell lines.

[0333] After 10 days of continuous drug treatment, all proliferation assays were terminated by fixing cells with 50 pL of 8% paraformaldehyde (4% final) for 45 minutes at room temperature. Paraformaldehyde was removed and plates washed 4 times with 75 pL / well of PBS using a BioTek EL406 microplate washer. Plates were stored at 4 degrees.

[0334] To quantify cell numbers, cell nuclei were stained with Hoechst 33342 (ThermoFisher Scientific #H3570), imaged, and counted. Cells were permeabilised and blocked for 60 minutes at room temperature using modified blocking buffer (1 Litre: Sodium Chloride 8g, Potassium Chloride 0.2g, Disodium hydrogen phosphate 1.44g, Potassium dihydrogen phosphate 0.2g, 1.1% BSA 11g, 0.1% Triton X-100 lg, Deionised water). 20 pL of Hoechst dye diluted in modified blocking buffer at 1 / 2000 was added to plates using a Multidrop™ Combi with a small cassette at slow speed. Plates were incubated for 2 hours at room temperature protected from light. Then, plates were washed 4 times with 75 pL / well of PBS using a BioTek EL406 microplate washer. A Cell Voyager 7000 (Yokogawa) spinning disk confocal microscope was used to acquire images. Images were acquired with 2x2 binning using a lOx dry objective. 4 fields of view were acquired per well with an optimal z-position (lx z-stack). Images were analysed with Columbus™ Image analysis system (PerkinElmer). The analysis sequence to count cell nuclei involved the identification of nuclei using Hoechst intensity (Method A with common threshold 0.7 (T47D / CAMA-1 cells) or 0.3 (MCF7 cells) and splitting coefficient 4 (T47D / CAMA-1 cells) or 3 (MCF7 cells)). Objects in the border of the images were excluded, and morphology and intensity properties were calculated for remaining nuclear objects. Nuclei objects were filtered to remove artefacts: for T47D cells (Nucleus Area pm2> 60 and intensity <20000 and >350), for CAMA-1 cells (Nucleus Area pm2> 70 and intensity <20000 and >350), for MCF7 cells (Nucleus Area pm2> 70 and intensity <50000 and >350 and Roundness > 0.75). The cell count mean per well was normalised to the cell count mean for DMSO samples for each cell line within a plate and plotted as fold change to DMSO using Prism v8 (GraphPad). Statistical analysis was performed in Prism v8. One-way ANOVA with a Bonferroni's post-hoc test (ns = P > 0.05, * = P < 0.05, ** = P < 0.01, *** = P < 0.001) was used to calculate statistical difference between (A) CPI-48 monotherapy samples to DMSO, (B) CPI-48 combined with capivasertib, alpelisib or everolimus to capivasertib, alpelisib or everolimus monotherapies (figures 20 to 28), and (C) Parental cell line and resistance cell line (figures 29 and 30).

[0335] Proliferation assays showed that:

[0336] • Inhibition of KDM5 combines with capivasertib to impair growth of both PIK3CA-mut (MCF7) and PTEN-null (CAMA-1) ER+ breast cancer cell lines, (figures 20, 21).

[0337] • KDM5 inhibition show monotherapy activity in MCF7 and T47D cell models, both harboring PIK3CA E545K mutation (figures 20, 23-27).

[0338] • Inhibition of KDM5 combines with capivasertib and increases its anti-proliferative effects in cell models with lower sensitivity or resistance to fulvestrant and fulvestrant combined with palbociclib (figures 22-25).

[0339] • Inhibition of KDM5 combines with alpelisib as well as everolimus to impair growth of T47D cell models resistant to fulvestrant or its combination with palbociclib (figures 26-28).

[0340] • MCF7 Y537S mutant and 100F P2 cell lines are less sensitive to 100 nM fulvestrant than parental WT cell line (figure 29).

[0341] • T47D 100F1P Pl and T47D 100F1P P2 cell lines are insensitive to fulvestrant or its combination with palbociclib (figure 30).

Claims

CLAIMS1. A compound for use in the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, and the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.

2. A compound for use as claimed in claim 1, where the compound is an AKT inhibitor.

3. A compound for use as claimed in claim 1, where the compound is a PI3K-a inhibitor.

4. A compound for use as claimed in claim 1, where the compound is an mTOR inhibitor.

5. A compound for use as claimed in any of the preceding claims, where the administration of the compound and the KDM5C inhibitor is separate, sequential, or simultaneous.

6. A compound for use as claimed in any of the preceding claims, where the cancer is PTEN deficient.

7. A compound for use as claimed in any of the preceding claims, where the cancer comprises a PIK3CA mutation.

8. A compound for use as claimed in claim 7, where the PIK3CA mutation is selected from one or more of R88Q, N345K, C420R, E542K, E545A, E545D, E545Q, E545K, E545G, Q546E, Q546K, Q.546R, Q.546P, M1043V, M1043I, H1047Y, H1047R, H1047L and G1049R.

9. A compound for use as claimed in any of the preceding claims, where the cancer is breast cancer.

10. A compound for use as claimed in any of the preceding claims, where the cancer is advanced breast cancer or metastatic breast cancer.

11. A compound for use as claimed in claim 9 or 10, where the breast cancer is an estrogen receptor positive breast cancer.

12. A compound for use as claimed in any of the preceding claims, where the patient is a postmenopausal woman or a pre-menopausal woman.A compound for use as claimed in any of claims 9 to 12, where the breast cancer is resistant to treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator or an aromatase inhibitor. A compound for use as claimed in any of claims 9 to 13, where the patient's breast cancer has progressed during or after previous treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator and / or an aromatase inhibitor. A compound for use as claimed in claim 13 or 14, where the selective estrogen receptor degrader is selected from fulvestrant or a pharmaceutically acceptable salt thereof, amcenestrant or a pharmaceutically acceptable salt thereof, camizestrant or a pharmaceutically acceptable salt thereof and elacestrant or a pharmaceutically acceptable salt thereof. A compound for use as claimed in any of claims 13 to 15, where the selective estrogen receptor modulator is selected from tamoxifen or a pharmaceutically acceptable salt thereof, toremifene or a pharmaceutically acceptable salt thereof and raloxifene or a pharmaceutically acceptable salt thereof. A compound for use as claimed in any of claims 13 to 16, where the aromatase inhibitor is selected from anastrozole or a pharmaceutically acceptable salt thereof, letrozole or a pharmaceutically acceptable salt thereof and exemestane or a pharmaceutically acceptable salt thereof. A compound for use as claimed in any of claims 9 to 17, where the breast cancer is resistant to treatment with a CDK4 / 6 inhibitor. A compound for use as claimed in any of claims 9 to 18, where the breast cancer has progressed during or after previous treatment with a CDK4 / 6 inhibitor. A compound for use as claimed in claim 18 or 19, where the CDK4 / 6 inhibitor is selected from palbociclib or a pharmaceutically acceptable salt thereof, ribociclib or a pharmaceutically acceptable salt thereof and abemaciclib or a pharmaceutically acceptable salt thereof.A compound for use as claimed in any of claims 1, 2 or 5-20, where the AKT inhibitor is selected from miransertib (ARQ-092) or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, borussertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib (GSK2110183) or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof and ipatasertib (GDC-0068) or a pharmaceutically acceptable salt thereof. A compound for use as claimed in claim 21, where the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof. A compound for use as claimed in any of claims 1, 3 or 5-22, where the PI3K-a inhibitor is a PI3K- a selective inhibitor. A compound for use as claimed in claim 23, where the PI3K-a inhibitor is a PI3K-a specific inhibitor. A compound for use as claimed in claim 23 or claim 24 where the PI3K-a inhibitor is selected from alpelisib or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof and serabelisib or a pharmaceutically acceptable salt thereof. A compound for use as claimed in any of claims 1 or 4-25, where the mTOR inhibitor is an mTORCl inhibitor.A compound for use as claimed in claim 26, where the mTOR inhibitor is an mTORCl selective inhibitor. A compound for use as claimed in claim 26 or claim 27, where the mTOR inhibitor is selected from everolimus or a pharmaceutically acceptable salt thereof and temsirolimus or a pharmaceutically acceptable salt thereof. A compound for use as claimed in any of the preceding claims, where the KDM5C inhibitor is CPI-48 or a pharmaceutically acceptable salt thereof. A compound for use as claimed in any of the preceding claims, where the compound and KDM5C inhibitor are administered in combination with a SERD. A compound for use as claimed in claim 30, where the administration of the compound, the KDM5C inhibitor and the SERD is separate, sequential, or simultaneous. A compound for use as claimed in any of claims 30-31, where the compound and KDM5C inhibitor are administered in combination with fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof and palbociclib or a pharmaceutically acceptable salt thereof. A compound for use as claimed in claim 32, where the administration of the compound, the KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant a pharmaceutically acceptable salt thereof and palbociclib or a pharmaceutically acceptable salt thereof is separate, sequential, or simultaneous. The use of a compound in the manufacture of a medicament for the treatment of cancer, where the compound is administered in combination with a KDM5C inhibitor, and where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor. A method of treating cancer in a patient in need of such a treatment, comprising administering to the patient a therapeutically effective amount of a compound, where the compound is administered in combination with a therapeutically effective amount of a KDM5C inhibitor, and where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor.A method of treating cancer in a patient in need of such a treatment, comprising administering to the patient a first amount of a compound, and a second amount of a KDM5C inhibitor, where the first amount and the second amount together comprise a therapeutically effective amount, and where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor. A pharmaceutical composition comprising a compound, a KDM5C inhibitor, and a pharmaceutically acceptable excipient, where the compound is an AKT inhibitor, a PI3K-a inhibitor or an mTOR inhibitor. The pharmaceutical composition of claim 37, comprising fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof. The pharmaceutical composition of claim 38, comprising a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, where the compound is capivasertib or a pharmaceutically acceptable salt thereof. The pharmaceutical composition of claim 38 or claim 39, comprising palbociclib or a pharmaceutically acceptable salt thereof.