Composition and use thereof for the treatment of hereditary diseases

Abstract

The invention relates to a composition comprising - a first single-stranded nucleic acid molecule comprising a region complementary to a target and transposase recognition sites, - a second single-stranded nucleic acid molecule comprising a region complementary to a target and transposase recognition sites , and - a third single-stranded molecule comprising a sequence coding for a portion of the interleukin 2 gamma receptor (IL2-Rγ) or coding for the entire IL2-Rγ receptor, and transposase binding sites.

Description

Composition and its use for the treatment of hereditary diseases

[0001] The invention relates to a composition and its use for the treatment of hereditary diseases.

[0002] SCID-X or X-linked Severe Combined Immune Deficiency is caused by mutations in the IL2Rγ gene that cause immune system dysfunction, resulting in severe infections, fevers, and rashes.

[0003] The gamma subunit of the interleukin-2 receptor (IL2-Rγ), regulated by the IL2-Rγ gene, is common to many interleukin receptors (IL-2, IL-4, IL-7, IL-9, IL-15) and is present on the surface of hematopoietic stem cells. This protein, in association with others, is essential for the formation of lymphocytes. Thus, the mutation of the IL2Rγ gene leading to a blockage of the production of the IL2-Rγ receptor will also lead to a blockage of cell differentiation into lymphocytes, mainly T and Natural Killer (NK) lymphocytes. Similarly, the absence of T and NK lymphocytes in the body leads to an inactivation of the formed B lymphocytes.

[0004] This IL2Rγ gene is located on the X chromosome. Males with only one copy of this chromosome and therefore of the IL2Rγ gene are automatically affected by the disease in the event of a gene mutation. On the other hand, females with two copies of the gene are said to be "healthy carriers" and will only show symptoms of the disease in extremely rare cases.

[0005] Symptoms of SCID-X typically appear between 3 and 6 months of age. Most affected children experience growth delays, oral and genital rashes, and multiple persistent infections that can lead to death within 1 or 2 years if left untreated.

[0006] The prevalence of DICS-X is very difficult to assess due to a lack of diagnosis, but has been estimated at approximately 1 in 50,000 births.

[0007] The standard treatment is reconstitution of the immune system through bone marrow transplantation. The success rate of this approach is directly related to the level of compatibility between the bone marrow donor and the sick child. If the compatibility is high (usually the bone marrow comes from the patient's brother or sister), complete remission will be achieved in 20% of cases. However, in 80% of cases, the patient will develop more or less intense symptoms of GVHD (Graft Versus Host Disease), meaning that the immune cells in the transplanted bone marrow will attack the patient.

[0008] The alternative treatment is gene therapy based on the use of viruses (lentivirus or AAV), where the IL2Rγ gene is reintroduced into a sample taken from the patient's hematopoietic stem cells and then reinjected to repopulate the immune system. This approach, still in clinical trials, is effective in 80% of cases, but requires several extremely expensive treatment sessions and leads to the development of leukemia in 20% of cases due to the fact that this viral approach is not targeted and does not bring the new IL2Rγ gene to its original locus.

[0009] Patent application US20150152436A1 describes new therapeutic developments that aim to adapt the CRISPR / CAS9 genome editing approach to the treatment of SCID-X. However, the polymorphism associated with this pathology, as well as the possible insertion of the IL2Rγ gene cDNA of more than 600 base pairs, remains a significant technical obstacle for clinical use.

[0010] Also, the need to provide effective treatment remains.

[0011] One of the aims of the invention is to overcome the drawbacks of the prior art.

[0012] An aim of the invention is to provide a composition capable of enabling the replacement of the IL2Rγ gene in an efficient and complete manner.

[0013] Another aim of the invention is to provide a method or a medicament capable of treating pathologies linked to the deficiency of said gene.

[0014] The invention relates to a composition comprising:

[0015] - a first single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence being linked in 5' to a first T-rich sequence 40 to 60 nucleotides long and in 3' to a second T-rich sequence 40 to 60 nucleotides long, said first and second T-rich sequences respectively comprising a first and a second domain of 6 to 12 nucleotides rich in G / C, the sequence of the first domain being complementary to the sequence of the second domain, said first and second domains being positioned 15 to 52 nucleotides from said sequence A,said first molecule comprising at its 5' end at least a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second sequence for recognizing said transposase,

[0016] - a second single-stranded nucleic acid molecule comprising or consisting essentially of a sequence B allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence B being linked in 5' to a third T-rich sequence 40 to 60 nucleotides long and in 3' to a fourth T-rich sequence 40 to 60 nucleotides long, said third and fourth T-rich sequences respectively comprising a third and fourth domain of 6 to 12 nucleotides rich in G / C, the sequence of the third domain being complementary to the sequence of the fourth domain, said third and fourth domains being positioned 15 to 52 nucleotides from said sequence B,said second molecule comprising at its 5' end at least the first 5'-3' oriented recognition sequence of said transposase and at its 3' end the second recognition sequence of said transposase,

[0017] said sequence B being a complementary sequence to said nucleic acid of interest, sequence A being positioned 5' of a region of interest of said nucleic acid of interest and sequence B positioned 3' of the region of interest of said nucleic acid of interest, and

[0018] - a third single-stranded molecule comprising

[0019] * in its 5' part, at least one sequence complementary to said second recognition sequence of said transposase of the first molecule,

[0020] * in its 3' part at least one sequence complementary to said first recognition sequence of said transposase of the second molecule, and

[0021] * an intermediate region located between the complementary sequence of said second recognition sequence of said transposase of the first molecule and the complementary sequence of said first recognition sequence of said transposase of the second molecule, said intermediate region comprising a sequence coding a part of the interleukin 2 gamma receptor or IL2-Rγ, or coding the complete IL2-Rγ receptor,

[0022] the first and third single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase and the second and third single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase.

[0023] The invention is based on the observation made by the inventors that the use of a molecule complex as described above, and involving a bacterial transposase, allows targeted and effective replacement of the IL2Rγ gene, which codes for IL2-Rγ.

[0024] This means that the invention relates to a molecular complex comprising a first single-stranded nucleic acid molecule, a second single-stranded nucleic acid molecule and a third single-stranded nucleic acid molecule, said third single-stranded nucleic acid molecule comprising or consisting essentially at its 5' end of at least one sequence complementary to said first recognition sequence of said transposase, and said third single-stranded nucleic acid molecule comprising or consisting essentially at its 3' end of at least one sequence complementary to said second recognition sequence of said transposase,

[0025] said complex being such that the first, second and third single-stranded nucleic acid molecules are paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites for said transposase in the 5' end of the third molecule and two double-stranded binding sites for said transposase in the 3' end of the third molecule.

[0026] The invention is based on the unexpected observation made by the inventor that the use of specific single-stranded guides capable of targeting a region of a nucleic acid of interest makes it possible to mobilize transposases in a controlled and "site-specific" manner, and thus use the recombination properties of said transposases to carry out sequence replacement in molecules of interest.

[0027] The aforementioned molecular complex is in fact the basic unit of the technology defined in the invention. This basic unit serves to guide the recombinases to a specific site where recombination, and therefore sequence replacement, must take place. Unlike the CRISPR / Cas9 system, which requires the presence of PAM-like sequences (NGG), the molecular tool defined here can be used on any target sequence, regardless of its sequence.

[0028] The aforementioned molecular complex is therefore the basic unit which will have to be completed by:

[0029] - a region homology to a 5' region of the target sequence, said homology region being represented by the sequence A and

[0030] - a region homology to a 3' region of the target sequence, said homology region being represented by sequence B.

[0031] This is therefore an intermediate product of the tool as described below.

[0032] The molecular complex consists of three single-stranded nucleic acid molecules, which can be DNA molecules, RNA molecules, or mixed RNA and DNA molecules.

[0033] These three molecules are partially complementary to each other two by two, according to the complementarity of nucleic acid bases defined by Watson and Crick, that is to say that an Adenine pairs with a Thymidine or a Uracil, and a Cytosine pairs with a Guanine, and vice versa.

[0034] More particularly, the three molecules forming the aforementioned complex each comprise the sequence of one of the strands of a double-stranded molecule corresponding to the binding sequence of a transposase. Also, each single-stranded molecule therefore comprises a “half sequence” of transposase binding and therefore cannot allow interaction with said corresponding transposase. On the other hand, when the three molecules of the complex interact together, by base pairing as defined above, a double-stranded molecule is thus formed, reconstituting a double-stranded binding site of said transposase, the latter thus being able to interact with the molecule formed.

[0035] The complex

[0036] In addition to the detailed definition of each of the first, second and third molecules, each described below, the complex according to the invention is such that it comprises two pairs of binding sites for one or more transposases, a first pair of binding sites for a first transposase due to pairing according to the complementarity of the nucleic acid bases defined by Watson and Crick between the first single-stranded nucleic acid molecule and the third nucleic acid molecule, and a second pair of binding sites for a second transposase due to pairing according to the complementarity of the nucleic acid bases defined by Watson and Crick between the second single-stranded nucleic acid molecule and the third nucleic acid molecule.

[0037] the first and second transposase may be the same or different.

[0038] Each transposase binding site consists of two double-stranded motifs, a first double-stranded motif composed of a first half transposase binding site and a sequence complementary, according to the base complementarity defined by Watson and Crick, to said first half transposase binding site, and a second double-stranded motif composed of a second half transposase binding site and a sequence complementary, according to the base complementarity defined by Watson and Crick, to said second half transposase binding site.

[0039] In the invention, with regard to the complementary sequence of a half-site for binding to a transposase, we will speak of a half-site complementary to said site.

[0040] Therefore, a transposase binding site consists of four half-sites:

[0041] - a first half transposase binding site presenting a first sequence,

[0042] - a second half transposase binding site with a second sequence,

[0043] - a third half-site which presents a complementary sequence according to the complementarity of the bases defined by Watson and Crick, of the sequence of the first half-site and

[0044] - a fourth half-site which presents a complementary sequence according to the complementarity of the bases defined by Watson and Crick of the sequence of the second half-site.

[0045] Also, in the complex there will be 8 binding sites, four of them constituting the first pair of binding sites by pairing of the first and third nucleic acid molecules, and the other four constituting the second pair of binding sites by pairing of the second and third nucleic acid molecules.

[0046] Note that for the first pair of transposase binding sites, the four half-binding sites are such that the first half-site and the second half-site are contained in the first nucleic acid sequence, the complementary site of the second half-site is included in the third nucleic acid sequence,

[0047] their positions in the complex are therefore defined, and the complementary site of the first half-site is i) either included in the first nucleic acid molecule, ii) or included in the third nucleic acid molecule

[0048] it is therefore not necessary to define its position in one (first) or the other (third) nucleic acid molecule, the essential thing being that when the first and third nucleic acid molecules are paired according to the base complementarity defined by Watson and Crick, the two half-sites are reconstituted, that is to say that the first half-site is paired with the half-site complementary to the first half-site and that the second half-site is paired with the half-site complementary to the second half-site.

[0049] It will also be noted that for the second pair of transposase binding sites, the four half-binding sites are such that the first half-site and the second half-site are contained in the second nucleic acid sequence, the complementary site of the first half-site is included in the third nucleic acid sequence,

[0050] their positions in the complex are therefore defined, and the complementary site of the second half-site is i) either included in the second nucleic acid molecule, ii) or included in the third nucleic acid molecule

[0051] it is therefore not necessary to define its position in one (second) or the other (third) nucleic acid molecule, the essential thing being that when the second and third nucleic acid molecules are paired according to the base complementarity defined by Watson and Crick, the two half-sites are reconstituted, that is to say that the first half-site is paired with the half-site complementary to the first half-site and that the second half-site is paired with the half-site complementary to the second half-site.

[0052] The first molecule.

[0053] The first molecule of the complex is the molecule that will include, once modified, a nucleic acid sequence that will allow to specifically target a region of interest of a nucleic acid molecule of interest. This sequence of interest will be chosen by the user of the system according to the chosen target. This sequence of interest will be inserted into the first molecule of said complex at the level of region A. This region A corresponds at least to two nucleic acids between which will be inserted the sequence allowing to target the target molecule. In view of the oriented structure of the nucleic acids (5'-3' direction), it is important that the sequence allowing to target the region of interest is positioned in the right direction, so that the pairing is possible with the target sequence.

[0054] Also, advantageously, region A comprises one or more sites recognizing restriction enzymes in order to promote oriented insertion. One or more of the following sites may be present in region A:

[0055] AA / CGTTAclIA / AGCTTHindIIIAAT / ATTSspI / AATTMluCIA / CATGTPciIA / CCGGTAgeIACCTGC(4 / 8)BfuAI BspMIA / CCWGGTSexAIA / CGCGTMluIACGGC(12 / 14)BceAIA / CGTHpyCH4IVACN / GTHpyCH4IIISEQ ID NO :4(10 / 15)ACNNNNGTAYC(12 / 7)BaeISEQ ID NO :5(9 / 12)ACNNNNNCTCC(10 / 7)BsaXIA / CRYGTAflIIIA / CTAGTSpeIACTGG(1 / -1)BsrIACTGGG(5 / 4)BmrIA / GATCTBglIIAGC / GCTAfeIAG / CTAluIAGG / CCTStuIAGT / ACTScaI-AT / CGATClaI BspDISEQ ID NO :6ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15 / -19)PI-SceIATGCA / TNsiIAT / TAATAseIATTT / AAATSwaISEQ ID NO :7(11 / 13)CAANNNNNGTGG(12 / 10)CspCIC / AATTGMfeICACCTGC(4 / 8)PaqCICACGAGNb.BssSICACGAG(-5 / -1)BssSI-v2CACGTC(-3 / -3)BmgBICAC / GTGPmlICACNNN / GTGDraIIISEQ ID NO :8CACNN / NNGTGAleI-v2CAGCAG(25 / 27)EcoP15ICAG / CTGPvuIICAGNNN / CTGAlwNICAGTG(2 / 0)BtsIMutICA / TATGNdeICATG / NlaIII / CATGFatIC / ATGCviAIISEQ ID NO :9CAYNN / NNRTGMslICC(12 / 16)FspEISEQ ID NO :10CCANNNNN / NNNNTGGXcmISEQ ID NO :11CCANNNNN / NTGGBstXISEQ ID NO :12CCANNNN / NTGGPflMICCATC(4 / 5)BccIC / CATGGNcoICCCAGC(-5 / -1)BseYICCCGC(4 / 6)FauICCC / GGGSmaIC / CCGGG(0 / -1)CCDTspMI XmaI Nt.CviPIICCDG(10 / 14)LpnPICCGC(-3 / -1)AciICCGC / GGSacIICCGCTC(-3 / -3)BsrBIC / CGGMspI HpaIICC / NGGScrFI / CCNGGStyD4IC / CNNGGBsaJISEQ ID NO :13CCNNNN / NNGGBslIC / CRYGGBtgICC / SGGNciIC / CTAGGAvrIICCTC(7 / 6)MnlICCTCAGCNb.BbvCICCTCAGC(-5 / -7)Nt.BbvCICCTCAGC(-5 / -2)BbvCICCTGCA / GGSbfICCTNAGC(-5 / -2)Bpu10ICC / TNAGGBsu36ISEQ ID NO. :14CCTNN / NNNAGGEcoNICCTTC(6 / 5)HpyAV / CCWGGPspGICC / WGGBstNIC / CWWGGStyISEQ ID NO :15(10 / 12)CGANNNNNTGC(12 / 10)BcgICGAT / CGPvuICG / CGBstUIC / GGCCGEagICG / GWCCGRsrIICGRY / CGBsiEIC / GTACGBsiWI CGTCTCBsmBI-v2CGTCTC(1 / 5)Esp3ICGWCG / Hpy99ICMG / CKGMspA1ISEQ ID NO. :16CNNNNNNNNNNN / NNNNNNNNNGAbaSICNNR(9 / 13)MspJICR / CCGGYGSgrAIC / TAGBfaICTCAG(9 / 7)BspCNIC / TCGAGXhoI PaeR7ICTCTTC(1 / 4)EarICTGAAG(16 / 14)AcuICTGCA / GPstICTGGAG(16 / 14)BpmIC / TNAGDdeIC / TRYAGSfcIC / TTAAGAflIICTTGAG(16 / 14)BpuEIC / TYRAGSmlIC / YCGRGBsoBI AvaIGAAGA(8 / 7)MboIIGAAGAC(2 / 6)BbsI SEQ ID NO :17GAANN / NNTTCXmnIGAATGC(1 / -1)BsmIGAATGCNb.<h2 style=";text-align:left;direction:ltr">BsmIG / AATTCEcoRIGACGC(5 / 10)HgaIGACGT / CAatIIGAC / GTCZraIGACN / NNGTCPflFI Tth111ISEQ ID NO :18GACNN / NNGTCPshAISEQ ID NO :19GACNNN / NNGTCAhdISEQ ID NO :20GACNNNN / NNGTCDrdIGAG / CTCEco53kIGAGCT / CSacIGAGGAG(10 / 8)BseRIGAGTC(4 / -5)Nt.BstNBIGAGTC(4 / 5)PleIGAGTC(5 / 5)MlyIG / ANTCHinfIGAT / ATCEcoRVGA / TCDpnI / GATCSau3AI DpnII MboISEQ ID NO ID NO:21GATNN / NNATCBsaBIG / AWTCTfiIGCAATGNb.BsrDIGCAATG(2 / 0)BsrDIGCAGC(8 / 12)BbvIGCAGTG(2 / 0)BtsI-v2GCAGTGNb. :22GCANNNN / NTGCBstAPIGCATC(5 / 9)SfaNIGCATG / CSphIGCCC / GGGCSrfIGCCGAG(21 / 19)NmeAIIIG / CCGGCNgoMIVGCC / GGCNaeISEQ ID NO :23GCCNNNN / NGGCBglIGCGAT / CGCAsiSIGCGATG(10 / 14)BtgZIGCG / CHhaIG / CGCHinP1IG / CGCGCBssHIIGC / GGCCGCNotIGC / NGCFnu4HIGCN / NGCCac8ISEQ ID NO: :24GCNNNNN / NNGCMwoIG / CTAGCNheIGCTAG / CBmtIGCTCTTC(1 / -7)Nt.AlwIG / GATCCBamHI GGATG(9 / 13)FokIGGATG(2 / 0)BtsCIGG / CCHaeIIIGGCCGG / CCFseISEQ ID NO :25GGCCNNNN / NGGCCSfiIG / GCGCCKasIGG / CGCCNarIGGCGC / CPluTIGGC / GCCSfoIGG / CGCGCCAscIGGCGGA(11 / 9)EciIGGGA C(10 / 14)BsmFIGGGCC / CApaIG / GGCCCPspOMIG / GNCCSau96IGGN / NCCNlaIVG / GTACCAcc65IGGTAC / CKpnIGGTCTC(1 / 5)BsaI v2GGTGA(8 / 7)HphIG / GTNACCBstEII G / GWCCAvaIIG / GYRCCBanIGKGCM / CBaeGIGR / CGYCBsaHIGRGCY / CBanIIGT / ACRsaIG / TACCviQIGTATACBstZ17IGTATCC(6 / 5)BciVIG / TCGACSalIGTATC(1mBTC) BcoDIGTCTC(1 / -5)Nt.BsmAIG / TGCACApaLIGTGCAG(16 / 14)BsgIGT / MKACAccIGTN / NACHpy166II / GTSACTsp45IGTT / AACHpaIGTTT / AAACPmeIGTY / RACHincIIGWGCW / CBsiHKAINNCASTGNN / TspRIR / AATTYApo RCATG / YNspIR / CCGGYBsrFI-v2R / GATCYBstYIRGCGC / YHaeIIRG / CYCviKI-1RG / GNCCYEcoO109IRG / GWCCYPpuMISEQ ID NO :26TAACTATAACGGTCCTAAGGTAGCGAA(-9 / -13)GTABISEQ / GTACI / GTABISEQ ID NO :27TAGGGATAACAGGGTAAT(-9 / -13)I-SceIT / CATGABspHIT / CCGGABspEITCCRAC(20 / 18)MmeIT / CGATaqI-v2TCG / CGANruITCN / GAHpy188ITC / NNGAHpy188IIIT / CTAGAXbalcITC / GATCABcITC TG / CAHpyCH4VTGC / GCAFspISEQ ID NO :28TGGCAAACAGCTATTATGGGTATTATGGGT(-13 / -17)PI-PspITGG / CCAMscIT / GTACABsrGI T / TAAMseITTAAT / TAAPacITTA / TAAPsiI-v2TT / CGAABstBITTT / AAADraIVC / TCGAGBPspXIW / CCGGWBsaWIYAC / GTRBsaAIY / GGCCREaeI.

[0056] Obviously, in the context of a chemical synthesis of the first molecule, it is not necessary to have cloning (or insertion) sites for the sequence allowing the target region to be targeted, but to take the precaution of providing a correctly oriented sequence. This is obviously possible, however.

[0057] The first molecule is furthermore made up on either side of the A region, of sequences rich in A / T, or if it is RNA in A / U, in order to allow a certain flexibility of the structure. By rich in A / T, or in A / U, is meant in the invention a sequence which comprises more than 50% of A or T, or U, preferably more than 50% of T or U, relative to the total number of nucleotides constituting the sequence. These sequences on either side of the A region have a size in nucleotides varying from 10 nucleotides to 60 nucleotides.

[0058] The flexibility of these flanking sequences of the A region, due to the presence of numerous A, T or U, can have the effect of allowing recombination via recombinases that are too poorly controlled, or even when the complex has not yet recognized the target molecule.

[0059] Also, in order to overcome this problem, G / C-rich sequences are introduced into each of the A / T-rich sequences, particularly those rich in T, or A / U, bordering the A region. These G / C-rich regions are made up of 6 to 12 nucleotides, the quantity of C or G or G+C of which is greater than 50% of the nucleotides contained in said G / C-rich sequence.

[0060] To stabilize the structure of the first molecule, and as described above to avoid untimely recombination, the G / C-rich regions are positioned 15 to 52 nucleotides from the end of the A region.

[0061] For clarity, if region A consists of 3 nucleotides, with the central nucleotide corresponding to position 0, the A / T or A / U rich region will start on the left at position -2, and on the right at position +2. Therefore, on the left side, the G / C rich region will be positioned from position -17 to position -54, and on the right side from position +17 to position +54.

[0062] Another important element is that the G / C-rich sequence to the right (or 5') of region A is necessarily complementary (according to the Watson and Crick pairing principle) to the G / C-rich region of the region to the right (or 3') of region A. Also, the first single-stranded molecule pairs with itself at the G / C-rich regions, which prevents any recombination by transposases, as long as there is no interaction with the complementary target sequence of the region that will be inserted into region A of the first molecule.

[0063] Finally, the first molecule comprises at its 5' end a sequence corresponding to a first binding site for a transposase, and at its 3' end a second binding site for said transposase.

[0064] The first binding site and the second binding site are advantageously the same, and above all both correspond to the same strand of the double-stranded binding site of said transposase. This means that the first transposase binding site present in the 5' region of the first molecule cannot pair completely, and therefore stably, with the transposase binding site present in the 3' region.

[0065] The first binding site and the second binding site are advantageously the same, but each correspond to a different strand of the double-stranded transposase binding site. Also, for example, if the first transposase binding site corresponds to the sense strand, the second transposase binding site corresponds to the sequence of the complementary strand. It is then possible to have two configurations: i) either the second binding site which corresponds to the complementary strand is oriented in the 3'-5' direction, in which case it will be able to pair with the first transposase binding site and form the double-stranded site, ii) or the second binding site which corresponds to the complementary strand is oriented in the 5'-3' direction, and in which case will not be able to pair with the first transposase binding sequence, the sequences, due to their orientation, not being complementary.In the above-mentioned case i), if the first single-stranded molecule self-pairs at the first and second binding sites, it will not be possible to form the above-mentioned complex, because there will no longer be a single-stranded complementary region available to pair with the second molecule so as to form two double-stranded transposase binding sites.

[0066] Also, the first molecule, when it lacks a sequence complementary to the target region in part A, or when it contains such a target sequence but the latter does not interact (does not pair) with said target sequence, forms a three-dimensional structure where the entire molecule is single-stranded except for the region corresponding to the G / C-rich regions which pair with each other.

[0067] A schematic representation of the paired form is shown in Figures 1A to 1E.

[0068] The second molecule.

[0069] The second molecule of the complex is structurally similar to the first molecule. The above explanations therefore apply mutatis mutandis. However, in the second molecule, the B region (or B sequence) and the transposase binding sites are organized differently.

[0070] First of all, region B is different from region A of the first molecule. Indeed, for the purpose of oriented recombination, there cannot be competition for the same target of interest between the first and second molecules.

[0071] Also, it is necessary that region B corresponds to a second sequence complementary to the target sequence, this second sequence complementary to the target sequence being positioned 3' relative to the first sequence recognized by the complementary sequence corresponding to sequence A of the first molecule.

[0072] Therefore, when the first molecule and the second molecule are paired with the target sequence, the target sequence will be flanked by these two molecules, the first molecule being located at the 5' end and the second molecule being positioned at the 3' end. The region of the target sequence located between the region of interaction with the first molecule and the region of interaction with the second molecule corresponds to the sequence that will be replaced by that of the third molecule.

[0073] The third molecule

[0074] The third molecule of the above-mentioned complex is simpler than the first two (the first and second molecules). The third molecule has a transposase binding site in its 5' portion that is complementary to the transposase binding site in the 3' portion of the first molecule. Therefore, when the complex is formed, the 3' ½ transposase binding site (single strand) of the first molecule could pair with the 5' ½ transposase binding site (single strand) of the second molecule to form a double stranded transposase binding site, a double stranded site to which the transposase can attach.

[0075] In the 3' portion of the third molecule there is a transposase binding site that is complementary to the transposase binding site in the 5' portion of the second molecule. Therefore, when the complex is formed, the 3' ½ transposase binding site (single strand) of the third molecule could pair with the 5' ½ transposase binding site (single strand) of the second molecule to form a double stranded transposase binding site, a double stranded site to which the transposase can attach.

[0076] Between the 5' portion which comprises a ½ transposase binding site and the 3' portion which comprises a ½ transposase binding site, the third molecule comprises a replacement sequence, i.e. the sequence which will eventually replace the target sequence. This replacement sequence is bordered in 5' by at least one restriction site and in 3' by at least one restriction site; these two restriction sites being distinct. Also, the third molecule comprises in the 5' to 3' direction: a ½ transposase binding site complementary to the transposase binding site of the first molecule, followed by at least one restriction site, followed by the replacement sequence, followed by at least one restriction site different from the restriction site upstream of the replacement sequence, followed finally by a ½ transposase binding site complementary to the transposase binding site of the second molecule.

[0077] The replacement sequence corresponds to all or part of the gene coding for the IL2-Rγ protein, i.e. all or part of the ILR2γ gene.

[0078] The common gamma chain (γc) (or CD132), is also known as the interleukin-2 receptor gamma subunit or IL-2RG, or IL2-Rγ. It is a cytokine receptor subunit that is common to the receptor complexes of at least six different interleukin receptors: interleukin 2 (IL-2), interleukin 4 (IL-4), interleukin 7 (IL-7), interleukin 9 (IL-9), interleukin 15 (IL-15), and the interleukin-2 receptor1. This chain is a glycoprotein that is a member of the type I cytokine receptor family expressed on most lymphocyte populations. The ILR2γ gene is found on the X chromosome of mammals.

[0079] IL2-Rγ is expressed on the surface of immature blood cells in the bone marrow. One end of the protein resides outside the cell where it binds to cytokines, and the other end of the protein resides inside the cell where it transmits signals to the cell nucleus. The common gamma chain combines with other proteins to direct hematopoietic cells to form lymphocytes. The receptor also directs the growth and maturation of lymphocyte subtypes: T cells, B cells, and natural killer (NK) cells.

[0080] The composition according to the invention makes it possible to obtain the complex described above. It schematically illustrates the complex formed between the first, second and third molecules according to the invention.

[0081] The complex formed from the molecules of the composition of the invention, when the three molecules are correctly paired, comprises two pairs of double-stranded binding sites for recognition of a transposase:

[0082] - the first pair being obtained by the hybridization of the first molecule with the third molecule, and

[0083] - the second pair being obtained by the hybridization of the second molecule with the third molecule.

[0084] Sequence A in the first molecule is complementary to the same strand of nucleic acid that is complementary to sequence B in the second molecule. In other words, sequence A in the first molecule and sequence B in the second molecule are able to hybridize to the same nucleic acid simultaneously, because the two sequences A and B do not recognize the same sequence.

[0085] To further clarify the subject, the interest in the present invention is to provide a first molecule and a second molecule, both as defined above, the respective sequences A and B being such that they are capable of recognizing for one, a sequence located 5' of the target sequence of the nucleic acid of interest and for the other, a sequence located 3' of the same target sequence of the nucleic acid of interest. The sequences A and B are therefore complementary to regions bordering the sequence of interest, which it is desired to replace, of the nucleic acid molecule of interest.

[0086] The first and second molecules of interest are therefore essential to specifically target the molecule of interest, in order to frame the sequence to be replaced.

[0087] The third molecule in the set, for its part, is the one that provides the nucleic acid molecule that contains the replacement sequence, i.e. a sequence corresponding to all or part of the gene coding for IL2-Rγ.

[0088] From a mechanistic point of view, the complex according to the invention is such that it consists of its three molecules, the first and second molecules being structurally organized in space so that their G / C-rich regions are paired.

[0089] On either side of the third molecule, i.e. 5' and 3', due to hybridization with the first and second molecules, two pairs of transposase binding sites allow, when present, transposase dimers to bind to the whole.

[0090] Note that the transposase binding sites of the first molecule may be the same as those of the second molecule, or they may be different. In the case where the binding sequences are the same, the transposase dimers at the 5' end of the third molecule (by hybridization of the 5' part of the third molecule with the first molecule), and at the 3' end of the third molecule (by hybridization of the 3' part of the third molecule with the second molecule) will be the same. Also, as an example, if the binding sites are all Tn5 transposase binding sites, the whole will be associated with 2 Tn5 transposase dimers.

[0091] It is also possible that the binding sites of the first molecule and the second molecule do not recognize the same transposase. In this case, and according to the definition given above, the 5' part of the third molecule will form, by hybridization with the first molecule, two double-stranded binding sites for a first transposase, and the 3' part of the third molecule will form, by hybridization with the second molecule, two double-stranded binding sites for a second transposase.

[0092] If now the above-mentioned complex, linked to two transposase dimers, is placed in the presence of a nucleic acid molecule of interest whose 5' part is complementary to the sequence A of the first molecule of the set and whose 3' part is complementary to the sequence B of the second molecule of the set, then there will be pairing between the nucleic acid molecule of interest and the set at the level of the regions A and B described above. This interaction will have the consequence of breaking the interaction of the two G / C-rich sequences of each of the first and second molecules of the set.From then on, the third molecule and the nucleic acid molecule of interest will be brought closer together spatially and the transposases will be able to carry out their tagmentation activity, the result of which will be the replacement of the sequence of the molecule of interest, bordered by the complementary sequences of sequences A and B, by the sequence of the third molecule of the set, which is located between the 5' and 3' transposase binding half-sites.

[0093] In the invention, the first, second and third molecules of the set are advantageously molecules consisting of deoxyribonucleotides, in order to form single-stranded DNA molecules.

[0094] Even more advantageously, the first, second and third molecules of the set are DNA / RNA hybrid molecules, where the "backbone" of the molecules is DNA, and the recognition sequences A and B of the nucleic acid molecule of interest, and the central region of the third molecule are RNA. This is particularly advantageous when the sequence replacement that the invention allows must be done directly on an RNA molecule.

[0095] La-A illustrates the interaction between the molecule of interest and the assembly according to the invention.

[0096] Advantageously, the invention relates to the aforementioned complex, where said first molecule or said second molecule, or both is / are coupled to an enzyme, in particular by means of a modified nucleotide. The purpose of this enzyme is to promote the replacement of the molecule of interest. It may be:

[0097] - a helicase, an enzyme capable of opening a double-stranded molecule which would be supercoiled or associated with proteins such as histones,

[0098] - a topoisomerase, an enzyme acting on the topological structure of DNA by generating transient cuts,

[0099] - a ligase which allows a phosphodiester bond to be formed between a 5' phosphate end of a nucleotide and the 3' OH end of another nucleotide,

[0100] - a polymerase, which will synthesize a nucleic acid molecule from an initiation site, free 3'OH, in the 5'-> 3' direction, in particular by copying an antiparallel complementary strand according to the Watson and Crick model.

[0101] It is also possible to combine two or more of said enzymes to provide all the enzymatic material necessary to enable the sequence replacement provided for within the scope of the invention.

[0102] In a particular aspect of the invention, the first molecule of the set may contain in its 5' portion, more precisely between the first transposase binding site and region A, one or more modified nucleotides. In the same way, the third molecule of the set may contain in its 3' portion, more precisely between the first transposase binding site and region 3, one or more modified nucleotides.

[0103] This modified nucleotide is notably modified by grafting a carbon chain substituted with a protein tag, outagen, or even a molecule allowing a specific interaction such as streptavidin or biotin.

[0104] Such modifications then make it possible to specifically bind, to the first molecule of the set, enzymes that can be used to promote tagmentation and sequence replacement. It will be particularly advantageous to have, for example, a streptavidin graft, which will allow the grafting of a biotinylated helicase (inversely helicase grafted with streptavidin and biotinylated nucleotide) used to open a double-stranded molecule. It is also possible to consider grafting with a biotinylated ligase (or coupled with streptavidin), in order to connect the recombinant strand on the 3' side.

[0105] It is also possible to associate with the first molecule or the second molecule of the set an oligonucleotide, so that said oligonucleotide will pair with a predetermined region of said first or second molecule. This oligonucleotide is then advantageously coupled to a grafting molecule as explained above.

[0106] Advantageously, the invention relates to the above-mentioned composition, wherein said sequence A comprises a sequence complementary to the sequence of a first region of the gene encoding IL2-Rγ, and wherein said sequence B comprises a sequence complementary to the sequence of a second region of the gene encoding IL2-Rγ, said sequence A and said sequence B being two different sequences, said first and second regions of the gene encoding IL2-Rγ, flanking a region comprising a sequence encoding a part of IL2-Rγ, or encoding the complete IL2-Rγ receptor.

[0107] As explained above, in order to carry out the replacement of the target gene by the third molecule, it is advantageous that the sequences of part A of the first molecule and part B of the second molecule are capable of:

[0108] - to recognize the same target molecule, and

[0109] - to frame the target region to be replaced, which means that the first molecule must, via its A region, recognize a sequence upstream of the sequence to be replaced of the target molecule and the second molecule must, via its B region, recognize a sequence downstream of the sequence to be replaced of the target molecule, or vice versa, i.e. the first molecule must, via its A region, recognize a sequence downstream of the sequence to be replaced of the target molecule and the second molecule must, via its B region, recognize a sequence upstream of the sequence to be replaced of the target molecule.

[0110] It is thus possible to replace any target sequence with any replacement sequence, as long as the sequences A and B respectively of the first and second molecules recognize the target region and frame it.

[0111] In the invention it is particularly advantageous that all or part of the gene coding for IL2-Rγ is replaced by the sequence of the third molecule. This is particularly advantageous when the target sequence is a sequence which comprises one or more mutations compared to the wild-type reference sequence, for example, a substitution of one or more nucleotides, contiguous or spaced, a deletion of one or more nucleotides, contiguous or spaced, or an insertion of one or more nucleotides, contiguous or spaced.

[0112] The entire gene coding for IL2-Rγ means the entire sequence of said gene including the 5', 3' regulatory elements, exons and introns.

[0113] By "parts of the gene coding for IL2-Rγ" is meant in the invention an element of the gene which does not allow the IL2-Rγ protein to be fully coded. This may be, without limitation, an intro, an exon, several introns and exons without the entire translational unit being complete... It may be particularly advantageous to replace only a part of the gene coding for IL2-Rγ, for example to replace only a single exon within which there is a mutation. In this case, it could be advantageous to choose a sequence complementary to region A of the first molecule in the intron preceding the sequence to be replaced, and a part complementary to region B in the intron following the exon to be replaced. Obviously, the person skilled in the art will know, depending on the substitution that wishes to be carried out, whether to choose the entire gene or a part of the gene, and thus to define the most relevant regions A and B.

[0114] Advantageously, the invention relates to the composition as defined above, where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognition of a transposase and at its 3' end a second 5'-3' oriented sequence for recognition of said transposase and

[0115] where the third molecule comprises at its 5' end a first sequence complementary to said first recognition sequence of said transposase of the first molecule followed by a second sequence complementary to said second recognition sequence of said transposase of the first molecule.

[0116] More advantageously, the invention relates to the composition as defined above, where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second 5'-3' oriented sequence for recognizing said transposase,

[0117] said second molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second 5'-3' oriented sequence for recognizing said transposase, and

[0118] where the third molecule comprises at its 5' end a first sequence complementary to said first recognition sequence of said transposase of the first molecule followed by a second sequence complementary to said second recognition sequence of said transposase of the first molecule and at its 3' end a first sequence complementary to said first recognition sequence of said transposase of the second molecule followed by a second sequence complementary to said second recognition sequence of said transposase of the second molecule.

[0119] Here a possible format of the first and second molecules of the invention is defined. This configuration is shown schematically in. Obviously, in the context of this example of configuration of the first, second and third molecules, between the two half transposase sites of the 5' and 3' parts of the third molecule is the replacement sequence, here, all or part of the gene coding for IL2-Rγ.

[0120] Advantageously, the invention relates to the above-mentioned composition, where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second sequence for recognizing said transposase, followed by a first sequence complementary to said first sequence for recognizing said transposase of the first molecule and

[0121] where the third molecule comprises at its 5' end a sequence complementary to said second recognition sequence of said transposase of the first molecule.

[0122] Even more advantageously, the invention relates to the above-mentioned composition, where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second sequence for recognizing said transposase, followed by a first sequence complementary to said first sequence for recognizing said transposase of the first molecule,

[0123] the second molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second sequence for recognizing said transposase, said first sequence for recognizing said transposase of the 5' end being preceded by a second sequence complementary to said second sequence for recognizing said transposase of the first molecule,

[0124] And

[0125] where the third molecule comprises at its 5' end a sequence complementary to said second recognition sequence of said transposase of the first molecule and at its 3' end a sequence complementary to said first recognition sequence of said transposase of the second molecule.

[0126] Here another possibility of format of first and second molecules of the invention is defined. This configuration is schematized in and in. Obviously, within the framework of this example of configuration of the first, second and third molecules, between the two half transposase sites of the 5' and 3' parts of the third molecule is the replacement sequence, here, all or part of the gene coding for IL2-Rγ.

[0127] Advantageously, the invention relates to the above-mentioned composition, where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a first sequence complementary to said first sequence for recognizing said transposase of the first molecule followed by a second sequence for recognizing said transposase, and

[0128] where the third molecule comprises at its 5' end a sequence complementary to said second recognition sequence of said transposase of the first molecule.

[0129] Even more advantageously, the invention relates to the above-mentioned composition, where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a first sequence complementary to said first sequence for recognizing said transposase of the first molecule followed by a second sequence for recognizing said transposase,

[0130] the second molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second sequence for recognizing said transposase of the first molecule, said first sequence being followed by a second sequence complementary to said second sequence for recognizing said transposase of the first molecule, and

[0131] where the third molecule comprises at its 5' end a sequence complementary to said second recognition sequence of said transposase of the first molecule and at its 3' end a sequence complementary to the first recognition sequence of the transposase of the second molecule.

[0132] This configuration is shown schematically in. Obviously, in this example of the configuration of the first, second and third molecules, between the two half transposase sites of the 5' and 3' parts of the third molecule is the replacement sequence, here, all or part of the gene coding for IL2-Rγ.

[0133] Advantageously, the invention relates to the above-mentioned composition, where said transposase is a bacterial transposase, in particular a transposase chosen from Tn5, Tn9, Tn10 or Tc1 / mariner.

[0134] Advantageously, the aforementioned transposase is a bacterial type transposase selected from the transposon Tn5 transposase, the transposon Tn9 transposase, the transposon Tn10 transposase, Tn903, Tn602 or the transposon Tc1 transposase, or more generally from the mariner transposon superfamily.

[0135] Other examples of transposases that can be used in the context of the invention are: Vibrio harveyi transposase (transposase characterized by Agilent and used in the SureSelect QXT product), MuA transposase and a Mu transposase recognition site comprising the terminal sequences R1 and R2, Staphylococcus aureus transposon Tn552 transposase, Tn7 transposon transposase, Tn / O and IS10 transposase, Tn3 transposon transposase.

[0136] The Tn5 transposase is the best known. It is encoded by the Tnp gene of the Tn5 transposon. The transposase initiates transposition by forming a transposase dimer that binds to its target sequences. Within this complex, the transposase then catalyzes four phosphoryl transfer reactions (DNA cleavage, DNA hairpin formation, hairpin resolution, and strand transfer into the target DNA) resulting in the integration of the transposon into its new DNA site: this is tagmentation.

[0137] The invention is based on the principle of this tagmentation. By using the tagmentation properties of transposases, it is possible to insert one sequence into another in a targeted manner, thanks to the aforementioned complex.

[0138] Also within the scope of the invention, when reference is made to a transposase, reference is made to one of the aforementioned transposases, namely the transposases of the Tn5, Tn9, Tn10 or Tc1 / mariner transposons (or transposases mutated in order to increase their transposition or tagmentation activity).

[0139] In the invention, when several transposases are used simultaneously, one binding to the complex formed by the first molecule and the third molecule, and the other binding to the complex formed by the second molecule and the third molecule, preference will be given to pairs of transposases derived from transposons Tn5 and Tn10.

[0140] Advantageously, the first and second transposase recognition sequences are Tn5 transposase recognition sequences having one of the following sequences:

[0141] - CTGtCTCTTataCAcAtcT (SEQ ID NO: 29),

[0142] - CTGACTCTTataCACAagT (SEQ ID NO: 30), and

[0143] - CTGtCTCTTgatCAgATCT (SEQ ID NO: 31).

[0144] Consequently, the corresponding complementary sequences are as follows:

[0145] - AgaTgTGtatAAGAGaCAG (SEQ ID NO: 32), complementary to the sequence SEQ ID NO: 29,

[0146] - ActTGTGtatAAGAGTCAG (SEQ ID NO: 33), complementary to the sequence SEQ ID NO: 30, and

[0147] - AGATcTGatcAAGAGaCAG (SEQ ID NO: 34), complementary to the sequence SEQ ID NO: 31.

[0148] Other transposase recognition sequences include:

[0149] Tn5MErev,

[0150] 5′-[phos]CTGTCTCTTATACACATCT-3′ (SEQ ID NO: 35)

[0151] Tn5ME-A (Illumina FC-121-1030),

[0152] 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3′; (SEQ ID NO: 36)

[0153] and Tn5ME-B (Illumina FC-121-1031),

[0154] 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3′ (SEQ ID NO: 37)

[0155] Yet other transposase recognition sequences include:

[0156] - sense sequence SEQ ID NO: i

[0157] - antisense sequence SEQ ID NO: i+1,

[0158] where i varies from 38 to 192.

[0159] For example, the following pairs of sense and antisense sequences are considered: SEQ ID NO: 38 and SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41, SEQ ID NO: 42 and SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45, SEQ ID NO: 46 and SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 49, SEQ ID NO : 50 and SEQ ID NO: 51, SEQ ID NO : 52 and SEQ ID NO: 53, SEQ ID NO : 54 and SEQ ID NO: 55, SEQ ID NO : 56 and SEQ ID NO: 57, SEQ ID NO : 58 and SEQ ID NO: 59, SEQ ID NO : 60 and SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 63, SEQ ID NO : 64 and SEQ ID NO: 65, SEQ ID NO : 66 and SEQ ID NO: 67, SEQ ID NO : 68 and SEQ ID NO: 69, SEQ ID NO : 70 and SEQ ID NO: 71, SEQ ID NO : 72 and SEQ ID NO: 73, SEQ ID NO : 74 and SEQ ID NO: 75, SEQ ID NO : 76 and SEQ ID NO: 77, SEQ ID NO : 78 and SEQ ID NO: 79, SEQ ID NO : 80 and SEQ ID NO: 81, SEQ ID NO : 82 and SEQ ID NO: 83, SEQ ID NO : 84 and SEQ ID NO: 85, SEQ ID NO : 86 and SEQ ID NO: 87, SEQ ID NO : 88 and SEQ ID NO: 89, SEQ ID NO: 90 and SEQ ID NO: 91,SEQ ID NO : 92 et SEQ ID NO: 93, SEQ ID NO : 94 et SEQ ID NO: 95, SEQ ID NO : 96 et SEQ ID NO: 97, SEQ ID NO : 98 et SEQ ID NO: 99, SEQ ID NO : 100 et SEQ ID NO: 101, SEQ ID NO : 102 et SEQ ID NO: 103, SEQ ID NO : 104 et SEQ ID NO: 105, SEQ ID NO : 106 et SEQ ID NO: 107, SEQ ID NO : 108 et SEQ ID NO: 109, SEQ ID NO : 110 et SEQ ID NO: 111, SEQ ID NO : 112 et SEQ ID NO: 113, SEQ ID NO : 114 et SEQ ID NO: 115, SEQ ID NO : 116 et SEQ ID NO: 117, SEQ ID NO : 118 et SEQ ID NO: 119, SEQ ID NO : 120 et SEQ ID NO: 121, SEQ ID NO : 122 et SEQ ID NO: 123, SEQ ID NO : 124 et SEQ ID NO: 125, SEQ ID NO : 126 et SEQ ID NO: 127, SEQ ID NO : 128 et SEQ ID NO: 129, SEQ ID NO : 130 et SEQ ID NO: 131, SEQ ID NO : 132 et SEQ ID NO: 133, SEQ ID NO : 134 et SEQ ID NO: 135, SEQ ID NO : 136 et SEQ ID NO: 137, SEQ ID NO : 138 et SEQ ID NO: 139, SEQ ID NO : 140 et SEQ ID NO: 141, SEQ ID NO : 142 et SEQ ID NO: 143, SEQ ID NO : 144 et SEQ ID NO: 145, SEQ ID NO : 146 et SEQ ID NO: 147,SEQ ID NO : 148 et SEQ ID NO: 149, SEQ ID NO : 150 et SEQ ID NO: 151, SEQ ID NO : 152 et SEQ ID NO: 153, SEQ ID NO : 154 et SEQ ID NO: 155, SEQ ID NO : 156 et SEQ ID NO: 157, SEQ ID NO : 158 et SEQ ID NO: 159, SEQ ID NO : 160 et SEQ ID NO: 161, SEQ ID NO : 162 et SEQ ID NO: 163, SEQ ID NO : 164 et SEQ ID NO: 165, SEQ ID NO : 166 et SEQ ID NO: 167, SEQ ID NO : 168 et SEQ ID NO: 169, SEQ ID NO : 170 et SEQ ID NO: 171, SEQ ID NO : 172 et SEQ ID NO: 173, SEQ ID NO : 174 et SEQ ID NO: 175, SEQ ID NO : 176 et SEQ ID NO: 177, SEQ ID NO : 178 et SEQ ID NO: 179, SEQ ID NO : 180 et SEQ ID NO: 181, SEQ ID NO : 182 et SEQ ID NO: 183, SEQ ID NO : 184 et SEQ ID NO: 185, SEQ ID NO : 186 et SEQ ID NO: 187, SEQ ID NO : 188 et SEQ ID NO: 189, SEQ ID NO : 190 et SEQ ID NO: 191, et SEQ ID NO : 192 et SEQ ID NO: 193.,

[0160] Advantageously, the first G / C-rich domain of the first molecule (or the second molecule) corresponds to the following sequence GGCGATCGC (SEQ ID NO: 194) so ​​that the second G / C-rich domain will be the same. Indeed, due to the folding of the molecule on itself, the second G / C-rich domain will be in a complementary and antiparallel orientation with respect to the first G / C-rich domain, and the interaction will take place at the palindromic region (underlined in the sequence above).

[0161] The first and second G / C-rich domains may also be the following sequence GCGGCGATCGGGC (SEQ ID NO: 195). The above explanations apply mutatis mutandis.

[0162] Other sequences of the G / C-rich domains of the first molecule or the second molecule may be:

[0163] - first G / C-rich domain of sequence GGTCGC (SEQ ID NO: 196) and the second G / C-rich domain of sequence GCGACC (SEQ ID NO: 197).

[0164] These examples are given for illustrative purposes only and do not limit the scope of the invention.

[0165] In an advantageous embodiment, the A / T-rich sequences of the first molecule of said complex consist essentially of, or consist of, A or T.

[0166] Even more advantageously, the A / T-rich sequence of the first molecule of said complex consists of T.

[0167] Advantageously, the invention relates to the aforementioned composition where the gene coding for IL2-Rγ comprises the sequence SEQ ID NO: 1, or the sequence SEQ ID NO: 2 or the sequence SEQ ID NO: 3.

[0168] The sequence SEQ ID NO: 1 corresponds to the complete human IL2Rγ reference gene, referenced under the GenBank number: AY692262.1. This gene is also known under the following names: P64, CIDX, IMD4, CD132, SCIDX, IL-2RG or SCIDX1. It is 7130 bases long.

[0169] The exons of the gene correspond to the sequences delimited as follows:

[0170] Exon 1: from 1956 (first nucleotide of the ATG initiation codon) to 2070, and intron 1: from 2071 to 2448,

[0171] Exon 2: from 2449 to 2602, and intron 2: from 2603 to 2810,

[0172] Exon 3: from 2811 to 2995, and intron 3: from 2996 to 3203,

[0173] Exon 4: from 3204 to 3343, and intron 4: from 3344 to 4108,

[0174] Exon 5: from 4109 to 4271, and intron 5: from 4272 to 4803,

[0175] Exon 6: from 4804 to 4900, and intron 6: from 4901 to 5152,

[0176] Exon 7: from 5153 to 5222, and intron 7: from 5223 to 5577, and

[0177] Exon 8: from 5578 to 5763 (last nucleotide of the stop codon),

[0178] The sequence SEQ ID NO: 2 corresponds to a fragment of SEQ ID NO: 1, since its sequence begins at position 1956 of the sequence SEQ ID NO: 1 and ends at the stop codon at position 5763 of SEQ ID NO: 1.

[0179] The sequence SEQ ID NO: 3 corresponds to the coding region (or CDS in English) of the gene. The one corresponding to the union of the aforementioned exons. This sequence is referenced under the GenBank number: AK314932.1.

[0180] In view of the above-mentioned division, the person skilled in the art will be able to choose a part of the gene as defined above, with the aim of carrying out a partial substitution of the gene. For example, and without being limiting, if it is desired to replace exon 1, it will be possible to target intron 1 with the first molecule, intron 2 with the second molecule while the third molecule will comprise the sequence of exon 2.

[0181] Even more advantageously, the invention relates to the composition as defined above, where the first, second and third molecules are chosen from the triplets as defined in Table 2 below.

[0182] Advantageously, the invention relates to a composition comprising one of the triplets of first, second and third molecules described in the following table 2

[0183]

[0184] Also advantageously, the invention relates to the above-mentioned composition, said composition comprising a triplet chosen from the above-mentioned triplets #1 to #312.

[0185] Advantageously, the invention relates to the composition described above, further comprising

[0186] ** a fourth single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A' allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence being linked in 5' to a fifth T-rich sequence 40 to 60 nucleotides long and in 3' to a sixth T-rich sequence 40 to 60 nucleotides long, said fifth and sixth T-rich sequences respectively comprising a fifth and a sixth domain of 6 to 12 nucleotides rich in G / C, the sequence of the fifth domain being complementary to the sequence of the sixth domain, said fifth and sixth domains being positioned 15 to 52 nucleotides from said sequence A',said fourth molecule comprising at its 5' end at least a first 5'-3' oriented sequence for recognition of a transposase and at its 3' end a second sequence for recognition of said transposase,

[0187] ** a fifth single-stranded nucleic acid molecule comprising or consisting essentially of a sequence B' allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence B' being linked in 5' to a seventh T-rich sequence 40 to 60 nucleotides long and in 3' to an eighth T-rich sequence 40 to 60 nucleotides long, said seventh and eighth T-rich sequences respectively comprising a seventh and eighth domain of 6 to 12 nucleotides rich in GC, the sequence of the seventh domain being complementary to the sequence of the eighth domain, said seventh and eighth domains being positioned 15 to 52 nucleotides from said sequence B',said fifth molecule comprising at its 5' end at least the first 5'-3' oriented recognition sequence of said transposase and at its 3' end the second recognition sequence of said transposase,

[0188] said sequence B' being a complementary sequence to said nucleic acid of interest, sequence A' being positioned 5' of a region of interest to said nucleic acid of interest and sequence B' positioned 3' of the region of interest to said nucleic acid of interest, and

[0189] - a sixth single-stranded molecule comprising

[0190] * in its 5' part, at least one sequence complementary to said fifth recognition sequence of said transposase of the first molecule,

[0191] * in its 3' part at least one sequence complementary to said fourth recognition sequence of said transposase of the second molecule, and

[0192] * an intermediate region located between the complementary sequence of said fourth recognition sequence of said transposase of the first molecule and the complementary sequence of said fifth recognition sequence of said transposase of the second molecule, said intermediate region comprising a complementary and antiparallel sequence of the sequence coding for the interleukin 2 gamma receptor or IL2-Rγ contained in the third molecule of the first composition,

[0193] the fourth and sixth single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase and the fifth and sixth single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase.

[0194] Advantageously, the composition according to the invention comprises 6 molecules, i.e. two triplets which allow a double-strand replacement of a target molecule. This replacement can only be done if the regions A, B and A' and B' are correctly chosen so that the region of interest to be replaced is correctly framed.

[0195] Obviously, all the definitions given for the composition comprising 3 molecules apply mutatis mutandis to a composition comprising 6 molecules.

[0196] Advantageously, the invention relates to the composition described above, where

[0197] - said sequence A comprises a sequence complementary to the sequence of a first region of the gene coding IL2-Rγ,

[0198] - said sequence B comprises a sequence complementary to the sequence of a second region of the gene coding IL2-Rγ,

[0199] said sequence A and said sequence B being two different sequences, said first and second regions of the gene coding for IL2-Rγ, framing a region comprising a sequence coding part of IL2-Rγ, or coding the complete IL2-Rγ receptor,

[0200] Or

[0201] - said sequence A' comprises a sequence complementary to the sequence of a third region of the gene coding IL2-Rγ,

[0202] - said sequence B' comprises a sequence complementary to the sequence of a fourth region of the gene coding IL2-Rγ,

[0203] said sequence A' and said sequence B' being two different sequences, said third and fourth regions of the gene coding for IL2-Rγ, framing a region comprising a sequence complementary to a sequence coding part of IL2-Rγ, or coding the complete IL2-Rγ receptor,

[0204] and where

[0205] sequence A and sequence A' are at most partly complementary,

[0206] sequence A and sequence B' are at most partly complementary,

[0207] sequence B and sequence A' are at most partly complementary, and

[0208] sequence B and sequence B' are at most partly complementary.

[0209] By "at most partly complementary" is meant in the invention that the sequences have sequences which are capable of pairing according to the complementarity of the bases defined by Watson and Crick, but not on all of the sequences. In other words, only a part of the sequences is complementary. Advantageously, the sequences A, A', B and B' are partly complementary on less than 50% of the sequences, in particular less than 30% of the sequences, in particular less than 10% of the sequences, in particular are not at all complementary to each other.

[0210] In this way it is possible to frame the gene coding for the IL2-Rγ receptor in a specific and oriented manner, for both strands, in order to avoid disordered or incoherent recombinations (i.e. tagmentations) so that the result would not be the expected one.

[0211] Even more advantageously, the aforementioned composition comprises at least one of the sextuplets mentioned in the following Table 3:

[0212]

[0213] The composition according to the invention thus advantageously offers 156 sextuplets of molecules allowing the replacement at the locus of the IL2Rγ gene of a potentially mutated or abnormal sequence by the wild-type reference sequence.

[0214] This therefore allows, depending on the target cell, to restore a function lost by the mutation, and to achieve functional complementation.

[0215] In another aspect, the invention relates to a pharmaceutical composition comprising the above-mentioned composition, in association with a pharmaceutically acceptable carrier.

[0216] The above-mentioned composition, in association with a pharmaceutically acceptable vehicle, can be used in the treatment of pathologies. The vehicle is a commonly accepted vehicle known to those skilled in the art, for example distilled water, or a physiological buffer. This vehicle must allow the formation of a complex as mentioned above, but also be acceptable to a cell or a living being.

[0217] In another aspect, the invention relates to the above-mentioned composition, for use as a medicament.

[0218] It is further advantageous that the composition comprising any one of the triplets of Table 2, or any one of the sextuplets of Table 3 is used as a medicament.

[0219] In yet another aspect, the invention relates to a composition for its use in the treatment of pathologies linked to a mutation of the gene encoding IL2-Rγ.

[0220] Mutations in the IL2Rγ gene are widely described in the literature and may correspond to substitutions, insertions or deletions affecting either an exon, an intron or the 5' or 3' regulatory regions of the gene.

[0221] More particularly, the invention relates to a composition for its use for the treatment of pathologies linked to a mutation of the gene coding IL2-Rγ, said composition comprising a triplet as mentioned in Table 2 or a sextuplet as mentioned in Table 3.

[0222] Advantageously, the invention relates to the composition for its aforementioned use, where the disease associated with a mutation of the gene coding for IL2-Rγ is DICS-X disease or Omenn syndrome.

[0223] Severe combined immunodeficiency (SCID) T-B+ due to gamma chain deficiency, also called SCIDX1 or SCID-X, is a form of SCID characterized by severe and recurrent infections associated with diarrhea and failure to thrive.

[0224] SCIDX1 manifests during the first months of life with severe and often fatal viral, bacterial, or fungal infections (e.g., Pneumocystis jiroveci pneumonitis, disseminated BCG infection secondary to vaccination) and failure to thrive. Chronic diarrhea is a common feature. Some patients present with rashes and liver function abnormalities. Graft-versus-host disease due to maternal-fetal transmission is also associated with the disease. Immunologic findings reveal lymphopenia with absent T or NK cells, hypogammaglobulinemia, and normal or elevated B cell counts.

[0225] Omenn syndrome is an inflammatory disorder characterized by erythroderma, scaling, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. Omenn syndrome presents during the first year of life with characteristic manifestations of severe combined immunodeficiency, including chronic diarrhea, pneumonitis, and failure to thrive. Patients also present with inflammatory symptoms such as lymphadenopathy, hepatosplenomegaly, and generalized erythroderma, often causing alopecia with loss of eyebrows and eyelashes. Protein loss can lead to generalized edema and metabolic disturbances. Signs and symptoms may evolve over time and may appear separately.Some patients manifest only certain symptoms and can then be described as cases of atypical Omenn syndrome. Rather than a distinct form of severe combined immunodeficiency, it is an inflammatory phenotype that can be associated with different types of severe combined immunodeficiency. Most cases reported to date have hypomorphic mutations in the RAG1 and RAG2 genes (11p13). Other cases of mutations occur in the RMRP, ADA, and IL2Rγ genes, as well as others.

[0226] In another aspect, the invention relates to a method of treating DICS-X or Omenn syndrome, said method comprising administering an effective amount of an above-mentioned composition to an individual in need, said composition comprising in particular a triplet as defined in Table 2 or a sextuplet as defined in Table 3.

[0227] In yet another aspect, the invention relates to the use of a composition as defined above, for the substitution, in a somatic cell, of a mutated sequence of the gene encoding IL2-Rγ by a wild-type sequence of the gene encoding wild-type IL2-Rγ, provided that the use does not comprise a method for modifying the germline genetic identity of human beings and that said use is not a method for the treatment of the human or animal body by surgery or therapy.

[0228] As explained above, the composition allows to specifically target a target region and replace it with a sequence of interest, using the tagmentation properties of transposases.

[0229] The composition according to the invention is particularly advantageous for carrying out targeted gene modifications (and in particular gene replacements, or non-coding sequences) in humans and in particular for replacing the mutated IL2Rγ gene with its wild-type reference sequence.

[0230] In yet another advantageous embodiment, the invention relates to a method of replacing, in particular in vitro, a mutated sequence of the gene coding IL2-Rγ with a wild-type sequence coding IL2-Rγ, said method comprising:

[0231] - bringing into contact a composition as defined above, with the nucleic acid comprising the mutated sequence coding the IL2-Rγ gene,

[0232] said composition being such that

[0233] the sequence A of said first molecule comprises a sequence complementary to the region immediately 5' of the mutated sequence coding the IL2-Rγ gene,

[0234] the sequence B of said second molecule comprises a sequence complementary to the region immediately 3' of the mutated sequence coding the IL2-Rγ gene, and

[0235] the third molecule comprises the wild-type sequence of the gene coding for IL2-Rγ, located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule, in order to obtain a replacement complex,

[0236] - bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said assembly, to obtain a recombination complex, and

[0237] - recombination of the combination complex to obtain the hybrid nucleic acid molecule the wild-type sequence of the gene coding for IL2-Rγ, instead of the mutated sequence of the gene coding for IL2-Rγ.

[0238] Advantageously, the invention relates to a method for replacing, in particular in vitro, a mutated sequence of the gene coding IL2-Rγ with a wild-type sequence coding IL2-Rγ, said method comprising:

[0239] - bringing into contact a composition comprising a triplet as defined in Table 2 or a sextuplet as defined in Table 3, with the nucleic acid comprising the mutated sequence coding the IL2-Rγ gene, in order to obtain a replacement complex,

[0240] - bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said assembly, to obtain a recombination complex, and

[0241] - recombination of the combination complex to obtain the hybrid nucleic acid molecule the wild-type sequence of the gene coding for IL2-Rγ, instead of the mutated sequence of the gene coding for IL2-Rγ.

[0242] In yet another aspect, the invention relates to a method for in vitro replacement of a mutated double-stranded sequence of the gene encoding IL2-Rγ of a stem cell, in particular a hematopoietic stem cell, with a wild-type double-stranded sequence encoding IL2-Rγ, said method comprising:

[0243] - bringing a composition as defined above into contact with the hematopoietic stem cell comprising the mutated sequence coding the IL2-Rγ gene,

[0244] said set being such that

[0245] the sequence A of said first molecule comprises a sequence complementary to the region immediately 5' of the mutated sequence coding the IL2-Rγ gene,

[0246] the sequence A' of said fourth molecule comprises a sequence complementary to the region immediately 5' of the mutated complementary sequence coding the IL2-Rγ gene,

[0247] the sequence B of said second molecule comprises a sequence complementary to the region immediately 3' of the mutated sequence coding the IL2-Rγ gene,

[0248] the sequence B' of said fifth molecule comprises a sequence complementary to the region immediately 3' of the mutated complementary sequence coding the IL2-Rγ gene, and

[0249] the third molecule comprises the wild-type sequence of the gene coding for IL2-Rγ, located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule,

[0250] the sixth molecule comprises the sequence complementary to the wild-type sequence of the gene coding for IL2-Rγ, located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule, in order to obtain a replacement complex,

[0251] - bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said composition, to obtain a recombination complex, and

[0252] - recombination of the combination complex to obtain the hybrid nucleic acid molecule the wild-type sequence of the gene coding for IL2-Rγ, instead of the mutated sequence of the gene coding for IL2-Rγ,

[0253] - and possibly the purification of the hematopoietic stem cell having a replacement of the mutated gene.

[0254] Advantageously, the invention relates to a method for in vitro replacement of a mutated double-stranded sequence of the gene coding for IL2-Rγ of a stem cell, in particular a hematopoietic stem cell, with a wild-type double-stranded sequence coding for IL2-Rγ, said method comprising:

[0255] - bringing a composition as defined above into contact with the hematopoietic stem cell comprising the mutated sequence coding the IL2-Rγ gene, in order to obtain a replacement complex, said composition comprising a triplet as defined in Table 2 or a sextuplet as defined in Table 3,

[0256] - bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said composition, to obtain a recombination complex, and

[0257] - recombination of the combination complex to obtain the hybrid nucleic acid molecule the wild-type sequence of the gene coding for IL2-Rγ, instead of the mutated sequence of the gene coding for IL2-Rγ,

[0258] - and possibly the purification of the hematopoietic stem cell having a replacement of the mutated gene.

[0259] In yet another aspect, the invention relates to a method of inserting, in particular in vitro, a double-stranded sequence of the wild-type gene encoding IL2-Rγ into a cell, in particular a stem cell, in particular a hematopoietic stem cell, at the locus of the gene encoding IL2-Rγ, wherein said locus of the gene encoding IL2-Rγ comprises a mutation affecting the expression, the function, or both, of IL2-Rγ,

[0260] where said double-stranded sequence of the wild-type gene coding IL2-Rγ corresponds to the cDNA of said gene, in particular the sequence SEQ ID NO: 3,

[0261] said method comprising:

[0262] - bringing a composition as defined in any one of claims 1 to 9 into contact with the cell comprising a mutation affecting the expression, the function, or both, of IL2-Rγ, at the locus of the gene encoding IL2-Rγ

[0263] said composition being such that

[0264] the sequence A of said first molecule comprises a sequence complementary to the 5' region of exon 1 of the gene coding for IL2-Rγ,

[0265] the sequence A' of said fourth molecule comprises a sequence complementary to the sequence complementary to the 5' region of exon 1 of the gene coding for IL2-Rγ,

[0266] the sequence B of said second molecule comprises a sequence complementary in 3' to the 5' region of exon 1 of the gene coding for IL2-Rγ,

[0267] the sequence B' of said fifth molecule comprises a sequence complementary in 3' to the sequence complementary to the region in 5' of exon 1 of the gene coding for IL2-Rγ, and

[0268] the third molecule comprises the wild-type sequence of the cDNA of the gene coding for IL2-Rγ, located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule,

[0269] the sixth molecule comprises the sequence complementary to the wild-type sequence of the cDNA of the gene coding for IL2-Rγ, located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule,

[0270] in order to obtain a replacement complex,

[0271] - bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said assembly, to obtain a recombination complex, and

[0272] - recombination of the combination complex to obtain the insertion of the cDNA of the gene coding for IL2-Rγ in 5' of exon 1 of the gene coding for IL2-Rγ,

[0273] - and possibly the purification of the cell having the insertion. Brief description of the figures

[0274] The invention will be better understood by reading the examples below and the following figures:

[0275] is a first schematic representation of a first form of pairing of the first, second and third molecules of the composition according to the invention.

[0276] is a second schematic representation of a first form of pairing of the first, second and third molecules of the composition according to the invention.

[0277] is a third schematic representation of a first form of pairing of the first, second and third molecules of the composition according to the invention.

[0278] is a fourth schematic representation of a first form of pairing of the first, second and third molecules of the composition according to the invention.

[0279] is a fifth schematic representation of a first form of pairing of the first, second and third molecules of the composition according to the invention.

[0280] is a diagram showing the principle and steps of single-strand replacement using the first, second and third molecules of the composition according to the invention.

[0281] is a diagram showing the principle and steps of double-strand replacement using the first, second, third, fourth, fifth and sixth molecules of the composition according to the invention.

[0282] is a diagram showing the association of the molecules contained in tube 1 of example 1. The black ball represents biotin.

[0283] is a diagram showing the association of the molecules contained in tube 2 of example 1. The black ball represents biotin. Examples

[0284] Example 1–Obtaining B cells expressing the wild-type ILR2G gene

[0285] In order to treat patients suffering from DICS-X, involving a mutation in the ILR2G gene, it may be advantageous to propose a cell therapy aimed at grafting into patients CD34+ hematopoietic stem cells which have been modified using a composition according to the invention, in particular to replace the mutated ILR2G gene with the wild-type sequence of said gene.

[0286] A - Purification of CD34+ hematopoietic stem cells (HSCs) from blood

[0287] The purification of CD34+ cells is well known to those skilled in the art, and can be summarized as follows:

[0288] 1- Blood samples from donors (adults or umbilical cord blood rich in CD34+ cells) are collected, fresh or frozen (it is also possible to purify CD34+ cells from a patient with DISC-X);

[0289] 2- The samples are centrifuged at 1000g for 8min without brake on sterile density gradient centrifugation medium (for example Ficoll in the presence of EDTA) to isolate peripheral blood mononuclear cells (PBMCs);

[0290] 3- The white blood cell rings are collected and washed with phosphate buffer PBS (in English for PhosphateBufferedSaline);

[0291] 4- The hematopoietic stem cells (i.e. CD34+ cells) are then isolated in the cell sorter by positive selection using anti-CD34 antibody labeling or by negative selection using a cocktail of anti-CD2, anti-CD3, anti-CD14, anti-CD16, anti-CD19, anti-CD24, anti-CD56n, anti-CD66b and anti-CD61 antibodies;

[0292] 5- Purified CD34+ cells are centrifuged at 300g for 5min and the cell pellets are suspended at a cell density of 100,000 to 300,000 cells / mL and cultured at 37°C and 5% CO2 for 48h in 24-well plates at a rate of 1mL per well in a culture medium specifically dedicated to stem cell culture and supplemented with a cocktail containing human IL-3, human IL-6, recombinant thrombopoietin, recombinant hCSF (ligand Kit) and recombinant Flt-3 ligand, at a rate of 100ng / mL for each.

[0293] 6- the CD34+ stem cells are thus ready to be transfected with the composition according to the invention.

[0294] B- Preparation of the molecules of the composition according to the invention

[0295] In order to target the IL2Rγ gene, and verify the insertion at the IL2Rγ chrX:70,327,254-70,331,958 GRCh37 / hg19 locus, a construct comprising GFP was prepared.

[0296] Two tubes were prepared as follows:

[0297] ** Tube 1 (10µL):

[0298] - oligo Great X1 (10µM) corresponding to molecule 1 of sequence SEQ ID: 198 following

[0299] 5'-AgaTgTGtatAAGAGaCAGGTAGTGTATTTTTTTTTTTTTTTTATCATCCTGtCTCTTataCAcAtcTTTTTTTTTTTTTTTTTTTTTTTGGCGATCGCTTTTTTTTT TTTTTTTGCTAGAAAGAGTACTGTTCTGGAAACTGACTTTTTTTTTTTTTTTTGCGATCGCCTTTTTTTTTTTGATACATTTAgaTgTGtatAAGAGaCAGGATGAT-3'

[0300] - oligo Great X3 (10µM) corresponding to molecule 4, of sequence SEQ ID: 201 following

[0301] 5'-CACGTGCTGtCTCTTataCAcAtcTTTTCTCGATCATTATTATTTTTTGGCGATCGCTTTTTTTTTTTTTTAGCAAATTGGTAATACTCCTGCCTCCACAGTTTTTTT TTTTTTTTTGCGATCGCCTTTTTTTTTTTTTTTTTTTTAgaTgTGtatAAGAGaCAGCACGTGTTTTTTTTTTTTTTTTTTTTCAGCTATACTGtCTCTTataCAcAtcT-3'

[0302] - the reverse oligo GREAT X1 Rev (10µM) corresponding to the 5' part of molecule 3 of sequence SEQ ID NO: 1134 following

[0303] 5'-TACACTACCTGtCTCTTataCAcAtcTTTTTTTTTTTTTTTTTTTTTTTggttacATGCATCGTACA-3'

[0304] - the reverse oligo GREAT X3 Rev (10µM) corresponding to the 3' part of molecule 6 of sequence SEQ ID NO: 1135 following

[0305] 5'-TGTACGATGCATgtaaccTTTTTTTTTTTTTTTTTTTTTTAgaTgTGtatAAGAGaCAGTATAGCTG-3'

[0306] - the Reverse Helix Rev oligo corresponding to an additional strand allowing a helicase to be bound by the biotinylated 3' end, the oligo having the following sequence SEQ ID NO: 1136

[0307] 5'-ATAATAATGATCGAGAACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT[Biot]-3'

[0308] ** Tube 2 (10µL):

[0309] - oligo Great X2 (10µM) corresponding to molecule 2, of the following sequence SEQ ID NO: 199

[0310] 5'-CACGTGCTGtCTCTTataCAcAtcTTTTCTCGATCATTATTATTTTTTGGCGATCGCTTTTTTTTTTTTTTTTGTTGAGAATGGTGCTAGTGGTAGTGAACAGTTTTTTTTTTTTTTTTGCGATCGCCTTTTTTTTTTTTTTTTTTTTTAgaTgTGtatAAGAGaCAGCACGTGTTTTTTTTTTTTTTTTTTTTGACGAATACTGtCTCTTataCAcAtcT-3'

[0311] - l’oligo Great X4 (10µM) correspondant à la molécule 5, de séquence SEQ ID NO : 202 suivante :

[0312] 5’- AgaTgTGtatAAGAGaCAGAGTATGAATTTTTTTTTTTTTTTTTATCATCCTGtCTCTTataCAcAtcTTTTTTTTTTTTTTTTTTTTTTTGGCGATCGCTTTTTTTTTTTTTTTTCCTTCTCCTCTAAATCATTACCTTCTATAATTTTTTTTTTTTTTTTGCGATCGCCTTTTTTTTTTTTTGATACATTTAgaTgTGtatAAGAGaCAGGATGAT-3’

[0313] - l’oligo reverse GREAT X2 Rev (10µM) correspondant à la partie 3’ de la molécule 3 de séquence SEQ ID NO : 1137 suivante

[0314] 5’-CGATACgcggccgcatgttcTTTTTTTTTTTTTTTTTTTTTTTAgaTgTGtatAAGAGaCAGTATTCGTC-3’

[0315] - l’oligo reverse GREAT X4 Rev (10µM) correspondant à la partie 5’ de la molécule 6 SEQ ID NO : 1138 suivante

[0316] 5'-TTCATACTCTGtCTCTTataCAcAtcTTTTTTTTTTTTTTTTTTTTTTTgaacatgcggccgcGTATCG-3'

[0317] - the Reverse Helix Rev oligo corresponding to an additional strand allowing a helicase to be bound via the biotinylated 3' end, the oligo having the sequence SEQ ID NO: 1136.

[0318] The two tubes are then heated to 95°C for 5 min then left for 1 hour at room temperature then each tube is digested with the corresponding restriction enzymes: Tube 1: NsiI and Tube 2: NotI then purified by PCR purification kit (elution 20µL).

[0319] Figures 4 and 5 schematically represent the contents of tubes 1 and 2 respectively before enzymatic digestion.

[0320] In parallel, an amplified GFP-ILR2γ sequence was obtained via lysis of HEK293T cells and genomic DNA extraction protocol and amplification of the locus of interest via hyperprocessive Taq PCR. This sequence was amplified (using oligonucleotides with an NsiI restriction site in 5' and a NotI restriction site in 3'). The PCR product was digested with both enzymes and purified by PCR purification kit eluted at a volume of 20µL. The GFP-ILR2γ fusion is then flanking ends (i.e. free NsiI and NotI half-site) in tube 3.

[0321] The contents of the 3 tubes (tube 1, tube 2 and tube 3) are then mixed and T4 phage ligase is added to the mixture (4µL, 100 U) in the presence of appropriate buffer (T4 buffer; 5µL 10X) and 11µL of distilled water. The mixture is left for 1 hour at room temperature. Then the mixture is gel purified (30µL elution) in order to isolate the largest fragment, GFP-ILR2γ, larger than 1kbases.

[0322] The purified fragment is ready for use and includes the first, second, fourth and fifth molecules at the ends, the third and sixth corresponding to the GFP IL2Rγ fusion (tube 4).

[0323] At this stage, the modified single-stranded oligonucleotide complementary to a part of the first and fourth molecules, the 3' part of the complementary modified single-stranded oligonucleotide being coupled to biotin (biotinylated oligo), was added. This biotinylated molecule is not mandatory.

[0324] C- Transfection of CD34+ cells with the composition according to the invention.

[0325] The contents of tube 4, containing the biotinylated oligo or not, are then used to transfect the isolated CD34+ cells by electroporation.

[0326] Cells are centrifuged at 300g for 5min and washed with PBS before being suspended in electrolytic buffer at a cell density of 75,000 to 100,000 cells per electroporation chamber. The contents of tube 4, as well as a plasmid encoding the Tn5 protein, and optionally a plasmid encoding a helicase-streptavidin fusion (UVRD-mSA) are added to the electroporation chamber according to the “Episomal iPSC Reprogramming Vectors” protocol of the Neon® Transfert System transfection system proposed by Thermofisher.

[0327] The mixture is electroporated at 1650V by three 10 ms sequences.

[0328] The cells are then immediately centrifuged at 300g for 5min and suspended in supplemented stem cell culture medium for 48 to 96h at 37°C and 5% CO2.

[0329] Tagmentation (i.e. gene replacement) is then possible. The cells are maintained in an appropriate culture medium. D- Verification of transfection

[0330] Transfected cells having inserted the molecule of interest at the locus are selected by means of selection with an antibiotic whose resistance gene is contained in the replacement sequence (for example neomycin, bleomycin, blasticidin S etc.).

[0331] Genomic DNA from transfected and resistant cells was extracted and fragmented by sonication, followed by the addition of sequencing adapters. PCR amplification of all genomic DNA fragments was performed. This library was sequenced on a HiSeq 2500 sequencer (50 × 8 × 50 reads, paired-end) and the results were compiled by mapping and alignment via bwa-mem module (hg19 library). On-target / off-target analysis was performed by specific selection and cluster read via comparison with the reference genome (hg19) by mapping with the Bwa-mem module in short reads mode and the minimap2 module. The insertion peak data were assembled via the macs2 module.

[0332] It is also possible to perform a simple PCR using a sense oligonucleotide 5' of the insertion and an antisense oligonucleotide 3' of the insertion (Single-Tail Adapter / Tag (STAT)-PCR based method). The PCR product is then sequenced using conventional techniques, in order to detect in the region of interest at least the presence of GFP, a sign of the fusion insertion.

[0333] E- Functional analysis of CD34+ cells modified by the composition according to the invention

[0334] The differentiation of modified CD34+ cells is monitored in vitro using the coculture model on murine OP9-DL1 or DL4 stromal cells as described in the literature.

[0335] Briefly, OP9-DL1 or DL4 cells are cultured with the modified CD34 cells for 14 days at 37°C at 5% CO2 and 10% O2 in MEM (Minimum Essential Medium) supplemented with 10% FCS (Fetal Bovine Serum), the cytokine cocktail necessary for CD34 cell culture (as described above) and a cytokine cocktail promoting the activation of the myeloerythroid and lymphoid differentiation pathways.

[0336] After 2 weeks of culture, differentiated CD34+ cells are collected and analyzed by flow cytometry to observe their hematopoietic differentiation profile using anti-CD19 (B lymphoid lineage), anti-CD3 (T lymphoid lineage, anti-CD56 (NK lineage), anti-CD16 (monocyte / macrophage lineage), anti-CD14 (macrophage / neutrophil lineage), anti-CD11c (myeloid lineage) and anti-CD235a (erythroid lineage) antibodies.

[0337] The differentiation of modified CD34+ cells is also monitored in vivo using the NSG or NOD SCID mouse model (immunodeficient mice).

[0338] Modified CD34+ cells are injected IH (intrahepatic) or IF (intrafemoral) into 3-4 day or 6-8 week old mice.

[0339] Differentiation was monitored at 8 weeks, 12 weeks, and 16 weeks post-injection in the bone marrow, spleen, and blood of mice. Human cells were analyzed by flow cytometry using anti-CD45 and anti-HLA ABC antibodies, and their cellular profile was analyzed using the same panel of antibodies used in vitro.

[0340] For each cell type, GFP expression can be detected by flow cytometry.

[0341] On differentiated cells, reverse transcription can also be performed on isolated cells to obtain a cDNA library. An amplification of the GFP and ILR2γ sequence is then carried out by PCR Oligos for PCR and sequencing IL2Rγ: AGTGAACAGATCCTTCCCAGG (SEQ ID NO: 1139) and GFP Rev: CACGAACTCCAGCAGGACCATG (SEQ ID NO: 1140) and the amplified fragment is sequenced by Sanger sequencing but also migrated on agarose gel. As expected, after analysis (NCBI blast), we find a very close similarity with the theoretical GFP-IL2Rγ fragment replacing the IL2Rγ locus.

[0342] These results show that the technology according to the invention makes it possible to replace the endogenous IL2Rγ gene efficiently with an exogenous sequence.

[0343] Of course, the example given above is intended to demonstrate the effectiveness of the technology, and uses genes such as GFP to facilitate detection of the insertion.

[0344] In cell therapy, the gene encoding GFP is not used and sequencing or functional detection of the receptor are then used to verify efficacy.

[0345] Example 2 – Obtaining B cells expressing the wild-type ILR2G gene from pluripotent stem cells.

[0346] Since it can be difficult to obtain CD34+ stem cells from patients with SCID-X, it is possible to use induced pluripotent stem cell (iPSC) technology.

[0347] iPSc cells can be sourced from cell banks, whose immunological profile is compatible with patients.

[0348] It is also possible to take differentiated cells from the patient (for example fibroblasts or epithelial cells), and to force dedifferentiation by the expression of the Oct4 and Socs2 genes, as well as other genes such as Klf4, Dub3, c-Myc, Nanog. Such techniques are now well known to those skilled in the art, and they will be able to adapt the protocols described in the prior art according to the cell type they wish to engage in a dedifferentiation model.

[0349] At this stage it is possible to transfect the iPSc cells with Lipofectamine in the presence of tube 4 as described in Example 1.

[0350] Transfected cells are selected by use of the appropriate antibiotic, and insertion is verified as described in Example 1.

[0351] iPSc cells are cultured on cell matrix gel-coated plates, cocultured with inactivated murine embryonic fibroblasts for 24 hours, in complete stem cell culture medium supplemented with bFGF and ROCK inhibitor.

[0352] The iPSc cells are then cultured for 7 days in 24-hour culture media containing distinct differentiation cocktails each day:

[0353] o D0-1: medium supplemented with hBMP-4, hVEGF, hWnt3a and KOSR;

[0354] o D2: medium supplemented with hBMP-4, hVEGF and KOSR;

[0355] o D3: medium supplemented with hBMP-4, hVEGF and bFGF;

[0356] o D4-5: medium supplemented with hVEGF and bFGF;

[0357] o D6: IMDM medium supplemented with F12, B27, N2, BSA, hVEGF, bFGF, human stem cell factor and hFlt3 ligand;

[0358] o D7: IMDM medium supplemented with F12, B27, N2, BSA, hVEGF, bFGF, human stem cell factor, hFlt3 ligand, TPO, IL-6, hEPOgen, and FICZ (6-formylindolo [3,2-b]carbazole)

[0359] After 7 days, the cells are then kept in culture for an additional 3 to 7 days before continuing the experiments on the harvested non-adherent cells. These cells are tested to verify that they express the CD34+ marker, by flow cytometry using an anti-CD34 antibody.

[0360] If the cells have not been transfected at the iPSc stage, they can then be transfected at the CD34+ stage as described in Example 1. Their differentiation is then induced as described in Example 1.

Claims

Composition comprising- a first single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence being linked in 5' to a first T-rich sequence 40 to 60 nucleotides long and in 3' to a second T-rich sequence 40 to 60 nucleotides long, said first and second T-rich sequences respectively comprising a first and a second domain of 6 to 12 nucleotides rich in G / C, the sequence of the first domain being complementary to the sequence of the second domain, said first and second domains being positioned 15 to 52 nucleotides from said sequence A,said first molecule comprising at its 5' end at least a first 5'-3' oriented sequence for recognition of a transposase and at its 3' end a second sequence for recognition of said transposase,- a second single-stranded nucleic acid molecule comprising or consisting essentially of a B sequence allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary B sequence being linked at 5' to a third T-rich sequence 40 to 60 nucleotides long and at 3' to a fourth T-rich sequence 40 to 60 nucleotides long, said third and fourth T-rich sequences respectively comprising a third and a fourth domain of 6 to 12 nucleotides rich in G / C, the sequence of the third domain being complementary to the sequence of the fourth domain,said third and fourth domains being positioned from 15 to 52 nucleotides of said sequence B, said second molecule comprising at its 5' end at least the first oriented 5'-3' recognition sequence of said transposase and at its 3' end the second recognition sequence of said transposase, said sequence B being a sequence complementary to said nucleic acid of interest, sequence A being positioned 5' of a region of interest of said nucleic acid of interest and sequence B positioned 3' of the region of interest of said nucleic acid of interest, and- a third single-stranded molecule comprising* in its 5' part, at least one sequence complementary to said second recognition sequence of said transposase of the first molecule,* in its 3' part at least one sequence complementary to said first recognition sequence of said transposase of the second molecule,and* an intermediate region located between the complementary sequence of said second recognition sequence of said transposase of the first molecule and the complementary sequence of said first recognition sequence of said transposase of the second molecule, said intermediate region comprising a sequence encoding a part of the interleukin 2 gamma receptor or IL2-Rγ, or encoding the complete IL2-Rγ receptor, the first and third single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase and the second and third single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase., The composition of claim 1, wherein said sequence A comprises a sequence complementary to the sequence of a first region of the gene encoding IL2-Rγ, and wherein said sequence B comprises a sequence complementary to the sequence of a second region of the gene encoding IL2-Rγ, said sequence A and said sequence B being two different sequences, said first and second regions of the gene encoding IL2-Rγ, flanking a region comprising a sequence encoding a part of IL2-Rγ, or encoding the complete IL2-Rγ receptor. Composition according to any one of claims 1 to 2, wherein said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognition of a transposase and at its 3' end a second 5'-3' oriented sequence for recognition of said transposase andwhere the third molecule comprises at its 5' end a first sequence complementary to said first recognition sequence of said transposase of the first molecule followed by a second sequence complementary to said second recognition sequence of said transposase of the first molecule. Composition according to any one of claims 1 to 3, wherein said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second sequence for recognizing said transposase, followed by a first sequence complementary to said first sequence for recognizing said transposase andwhere the third molecule comprises at its 5' end a sequence complementary to said second sequence for recognizing said transposase. Composition according to any one of claims 1 to 4, wherein said transposase is a bacterial transposase, in particular a transposase chosen from Tn5, Tn9, Tn10 or Tc1 / mariner. Composition according to any one of claims 1 to 5, wherein the gene encoding IL2-Rγ comprises a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO:

3. Composition according to any one of claims 1 to 6, wherein the first, second and third molecules are chosen from the triplets as defined in Table 2. A composition according to any one of claims 1 to 7, further comprising a fourth single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A' allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence being linked in 5' to a fifth T-rich sequence 40 to 60 nucleotides long and in 3' to a sixth T-rich sequence 40 to 60 nucleotides long, said fifth and sixth T-rich sequences respectively comprising a fifth and sixth domain of 6 to 12 nucleotides rich in G / C, the sequence of the fifth domain being complementary to the sequence of the sixth domain, said fifth and sixth domains being positioned 15 to 52 nucleotides from said sequence A',said fourth molecule comprising at its 5' end at least a first 5'-3' oriented sequence for recognition of a transposase and at its 3' end a second sequence for recognition of said transposase,** a fifth single-stranded nucleic acid molecule comprising or consisting essentially of a B' sequence allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary B' sequence being linked in 5' to a seventh T-rich sequence 40 to 60 nucleotides long and in 3' to an eighth T-rich sequence 40 to 60 nucleotides long, said seventh and eighth T-rich sequences respectively comprising a seventh and eighth domain of 6 to 12 nucleotides rich in GC, the sequence of the seventh domain being complementary to the sequence of the eighth domain,said seventh and eighth domains being positioned from 15 to 52 nucleotides of said sequence B', said fifth molecule comprising at its 5' end at least the first 5'-3' oriented recognition sequence of said transposase and at its 3' end the second recognition sequence of said transposase, said sequence B' being a sequence complementary to said nucleic acid of interest, sequence A' being positioned 5' of a region of interest of said nucleic acid of interest and sequence B' positioned 3' of the region of interest of said nucleic acid of interest, and- a sixth single-stranded molecule comprising* in its 5' part, at least one sequence complementary to said fifth recognition sequence of said transposase of the first molecule,* in its 3' part at least one sequence complementary to said fourth recognition sequence of said transposase of the second molecule,and* an intermediate region located between the complementary sequence of said fourth recognition sequence of said transposase of the first molecule and the complementary sequence of said fifth recognition sequence of said transposase of the second molecule, said intermediate region comprising a sequence complementary, and antiparallel, to the sequence coding for the interleukin 2 gamma receptor or IL2-Rγ contained in the third molecule of the first composition, the fourth and sixth single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase and the fifth and sixth single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase., Composition according to claim 8, wherein- said sequence A comprises a sequence complementary to the sequence of a first region of the gene encoding IL2-Rγ,- said sequence B comprises a sequence complementary to the sequence of a second region of the gene encoding IL2-Rγ,said sequence A and said sequence B being two different sequences, said first and second regions of the gene encoding IL2-Rγ, flanking a region comprising a sequence encoding a part of IL2-Rγ, or encoding the complete IL2-Rγ receptor,wherein- said sequence A' comprises a sequence complementary to the sequence of a third region of the gene encoding IL2-Rγ,- said sequence B' comprises a sequence complementary to the sequence of a fourth region of the gene encoding IL2-Rγ,said sequence A' and said sequence B' being two different sequences, said third and fourth regions of the gene encoding IL2-Rγ,framing a region comprising a sequence complementary to a sequence coding part of IL2-Rγ, or coding the complete IL2-Rγ receptor, and where sequence A and sequence A' are at most partly complementary, sequence A and sequence B' are at most partly complementary, sequence B and sequence A' are at most partly complementary, and sequence B and sequence B' are at most partly complementary., A pharmaceutical composition comprising a composition according to any one of claims 1 to 9, in association with a pharmaceutically acceptable carrier. Composition according to any one of claims 1 to 9, for use as a medicament. Composition according to any one of claims 1 to 9, for its use for the treatment of a disease associated with a mutation of the gene coding IL2-Rγ. Composition for its use according to claim 12, where the disease associated with a mutation of the gene coding for IL2-Rγ is DICS-X disease or Omenn syndrome. Use of a composition according to any one of claims 1 to 9, for the substitution, in a somatic cell, of a mutated sequence of the gene encoding IL2-Rγ by a wild-type sequence of the gene encoding wild-type IL2-Rγ, provided that the use does not comprise a method for modifying the germline genetic identity of human beings and that said use is not a method for the treatment of the human or animal body by surgery or therapy. A method for in vitro replacement of a mutated sequence of the gene encoding IL2-Rγ with a wild-type sequence encoding IL2-Rγ, said method comprising:- bringing a composition as defined in any one of claims 1 to 9 into contact with the nucleic acid comprising the mutated sequence encoding the IL2-Rγ gene,said composition being such thatsequence A of said first molecule comprises a sequence complementary to the region immediately 5' of the mutated sequence encoding the IL2-Rγ gene,sequence B of said second molecule comprises a sequence complementary to the region immediately 3' of the mutated sequence encoding the IL2-Rγ gene, andthe third molecule comprises the wild-type sequence of the gene encoding IL2-Rγ,located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule, in order to obtain a replacement complex, - bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said assembly, to obtain a recombination complex, and - recombination of the combination complex to obtain the hybrid nucleic acid molecule the wild-type sequence of the gene coding IL2-Rγ, in place of the mutated sequence of the gene coding IL2-Rγ., A method for in vitro replacement of a mutated double-stranded sequence of the gene encoding IL2-Rγ of a stem cell, in particular a hematopoietic stem cell, with a wild-type double-stranded sequence encoding IL2-Rγ, said method comprising:- bringing a composition as defined in any one of claims 1 to 9 into contact with the hematopoietic stem cell comprising the mutated sequence encoding the IL2-Rγ gene,said assembly being such thatsequence A of said first molecule comprises a sequence complementary to the region immediately 5' of the mutated sequence encoding the IL2-Rγ gene,sequence A' of said fourth molecule comprises a sequence complementary to the region immediately 5' of the mutated complementary sequence encoding the IL2-Rγ gene,sequence B of said second molecule comprises a sequence complementary to the region immediately 3' of the mutated sequence encoding the IL2-Rγ gene,the sequence B' of said fifth molecule comprises a sequence complementary to the region immediately 3' of the mutated complementary sequence encoding the IL2-Rγ gene, andthe third molecule comprises the wild-type sequence of the gene encoding IL2-Rγ, located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule,the sixth molecule comprises the sequence complementary to the wild-type sequence of the gene encoding IL2-Rγ, located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule,in order to obtain a replacement complex,- bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said assembly, to obtain a recombination complex, and- recombination of the combination complex to obtain the hybrid nucleic acid molecule the wild-type sequence of the gene coding IL2-Rγ, in place of the mutated sequence of the gene coding IL2-Rγ,- and possibly the purification of the hematopoietic stem cell having a replacement of the mutated gene., A method for in vitro insertion of a double-stranded sequence of the wild-type gene encoding IL2-Rγ into a cell, in particular a stem cell, in particular a hematopoietic stem cell, at the locus of the gene encoding IL2-Rγ, wherein said locus of the gene encoding IL2-Rγ comprises a mutation affecting the expression, the function, or both, of IL2-Rγ,wherein said double-stranded sequence of the wild-type gene encoding IL2-Rγ corresponds to the cDNA of said gene,said method comprising:- bringing a composition as defined above into contact with the cell comprising a mutation affecting the expression, the function, or both, of IL2-Rγ, at the locus of the gene encoding IL2-Rγsaid composition being such thatsequence A of said first molecule comprises a sequence complementary to the 5' region of exon 1 of the gene encoding IL2-Rγ,the sequence A' of said fourth molecule comprises a sequence complementary to the sequence complementary to the 5' region of exon 1 of the gene encoding IL2-Rγ,the sequence B of said second molecule comprises a sequence complementary to the 3' region of the 5' region of exon 1 of the gene encoding IL2-Rγ,the sequence B' of said fifth molecule comprises a sequence complementary to the 3' region of the 5' region of exon 1 of the gene encoding IL2-Rγ, andthe third molecule comprises the wild-type sequence of the cDNA of the gene encoding IL2-Rγ, located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule,the sixth molecule comprises the sequence complementary to the wild-type sequence of the cDNA of the gene encoding IL2-Rγ,located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule, in order to obtain a replacement complex, - bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said assembly, to obtain a recombination complex, and - recombination of the combination complex to obtain the insertion of the cDNA of the gene coding for IL2-Rγ in 5' of exon 1 of the gene coding for IL2-Rγ, - and possibly purification of the cell having the insertion.,

Images