Methods for detecting diastatic yeast contaminants
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- INVISIBLE SENTINEL INC
- Filing Date
- 2023-12-15
- Publication Date
- 2026-04-22
AI Technical Summary
Current methods for detecting diastatic yeast contaminants in breweries rely on molecular detection assays targeting the STA1 and STA2 genes, but these are ineffective for diastatic strains that lack these genes, and cannot differentiate between diastatic and non-diastatic yeast strains, leading to challenges in predicting spoilage potential.
A method and system for detecting diastatic Saccharomyces cerevisiae strains using oligonucleotide molecules that are predictive of yeast spoilage potential, independent of the STA1 or STA2 genotype, involving specific primers and probes that amplify and detect target nucleic acid molecules, allowing for the identification of diastatic contaminants in brewery products.
Enables the sensitive and conclusive detection of diastatic yeast strains, even in the presence of large amounts of Brewer's yeast, and predicts spoilage potential by identifying specific genomic regions associated with diastatic activity, reducing the risk of over-attenuation and re-fermentation in beer.
Smart Images

Figure 1.1
Abstract
Description
Docket No.02136WO METHODS FOR DETECTING DIASTATIC YEAST CONTAMINANTS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 477,051 filed on December 23, 2022, which is herein incorporated by reference in its entirety. SEQUENCE LISTING
[0002] This application contains a Sequence Listing which has been submitted in electronic format and is hereby incorporated by reference in its entirety. The Sequence Listing is provided as a file entitled 02136WO-Sequence Listing.xml created on November 17, 2023, which is 7530 bytes in size. FIELD OF THE INVENTION
[0003] The present embodiments relate to compositions and methods, mixtures, kits, and systems for detecting diastatic yeast strains independent of the STA1 and STA2 genotype and use for predicting the spoilage potential of brewery products that may be contaminated with diastatic yeast. This application claims the benefit of U.S. Provisional Application No. 63 / 477,051 filed on December 23, 2022, which is herein incorporated by reference in its entirety. BACKGROUND OF THE INVENTION
[0004] Diastatic strains of wild yeasts are a major source of lost revenue in breweries; these beer spoilers are commonly found as contaminants in spoiled brewery products that cannot be sold, such as over-attenuated beer and beer with alcohol by volume (ABV) content above what is legally permissible, and spoiled brewery products that must be recalled, such as re-fermented packaged beer with a high risk of container ruptures. Differentiating diastatic strains of wild yeast from non-diastatic strains is a challenge. Current methods for detecting the contamination of diastatic strains of wild yeast rely on molecular detection assays that are targeted to the yeast glucoamylase genes (STA1 and STA2). However, diastatic strains of S. cerevisiae can lack the STA1 or STA2 gene, while STA1 positive yeast strains can lack diastatic activity. A need exists in the art for a sensitive and conclusive detection assay that can detect yeast strains that are diastatic independent of the STA1 and STA2 genotype of the yeast. The present embodimentsDocket No.02136WO address this need as well as others. In some embodiments, the methods allow for detection of very small amounts of diastatic Saccharomyces cerevisiae strains when mixed with large amounts of, more common Brewer's yeast strains. SUMMARY OF THE INVENTION
[0005] Embodiments herein are directed to mixtures, methods, kits, and systems that allow for the detection of an oligonucleotide molecule derived from Saccharomyces cerevisiae that is predictive of yeast that is diastatic, independently of the STA1 or STA2 genotype, in contaminated brewery products.
[0006] In one embodiment, the disclosure is a method of detecting an organism comprising a target nucleic acid molecule that is substantially homologous with a sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof in a test sample. The method may comprise the step of reacting the test sample with a first primer that specifically hybridizes to a target nucleic acid molecule and a second primer that specifically hybridizes to the target nucleic acid molecule under amplification conditions to produce an amplicon. In some embodiments the first and second primers are each independently, 15 to 40 nucleotides in length. The method may further include the step of detecting the presence or absence of the amplicon.
[0007] In one embodiment, the method may further include the step of reacting the test sample with a probe that specifically binds to the target nucleic acid molecule that the first primer binds to. In this embodiment the detecting step may include detecting a signal from the probe that is indicative of amplification. In some embodiments, the probe is labeled with a detectable label. In some embodiments, the probe includes a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In some embodiments, the probe may include a sequence that is fully homologous to the sequence of SEQ ID NO: 5, SEQ ID NO: 6, or the complements thereof.
[0008] In some embodiments, the first primer includes a sequence that is substantially homologous to the sequence of SEQ ID NO: 2. Additionally, the second primer may include a sequence that is substantially homologous to the sequence of SEQ ID NO: 3. Alternatively, the first primer may be fully homologous to the sequence of SEQ ID NO: 2 and the second primer may be fully homologous to the sequence of SEQ ID NO: 3.Docket No.02136WO
[0009] In some embodiments, the presence of the detectable amplicon is indicative of a contaminant in the test sample.
[0010] In some embodiments, the detecton of the detectable amplicon indicates positive spoilage potential of the test sample. In some embodiments, positive spoilage potential indicates the presence of a contaminating diastatic wild yeast.
[0011] In some embodiments, the first primer and the second primer are configured to amplify the detectable amplicon, and the detectable amplicon is substantially homologous to SEQ ID NO: 4, or a fragment thereof, or a complement thereof. In some embodiments, the detectable amplicon has the sequence of SEQ ID NO: 4, or a fragment thereof, or a complement thereof.
[0012] In some embodiments, the detectable amplicon is produced by a polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).
[0013] In some embodiments, the method includes the step of detecting the detectable amplicon using one or more of the following techniques: direct detection of a measurement of a physical property of the amplicon, for example a measurement of UV absorption at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye, and detecting the dye; complexing the amplicon with a detectable label, and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample; or detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample.
[0014] In some embodiments, the method includes the step of producing and detecting a second detectable amplicon. The second detectable amplicon may include a sequence of the STA1 gene or the sequence of the STA2 gene, a complement thereof, or a fragment thereof. In some embodiments, the method includes the step of producing and detecting a second and a third detectable amplicon. The second detectable amplicon may include a sequence of the STA1 gene, a complement thereof or a fragment thereof and the third detectable amplicon may include the sequence of the STA2 gene, a complement thereof, or a fragment thereof.Docket No.02136WO
[0015] In some embodiments the method includes the step of reacting the test sample in a reaction mixture in which primers which hybridize to a sequence of the STA1 gene are not present, and in which primers which hybridize to a sequence of the STA2 gene are not present.
[0016] In some embodiments, the disclosure is a method of detecting contamination of a food or beverage that includes a target nucleic acid molecule that is substantially homologous to a sequence of SEQ ID NO: 1, or a complement thereof, or a fragment thereof, in a test sample derived from the food or beverage. The method includes the step of reacting the test sample with a first primer that specifically hybridizes to a target nucleic acid molecule and a second primer that specifically hybridizes to the target nucleic acid molecule under amplification conditions to produce an amplicon; and the step of detecting the presence or absence of the amplicon.
[0017] In some embodiments, the first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO: 2 and the second primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO: 3.
[0018] In some embodiments, the method further includes reacting the test sample with a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO: 6.
[0019] The disclosure also includes a kit. In some embodiments the kit includes a primer that includes a sequence that is substantially homologous to SEQ ID NO: 2 or a fragment thereof; a primer that includes a sequence that is substantially complementary to SEQ ID NO: 3 or a fragment thereof; deoxynucleotide triphosphate nucleotides; and a buffer. In some embodiments, the kit may also include a DNA polymerase.
[0020] In some embodiments, the kit may include a probe. In some embodiments, the probe includes a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In some embodiments, the probe includes a sequence that is fully homologous to or fully complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In some embodiments, the probe may be covalently bound to a detectable label. Likewise, in some embodiments at least one of the primers may be covalently bound to the detectable label. The probe also may include a quencher positioned to quench a signal from the detectable label. Such kits may or may not include a DNA polymerase.Docket No.02136WO
[0021] The disclosure also includes a mixture. The mixture may include a primer that is substantially homologous to SEQ ID NO: 2; a primer that is substantially homologous to SEQ ID NO: 3; deoxynucleotide triphosphate nucleotides; a DNA polymerase; a buffer; and a test sample that is suspected of having a nucleic acid that is substantially homologous with a sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof. In some embodiments, the mixgure also includes a probe. In some embodiments, the probe is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO: 6 or fragments thereof. In some embodiments, the mixture further includes primers which hybridize to a gene coding for either or both of STA1 and STA2. In contrast, in some embodiments primers for which hybridize to a gene coding for either STA1 or STA2 are not present.
[0022] The disclosure also includes a system. In some embodiments, the system may include at least one of the mixtures described herein and an instrument configured to perform an amplification assay on the at least one mixture.
[0023] In some embodiments, the system further includes at least one sample vessel. In some embodiments, the at least one mixture is housed in one of the at least one sample vessel. Some embodiments may also include a temperature controlling device.
[0024] What is described is:
[0025] A1. A method of detecting an organism comprising a target nucleic acid molecule that is substantially homologous with a sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof in a test sample, the method comprising: reacting the test sample with a first primer that specifically hybridizes to a target nucleic acid molecule and a second primer that specifically hybridizes to a complement of the target nucleic acid molecule under amplification conditions to produce an amplicon; and detecting the presence or absence of the amplicon.
[0026] A2. The method of clause A1, wherein the method further comprises reacting the test sample with a probe that specifically binds to the target nucleic acid molecule that the firstDocket No.02136WO primer binds to, wherein the detecting step includes detecting a signal from the probe that is indicative of amplification.
[0027] A3. The method of clause A1, wherein the first and second primers are each, independently, 15 to 40 nucleotides in length.
[0028] A4. The method of any one of clauses A1-A3, wherein the first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO: 2 and the second primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO: 3.
[0029] A5. The method of clause A1, wherein the first primer comprises a sequence that is fully homologous to the sequence of SEQ ID NO: 2 and the second primer comprises a sequence that is fully homologous to the sequence of SEQ ID NO: 3.
[0030] A6. The method of clause A2, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO: 6.
[0031] A7. The method of clause A2, wherein the probe comprises a sequence that is fully homologous to the sequence of SEQ ID NO: 5, SEQ ID NO: 6, or the complements thereof.
[0032] A8. The method of clause A2, wherein the probe is labeled with a detectable label.
[0033] A9. The method of clause A1, wherein the presence of the detectable amplicon is indicative of a contaminant in the test sample.
[0034] A10. The method of clause A1, wherein the detection of the detectable amplicon indicates positive spoilage potential.
[0035] A11. The method of clause A10, wherein positive spoilage potential indicates the presence of a contaminating diastatic wild yeast.
[0036] A12. The method of clause A1, wherein the first primer and the second primer are configured to amplify the detectable amplicon, wherein the detectable amplicon is substantially homologous to SEQ ID NO: 4, or a fragment thereof, or a complement thereof.
[0037] A13. The method of clause A1, wherein the detectable amplicon has the sequence of SEQ ID NO: 4, or a fragment thereof, or a complement thereof.Docket No.02136WO
[0038] A14. The method of clause A1, wherein the detectable amplicon is produced by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).
[0039] A15. The method of clause A1, wherein the step of detecting the detectable amplicon comprises one or more from the group consisting of: direct detection of a measurement of a physical property of the amplicon, for example a measurement of UV absorption at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye, and detecting the dye; complexing the amplicon with a detectable label, and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample; or detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample.
[0040] A16. The method of clause A1, further comprising a step of producing and detecting a second detectable amplicon, wherein the second detectable amplicon comprises a sequence of the STA1 gene or the sequence of the STA2 gene, a complement thereof, a fragment thereof.
[0041] A17. The method of clause A1, further comprising a step of producing and detecting a second and a third detectable amplicon, wherein the second detectable amplicon comprises a sequence of the STA1 gene and wherein the third detectable amplicon comprises a sequence of the STA2 gene.
[0042] A18. The method of clause A1, wherein primers configured to amplify a sequence of the STA1 gene are not present, and wherein primers configured to amplify a sequence of the STA2 gene are not present.Docket No.02136WO
[0043] B1. A method of detecting a contaminant in a food or beverage comprising a target nucleic acid molecule that is substantially homologous to a sequence of SEQ ID NO: 1, or a complement thereof, or a fragment thereof, the method comprising: reacting a test sample derived from the food or beverage with a first primer that specifically hybridizes to a target nucleic acid molecule and a second primer that specifically hybridizes to a complement of the target nucleic acid molecule under amplification conditions to produce an amplicon; and detecting the presence or absence of the amplicon.
[0044] B2. The method of clause B1, wherein the first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO: 2 and the second primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO: 3.
[0045] B3. The method of clause B2, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO: 6.
[0046] C1. A kit, comprising: a primer that comprises a sequence that is substantially homologous to SEQ ID NO: 2 or a fragment thereof; and a primer that comprises a sequence that is substantially homologous to SEQ ID NO: 3 or a fragment thereof.
[0047] C2. The kit of clause C1, further comprising at least one of the following: a DNA polymerase, deoxynucleotide triphosphate nucleotides, a buffer.
[0048] C3. The kit of either of clauses C1 or C2, further comprising a probe.
[0049] C4. The kit of clause C3, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO: 6.
[0050] C5. The kit of clause C3, wherein the probe is covalently bound to a detectable label.Docket No.02136WO
[0051] C6. The kit of clause C5, wherein the probe also includes a quencher positioned to quench a signal from the detectable label.
[0052] C7. The kit of clause C1, wherein at least one of the primers is covalently bound to a detectable label.
[0053] D1. A mixture comprising: a primer that is substantially homologous to SEQ ID NO: 2; a primer that is substantially homologous to SEQ ID NO: 3; deoxynucleotide triphosphate nucleotides; a DNA polymerase; a buffer; and a test sample that is suspected of having a nucleic acid that is substantially homologous with a sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof.
[0054] D2. The mixture of clause D1, further comprising a probe.
[0055] D3. The mixture of clause D2, wherein the probe is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO: 6 or fragments thereof.
[0056] D4. The mixture of clause D1, further comprising primers which hybridize to a gene coding for either or both of STA1 and STA2.
[0057] D5. The mixture of clause D1, wherein primers configured to amplify STA1 and STA2 are not present.
[0058] E1. A system comprising: at least one of the mixtures of any one of clauses C1-C5; and an instrument configured to perform an amplification assay on the at least one mixture.Docket No.02136WO
[0059] E2. The system of clause E1, further comprising at least one sample vessel.
[0060] E3. The system of clause E2, wherein each of the at least one mixture is housed in one of the at least one sample vessel respectively.
[0061] E4. The system of clause E3, further comprising at least one sample temperature controlling device. BRIEF DESCRIPTION OF THE DRAWINGS
[0062] For the purpose of illustrating the embodiments, there are shown in the drawings exemplary embodiments. It should be understood, however, that the embodiments are not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
[0063] FIG.1 depicts SEQ ID NO: 1 and is annotated with the primers of SEQ ID NO: 2 and SEQ ID NO: 3 and the probe of SEQ ID NO: 5.
[0064] FIG.2 depicts an alignment view of the sequence of SEQ ID NO: 4 to the sequence of SEQ ID NO: 1. The sequence of SEQ ID NO: 4 is underlined within the sequence of SEQ ID NO: 1.
[0065] FIGs.3A-3C depict a schematic view that depicts the relationship between the presence of the predictive region (SEQ ID NO: 1) within the genome of a wild yeast strain, the predicted diastatic activity of the total yeast within a brewery product sample, and the predicted spoilage potential in a brewery product sample.
[0066] FIG.4 illustrates a block diagram of an exemplary embodiment of a thermal cycling system in accordance with aspects of the disclosure. DETAILED DESCRIPTION
[0067] The present disclosure provides for compositions and methods of use for the detection of diastatic strains of wild yeast in contaminated brewery products, wherein the detection of the diastatic strains of wild yeast is independent of the STA1 or STA2 genotype of said yeast. The present disclosure additionally provides for compositions and methods of use for the prediction of the spoilage potential of brewery products contaminated with wild yeast.Docket No.02136WO
[0068] Various compositions and methods are described in the embodiments herein. The embodiments can be combined with one another. It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. All references cited herein are incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the subject matter is not entitled to antedate such disclosure by virtue of prior invention. The use of examples anywhere in the specification, including examples of any terms discussed herein, is illustrative only, and in no way limits the scope and meaning of the disclosure or any exemplified term. Likewise, the disclosure is not limited to its preferred embodiments.
[0069] That the disclosure may be more readily understood, select terms are defined.
[0070] Unless defined otherwise, all technical and scientific terms have the same meaning as is commonly understood by one of ordinary skill in the art to which the embodiments disclosed belongs. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the compositions and methods of the disclosure and how to use them. Moreover, it will be appreciated that the same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of the other synonyms.
[0071] Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
[0072] The articles “a,” “an,” and “the” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “a sample” means one sample or more than one sample.
[0073] As used herein, the adverbs “about” or “approximately” means that the numerical value is approximate and small variations would not significantly affect the practice of the disclosed embodiments. Where a numerical limitation is used, unless indicated otherwise by the context, “about” means the numerical value can vary by ±5% and remain within the scope of the disclosed embodiments. Thus, about 100 means 95 to 105.Docket No.02136WO
[0074] As used herein, the term “sample” means any fluid medium or liquid that may contain a particular item (e.g., analyte) or that is suspected of containing a particular item. In some embodiments, samples may be used which are high in dissolved solids without further processing. In some embodiments, samples containing high solids (non-dissolved) may be analyzed through the use of a filter or used in conjunction with additional manual steps. In some embodiments, samples are non-filtered. In some embodiments, samples are filtered. In some embodiments, samples are purified. In some embodiments, samples are non-purified. Samples may be a liquid, a suspension, extracted or dissolved sample, or a supercritical fluid. If a sample is going to be used in a flow device (vertical or lateral) some flow properties should exist in the sample or sample extract or be added to the sample or sample extract to allow flow through the devices and systems described herein. Examples of samples include, but are not limited to, food swabs, food extracts, food suspensions, food cultures, yeast cultures, amplification reactions, PCR reactions, and the like. The sample may also be derived from another sample. For example, a PCR reaction may be performed on a nucleic acid mixture that has been extracted, isolated, and / or purified from another sample (e.g., beer). The PCR reaction would be considered to be a sample derived from another sample.
[0075] As used herein, the term “beverage” means a liquid for drinking. As used herein, the term “food” refers to any raw, cooked, or processed edible substance, ice, beverage, or ingredient used or intended for use in whole or in part for human consumption. The term food includes food suspensions and food cultures. The terms “food suspension” and “food solution” are used interchangeably throughout this application to refer to raw, cooked, or processed food that is in a solution, or that has been placed or suspended in a solution. Non- limiting examples of food suspensions include fermented alcoholic beverages, malt beverages, brews, and beer. A food suspension may be mixed, vortexed or blended. A food suspension may also be filtered or unfiltered. As used herein, a “food culture” is a food sample that is cultured under conditions to enrich the sample. This process can also be referred to as “enrichment.”
[0076] As used herein, the term “beer” refers to any beer, ale, porter, stout, or other similar fermented beverage, brewed or produced from malt, wholly or in party, or from any substituteDocket No.02136WO for malt. The term beer included packaged beer and unpackaged beer. This definition includes alcoholic beer and non-alcoholic beer.
[0077] The process of manufacturing beer is called “brewing.” As used herein, the term “brewing” refers to any processing stage that can be used to manufacture beer. Brewing stages include, but are not limited to, malting, milling, mashing, lautering, boiling, fermentation, conditioning, filtering, and packaging. Malting and fermentation are critical and necessary stages for brewing.
[0078] As used herein, the term “brew” refers to beer at any stage in the brewing process prior to packaging into any container that can hold beer, such as a bottle or a can. The term brew includes malt and fermented malt.
[0079] As used herein, the term “brewery product” includes any food, beverage, brew, or beer that is produced during brewing.
[0080] The term “spoilage,” as used herein, refers to the process through which a food becomes unsuitable for ingestion. Spoilage in a brewery product can include changes in taste, flavor, aroma, viscosity, body, aroma, odor, and appearance in a way that is undesirable, or the presence of an ingredient, such as ethanol, that is outside of the legal limit. Spoilage events can include over-attenuation and re-fermentation events.
[0081] The term “spoilers” refers to any microorganisms that can cause spoilage in food. A beer spoiler is any microorganism that that can change the flavor, aroma, or appearance of beer, or otherwise cause beer spoilage, in a manner deemed undesirable by the brewer. Non-limiting examples of beer spoilers include diastatic strains of wild yeast, for example, Saccharomyces cerevisiae variant diastaticus (S. cerevisiae var. diastaticus).
[0082] As used herein, the term “malt” refers to a product made from cereal grain that is used in beverages and foods as a basis for fermentation. Malt typically includes maltose. Malt can additionally include starch and non-starch polysaccharides, for example, dextrins.
[0083] As used herein, the term “diastase” refers to any enzyme from a group of glycosidases that can convert a starch or polysaccharide into a fermentable sugar, typically maltose. Non- limiting examples of diastases include amylases, for example, α-amylase and β-amylase.Docket No.02136WO
[0084] The terms “glucoamylase” and “amyloglucosidases” are used interchangeably throughout this application to refer to any maltase that can additionally digest starch and non-starch polysaccharides, including, but not limited to dextrins, into glucose. Non-limiting examples of glucoamylases include the yeast glucoamylase S1 (STA1) and the yeast glucoamylase S2 (STA2).
[0085] As used herein, the term “malt enzymes” refers to any mixture of enzymes used during the conversion of cereal grain into malt. Malt enzymes can include glycosidases, for example, β- glucanase, and diastases, for example, α-amylase and β-amylase. As used herein, the term “malt enzymes” specifically excludes maltases and glucoamylases.
[0086] As used herein, the term “malting” refers to the process of converting cereal grain into malt.
[0087] As used herein, the term “desirable yeast” is used to refer to any yeast that is added during the brewing process purposefully. As used herein, the term “wild yeast” refers to any yeast species or strain that is not purposefully added during brewing.
[0088] As used herein, the term “attenuation” refers to the percentage of fermentable sugars that is converted into alcohol and CO2during brewing or after packaging a brewery product. As used herein, “low attenuation” refers to attenuation less than 72%. As used herein, “medium attenuation” refers to attenuation between 72% and 77%. As used herein, “high attenuation” refers to attenuation above 77%. A brewery product that does not reach desirable attenuation is said to be “under-attenuated.” As used herein, the term “over-attenuated” refers to attenuation beyond what is desired for a brewery product.
[0089] As used herein, the term “re-fermented” refers to a brewery product that has been fermented after filtering and / or packaging.
[0090] The term “diastatic activity” refers to the activity of diastases, particularly to diastases used during the process of brewing. Examples of enzymes that contribute to diastatic activity include, but are not limited to, malt enzymes and endogenous yeast enzymes. The term “diastatic power,” as used herein, specifically refers to the activity of diastases in malt enzymes. As used herein, the term “diastatic potential” refers to the potential for yeast to add active diastases to a brewery product. Unless otherwise defined by context, as used herein, “diastatic activity” refersDocket No.02136WO to the combined diastatic power and diastatic potential of the malt enzymes and endogenous yeast enzymes present in a brewery product, including in a malt, a brew, or a packaged beer. Both desirable yeast and wild yeast strains can contribute to the diastatic activity of a brewery product.
[0091] As used herein, the term “high diastatic activity” refers to diastatic activity that leads to > 77% attenuation in a brewery product. Likewise, as used herein, “low diastatic activity” refers to diastatic activity that leads to < 72% attenuation in a brewery product. The term “medium diastatic activity” refers to diastatic activity that leads to between 72% and 77% attenuation in a brewery product. Thus, high diastatic activity leads to high attenuation and low diastatic activity leads to low attenuation.
[0092] As used herein, “diastatic yeast” and “diastatic strain” are used interchangeably throughout this application to refer to any wild yeast strain with a high diastatic potential that can be added to a brewery product through contamination. A yeast with a high diastatic potential is a yeast that has the potential to significantly increase the diastatic activity of a brewery product beyond that which is desired.
[0093] As used herein, the term “detecting” or “detection” is used in the broadest sense to include qualitative and / or quantitative measurements of an analyte.
[0094] As used herein, the terms “analyte” refers to a substance being measured in an analytical procedure. Non-limiting examples of analytes include RNA, DNA, nucleic acid molecules encoded by a cell, synthetic nucleic acid molecules, and amplification products (e.g. amplicons).
[0095] An “amplicon,” as described herein, is an amplification product. An amplicon can be produced by amplifying a nucleic acid sequence from a test sample. An amplicon can include, but is not limited to, a PCR product.
[0096] A “PCR product,” as described herein, refers to any product produced as a result of a PCR reaction.
[0097] Without wishing to be bound by theory, an amplicon can be produced by amplifying a nucleic acid molecule through many means, and the amplicon can be detected through many means. Non-limiting examples of DNA amplification reactions include polymerase chainDocket No.02136WO reaction (PCR), isothermal amplification, ligase chain reaction (LCR), and rolling circle replication (RCR). Non-limiting examples of PCR reactions include emulsion PCR, real time PCR (RT-PCR), multiplex PCR, long-range PCR, single-cell PCR, fast-cycling PCR, methylation-specific PCR (MSP), hot start PCR, high-fidelity PCR, rapid amplified polymorphic DNA analysis (RAPD), rapid amplification of cDNA ends (RACE), in situ PCR, differential display PCR, and bridge PCR (bPCR) amplification. Non-limiting examples of isothermal reactions include isothermal amplification is LOOP-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), thermophilic helicase-dependent amplification (tHDA), rolling-circle amplification (RCA),multiple displacement amplification (MDA), recombinase polymerase amplification (RPA), nucleic acid sequence-based amplification (NASBA), self-sustained sequence reaction (3SR), strand displacement amplification (SDA), transcription-mediated amplification (TMA), and bridge amplification.
[0098] An amplicon can be detected following amplification, e.g., with a DNA gel, a lateral flow detection device, or a vertical flow detection device. Alternatively, the predictive region, or a fragment thereof, or a complement thereof, may be amplified and the resulting amplicon may be detected in real-time or post-amplification. In one aspect, positive amplification of DNA may be monitored in real-time using dsDNA binding dyes such as SYBR Green or EvaGreen®.
[0099] As used herein, “target nucleic acid” or grammatical equivalent thereof can refer to nucleic acid molecules or sequences that it is desired to identify, detect, hybridize to, sequence, analyze and / or further manipulate.
[0100] As used herein, the term “probe” is defined as a detectable, illustratively partially single-stranded and often entirely single-stranded, polynucleotide, for example, an oligonucleotide, capable of specifically hybridizing to a target nucleic acid.
[0101] As used herein, “specifically hybridizes” means that a probe, primer, or oligonucleotide recognizes and physically interacts (that is, base-pairs) with a substantially complementary nucleic acid (for example, a sample nucleic acid) under high stringency conditions, and does not substantially base pair with other nucleic acids. By “high stringency conditions” is meant conditions configured to allow for identification of target nucleic acid sequences. Such conditions typically occur at about Tm minus 5°C (5° below the Tm of the probe). Functionally, high stringency conditions are used to identify nucleic acid sequences having at least 80%Docket No.02136WO sequence identity. In some embodiments, this may mean at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.
[0102] As used herein, a “substantially complementary” nucleic acid means that the nucleic acid specifically hybridizes to the designated sequence. As used herein, “substantially homologous” means that the nucleic acid specifically hybridizes to the complement of the designated sequence.
[0103] The yeast STA1 and STA2 genes encodes for glucoamylase S1 and glucoamylase S2, which are exo-enyzmes that can hydrolyze and release glucose one unit at a time from the non- reducing end of polysaccharides, including starches, dextrins, oligonucleotides, and dinucleotides, in an uncontrollable manner. As used herein, “Saccharomyces cerevisiae variant diastaticus (S. cerevisiae var. diastaticus)” and “Saccharomyces diastaticus (S. diastaticus)” are used interchangeably to refer to any variant of Saccharomyces cerevisiae that carries the STA1 and / or the STA2 gene. As used herein, “STA1+ yeast” refers to any Saccharomyces or non- Saccraromyces yeast that has the STA1 gene. As used herein, “STA2+ yeast” refers to any Saccharomyces or non-Saccraromyces yeast that has the STA2 gene. As used herein, “STA1- / STA2- yeast” refers to any Saccharomyces or non-Saccraromyces yeast that lacks both the STA1 and STA2 genes.
[0104] Often, yeast strains carrying the STA1 and / or STA2 genes are diastatic yeast. Phenotypic studies evaluating the diastatic potential of wild strains of S. cerevisiae show that strains carrying STA1 or STA2 exhibit higher levels of attenuation and beer-spoilage compared to desirable S. cerevisiae strains. Currently, breweries rely on the molecular detection assays that target the STA1 or STA2 gene in order to detect the presence of diastatic contaminating wild yeast strains in brewery product samples and predict a brewery product’s spoilage potential. However, some diastatic yeasts lack the STA1 and STA2 genes, and some STA1 or STA2 strains of S. cerevisiae var. diastaticus lack diastatic ability altogether (Krogergus et al., 2019).
[0105] A previously unannotated DNA sequence within the Saccharomyces cerevisiae genome was identified to be predictive of diastatic activity and beer spoilage in of both STA1+ and STA1- strains. The unannotated genomic region was identified to be within the broad region of chromosome 7, comprising the sequence of SEQ ID NO: 1:Docket No.02136WO ACGCGAGAATACTAAGCCCAAGCCTCTCCAAATTGATTTCCTTTTGGTACTGAAAG ACTTAGTATCAACCTCAAAAAGTTGAAATTTCTGTAGATAAATATGCAGATGACAT GAAGTACCCAGTTCTTTTGTGAATATGGAAGTAGTTTTCTTTCAAATCGTTATTAA TATTTCCTCTGCCCTCTTCACCTTATAGCTTTAGGAAACACTACTCTATTCATATT CAACTAAAAAAGTAGTATATTTCCTTCCGTTAGAATTGTGGTACAAACCAGCGCAA TATAAACCCTGATTGCCTCATGCGAGACTTTCAGTAAACATCAATCTCCATACATA TCCTATCATCCTTAATTGGTAGAATAGACTTGCATTTAGTCGACGAAAGTCTACCA CTTCAACTTTTTTTTATCCTTTTTATATTAGGACCTGGCCTACCATTCTTCTGTTG TTCTTAATATTATCTTACGAGCATTATATGAGTTTTCATGAACTTTAATGTATACC AATATACCTCTACAAATTATTACATCGTAAAAGCTTGTTCAAACCGACACTCAATT TACTAGCGTTCATTTCACTTAGACTCAGGTTGGTTGGAAATTGGTTAAATGGACAG ACCGTGTTCCATCTCAAGAATTTACTGCACAACGCTAATCAAGAACTAACTGTCGA AGTAATTAGCGGTTTGAACGCGCTTGACAAATGTTCTATTGAAAAAGTGATGTCCT CTGAAGAGTAAAGGCACTATGGGGCGTTGCAACTAAAGGAGATATTAGATTCATCA AAAGTGAGATTTTTTCATAAAACATGAGTCTATATCAGGTGAAACAGTTTGAGGCA GCCTTAATATGGAACTGAAAAAGCAAAATCAAAGGCAAAAGTTTCTCATATATATA TGGCATTGTTGATCACCCAGTGC (SEQ ID NO: 1).
[0106] As used herein, the terms “nucleic acid”, “nucleic acid molecule”, and “nucleotide” are intended to be consistent with their use in the art and to include naturally occurring species or functional analogs thereof. Nucleic acids comprise one or more nucleotides and can include oligonucleotides, polynucleotides and the like. As used herein, “polynucleotide”, “nucleic acid molecule”, and “nucleic acid”, may be used interchangeably, and can refer to a polymeric form of nucleotides of any length, for example either ribonucleotides or deoxyribonucleotides. As used herein, “oligonucleotide” denotes a single-stranded multimer of nucleotides of from about 2 to 200 nucleotides, up to 500 nucleotides in length, illustratively from about 15 to about 40 nucleotides in length, about 16 to about 25 nucleotides in length, about 18 to about 22 nucleotides in length, about 26 to about 34 nucleotides in length, or about 28 to about 32 nucleotides in length, such as 18, 19, 20, 21, or 22 nucleotides, including for a primer, and, for example, 28, 29, 30, 31, or 32 nucleotides, for example, for a probe. Oligonucleotides may be synthetic or may be made enzymatically. An example nucleic acid molecule is DNA, which may include a deoxyribonucleotide or modified deoxyribonucleotide. As used herein, the term “nucleotide” also is intended to encompass any nucleotide analogue which is a type of nucleotide that includes a modified nucleobase, sugar and / or phosphate moiety compared to naturally occurring nucleotides.
[0107] In some embodiments, a first primer is provided that specifically hybridizes to to SEQ ID NO: 1, or a fragment thereof, or a complement thereof. In some embodiments, a second primer is provided that specifically hybridizes to to SEQ ID NO: 1, or a fragment thereof, or aDocket No.02136WO complement thereof. In some embodiments, the first primer and the second primer are configured to amplify a fragment of SEQ ID NO: 1, or a complement thereof, that is about 150- 800, about 150-700, about 150-600, about 150-500, about 200-1000, about 200-900, about 200- 800, about 200-700, abouat 200-600, about 200-500, about 500-1000, about 500-900, about 500- 800, about 500-700, about 500-600, about 600-1000, about 600-900, about 600-800, about 600- 700, about 700-1000, about 700-900, about 700-800, about 800-1000, about 800-900, or about 900-1000 nucleotides in length. In some embodiments, the first primer and the second primer are configured to amplify a fragment of SEQ ID NO: 1, or a complement thereof, that is about 40-200, about 40-150, about 40-100, about 200-450, about 250-500, about 250-450, about 300- 500, about 300-450, about 350-500, about 350-450, about 400-500, about 400-450, about 400- 425, about 400-420, about 405-425, about 410-430, about 400-415, about 405-420, about 410- 425, about 405-415, about 410-420, about 410-415, about 300-800, about 300-700, about 300- 600, about 400-800, about 400-700, or about 400-600 nucleotides in length.
[0108] In some embodiments, the primer has a sequence that is substantially homologous to the sequence of SEQ ID NO: 2: CCCTGATTGCCTCATGCGA (SEQ ID NO: 2), or the complement thereof.
[0109] In some embodiments, the primer has a sequence that is substantially homologous to the sequence of SEQ ID NO: 3: TCAAGCGCGTTCAAACCG (SEQ ID NO: 3), or the complement thereof.
[0110] In some embodiments, the probe has a sequence that is substantially homologous to the sequence of SEQ ID NO: 5: CGTAAAAGCTTGTTCAAACCGGCACTCA (SEQ ID NO: 5).Docket No.02136WO
[0111] In some embodiments, the probe has a sequence that is substantially homologous to the sequence of SEQ ID NO: 6: CTCAATTTACTAGCGTTCATTTCACTTAG (SEQ ID NO: 6).
[0112] In some embodiments, the probe includes detectable label covalently bound to the probe. Non-limiting examples of detectable labels include: 1,5 IAEDANS; 1,8-ANS; 2′-chloro- 7′phenyl-1,4-dichloro-6-carboxyfluorescein (VIC); 3(4)-carboxyfluorescein dipivalate NHS ester; 3(4)-carboxyfluorescein dipivalate hydroxyhexyl carboxamide; 3(4)-carboxyfluorescein dipivalate hydroxyhexyl carboxamide phosphoramidite; 3(4)-carboxyfluorescein dipivaloyl-N- succinimidyl ester; 4-Methylumbelliferone; 5-carboxy-2,7-dichlorofluorescein; 5- Carboxyfluorescein (5-FAM); 5-Carboxynapthofluorescein; 5-carboxyfluorescein dipivalate; 5- Carboxytetramethylrhodamine (5-TAMRA); 5-FAM (5-Carboxyfluorescein); 5-HAT (Hydroxy Tryptamine); 5-Hydroxy Tryptamine (HAT); 5-ROX (carboxy-X-rhodamine); 5-TAMRA (5- Carboxytetramethyirhodamine); 6-Carboxyfluorescein (6-FAM); 6-carboxyfluorescein dipivalate; 6-carboxynapthofluorescein; 6-Carboxyrhodamine 6G; 6-CR 6G; 6-JOE; 7-Amino-4- methylcoumarin; 7-Aminoactinomycin D (7-AAD); 7-Hydroxy-4-methylcoumarin; 9-Amino-6- chloro-2-methoxyacridine; ABQ; ABY; Acid Fuchsin; ACMA (9-Amino-6-chloro-2- methoxyacridine); Acridine Orange; Acridine Red; Acridine Yellow; Acriflavin; Acriflavin Feulgen SITSA; Alexa Fluor 350; Alexa Fluor 405; Alexa Fluor 430; Alexa Fluor 488; Alexa Fluor 500; Alexa Fluor 514; Alexa Fluor 532; Alexa Fluor 546; Alexa Fluor 555; Alexa Fluor 568; Alexa Fluor 594; Alexa Fluor 610; Alexa Fluor 633; Alexa Fluor 635; Alizarin Complexon; Alizarin Red; AMC; AMCA-S; AMCA (Aminomethylcoumarin); AMCA-X; Aminoactinomycin D; Aminocoumarin; Aminomethylcoumarin (AMCA); Anilin Blue; Anthrocyl stearate; APTRA- BTC; APTS; Astrazon Brilliant Red 4G; Astrazon Orange R; Astrazon Red 6B; Astrazon Yellow 7 GLL; Atabrine; ATTO 390; ATTO 425; ATTO 465; ATTO 488; ATTO 495; ATTO 520; ATTO 532; ATTO 550; ATTO 565; ATTO 590; ATM 594; ATTO 610; ATTO 611X; ATTO 620; ATTO 633; ATTO 635; ATTO 647; ATTO 647N; ATTO 655; ATTO 680; ATTO 700; ATTO 725; ATTO 740; ATTO-TAG CBQCA; ATTO-TAG FQ; Auramine; Aurophosphine G; Aurophosphine; BAO 9 (Bisaminophenyloxadiazole); BCECF (high pH); BCECF (low pH); Berberine Sulphate; Bimane; Bisbenzamide; Bisbenzimide (Hoechst); bis-BTC; BlancophorDocket No.02136WO FFG; Blancophor SV; BOBO-1; BOBO-3; Bodipy 492 / 515; Bodipy 493 / 503; Bodipy 500 / 510; Bodipy 505 / 515; Bodipy 530 / 550; Bodipy 542 / 563; Bodipy 558 / 568; Bodipy 564 / 570; Bodipy 576 / 589; Bodipy 581 / 591; Bodipy 630 / 650-X; Bodipy 650 / 665-X; Bodipy 665 / 676; Bodipy Fl; Bodipy FL ATP; Bodipy Fl-Ceramide; Bodipy R6G; Bodipy TMR; Bodipy TMR-X conjugate; Bodipy TMR-X; SE; Bodipy TR; Bodipy TR ATP; Bodipy TR-X SE; BO-PRO-1; BO-PRO-3; Brilliant Sulphoflavin FF; BTC; BTC-5N; Calcein; Calcein Blue; Calcium Crimson; CAL Fluor Gold 540; CAL Fluor Orange 560; CAL Fluor Red590; CAL Fluor Red 610; CAL Fluor 635; Calcium Green; Calcium Green-1 Ca2+ Dye; Calcium Green-2 Ca2+; Calcium Green-5N Ca2+; Calcium Green-C18 Ca2+; Calcium Orange; Calcofluor White; carboxyfluorescein diacetate; carboxyfluorescein diacetate succinimidyl ester; carboxyfluorescein dipivalate succinimide ester; carboxyfluorescein succinimidyl ester (CFSE); Carboxy-X-rhodamine (5-ROX); Cascade Blue; Cascade Yellow; Catecholamine; CCF2 (GeneBlazer); CFDA; Chromomycin A; Chromomycin A; CL-NERF; CMFDA; Coumarin Phalloidin; CPM Methylcoumarin; CTC; CTC Formazan; Cy2; Cy3.18; Cy3.5; Cy3; Cy5.18; cyclic AMP Fluorosensor (FiCRhR); Dabcyl; Dansyl; Dansyl Amine; Dansyl Cadaverine; Dansyl Chloride; Dansyl DHPE; Dansyl fluoride; DAPI; Dapoxyl; Dapoxyl 2; Dapoxyl 3′ DCFDA; DCFH (Dichlorodihydrofluorescein Diacetate); DDAO; DHR (Dihydorhodamine 123); Di-4-ANEPPS; Di-8-ANEPPS (non-ratio); DiA (4-Di- 16-ASP); Dichlorodihydrofluorescein Diacetate (DCFH); DiD—Lipophilic Tracer; DiD (DiIC18(5)); DIDS; Dihydorhodamine 123 (DHR); DiI (DiIC18(3)); Dinitrophenol; DiO (DiOC18(3)); DiR; DiR (DiIC18(7)); dipivaloyl-3(4)-(N-(6’-hydroxyhexul))-carboxamide; DM- NERF (high pH); DNP; Dopamine; DTAF; DY-630-NHS; DY-635-NHS; DyLight 405; DyLight 488; DyLight 549; DyLight 633; DyLight 649; DyLight 680; DyLight 800; ELF 97; Eosin; Erythrosin; Erythrosin ITC; Ethidium Bromide; Ethidium homodimer-1 (EthD-1); Euchrysin; EukoLight; Europium (III) chloride; Fast Blue; FDA; Feulgen (Pararosaniline); FIF (Formaldehyd Induced Fluorescence); FITC; Flazo Orange; Fluo-3; Fluo-4; Fluorescein (FITC); Fluorescein amidite (FAM); Fluorescein Diacetate; fluorescein diacetate 6-isothiocyanate; fluorescein dipivaloyl amidite; fluorescein phosphoramidite; Fluoro-Emerald; Fluoro-Gold (Hydroxystilbamidine); Fluor-Ruby; FluorX; FM 1-43; FM 4-46; Fura Red (high pH); Fura Red / Fluo-3; Fura-2; Fura-2 / BCECF; Genacryl Brilliant Red B; Genacryl Brilliant Yellow 10GF; Genacryl Pink 3G; Genacryl Yellow SGF; GeneBlazer (CCF2); Gloxalic Acid; Granular blue; Haematoporphyrin; HEX; Hoechst 33258; Hoechst 33342; Hoechst 34580; HPTS;Docket No.02136WO Hydroxycoumarin; Hydroxystilbamidine (FluoroGold); Hydroxytryptamine; Indo-1; high calcium; Indo-1; low calcium; Indodicarbocyanine (DiD); Indotricarbocyanine (DiR); Intrawhite Cf; JC-1; JOE; JO-JO-1; JO-PRO-1; JUN; LaserPro; Laurodan; LDS 751 (DNA); LDS 751 (RNA); Leucophor PAF; Leucophor SF; Leucophor WS; Lissamine Rhodamine; Lissamine Rhodamine B; Calcein / Ethidium homodimer; LOLO-1; LO-PRO-1; Lucifer Yellow; Lyso Tracker Blue; Lyso Tracker Blue-White; Lyso Tracker Green; Lyso Tracker Red; Lyso Tracker Yellow; LysoSensor Blue; LysoSensor Green; LysoSensor Yellow / Blue; Mag Green; Magdala Red (Phloxin B); Mag-Fura Red; Mag-Fura-2; Mag-Fura-5; Mag-Indo-1; Magnesium Green; Magnesium Orange; Malachite Green; Marina Blue; Maxilon Brilliant Flavin 10 GFF; Maxilon Brilliant Flavin 8 GFF; Merocyanin; Methoxycoumarin; Mitotracker Green FM; Mitotracker Orange; Mitotracker Red; Mitramycin; Monobromobimane; Monobromobimane (mBBr-GSH); Monochlorobimane; MPS (Methyl Green Pyronine Stilbene); NBD; NBD Amine; Nile Red; Nitrobenzoxadidole; Noradrenaline; Nuclear Fast Red; Nuclear Yellow; Nylosan Brilliant lavin EBG; Oregon Green; Oregon Green 488-X; Oregon Green; Oregon Green 488; Oregon Green 500; Oregon Green 514; Pacific Blue; Pararosaniline (Feulgen); PBFI; Phloxin B (Magdala Red); Phorwite AR; Phorwite BKL; Phorwite Rev; Phorwite RPA; Phosphine 3R; PKH26 (Sigma); PKH67; PMIA; Pontochrome Blue Black; POPO-1; POPO-3; PO-PRO-1; PO-PRO-3; Primuline; Procion Yellow; Propidium Iodid (PI); PyMPO; Pyrene; Pyronine; Pyronine B; Pyrozal Brilliant Flavin 7GF; QSY 7; Quinacrine Mustard; Resorufin; RH 414; Rhod-2; Rhodamine; Rhodamine 110; Rhodamine 123; Rhodamine 5 GLD; Rhodamine 6G; Rhodamine B; Rhodamine B 200; Rhodamine B extra; Rhodamine BB; Rhodamine BG; Rhodamine Green; Rhodamine Phallicidine; Rhodamine Phalloidine; Rhodamine Red; Rhodamine WT; Rose Bengal; S65A; S65C; S65L; S65T; SBFI; Serotonin; Sevron Brilliant Red 2B; Sevron Brilliant Red 4G; Sevron Brilliant Red B; Sevron Orange; Sevron Yellow L; SITS; SITS (Primuline); SITS (Stilbene Isothiosulphonic Acid); SNAFL calcein; SNAFL-1; SNAFL-2; SNARF calcein; SNARF1; Sodium Green; SpectrumAqua; SpectrumGreen; SpectrumOrange; Spectrum Red; SPQ (6-methoxy-N-(3-sulfopropyl)quinolinium); Stilbene; Sulphorhodamine B can C; Sulphorhodamine Extra; SUN; SYBR Green; SYTO 11; SYTO 12; SYTO 13; SYTO 14; SYTO 15; SYTO 16; SYTO 17; SYTO 18; SYTO 20; SYTO 21; SYTO 22; SYTO 23; SYTO 24; SYTO 25; SYTO 40; SYTO 41; SYTO 42; SYTO 43; SYTO 44; SYTO 45; SYTO 59; SYTO 60; SYTO 61; SYTO 62; SYTO 63; SYTO 64; SYTO 80; SYTO 81; SYTO 82; SYTO 83;Docket No.02136WO SYTO 84; SYTO 85; SYTOX Blue; SYTOX Green; SYTOX Orange; TAMARA; Tetracycline; tetrachlorofluorescein (TET); Tetramethylrhodamine (TAMRA); Texas Red; Texas Red-X conjugate; Thiadicarbocyanine (DiSC3); Thiazine Red R; Thiazole Orange; Thioflavin 5; Thioflavin S; Thioflavin TCN; Thiolyte; Thiozole Orange; Tinopol CBS (Calcofluor White); TMR; TO-PRO-1; TO-PRO-3; TO-PRO-5; TOTO-1; TOTO-3; TRITC (tetramethylrodamine isothiocyanate); True Blue; TruRed; Ultralite; Uranine B; Uvitex SFC; WW 781; X-Rhodamine; XRITC; Xylene Orange; Y66F; Y66H; Y66W; Yamika Yellow; YO-PRO-1; YO-PRO-3; YOYO-1; or YOYO-3, or any combination thereof.
[0113] In some embodiments, the probe additionally comprises a quencher of a detectable label, wherein the quencher of a detectable label is covalently bound to the probe. In some embodiments, the quencher is selected from the group consisting of: BBQ-650, BHQ-1, BHQ-2, BHQ-3, Black Hole Quencher (BHQ), Dabcyl, Eclipse, IBFQ, Iowa Black, TAMARA, TAMRA, ZEN, or ZEN Iowa Black, or any combination thereof. However, it is understood that these are non-limiting examples of quenchers.
[0114] In some embodiments, the quenching of the detectable label ceases following hydrolysis of a covalent bond within the reporter nucleic acid molecule, wherein: the first hydrolysis product comprises the detectable label and the second hydrolysis product comprises the quencher of the detectable label; the detectable label and the quencher become uncoupled; or the hydrolysis prevents the quencher molecule from quenching the detectable signal.
[0115] In some embodiments, the probe or amplicon may be detected using a dsDNA binding dye or by other methods, as are known in the art.
[0116] In some embodiments, a complex is provided, wherein the complex comprises a target nucleic acid molecule and a probe, wherein: the target nucleic acid molecule is substantially complementary to SEQ ID NO: 1, or a fragment thereof, or a complement thereof; and the probe specifically binds to the target.
[0117] In some embodiments, the target nucleic acid molecule, or a fragment thereof, or a complement thereof is substantially homologous to SEQ ID NO: 1, or a fragment thereof, or a complement thereof. In some embodiments, the target nucleic acid molecule, or a fragment thereof, or a complement thereof is substantially homologous to SEQ ID NO: 4:Docket No.02136WO CCCTGATTGCCTCATGCGAGACTTTCAGTAAACATCAATCTCCATACATATCCT ATCATCCTTAATTGGTAGAATAGACTTGCATTTAGTCGACGAAAGTCTACCACT TCAACTTTTTTTTATCCTTTTTATATTAGGACCTGGCCTACCATTCTTCTGTTG TTCTTAATATTATCTTACGAGCATTATATGAGTTTTCATGAACTTTAATGTATA CCAATATACCTCTACAAATTATTACATCGTAAAAGCTTGTTCAAACCGACACTC AATTTACTAGCGTTCATTTCACTTAGACTCAGGTTGGTTGGAAATTGGTTAAAT GGACAGACCGTGTTCCATCTCAAGAATTTACTGCACAACGCTAATCAAGAACTA ACTGTCGAAGTAATTAGCGGTTTGAACGCGCTTGA (SEQ ID NO: 4), or a fragment thereof, or a complement thereof. In some embodiments, SEQ ID NO: 4 is the amplicon resulting from the amplification of SEQ ID NO: 1, illustratively when the primers are SEQ ID NO: 2 and SEQ ID NO: 3.
[0118] In some embodiments, the probe specifically hybridizes to SEQ ID NO: 4, or a fragment thereof, or a complement thereof.
[0119] In some embodiments, an oligonucleotide molecule is provided, the oligonucleotide molecule comprising a sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof, or of SEQ ID NO: 4, or a fragment thereof, or a complement thereof, wherein the oligonucleotide molecule is detectable by direct detection or by indirect detection. In some embodiments, the oligonucleotide molecule is substantially homologous with SEQ ID NO: 4, or a fragment thereof, or a complement thereof. In some embodiments, the oligonucleotide molecule is unlabeled. In some embodiments, the oligonucleotide molecule is labeled with a detectable label. In some embodiments, the oligonucleotide molecule is a PCR product.
[0120] In some embodiments, a composition, for example, an amplification reaction mixture, is provided, the composition comprising: primers as described herein; deoxynucleoside triphosphate nucleotides; a polymerase; and a buffer, wherein the target nucleic acid may be added. In some embodiments, a composition, such as an amplification reaction mixture, is provided, the composition comprising: primes as described herein; a probe, as described herein; deoxynucleoside triphosphate nucleotides; a polymerase; and a buffer. In some embodiments, a composition, such as an amplification reaction mixture, is provided, the composition comprising: a composition, as described herein; deoxynucleoside triphosphate nucleotides; a polymerase; and a buffer.Docket No.02136WO
[0121] In some embodiments, the deoxynucleoside triphosphate nucleotides (dNTPs) comprise a mixture of dATP, dCTP, dGTP, and dTTP. In some embodiments, the dNTPs additionally comprise deoxyuridine triphosphate (dUTP) in conjunction with an uracil DNA glycosylase (UDG) pre-treatment, as a strategy to prevent carryover PCR contamination. In some embodiments, the dNTPs comprise a mixture of dATP, dCTP, dGTP, and dUTP. In some embodiments, the dUTP is modified. In some embodiments, the dUTP is aminoallyl-dUTP, fluorescein-12-dUTP, 5-bromo-dUTP, or biotin-11-dUTP. Other natural or non-natural dNTPs may be used.
[0122] In some embodiments, the polymerase originates from Thermus aquaticus (Taq), Pyrococcus furiosus (Pfu polymerase), Thermococcus litoralis (Wind or Tli polymerase or Vent polymerase) or Thermus thermophilus (Tth polymerase). In some embodiments, the polymerase is specifically modified for uracil incorporation. In some embodiments, the polymerase is specifically modified for incorporating modified dNTPs.
[0123] In some embodiments, the buffer includes Tris-HCl, potassium chloride (KCl) and magnesium chloride (MgCl2). In some embodiments, the buffer includes Tris-HCl, ammonium sulfate ((NH4)2SO4), and magnesium chloride (MgCl2).
[0124] In some embodiments, the composition further comprises a test sample. In some embodiments, the test sample comprises a brewery product, for example malt, fermented malt, a fermented alcoholic beverage, a malt beverage, or beer. In some embodiments, the test sample comprises a solid suspension. In some embodiments, the test sample comprises yeast cells. In some embodiments, the test sample comprises a yeast slurry. In some embodiments, the test sample comprises yeast cells that have been separated from a solid suspension. In some embodiments, the test sample comprises lysed yeast cells. In some embodiments, the test sample comprises genomic DNA from yeast cells. In some embodiments, the test sample comprises digested genomic DNA from yeast cells.
[0125] In some embodiments, the composition further comprises a genomic free oligonucleotide molecule. In some embodiments, the genomic free oligonucleotide molecule is a PCR product. In some embodiments, the genomic free oligonucleotide molecule is substantially homologous to SEQ ID NO: 1, a fragment thereof, or the complement thereof or SEQ ID NO: 4, a fragment thereof, or the complement thereof.Docket No.02136WO
[0126] In some embodiments, the detectable amplicon is a PCR product. In some embodiments, the detectable amplicon is an RT-PCR product.
[0127] In some embodiments, a primer is provided capable of specifically binding to SEQ ID NO: 1 and wherein the primer comprises a 3’ end having a free hydroxyl group. In some embodiments, the primer comprises, consists of, or consists essentially of a portion of the sequence of SEQ ID NO: 1, or a complement thereof. In some embodiments, the primer comprises the sequence of SEQ ID NO: 2, or a fragment thereof, or a complement thereof. In some embodiments, the primer comprises sequence of SEQ ID NO: 3, or a fragment thereof, or a complement thereof. In some embodiments, one or both of the primers further comprises a detectable moiety coupled to a 5’ end of the primer.
[0128] In some embodiments, a container comprising a composition, as described herein, is provided. In some embodiments, the container is a tube, plate, reaction vessel, and the like. Methods of Use
[0129] In some embodiments, a method of detecting a nucleic acid molecule having a sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof, or a variant thereof, is provided.
[0130] In some embodiments, the methods described herein comprise detecting an analyte in a test sample. In some embodiments, the test sample comprises a brewery product. In some embodiments, the test sample comprises malt, fermented malt, a fermented alcoholic beverage, a malt beverage, or beer. In some embodiments, the test sample comprises a suspension of yeast cells. In some embodiments, the test sample comprises a suspension of yeast cells in a container that is capable of being centrifuged. In some embodiments, the test sample comprises yeast cells that have been separated from a suspension of yeast cells. In some embodiments, the test sample comprises a pellet of yeast cells that has been separated from a suspension of yeast cells via centrifugation, wherein the supernatant has been decanted from the pellet. In some embodiments, the test sample comprises yeast cells and a lysis buffer. In some embodiments, the test sample comprises yeast cells, wherein the cell walls have been lysed. In some embodiments, the test sample comprises genomic DNA from lysed yeast cells. In some embodiments, the test sampleDocket No.02136WO comprises genomic DNA from lysed yeast cells and a DNA digestion buffer. In some embodiments, the sample is derived from another sample. For example, a PCR reaction may be performed on a nucleic acid mixture that has been extracted, isolated, and / or purified from another sample (e.g. beer). The PCR reaction would be a sample derived from another sample.
[0131] In some embodiments, primers are provided for either or both of STA1 and STA2 genes, as are known in the art. The primers for STA1 and / or STA2 may be provided in the same reaction mixture with the primers described herein for detection SEQ ID NO: 1 in a single multiplex reaction, or the primers for STA1 and / or STA2 may be provided to be run in a separate reaction chamber.
[0132] In some embodiments, the primers described herein for detection SEQ ID NO: 1 are provided for use without primers for STA1 and / or STA2. In such embodiments, methods may include a determination that a sample of yeast is a diastatic yeast, without determining STA1 or STA2 status for that sample.
[0133] Although the present disclosure has been described in considerable detail with reference to certain preferred embodiments thereof, other versions are possible. Therefore, the spirit and scope of the appended claims should not be limited to the description and the preferred versions contained within this specification. The embodiments arc now described with reference to the following examples. These examples are provided for the purpose of illustration only and the embodiments should in no way be construed as being limited to these examples, but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. Those of skill in the art will readily recognize a variety of non-critical parameters that could be changed or modified to yield essentially similar results. Kits
[0134] In some embodiments, kits are provided for usage with the methods described herein. The kit can include a detection device as described herein, a sample collector, a buffer container, an instruction manual, a positive control, a negative control, or any combination thereof. With respect to the kit, a positive control is a sample that is known to contain the analyte(s) that may be detected with the device present in the kit. In contrast the negative control, would not contain an analyte that can be detected by the kit. The kit may also include instructions for use.Docket No.02136WO Systems
[0135] In some embodiments, systems are provided for usage with the methods described herein. The system may include a kit or a mixture, as described above, along with an instrument to run the assay. In at least one embodiment, the system as shown in Fig. 4 may include at least one PCR reaction mixture housed in sample vessel 714. In certain embodiments, the sample vessel 714 may include a PCR reaction mixture configured to permit and / or effect amplification of a template nucleic acid. Certain illustrative embodiments may also include at least one sample block or chamber 716 configured to receive the at least one sample vessel 714. The sample vessel 714 may include any plurality of sample vessels in individual, strip, plate, or other format, and, illustratively, may be provided as or received by a sample block or chamber 716.
[0136] One or more embodiments may also include at least one sample temperature controlling device 718 and / or 720 configured to manipulate and / or regulate the temperature of the sample(s). Such a sample temperature controlling device may be configured to raise, lower, and / or maintain the temperature of the sample(s). In one example, sample controlling device 718 is a heating system and sample controlling device 720 is a cooling system. Illustrative sample temperature controlling devices include (but are not limited to) heating and / or cooling blocks, elements, exchangers, coils, radiators, refrigerators, filaments, Peltier devices, forced air blowers, handlers, vents, distributors, compressors, condensers, water baths, ice baths, flames and / or other combustion or combustible forms of heat, hot packs, cold packs, dry ice, dry ice baths, liquid nitrogen, microwave- and / or other wave-emitting devices, means for cooling, means for heating, means for otherwise manipulating the temperature of a sample, and / or any other suitable device configured to raise, lower, and / or maintain the temperature of the sample(s).
[0137] The illustrative PCR system 700 also includes an optical system 710 configured to detect an amount of fluorescence emitted by the sample 714 (or a portion or reagent thereof). Such an optical system 710 may include one or more fluorescent channels, as are known in the art, and may simultaneously or individually detect fluorescence from a plurality of samples.
[0138] At least one embodiment of the PCR system may further include a CPU 706 programmed or configured to operate, control, execute, or otherwise advance the heating system 718 and cooling system 720 to thermal cycle the PCR reaction mixture, illustratively while optical system 710 collects fluorescent signal. CPU 706 may then generate an amplification curve, a melting curve, or any combination, which may or may not be printed, displayed on a screen of the userDocket No.02136WO terminal 704, or otherwise outputted. Optionally, a positive, negative, or other call may be outputted based on the amplification and / or melting curve for example on the screen of the user terminal 704. Optionally, only the calls are outputted, illustratively, one call for each target tested.
[0139] The CPU 706 may include a program memory, a microcontroller or a microprocessor (MP), a random-access memory (RAM), and an input / output (I / O) circuit, all of which are interconnected via an address / data bus. The program memory may include an operating system such as Microsoft Windows®, OS X®, Linux®, Unix®, etc. In some embodiments, the CPU 706 may also include, or otherwise be communicatively connected to, a database or other data storage mechanism (e.g., one or more hard disk drives, optical storage drives, solid state storage devices, etc.). The database may include data such as melting curves, annealing temperatures, denaturation temperatures, and other data necessary to generate and analyze melting curves. The CPU 706 may include multiple microprocessors, multiple RAMS, and multiple program memories as well as a number of different types of I / O circuits. The CPU 706 may implement the RAM(s) and the program memories as semiconductor memories, magnetically readable memories, and / or optically readable memories, for example.
[0140] The microprocessors may be adapted and configured to execute any one or more of a plurality of software applications and / or any one or more of a plurality of software routines residing in the program memory, in addition to other software applications. One of the plurality of routines may include a thermocycling routine which may include providing control signals to the heating system 718 and the cooling system 720 to heat and cool the sample 714 respectively, in accordance with the two-step PCR protocol. Another of the plurality of routines may include a fluorescence routine which may include providing control signals to the optical system 710 to emit a fluorescence signal and detect the amount of fluorescence scattered by the sample 714. Yet another of the plurality of routines may include a sample calling routine which may include obtaining fluorescence data (temperature, fluorescence pairs) from the optical system 710 during the in-cycle temperature adjusting segment for each of N cycles, generating a composite melting curve by combining the fluorescent data from each of the N cycles during the respective in-cycle temperature adjusting segments, analyzing the composite melting curve to make a positive or negative call, and displaying the composite melting curve, individual melting curve, and / or an indication of the call on the user terminal 704.Docket No.02136WO
[0141] In some embodiments, the CPU 706 may communicate with the user terminal 704, the heating system 718, the cooling system 720, the optical system 710, and the sample block 716 over a communication network 722-732 via wired or wireless signals and, in some instances, may communicate over the communication network via an intervening wireless or wired device, which may be a wireless router, a wireless repeater, a base transceiver station of a mobile telephony provider, etc. The communication network may be a wireless communication network such as a fourth- or third-generation cellular network (4G or 3G, respectively), a Wi-Fi network (802.11 standards), a WiMAX network, a wide area network (WAN), a local area network (LAN), the Internet, etc. Furthermore, the communication network may be a proprietary network, a secure public Internet, a virtual private network and / or some other type of network, such as dedicated access lines, plain ordinary telephone lines, satellite links, combinations of these, etc. Where the communication network comprises the Internet, data communication may take place over the communication network via an Internet communication protocol. Still further, the communication network may be a wired network where data communication may take place via Ethernet or a Universal Serial Bus (USB) connection.
[0142] In some embodiments, the CPU 706 may be included within the user terminal 704. In other embodiments, the CPU 706 may communicate with the user terminal 704 via a wired or wireless connection (e.g., as a remote server) to display individual melting curves, composite melting curves, calls, etc. on the user terminal 704. The user terminal 704 may include a user interface, a communication unit, and a user-input device such as a “soft” keyboard that is displayed on the user interface of the user terminal 704, an external hardware keyboard communicating via a wired or a wireless connection (e.g., a Bluetooth keyboard), an external mouse, or any other suitable user-input device in addition to the CPU 706 or another CPU similar to the CPU 706. EXAMPLES Various aspects of the present disclosure are illustrated with reference to the following non-limiting examples. Example 1: Identification of predictive DNA region for diastatic activity in Saccharomyces cerevisiae.Docket No.02136WO
[0143] The purpose of this study was to identify previously unidentified DNA sequences within the Saccharomyces cerevisiae genome that are predictive of diastatic activity and beer spoilage.
[0144] The genomes of 81 Saccharomyces cerevisiae strains were screened for unique sequences that can be used as predictors of diastatic activity and spoilage potential. Of these, 32 strains were sequenced by short read sequencing using the Illumina HiSeq platform. Long read sequencing was provided by Cornell University. High-quality genome assemblies were created using long and short read sequencing data.
[0145] The Saccharomyces cerevisiae strains comprised both STA1 positive and STA1 negative phenotypes. Phenotypic activity was evaluated by pH monitoring as a readout of maltodextrin-supported growth, a method described by Burns et al., (2021) as a functional assessment of diastatic risk. Two strains (STA1+ and STA-) were established as controls for foreground and background, respectively, using the phenotypic data.
[0146] The Bionumerics PCR plugin was used to screen potential candidates that correlate with diastatic activity. A total of 600 consensus output sequences were recovered from this screen. A Basic Local Alignment Search Tool (BLAST) was used to compare these sequences against a sequence-read database made from all OYL strains sequenced. A similarity matrix with the resulting hits, % ID and correlation with phenotypic data was used to identify potential candidates.
[0147] An in silico screen of the 600 output sequences was carried out on Geneious to find target candidates for primer design and vetting. One target was an unannotated genomic region of within the broad region of chromosome 7 comprising the sequence of SEQ ID NO: 1: ACGCGAGAATACTAAGCCCAAGCCTCTCCAAATTGATTTCCTTTTGGTACTGAA AGACTTAGTATCAACCTCAAAAAGTTGAAATTTCTGTAGATAAATATGCAGATG ACATGAAGTACCCAGTTCTTTTGTGAATATGGAAGTAGTTTTCTTTCAAATCGT TATTAATATTTCCTCTGCCCTCTTCACCTTATAGCTTTAGGAAACACTACTCTA TTCATATTCAACTAAAAAAGTAGTATATTTCCTTCCGTTAGAATTGTGGTACAA ACCAGCGCAATATAAACCCTGATTGCCTCATGCGAGACTTTCAGTAAACATCAA TCTCCATACATATCCTATCATCCTTAATTGGTAGAATAGACTTGCATTTAGTCG ACGAAAGTCTACCACTTCAACTTTTTTTTATCCTTTTTATATTAGGACCTGGCC TACCATTCTTCTGTTGTTCTTAATATTATCTTACGAGCATTATATGAGTTTTCA TGAACTTTAATGTATACCAATATACCTCTACAAATTATTACATCGTAAAAGCTT GTTCAAACCGACACTCAATTTACTAGCGTTCATTTCACTTAGACTCAGGTTGGTDocket No.02136WO TGGAAATTGGTTAAATGGACAGACCGTGTTCCATCTCAAGAATTTACTGCACAA CGCTAATCAAGAACTAACTGTCGAAGTAATTAGCGGTTTGAACGCGCTTGACAA ATGTTCTATTGAAAAAGTGATGTCCTCTGAAGAGTAAAGGCACTATGGGGCGTT GCAACTAAAGGAGATATTAGATTCATCAAAAGTGAGATTTTTTCATAAAACATG AGTCTATATCAGGTGAAACAGTTTGAGGCAGCCTTAATATGGAACTGAAAAAGC AAAATCAAAGGCAAAAGTTTCTCATATATATATGGCATTGTTGATCACCCAGTG C (SEQ ID NO: 1).
[0148] The phenotypic and genotypic data are summarized in Table 1. Strains with high diastatic risk are designated as POS (+) and strains with low diastatic risk are designated as NEG (-). OYL Strain 52 was identified to have a low diastatic risk potential, a STA1 positive (+) genotype, and a presumed negative (-) genotype for the sequence of SEQ ID NO: 1. OYL Strain 56 was identified to have a high diastatic risk potential, a STA1 negative (-) genotype, and a presumed positive (+) genotype for the sequence of SEQ ID NO: 1. OYL Strain 56 was identified to have a moderate diastatic risk potential, a STA1 positive (+) genotype, and a presumed positive (+) genotype for the sequence of SEQ ID NO: 1. Table 1: Yeast Strain Library Diastatic Genotype for the Yeast Strain Risk STA1 genotype sequence of SEQDocket No.02136WO OYL 2 NEG (-) NEG (-) NEG (-) OYL 3 NEG (-) NEG (-) NEG (-)Docket No.02136WO ISSD004 ATCC 28338 POS (+) POS (+) POS (+) ISSD003 YB4238 POS (+) POS (+) POS (+)ISSD - Invisible Sentinel Saccharomyces Diastaticus Library ISSD - Invisible Sentinel Saccharomyces Diastaticus Library ATCC - American Type Culture CollectionDocket No.02136WO
[0149] Primer pairs were designed against the targets and were tested and compared to phenotypic data for diastatic activity. Predicted open reading frames (ORFs) within the target sequences were identified to aid the primer design (FIG.1). For example, a primer pair was designed against SEQ ID NO: 1. The primer pair comprised a first primer with the sequence of SEQ ID NO: 2: CCCTGATTGCCTCATGCGA (SEQ ID NO: 2),
[0150] and a second primer with the sequence of SEQ ID NO: 3: TCAAGCGCGTTCAAACCG (SEQ ID NO: 3).
[0151] The predicted amplicon for the primer pair against SEQ ID NO: 1 comprises the sequence of SEQ ID NO: 4: CCCTGATTGCCTCATGCGAGACTTTCAGTAAACATCAATCTCCATACATATCCT ATCATCCTTAATTGGTAGAATAGACTTGCATTTAGTCGACGAAAGTCTACCACT TCAACTTTTTTTTATCCTTTTTATATTAGGACCTGGCCTACCATTCTTCTGTTG TTCTTAATATTATCTTACGAGCATTATATGAGTTTTCATGAACTTTAATGTATA CCAATATACCTCTACAAATTATTACATCGTAAAAGCTTGTTCAAACCGACACTC AATTTACTAGCGTTCATTTCACTTAGACTCAGGTTGGTTGGAAATTGGTTAAAT GGACAGACCGTGTTCCATCTCAAGAATTTACTGCACAACGCTAATCAAGAACTA ACTGTCGAAGTAATTAGCGGTTTGAACGCGCTTGA (SEQ ID NO: 4), as shown in FIG.2.
[0152] The unannotated genomic region comprising the sequence of SEQ ID NO: 1 or SEQ ID NO: 4 was found to be predictive of diastatic activity in Saccharomyces cerevisiae, as depicted in FIGs.3A-3C. The predictive region (SEQ ID NO: 1 or SEQ ID NO: 4) was only observed in the diastatic strains of S. cerevisiae. Because diastatic activity in yeast is predictive of a high spoilage potential in beer, the presence of a contaminating yeast in a beer sample that contains the sequence of SEQ ID NO: 1 or SEQ ID NO: 4 within its genome is predictive of a high spoilage potential for the beer. Such a contaminating yeast is predicted to have a significant effect on the concentrations of starch, maltose, dextrins, glucose, ethanol, and CO2 compared to a non-contaminated beer sample. In other words, when the predictive region for diastatic activity (SEQ ID NO: 1 or SEQ ID NO: 4) is not present in the contaminating yeast, beer spoilage is unlikely. In contrast, if a contaminating yeast that does contain a sequence of SEQ ID NO: 1 or SEQ ID NO: 4 within its genome is present in a beer, the contaminated beer is predicted to have significantly increased starch, maltose, dextrins, glucose, ethanol, and CO2compared to a non-Docket No.02136WO contaminated beer sample. In other words, when the predictive region for diastatic activity (SEQ ID NO: 1 or SEQ ID NO: 4) is present in the contaminating yeast, the contaminated beer will support a culture of the contaminating yeast, and it is likely that the contaminating yeast culture will spoil the beer. Diastatic activity within the contaminating yeast can significantly increase the concentrations of maltose and glucose in the beer and drive fermentation activity. Fermentation activity can lead to over-attenuated beer during brewing, or re-fermentation and container ruptures after brewing and packaging of the beer. Fermentation activity can also increase the concentration of ethanol in the beer above the legal limit.
[0153] Interestingly, the unannotated genomic region containing the sequence of SEQ ID NO: 1, proved to have a better predictive potential for diastatic activity compared to the predictive potential of STA1. For example, isolates of STA1 (+) and non-diastatic strains were found to lack the predictive region (SEQ ID NO: 1), while STA1 (-) diastatic strains were found to have the predictive region (SEQ ID NO: 1) within the genome. In other words, the predictive region (SEQ ID NO: 1) was only found in diastatic strains, regardless of STA genotype. While most known diastatic strains have STA1, not all diastatic strains have STA1. Without being bound to theory, it is possible that the predictive region (SEQ ID NO: 1) encodes for a third glucoamylase, encodes for a transcript or protein that regulates the expression of a third glucoamylase, or encodes for a transcript or protein that regulates the activity of a third glucoamylase.
[0154] Next, probes were designed that target SEQ ID NO: 1. The first probe comprised a nucleic acid molecule with the sequence of SEQ ID NO: 5: CGTAAAAGCTTGTTCAAACCGGCACTCA (SEQ ID NO: 5).
[0155] The second probe comprised a nucleic acid molecule comprises with the sequence of SEQ ID NO: 6: CTCAATTTACTAGCGTTCATTTCACTTAG (SEQ ID NO: 6).
[0156] The probes may be labeled with a fluorophore and a quencher. In this embodiment, one of the first and second probes is used in a single reaction.
[0157] An example of SEQ ID NO: 1 with primers consisting of SEQ ID NO: 2 and SEQ ID NO: 3 as well as the probe of SEQ ID NO: 5 and their binding sites is shown in FIG.1.Docket No.02136WO
[0158] It is possible to detect the predictive region (SEQ ID NO: 1), or a fragment thereof, using multiple detection methods, including real-time PCR. In an example, a fragment of SEQ ID NO: 1 may be SEQ ID NO: 4.
[0159] The method of sample preparation varies depending on the sample type.
[0160] The sample can be a yeast colony. For sample preparation, a colony is picked and transferred into a container containing dH2O. For a negative control, dH2O is used. The contents are mixed by pipetting the sample up and down or by vortexing. The colony re-suspension is transferred to a tube containing the PCR reagents. The PCR tube is opened only when adding sample and promptly closed after to avoid cross contamination between tubes. DNA restriction digest is not necessary for samples from yeast colony resuspensions.
[0161] A sample may be beer. For sample preparation, sample containing beer is centrifuged and the supernatant is decanted carefully, without disturbing the pellet. The pellet is resuspended in a buffer and the sample is mixed until the pellet is no longer visible. The lysed sample is transferred to a tube that can fit into a PCR tube holder and that contains reagents for DNA restriction digest. The PCR tube holder is placed into the thermocycler. For best performance, the tubes are briefly centrifuged prior to transferring to the thermocycler. A DNA restriction digest program is run on a thermocycler. Upon completion of the digest program, the digest tubes are immediately removed from the PCR instrument. Immediately following the digestion step, the sample is transferred from the top 1 / 3 portion of digest tube to a tube containing PCR reagents. The target DNA is present in solution at the top of the tube.
[0162] A sample can be enriched beer. To enrich beer, in one illustrative embodiment, the beer is incubated with growth media at +30 °C / +35 °C for 46-50 hours. The sample is centrifuged, and the supernatant is carefully decanted, without disturbing the pellet. The pellet is resuspended in a buffer by pipetting until the pellet is no longer visible. For sample preparation, a sample containing enriched beer is centrifuged and the supernatant is decanted carefully, without disturbing the pellet. The pellet is resuspended in a buffer and the sample is mixed until the pellet is no longer visible. The lysed sample is transferred to a tube that can fit into a PCR tube holder and that contains reagents for DNA restriction digest. The PCR tube holder is placed into the thermocycler. For best performance, the tubes are briefly centrifuged prior to transferring to the thermocycler. A DNA restriction digest program is run on a thermocycler. Upon completion ofDocket No.02136WO the digest program, the digest tubes are immediately removed from the PCR instrument. Immediately following the digestion step, the sample is transferred from the top 1 / 3 portion of digest tube to a tube containing PCR reagents. The target DNA is present in solution at the top of the tube.
[0163] A sample can be a hazy beer. Alternatively, a sample can be an FV / yeast slurry. For sample preparation, sample containing either hazy beer, or FV / yeast slurry is centrifuged, and the supernatant is decanted carefully, without disturbing the pellet. The pellet is resuspended in a buffer and the sample is mixed until the pellet is no longer visible. The lysed sample is transferred to a tube that can fit into a PCR tube holder and that contains reagents for DNA restriction digest. The PCR tube holder is placed into the thermocycler. For best performance, the tubes are briefly centrifuged prior to transferring to the thermocycler. A DNA restriction digest program is run on a thermocycler. Upon completion of the digest program, the digest tubes are immediately removed from the PCR instrument. The sample is transferred to a 5 μM filter column tube inside a column collection tube, and the sample is briefly centrifuged. The filter column is removed, and sample is collected from the bottom of the column collection tube and transferred to a tube containing PCR reagents.
[0164] It is understood that the above sample preparation methods are illustrative only, and other sample preparation methods are within the scope of this disclosure.
[0165] The target nucleic acid molecule can then be amplified, for example, by PCR. The PCR may be RT-PCR.
[0166] In one illustrative example, following sample preparation, sample is transferred to a tube, well, or other container containing PCR reagents. After addition of the sample, the tube may, for example, contain: 10 ng template DNA (200 pg / μL); 0.1-0.5 μM primer with sequence of SEQ ID NO: 2; 0.1-0.5 μM primer with the complement to sequence of SEQ ID NO: 3; deoxynucleoside triphosphate nucleotides (200 μM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1-0.5 μM probe with sequence of SEQ ID NO: 5 or SEQ ID NO: 6; and a PCR buffer. An example in which the probe has SEQ ID NO: 5 is illustrated by FIG.1. Alternatively, for the detection of multiple analytes, the tube can, for example, contain: 10 ng template DNA (200 pg / μL); 0.1-0.5 μM primer with sequence of SEQ ID NO: 2; 0.1-0.5 μM primer with the complement to sequence of SEQ ID NO: 3; 0.1-0.5 μMDocket No.02136WO forward primer that targets STA1 and / or STA2; 0.1-0.5 μM reverse primer that targets STA1 and / or STA2; deoxynucleoside triphosphate nucleotides (200 μM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1-0.5 μM probe with sequence of SEQ ID NO: 5 or SEQ ID NO: 6; probes for STA 1 and / or STA2 and a PCR buffer. A helper oligonucleotide or a second probe may also be added. Alternatively, a dye, for example SYBR Green, may be used in place of probes.
[0167] In this example, DNA amplification is achieved using PCR. A multiplex protocol may be used. An example protocol is: 35-40 repeats of 94 °C x 1 minute, 58.1 °C x 2 minutes, and 72 °C x 3 minutes; then hold at 4 °C. Once the run is complete, the results are analyzed. Color compensation is applied to eliminate signal crosstalk. The Ct / Cp values are calculated.
[0168] Amplification curves have a characteristic shape of an initial lag phase, an exponential amplification phase, and a final plateau phase. The final plateau phase, which represents a decrease in reaction efficiency as reagents are consumed, may not be reached in reactions containing low levels of target organisms. Amplification curves that deviate from the characteristic shape should be interpreted with caution. For each amplification reaction, the cycle at which fluorescence signal rises above background fluorescence is determined and is called the “threshold cycle” (Ct) or “crossing point” (Cp), depending on the instrument. The Ct / Cp will occur at an earlier cycle for samples containing high levels of target organisms and will be delayed for reactions containing low levels of target organisms. Real time PCR and / or post-PCR melting can be used to detect a single amplicon.
[0169] Depending on the detection method used, the presence of an amplification curve indicates the presence of an amplicon in a sample. The presence of the amplicon having a sequence substantially homologous to the sequence of SEQ ID NO: 4 indicates a sample that is positive for diastatic yeast. High Ct / Cp values (e.g., ≥ 38) may indicate false positives. Negative and positive controls can be used to verify assay functionality. Samples may also be rerun with higher concentrations of starting template DNA. Presumptive positive samples can be confirmed by microbiological plating and colony PCR.
[0170] The target nucleic acid molecule can be amplified, for example by PCR according to the following method. Following sample preparation, sample is transferred to a tube containing PCR reagents. After addition of the sample, illustratively 5 uL although other amounts may be used,Docket No.02136WO the tube may, for example, contain: 10 ng template DNA (200 pg / μL); 0.1-0.5 μM primer with sequence of SEQ ID NO: 2; 0.1-0.5 μM primer with the complement to sequence of SEQ ID NO: 3; deoxynucleoside triphosphate nucleotides (200 μM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); and a PCR buffer. Alternatively, for the detection of multiple analytes, the tube can, for example, contain: 10 ng template DNA (200 pg / μL); 0.1-0.5 μM primer with sequence of SEQ ID NO: 2; 0.1-0.5 μM primer with the complement to sequence of SEQ ID NO: 3; 0.1-0.5 μM forward primer that targets STA1 and / or STA2; 0.1-0.5 μM reverse primer that targets STA1 and / or STA2; deoxynucleoside triphosphate nucleotides (200 μM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); and a PCR buffer.
[0171] DNA amplification is achieved using PCR, e.g., by using the following protocol: 25-30 repeats of 94 °C x 1 minute, 58.1 °C x 2 minutes, and 72 °C x 3 minutes; then hold at 4 °C.
[0172] While the invention has been described and exemplified in sufficient detail for those skilled in this art to make and use it, various alternatives, modifications, and improvements should be apparent without departing from the spirit and scope of the invention. The examples provided herein are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Modifications therein and other uses will occur to those skilled in the art. These modifications are encompassed within the spirit of the invention and are defined by the scope of the claims. It will be readily apparent to a person skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. All patents and publications mentioned in the specification are indicative of the levels of those of ordinary skill in the art to which the invention pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
[0173] The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized thatDocket No.02136WO various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.
[0174] Other embodiments are set forth within the following claims. REFERENCES Krogerus, K., et al. Appl Microbiol Biotechnol 103, 7597–7615 (2019). Burns et al. J Am Society of Brewing Chemists 79, 167-180 (2021).
Claims
Docket No.02136WO What is claimed is:
1. A method of detecting an organism comprising a target nucleic acid molecule that is substantially homologous with a sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof in a test sample, the method comprising: a. reacting the test sample with a first primer that specifically hybridizes to a target nucleic acid molecule and a second primer that specifically hybridizes to a complement of the target nucleic acid molecule under amplification conditions to produce an amplicon; and b. detecting the presence or absence of the amplicon.
2. The method of claim 1, wherein the method further comprises reacting the test sample with a probe that specifically binds to the target nucleic acid molecule that the first primer binds to, wherein the detecting step includes detecting a signal from the probe that is indicative of amplification.
3. The method of claim 1, wherein the first and second primers are each, independently, 15 to 40 nucleotides in length.
4. The method of any one of claims 1-3, wherein the first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO: 2 and the second primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:
3.
5. The method of claim 1, wherein the first primer comprises a sequence that is fully homologous to the sequence of SEQ ID NO: 2 and the second primer comprises a sequence that is fully homologous to the sequence of SEQ ID NO:
3.
6. The method of claim 2, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO:
6.
7. The method of claim 2, wherein the probe comprises a sequence that is fully homologous to the sequence of SEQ ID NO: 5, SEQ ID NO: 6, or the complements thereof.Docket No.02136WO 8. The method of claim 2, wherein the probe is labeled with a detectable label.
9. The method of claim 1, wherein the presence of the detectable amplicon is indicative of a contaminant in the test sample.
10. The method of claim 1, wherein the detection of the detectable amplicon indicates positive spoilage potential.
11. The method of claim 10, wherein positive spoilage potential indicates the presence of a contaminating diastatic wild yeast.
12. The method of claim 1, wherein the first primer and the second primer are configured to amplify the detectable amplicon, wherein the detectable amplicon is substantially homologous to SEQ ID NO: 4, or a fragment thereof, or a complement thereof.
13. The method of claim 1, wherein the detectable amplicon has the sequence of SEQ ID NO: 4, or a fragment thereof, or a complement thereof.
14. The method of claim 1, wherein the detectable amplicon is produced by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).
15. The method of claim 1, wherein the step of detecting the detectable amplicon comprises one or more from the group consisting of: a. direct detection of a measurement of a physical property of the amplicon, for example a measurement of UV absorption at 260 nm; b. isolating the amplicon; c. sequencing the amplicon; d. staining the amplicon with a dye, and detecting the dye; e. complexing the amplicon with a detectable label, and detecting the presence of the label; f. detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of copies of the amplicon in theDocket No.02136WO sample; or g. detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample.
16. The method of claim 1, further comprising a step of producing and detecting a second detectable amplicon, wherein the second detectable amplicon comprises a sequence of the STA1 gene or the sequence of the STA2 gene, a complement thereof, a fragment thereof.
17. The method of claim 1, further comprising a step of producing and detecting a second and a third detectable amplicon, wherein the second detectable amplicon comprises a sequence of the STA1 gene and wherein the third detectable amplicon comprises a sequence of the STA2 gene.
18. The method of claim 1, wherein primers configured to amplify a sequence of the STA1 gene are not present, and wherein primers configured to amplify a sequence of the STA2 gene are not present.
19. A method of detecting a contaminant in a food or beverage comprising a target nucleic acid molecule that is substantially homologous to a sequence of SEQ ID NO: 1, or a complement thereof, or a fragment thereof, the method comprising: a. reacting a test sample derived from the food or beverage with a first primer that specifically hybridizes to a target nucleic acid molecule and a second primer that specifically hybridizes to a complement of the target nucleic acid molecule under amplification conditions to produce an amplicon; and b. detecting the presence or absence of the amplicon.
20. The method of claim 19, wherein the first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO: 2 and the second primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:
3.
21. The method of claim 20, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to aDocket No.02136WO sequence of SEQ ID NO: 5 or SEQ ID NO:
6.
22. A kit, comprising: a. a primer that comprises a sequence that is substantially homologous to SEQ ID NO: 2 or a fragment thereof; and b. a primer that comprises a sequence that is substantially homologous to SEQ ID NO: 3 or a fragment thereof.
23. The kit of claim 22, further comprising at least one of the following: a DNA polymerase, deoxynucleotide triphosphate nucleotides, a buffer.
24. The kit of either of claims 22 or 23, further comprising a probe.
25. The kit of claim 24, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO:
6.
26. The kit of claim 24, wherein the probe is covalently bound to a detectable label.
27. The kit of claim 26, wherein the probe also includes a quencher positioned to quench a signal from the detectable label.
28. The kit of claim 22, wherein at least one of the primers is covalently bound to a detectable label.
29. A mixture comprising: a. a primer that is substantially homologous to SEQ ID NO: 2; b. a primer that is substantially homologous to SEQ ID NO: 3; c. deoxynucleotide triphosphate nucleotides; d. a DNA polymerase; e. a buffer; andDocket No.02136WO f. a test sample that is suspected of having a nucleic acid that is substantially homologous with a sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof.
30. The mixture of claim 29, further comprising a probe.
31. The mixture of claim 30, wherein the probe is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 5 or SEQ ID NO: 6 or fragments thereof.
32. The mixture of claim 29, further comprising primers which hybridize to a gene coding for either or both of STA1 and STA2.
33. The mixture of claim 29, wherein primers configured to amplify STA1 and STA2 are not present.
34. A system comprising: a. at least one of the mixtures of any one of claims 30-34; and b. an instrument configured to perform an amplification assay on the at least one mixture.
35. The system of claim 34, further comprising at least one sample vessel.
36. The system of claim 35, wherein each of the at least one mixture is housed in one of the at least one sample vessel respectively.
37. The system of claim 36, further comprising at least one sample temperature controlling device.
Citation Information
Patent Citations
Saccharomyces cerevisiae industrial strain for secreting and expressing cellulase and building method thereof
CN108624613A