Products and methods for improving plant growth features
Patent Information
- Application Number
- EP2023840695
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-12-23
- Filing Date
- 2023-12-22
- Publication Date
- 2025-10-29
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current agricultural methods face challenges in improving crop yields and resilience to stresses while being environmentally sustainable, as genetically modified crops and chemical fertilizers face acceptance issues and resource inefficiencies.
The use of specific fungal strains, such as Penicillium novae-zeelandiae, as biostimulants to enhance plant growth traits like biomass, height, and seed yield by inoculating seeds or plant growth media, providing nutrients and improving resource use efficiency.
The fungal strains significantly increase wet and dry biomass, plant height, and seed yield, reducing the need for chemical fertilizers and promoting sustainable agriculture, with compatibility for organic farming practices.
Smart Images

Figure 00000071_0000 
Figure 00000071_0001 
Figure 00000072_0000
Abstract
Description
[0001] PRODUCTS AND METHODS FOR IMPROVING PLANT GROWTH FEATURES
[0002] FIELD OF THE INVENTION
[0003] The invention is broadly in the field of plant biology and fungal strains, more precisely in the field of agricultural biologicals or agro-biologicals. In particular, the invention relates to products and methods for enhancing certain plant growth characteristics, and to a novel fungal strain useful as a biostimulant.
[0004] BACKGROUND OF THE INVENTION
[0005] There is a need for improved agricultural plants that will enable the food production demands with fewer resources and more environmentally sustainable inputs, for plants with improved responses to various biotic and abiotic stresses.
[0006] Crop performance is optimized primarily via technologies directed towards the interplay between crop genotype (e.g. plant breeding, genetically-modified (GM) crops) and its surrounding environment (e.g. fertilizer, synthetic herbicides, pesticides). While these paradigms have assisted in the increasing global food production, yield growth rates have stalled in many major crops. Shifts in the climate are linked to production instabilities as well as changing pest and disease pressures. In addition, genetically manipulated (GM) crops and agrochemicals have been challenged in their use in a large number of agricultural important crops and countries, resulting in a lack of acceptance for many GM traits and the exclusion of GM crops and many agrochemicals from global markets. Therefore, there is an urgent need for novel solutions to crop improvement, more particularly, there is a need for innovative, effective, environmentally-sustainable, and publicly-acceptable approaches to improve the biomass, yield, and other agronomically important characteristics of plants.
[0007] A promising practice is the use of microorganisms that enhance plant growth and yield, increase tolerance to unfavorable conditions, and / or improve the resource use efficiency. The aim of the invention is to provide further and / or improved means and methods to enhance agriculturally useful characteristics of an agricultural plant.
[0008] SUMMARY OF THE INVENTION
[0009] The present invention is at least in part based on the inventors' discovery that certain fungi can be used as an agricultural biological, in particular as a biostimulant, to increase one or more plant trait of agronomic importance, such as in particular biomass (such as wet or dry biomass), plant height, seed yield, and / or silage yield of a plant or part thereof.
[0010] As corroborated in the experimental section, which illustrates certain representative embodiments of the invention, the present inventors have found inter alia that plants grown from seeds treated with said fungi demonstrated an increase in wet biomass, dry biomass, plant height, seed yield, and silage yield as compared to untreated seeds.
[0011] Accordingly, an aspect of the invention relates to a method for improving a plant growth feature of a plant compared to an untreated plant, the method comprising administering cells of a fungal strain which comprises a nuclear ribosomal internal transcribed spacer (ITS) polynucleotide having at least 99.00% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (see Table 2) to the plant, a part thereof, a seed for growing the plant, or a locus of the plant. A related aspect provides the use of cells of a fungal strain which comprises an ITS polynucleotide having at least 99.00% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 for improving a plant growth feature of a plant compared to an untreated plant. In certain preferred embodiments, seed (grain) yield may thereby be increased.
[0012] A further aspect provides a method for improving a plant growth feature of a plant compared to an untreated plant, the method comprising administering cells of a Penicillium novae-zeelandiae strain to the plant, a part thereof, a seed for growing the plant, or a locus of the plant. A related aspect provides the use of cells of a Penicillium novae-zeelandiae strain for improving a plant growth feature of a plant compared to an untreated plant. In certain preferred embodiments, seed (grain) yield may thereby be increased.
[0013] A further aspect relates to a method of treating a seed of a plant comprising inoculating the seed with said fungal cells (i.e., cells of one or more fungal strain as defined above), such that the fungal cells colonize a plant germinated from the inoculated seed and / or the soil or plant growth medium surrounding the growing plant, whereby the plant growth feature of the plant is improved compared to a plant germinated from an untreated seed. In certain preferred embodiments, seed (grain) yield of the plant may thereby be increased. Without wishing to be bound to any hypothesis, where the fungal cells colonize the soil or plant growth medium in the vicinity of the plant roots, the fungal cells may make accessible and provide to the plant absorbable nutrients.
[0014] Another aspect provides a plant or part thereof treated with said fungal cells or with a composition comprising the fungal cells; or a plant or part thereof heterologously disposed with said fungal cells. The inventors also identified several novel fungal strains particularly advantageous in the present context. An aspect thus provides a fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 10 December 2021 under Accession No. MUCL 58200, or a functional mutant thereof. Another aspect provides a fungal strain as deposited under the Budapest Treaty at the BCCM™ / MUCL on 24 August 2022 under Accession No. MUCL 58316, or a functional mutant thereof. Another aspect provides a fungal strain as deposited under the Budapest Treaty at the BCCM™ / MUCL on 17 January 2022 under Accession No. MUCL 58238, or a functional mutant thereof. Also provided is a combination of any two or more such strains. An aspect provides a fungal strain as deposited under the Budapest Treaty at the BCCM™ / MUCL on 27 November 2023 under Accession No. 58394 , or a functional mutant thereof. An aspect provides a fungal strain as deposited under the Budapest Treaty at the BCCM™ / MUCL on 27 November 2023 under Accession No. 58395, or a functional mutant thereof. An aspect provides a fungal strain as deposited under the Budapest Treaty at the BCCM™ / MUCL on 27 November 2023 under Accession No.58396 , or a functional mutant thereof. An aspect provides a fungal strain as deposited under the Budapest Treaty at the BCCM™ / MUCL on 1 November 2023 under Accession No.58397 , or a functional mutant thereof.
[0015] Further aspects provide: a fungal cell population comprising one or more of the aforementioned strain; as well as an agricultural active composition comprising one or more of the aforementioned strain.
[0016] The fungal strains, products, methods, and uses of the present invention advantageously allow to improve one or more trait of agronomic importance in a plant, such as one or more plant growth features. Hence, the herein described fungal strains provide several significant advantages to plants, in particular to agricultural plants, such as wheat, barley, maize, and the like. For example, dry biomass, wet biomass, height of the plant, plant yield, and / or seed yield of a plant can be increased compared to untreated plants by applying the teachings of the present invention. Further the herein described fungal strain may also improve the ability of the plants to cope with abiotic stresses such as, but not limited to, drought. The present invention can thus allow to substitute or even abolish the use of chemical products such as fertilizers, and thereby advantageously facilitate more sustainable agriculture or increase the yield under adverse conditions. The teachings of the present invention can be immediately applied to any plant and, compared to provision of transgenic plants, do not require additional time for gene identification, generation and characterization of transgenic lines. Compared to the use of traditional agricultural methods including the application of chemical fertilizers, the present approaches can require less resources, can be less labor intensive, and are more environmentally friendly, and thereby also compatible with organic farming practices.
[0017] The above and further aspects and preferred embodiments of the invention are described in the following sections and in the appended claims. The subject-matter of appended claims is hereby specifically incorporated in this specification.
[0018] DESCRIPTION OF THE DRAWINGS
[0019] The following description of the figures of specific embodiments of the invention is merely exemplary in nature and is not intended to limit the present teachings, their application or uses.
[0020] In Figure 1, the graphs on the left visualize the values of the dry biomass, wet biomass, or plant height, with 95% confidence intervals for treated seeds and mock treated seeds in greenhouse condition, whereas the graphs on the right visualize the values of the difference between treated and mock treated seeds in dry biomass, wet biomass, or plant height with its 95% confidence interval in greenhouse condition. The percentage indicates the difference in dry biomass, wet biomass, or plant height expressed as a percentage of the mock treatment.
[0021] Figure 1A represents graphs illustrating the increased dry biomass per plant at 6 weeks after sowing of maize plants obtained from seeds treated with a formulation comprising spores of the MUCL58200 or MUCL58238 fungal strain compared to the dry biomass per plant at 6 weeks after sowing of maize plants obtained from untreated seeds (mock).
[0022] Figure IB represents graphs illustrating the increased wet biomass per plant at 6 weeks after sowing of maize plants obtained from seeds treated with a formulation comprising spores of the MUCL58200 or MUCL58238 fungal strain compared to the dry biomass per plant at 6 weeks after sowing of maize plants obtained from untreated seeds (mock).
[0023] Figure 1C represents graphs illustrating the plant height at 5 weeks after sowing of maize plants obtained from seeds treated with a formulation comprising spores of the MUCL58200 or MUCL58238 fungal strain compared to the plant height at 5 weeks after sowing of maize plants obtained from untreated seeds (mock).
[0024] Figure 2A visualizes the value in grain yield of maize measured at a location in France in the season 2022 with a 50 % N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a wettable powder (WP) formulation containing Penicillium MUCL 58200 strain and colorant showed an increased yield of 5.2 % compared to the untreated seeds.
[0025] Figure 2B visualizes the value in grain yield of maize measured at a location in Germany in the season 2022 with a 100 % N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a WP formulation containing Penicillium MUCL58200 strain and colorant showed an increased yield of 4.4 % compared to the untreated seeds.
[0026] Figure 2C visualizes the value in grain yield of maize measured at a location in France in the season 2022 with a 100 % N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a WP formulation containing Penicillium MUCL58200 strain and colorant showed an increased yield of 4.2 % compared to the untreated seeds.
[0027] Figure 3A visualizes the value in dry weight yield of silage maize measured at a location in Poland in the season 2021 with a 50 % N fertilizer regime. The graph on the left visualizes the values of dry weight yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in dry weight yield with its 95% confidence interval. Maize seeds treated with spores of Penicillium MUCL58200 strain and colorant showed an increased yield of 14.6 % compared to the untreated seeds.
[0028] Figure 3B visualizes the value in dry weight yield of silage maize measured at a location in Poland in the season 2021 with a 50 % N fertilizer regime. The graph on the left visualizes the values of dry weight yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in dry weight yield with its 95% confidence interval. Maize seeds treated with spores of Penicillium MUCL58238 strain and colorant showed an increased yield of 16.5 % compared to the untreated seeds. Figure 3C visualizes the value in dry weight yield of silage maize measured at a location in France in the season 2021 with a 50 % N fertilizer regime. The graph on the left visualizes the values of dry weight yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in dry weight yield with its 95% confidence interval. Maize seeds treated with spores of Penicillium MUCL58238 strain and colorant showed an increased yield of 8.3 % compared to the untreated seeds.
[0029] Figure 4A visualizes the value in grain yield of maize measured at a location in Northern Germany in the season 2023 with a 50% N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a WG formulation containing Penicillium F13E1 (MUCL 58200) strain and colorant showed an increased yield of 10.7% compared to the blank coated seeds.
[0030] Figure 4B visualizes the value in number of maize plants per ha measured at a location in Romania in 2023 with a 50% N fertilizer regime. The graph on the left visualizes the values of number of maize plants per ha with 95% confidence intervals for treated seeds an untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in number of plants per ha with its 95% confidence interval. Maize seeds treated with a WG formulation containing Penicillium F13E1 (MUCL 58200) strain and colorant showed an increased number of plants of 9% compared to the untreated seeds.
[0031] Figure 4C visualizes the value in grain yield of maize measured at a location in Poland in 2023 with a 50% N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a WG formulation containing Penicillium F5E4 strain (MUCL 58396) and colorant showed an increased yield of 12.6% compared to the untreated seeds.
[0032] Figure 5A visualizes the value in dry weight yield of maize measured at a location in Belgium in the season 2023 with a 50 % N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a WG formulation containing Penicillium F13G3 strain (MUCL 58394) and colorant showed an increased yield of 2.4 % compared to the blank coated seeds.
[0033] Figure 5B visualizes the value in dry weight yield of maize measured at a location in Southern Germany in 2023 with a 50 % N fertilizer regime. The graph on the left visualizes the values of number of maize plants per ha with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in number of plants per ha with its 95% confidence interval. Maize seeds treated with a WG formulation containing Penicillium F13H3 strain (MUCL 58395) and colorant showed an increased number of plants of 5.9 % compared to the untreated seeds.
[0034] Figure 6: Colonization of strain MUCL58200 in the bulk soil surrounding the maize seeds (bulk_seed) and in the maize rhizosphere soil (M_rhizo), but not in maize roots (M_roots) of plants originating from seeds coated with MUCL58200. Results of five replicate plants are shown.
[0035] Figure 7 visualizes the value in dry weight yield of maize from seeds treated with strain MUCL 58397 (strain F6A1) as compared to mock-treated seeds as described above. The graph visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds. Maize seeds treated with a WG formulation containing strain MUCL 58397 showed an increased yield in dry biomass of 8.9 % compared to the blank coated seeds (p<0.0001).
[0036] DETAILED DESCRIPTION OF THE INVENTION
[0037] As used herein, the singular forms "a", "an", and "the" include both singular and plural referents unless the context clearly dictates otherwise.
[0038] The terms "comprise", "comprising", "comprises" and "comprised of" as used herein are synonymous with "include", "including", "includes" or "contain", "containing", "contains", and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. The terms also encompass "consisting of" and "consisting essentially of".
[0039] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints. This applies to numerical ranges irrespective of whether they are introduced by the expression "from... to..." or the expression "between... and..." or another expression. The terms "about" or "approximately" as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of + / -10% or less, preferably + / -5% or less, more preferably + / -1% or less, and still more preferably + / -0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier "about" or "approximately" refers is itself also specifically, and preferably, disclosed.
[0040] Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order, unless specified. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.
[0041] Whereas the term "one or more" or "at least one", such as one or more or at least one member(s) of a group of members, is clear perse, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any33,34,35,36 or37 etc. of said members, and up to all said members. In another example, "one or more" or "at least one" may refer to 1, 2, 3, 4, 5, 6, 7 or more.
[0042] The discussion of the background to the invention herein is included to explain the context of the invention. This is not to be taken as an admission that any of the material referred to was published, known, or part of the common general knowledge in any country as of the priority date of any of the claims. All documents cited in the present specification are hereby incorporated by reference in their entirety.
[0043] Throughout this disclosure, various publications, patents and published patent specifications may be referenced by an identifying citation. All documents cited in the present specification are hereby incorporated by reference in their entirety. In particular, the teachings or sections of such documents herein specifically referred to are incorporated by reference.
[0044] Unless otherwise defined, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions are included to better appreciate the teaching of the invention. When specific terms are defined in connection with a particular aspect of the invention or a particular embodiment of the invention, such connotation or meaning is meant to apply throughout this specification, i.e., also in the context of other aspects or embodiments of the invention, unless otherwise defined.
[0045] In the following passages, different aspects or embodiments of the invention are defined in more detail. Each aspect or embodiment so defined may be combined with any other aspect(s) or embodiment(s) unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.
[0046] Reference throughout this specification to "one embodiment", "an embodiment" means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention, and form different embodiments, as would be understood by those in the art. For example, in the appended claims, any of the claimed embodiments can be used in any combination.
[0047] By extensive experimental testing, the present inventors have found that certain fungal strains exhibit plant growth promoting effects when administered to plants and hence that such strains can advantageously be used as biostimulants on plants. In particular, the fungal strains provided an unexpected enhancement of seed (grain) yield in tested plants.
[0048] Accordingly, an aspect of the invention relates to a method for improving a plant growth feature of a plant compared to an untreated plant, the method comprising administering cells of a fungal strain which comprises a nuclear ribosomal internal transcribed spacer (ITS) polynucleotide having at least 99.00% sequence identity to SEQ. ID NO: 1 or SEQ ID NO: 2 to the plant, a part thereof, a seed for growing the plant, or a locus of the plant. A further aspect provides a method for improving a plant growth feature of a plant compared to an untreated plant, the method comprising administering cells of a Penicillium novae-zeelandiae strain to the plant, a part thereof, a seed for growing the plant, or a locus of the plant. For example, such methods may be suitably practiced in the context of agriculture or horticulture. Also provided is a method of treating a seed of a plant comprising inoculating the seed with said fungal cells, such that the fungal cells colonize a plant germinated from the inoculated seed and / or the soil or plant growth medium surrounding the growing plant, whereby the plant growth feature of the plant is improved compared to a plant germinated from an untreated seed.
[0049] A plant or part thereof treated with said fungal cells or with a composition comprising the fungal cells; or a plant or part thereof heterologously disposed with said fungal cells, are also provided herein.
[0050] A further aspect discloses a fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 10 December 2021 under Accession No. 58200 (also referred to herein as MUCL 58200), or a functional mutant thereof. The proposed taxonomic designation of this strain is Penicillium novae-zeelandiae. Also provided is a fungal cell population comprising the aforementioned strain, as well as an agricultural active composition comprising the aforementioned strain.
[0051] The originally proposed taxonomic designation of this strain is Penicillium novae-zeelandiae, as indicated on the deposit forms. However, the most recent taxonomy data indicates that the deposited strain may be more suitably classified as either a Penicillium murcianum or Penicillium radiatolobatum strain.
[0052] A further aspect discloses a fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 24 August 2022 under Accession No. 58316 (also referred to herein as MUCL 58316), or a functional mutant thereof. The proposed taxonomic designation of this strain is Penicillium novae-zeelandiae. Also provided is a fungal cell population comprising the aforementioned strain, as well as an agricultural active composition comprising the aforementioned strain. The originally proposed taxonomic designation of this strain is Penicillium novae-zeelandiae, as indicated on the deposit forms. However, the most recent taxonomy data indicates that the deposited strain may be more suitably classified as either a Penicillium murcianum or Penicillium radiatolobatum strain.
[0053] A further aspect discloses a fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 17 January 2022 under Accession No. 58238 (also referred to herein as MUCL 58238), or a functional mutant thereof. The proposed taxonomic designation of this strain is Penicillium novae-zeelandiae. Also provided is a fungal cell population comprising the aforementioned strain, as well as an agricultural active composition comprising the aforementioned strain. The originally proposed taxonomic designation of this strain is Penicillium novae-zeelandiae, as indicated on the deposit forms. However, the most recent taxonomy data indicates that the deposited strain may be more suitably classified as either a Penicillium murcianum or Penicillium radiatolobatum strain.
[0054] A further aspect discloses a fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 27 November 2023 under Accession No. 58394 (also referred to herein as MUCL 58394), or a functional mutant thereof. The proposed taxonomic designation of this strain is Penicillium novae-zeelandiae. Also provided is a fungal cell population comprising the aforementioned strain, as well as an agricultural active composition comprising the aforementioned strain. The originally proposed taxonomic designation of this strain is Penicillium novae-zeelandiae, as indicated on the deposit forms. However, the most recent taxonomy data indicates that the deposited strain may be more suitably classified as either a Penicillium murcianum or Penicillium radiatolobatum strain.
[0055] A further aspect discloses a fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 27 November 2023 under Accession No. 58395 (also referred to herein as MUCL 58395), or a functional mutant thereof. The proposed taxonomic designation of this strain is Penicillium novae-zeelandiae. Also provided is a fungal cell population comprising the aforementioned strain, as well as an agricultural active composition comprising the aforementioned strain. The originally proposed taxonomic designation of this strain is Penicillium novae-zeelandiae, as indicated on the deposit forms. However, the most recent taxonomy data indicates that the deposited strain may be more suitably classified as either a Penicillium murcianum or Penicillium radiatolobatum strain.
[0056] A further aspect discloses a fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 27 November 2023 under Accession No. 58396 (also referred to herein as MUCL 58396), or a functional mutant thereof. The proposed taxonomic designation of this strain is Penicillium novae-zeelandiae. Also provided is a fungal cell population comprising the aforementioned strain, as well as an agricultural active composition comprising the aforementioned strain. The originally proposed taxonomic designation of this strain is Penicillium novae-zeelandiae, as indicated on the deposit forms. However, the most recent taxonomy data indicates that the deposited strain may be more suitably classified as either a Penicillium murcianum or Penicillium radiatolobatum strain.
[0057] A further aspect discloses a fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 27 November 2023 under Accession No. 58397 (also referred to herein as MUCL 58397), or a functional mutant thereof. The proposed taxonomic designation of this strain is Penicillium novae-zeelandiae. Also provided is a fungal cell population comprising the aforementioned strain, as well as an agricultural active composition comprising the aforementioned strain. The originally proposed taxonomic designation of this strain is Penicillium novae-zeelandiae, as indicated on the deposit forms. However, the most recent taxonomy data indicates that the deposited strain may be more suitably classified as either a Penicillium murcianum or Penicillium radiatolobatum strain.
[0058] Also provided is a combination of any two or more of the aforementioned strains, and a fungal cell population comprising any two or more of the aforementioned strains, as well as an agricultural active composition comprising any two or more of the aforementioned strains.
[0059] The terms "fungi", "fungus" or "fungal" broadly refer to a wide variety of nucleated (eukaryotic) spore-bearing organisms that are devoid of chlorophyll (i.e., fungi do not photosynthesize, and are heterotrophs). These organisms are classified in the kingdom Fungi, separately from other eukaryotic kingdoms. Examples of fungi include multicellular filamentous fungi and unicellular fungi. Examples of fungi include yeasts, molds, mildews, rusts, smuts, and mushrooms. Many fungi are free-living in soil or water; others form parasitic or symbiotic relationships with plants or animals. The term "fungal cell" includes any cell of a fungal organism at any stage of the organism's life cycle, and for example encompasses fungal cells of any ploidy, such as haploid, diploid, and polyploid fungal cells; and encompasses vegetative cells as well as fungal spores.
[0060] As used herein, the term "bacterium", "bacteria", or "bacterial" refers in general to any prokaryotic organism, and may refer to an organism from either Kingdom Eubacteria (Bacteria), Kingdom Archaebacteria (Archaea), or both. In some cases, bacterial genera have been reassigned due to various reasons (such as, but not limited to, the evolving field of whole genome sequencing), and it is understood that such nomenclature reassignments are within the scope of any claimed genus. The term "strain" (such as for example in the phrases "fungal strain" and "bacterial strain") as a basic operational unit of microbial taxonomy, such as fungal or bacterial taxonomy, is frequently used to denote a population made up of the descendants of a single isolation in pure culture, usually made up of a succession of cultures ultimately derived from an initial single fungal or bacterial colony. Where a species encompasses two or more distinct isolates, the term "strain" may be used to refer to an isolate or group of isolates that can be distinguished from other isolates of the same genus and species by phenotypic characteristics or genotypic characteristics or both.
[0061] In the practice of the present invention, the strain may be deemed as "isolated" or "purified". The terms "isolated" or "purified" with reference to a particular component generally denote that such component exists in separation from - for example, has been separated from or prepared and / or maintained in separation from - one or more other components of its natural environment. The terms do not necessarily reflect the extent to which the component has been purified. Hence, the phrases "isolated strain" or "purified strain" may be seen as referring to a strain that has been removed from its natural milieu. In particular, the terms refer to substantially no other strains than the desired strain, which is thus substantially free of other contaminants, which can include microbial contaminants. Further, the terms may denote that the strain has been separated from materials with which it is normally found in nature. A strain heterologously disposed to other strains, or with compounds or materials with which it is not normally found in nature, is encompassed by the phrases "isolated strain" or "purified strain".
[0062] In certain embodiments, the purified fungal strains as taught herein may be denoted as endophytes. An "endophyte" is an organism capable of living on a plant element (e.g., rhizoplane or phyllosphere) or within a plant element (e.g., endosphere) or on a surface in close physical proximity with a plant element (e.g., the rhizosphere or on a seed). Endophytes can occupy the intracellular or extracellular spaces of plant tissue, including but not limited to leaves, stems, flowers, fruits, seeds, or roots. An endophyte can be, for example, a bacterial or fungal organism, and can confer a beneficial property to the host plant such as an increase in yield, biomass, resistance, and / or fitness. An endophyte can be a bacterium or a fungus. As used herein, the term "microbe" or "strain" is sometimes used to describe an endophyte. As used herein, the microbes or strains as described herein can be labelled as endophytes.
[0063] Endophytes may favorably impact one or more traits of agronomic interest in plants. By means of an example and without limitation, a plant heterologously disposed with one or more endophyte microorganism, or a plant grown from a plant part or seed treated with or heterologously disposed with one or more endophyte microorganism, such as an endophytic bacterial or fungal strain, may exhibit a trait of agronomic interest, such as a trait selected from the group consisting of: disease resistance, drought tolerance, heat tolerance, cold tolerance, salinity tolerance, metal tolerance, herbicide tolerance, chemical tolerance, improved water use efficiency, improved phosphorus solubilization, improved phosphorus mobilization, improved nitrogen utilization, improved nitrogen fixation, pest resistance, herbivore resistance, pathogen resistance, increase in yield, increase in yield under water-limited conditions, health enhancement, vigor improvement, growth improvement, improved plant emergence, photosynthetic capability improvement, nutrition enhancement, altered protein content, altered oil content, increase in biomass, increase in number of tillers per plant, increase in shoot length, increase in root length, improved root architecture, increase in seed weight, altered seed carbohydrate composition, altered seed oil composition, increase in radical length, delayed senescence, stay-green, altered seed protein composition, increase in dry weight of mature plant reproductive elements, increase in fresh weight of mature plant reproductive elements, increase in number of mature plant reproductive elements per plant, increase in chlorophyll content, reduced number of wilted leaves per plant, reduced number of severely wilted leaves per plant, increase in number of non-wilted leaves per plant, improved plant visual appearance, and combinations thereof.
[0064] As used herein, a microorganism, such as a bacterial or fungal strain, such as an endophytic bacterial or fungal strain, is considered to have conferred an improved agricultural trait whether or not the improved trait arose from the plant, the strain, or the concerted action between the plant and the strain. Therefore, for example, where an improved agronomic trait results at least in part from the production of a beneficial hormone or chemical, for the purposes of the present specification the strain will be considered to have conferred the improved agronomic trait upon the plant as compared to a plant, plant part or seed that has not been treated with or heterologously disposed with said strain, whether the beneficial hormone or chemical is produced by the plant or by the strain.
[0065] Particularly envisaged herein is the administration of live fungi and / or microorganisms. The term "live" as used herein is synonymous with "viable" and refers to any living intact state of a microorganism, such as active growth or dormancy, from which state it can multiply and / or reproduce itself in a medium capable of supporting the growth of the microorganism. Typically, substantially all fungal cells or microorganisms comprised by populations or compositions intended herein may be live or viable. For example, at least 50%, preferably at least 60%, more preferably at least 75%, still more preferably at least 90%, such as at least 95%, 96%, 97%, 98%, 99% or 100% of the fungal cells or microorganisms in the population or composition may be viable, such as capable of forming colonies when plated on a suitable solid medium.
[0066] The nuclear ribosomal internal transcribed spacer (ITS) refers to the spacer polynucleotide situated between the small-subunit ribosomal RNA (18S rRNA) and large-subunit rRNA (28S rRNA) genes in the chromosome, or the corresponding transcribed region in the polycistronic rRNA precursor transcript. Conveniently, the ITS sequence can be determined by sequencing (e.g., Sanger sequencing) the ITS in the chromosomal DNA, which may be amplified (e.g., PCR amplified) using suitable amplification primers, such as the reference primers ITS1 (TCCGTAGGTGAACCTGCGG, SEQ ID NO: 3) for forward and ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO: 4) for reverse which capture the entire region .The ITS region is the formal fungal barcode and the most commonly sequenced genetic marker in mycology. The average length of the ITS region is 550 base pairs (bp) in the fungal kingdom, but varies markedly among lineages. It is composed of the two variable spacers, ITS1 and ITS2, and the intercalary, highly conserved 5.8S ribosomal gene.
[0067] The terms "identity", "sequence identity" or "identical" in the context of nucleotide sequences may be used interchangeably herein, and refer to the extent that nucleic acid sequences are identical on a nucleotide-by-nucleotide basis, over a window of comparison. The percentage of sequence identity may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. The percent identity value may, but need not, be rounded to the nearest tenth. For example, 98.11, 98.12, 98.13, and 98.14 may be rounded down to 98.1, while 98.15, 98.16, 98.17, 98.18, and 98.19 may be rounded up to 98.2.
[0068] Sequence identity between nucleic acids as envisaged herein may be determined using suitable algorithms for performing sequence alignments and determination of sequence identity as know per se. Exemplary but non-limiting algorithms include those based on the Basic Local Alignment Search Tool (BLAST) originally described by Altschul et al. 1990 (J Mol Biol 215: 403-10), such as the "Blast 2 sequences" tool described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174: 247- 250), or the "blastn suite-2sequences" sequence alignment algorithm described by Zheng Zhang et al. 2000 (J Comput Biol 2000, vol. 7(1-2), 203-14), now incorporated into the BLAST program suite available at ncbi.nlm.nih.gov. The skilled person can implement such algorithms and set the requisite parameters. By means of an example and without limitation, parameters for the BLASTN program may be as follows: cost to open a gap = 0, cost to extend a gap = 2.5, reward for a match = 1, penalty for a mismatch = -2, Expect value = 0.05, word size = 28, Low Complexity Filter = Yes.
[0069] There are further algorithms known in the art that can be used to measure nucleotide sequence identity. Nucleotide sequence identity can be measured by a local or global alignment, preferably implementing an optimal local or optimal global alignment algorithm. For example, a global alignment may be generated using an implementation of the Needleman-Wunsch algorithm (Needleman & Wunsch. Journal of Molecular Biology 1970, vol. 48(3), 443-53). For example, a local alignment (which does not consider the entirety of the sequence but tries to find the longest subsequence that confirms to a given matching criteria) may be generated using an implementation of the Smith-Waterman algorithm (Smith & Waterman Journal of Molecular Biology 1981, vol. 147(1), 195-197). Optimal global alignments using the Needleman-Wunsch algorithm and optimal local alignments using the Smith-Waterman algorithm are implemented in USEARCH (https: / / www.drive5.com / usearch / ), for example USEARCH version 11.0.667.
[0070] A gap is a region of an alignment wherein a sequence does not align to a position in the other sequence of the alignment. In global alignments, terminal gaps are discarded before identity is calculated. For both local and global alignments, internal gaps are counted as differences. A terminal gap is a region beginning at the end of a sequence in an alignment wherein the nucleotide in the terminal position of that sequence does not correspond to a nucleotide position in the other sequence of the alignment and extending for all contiguous positions in that sequence wherein the nucleotides of that sequence do not correspond to a nucleotide position in the other sequence of the alignment.
[0071] Sequence identity as envisaged herein in particular denotes overall sequence identity, i.e., sequence identity calculated from optimally aligning the whole sequences of the to-be-compared ITS region sequences. In other words, the nucleic acid sequences to be aligned are the complete ITS region sequences, and the window of comparison corresponds to the whole region of optimal alignment between these complete ITS sequences, i.e., to the alignment length. Hence, in an example, a query ITS region sequence, such as the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, is optimally aligned with another complete ITS region sequence (in case of a global alignment any terminal gaps are disregarded; in case of a local alignment the region of alignment will be expressed as the region between a given 5' and a given 3' position in the query sequence), and the percentage sequence identity is calculated over a window of comparison which corresponds to the whole region of alignment, counting internal gaps as differences. The length of the ITS region can vary between fungal species and strains. Therefore, fungal strains as envisaged herein preferably comprise an ITS polynucleotide the length of which is between 90% and 110% (496-606 nucleotides), more preferably between 95% and 105% (524-579 nucleotides) of the length of the ITS region polynucleotide shown in SEQ ID NO: 1 or SEQ ID NO: 2. These ITS sequences can be subjected to pairwise sequence comparisons with SEQ ID NO: 1 or SEQ ID NO: 2.
[0072] When two complete ITS region sequences in a pairwise sequence comparison are optimally aligned, for example by a local alignment algorithm such as BLAST, it is particularly envisaged that the alignment length is at least 90% of the length of the shorter one of the two ITS sequences, preferably at least about 91%, 92%, 93%, 94%, more preferably at least about 95%, or at least about 96%, 97%, 98%, 99% or 100% of the length of the shorter one of the two ITS sequences, and the window of comparison corresponds to the whole alignment length.
[0073] Preferably, the region of alignment, for example the region of alignment provided by a local alignment algorithm such as BLAST, will comprise at least 90% of the length of SEQ ID NO: 1 or SEQ ID NO: 2, more preferably at least about 91%, 92%, 93%, 94%, even more preferably at least about 95%, or at least about 96%, 97%, 98%, 99% or 100% of the length of SEQ ID NO: 1 or SEQ ID NO: 2. Preferably, the region of alignment, for example the region of alignment provided by a local alignment algorithm such as BLAST, will comprise at least 496 contiguous (the term contiguous in this context does not exclude the presence of internal gaps in the alignment) nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2, or at least 500 contiguous nucleotides, such as at least 510 or at least 520 contiguous nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2. Particularly preferably, the region of alignment will comprises at least 524, or in increasing order of preference, at least 530, at least 535, at least 540, at least 545, at least 550, or all 551 contiguous nucleotides of the ITS polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2.
[0074] In certain preferred embodiments, the fungal strain comprises an ITS polynucleotide having at least 99.00% sequence identity to SEQ ID NO: 1, or in increasing order of preference, at least 99.10%, at least 99.20%, at least 99.30%, at least 99.40%, at least 99.50%, at least 99.60%, at least 99.70%, at least 99.80%, at least 99.90% sequence identity to SEQ ID NO: 1; such as for example, at least 99.10%, at least 99.28%, at least 99.46%, at least 99.64%, or at least 99.82% sequence identity to SEQ ID NO: 1. In certain still more preferred embodiments, the fungal strain comprises an ITS polynucleotide having 100.00% sequence identity to SEQ ID NO: 1.
[0075] In certain particularly preferred embodiments, the fungal strain comprises an ITS polynucleotide which, when aligned over a region of alignment comprising at least 524 contiguous nucleotides of SEQ ID NO: 1, or in increasing order of preference, over a region of alignment comprising at least 530, at least 535, at least 540, at least 545, at least 550, or all 551 contiguous nucleotides of SEQ ID NO: 1, will display no more than 5 nucleotide mismatches and internal gaps with SEQ ID NO: 1, or in increasing order of preference no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide mismatch and internal gap with SEQ ID NO: 1, and most preferably no nucleotide mismatches and internal gaps with SEQ ID NO: 1. The mismatch or internal gap in this context refers to a single nucleotide mismatch or a gap that involves or spans a single nucleotide.
[0076] In certain particularly preferred embodiments, the fungal strain comprises an ITS polynucleotide as set forth in (i.e., identical to) SEQ ID NO: 1, i.e., an ITS polynucleotide identical over the full length thereof to SEQ ID NO: 1.
[0077] In certain particularly preferred embodiments, the fungal strain comprises an ITS polynucleotide which, when aligned over a region of alignment comprising at least 524 contiguous nucleotides of SEQ ID NO: 2, or in increasing order of preference, over a region of alignment comprising at least 530, at least 535, at least 540, at least 545, at least 550, or all 551 contiguous nucleotides of SEQ ID NO: 2, will display no more than 5 nucleotide mismatches and internal gaps with SEQ ID NO: 2, or in increasing order of preference no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide mismatch and internal gap with SEQ ID NO: 2, and most preferably no nucleotide mismatches and internal gaps with SEQ ID NO: 2. The mismatch or internal gap in this context refers to a single nucleotide mismatch or a gap that involves or spans a single nucleotide.
[0078] In certain particularly preferred embodiments, the fungal strain comprises an ITS polynucleotide as set forth in (i.e., identical to) SEQ ID NO: 2, i.e., an ITS polynucleotide identical over the full length thereof to SEQ ID NO: 2.
[0079] In certain embodiments, the fungal strain is a Penicillium species strain. Penicillium is a genus of ascomycetous fungi that has been reported to contains over 300 species. In particular, the fungal strain may belong to the subgenus Penicillium. Morphological and biochemical characteristics of Penicillium species can be consulted, for example, in A Laboratory Guide to Common Penicillium Species, by John I. Pitt, Lubrecht & Cramer Ltd (June 6, 1995).
[0080] In certain embodiments, the fungal strain can be denoted or classified as a Penicillium novae- zeelandiae strain.
[0081] In certain embodiments, the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 10 December 2021 under Accession No.
[0082] 58200, or a functional mutant thereof.
[0083] In certain embodiments, the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 24 August 2022 under Accession No. 58316, or a functional mutant thereof.
[0084] In certain embodiments, the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 17 January 2022 under Accession No. 58238, or a functional mutant thereof.
[0085] In certain embodiments, the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 27 November 2023 under Accession No. 58394, or a functional mutant thereof.
[0086] In certain embodiments, the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 27 November 2023 under Accession No. 58395, or a functional mutant thereof.
[0087] In certain embodiments, the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 27 November 2023 under Accession No. 58396, or a functional mutant thereof.
[0088] In certain embodiments, the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) on 27 November 2023 under Accession No. 58397, or a functional mutant thereof.
[0089] Certain embodiments employ a combination of any two or more of said strains.
[0090] The term "functional mutant" means a fungal strain directly or indirectly obtained by genetic modification (such as by random mutagenesis or by targeted genetic modification) of the respective referenced strain and retaining at least some extent of the activity of the referenced strain on the plant growth feature of interest, such as ability to or activity in increasing the biomass, plant height, seed yield, and / or plant yield of the plant, preferably retaining at least 10%, such as at least 20%, at least 30%, or at least 40%, preferably at least 50%, such as at least 60%, at least 70%, or at least 80%, more preferably at least 90%, such as 100%, or even greater than 100% of the activity of the referenced strain on the plant growth feature of interest. In certain embodiments, the functional mutant retains at least 10%, such as at least 20%, at least 30%, or at least 40%, preferably at least 50%, such as at least 60%, at least 70%, or at least 80%, more preferably at least 90%, such as 100%, or even greater than 100% of the biomass-, plant height-, seed yield-, and / or plant yield-increasing activity of the referenced strain, in particular of the said activity or activities in maize. The genetic modification of a functional mutant can be achieved through any means, such as, but not limited to, chemical mutagens, ionizing radiation, transposon-based mutagenesis, or via conjugation, transduction, or transformation using the referenced strains as either the recipient or donor of genetic material. In certain embodiments, the ITS sequence of the functional mutant remains identical to the ITS sequence of the referenced strain. Hence, the functional mutant may preferably comprise the ITS sequence as shown in SEQ. ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the functional mutant comprises at most 10, such as in increasing order of preference, at most 9, 8, 7, 6, 5, 4, 3, 2, or at most 1 chromosomal loci (such as genes) whose nucleic acid sequence differs from (has been modified compared to) the sequence of the corresponding loci in the referenced strain, and / or the functional mutant comprises at most 10, such as in increasing order of preference, at most 9, 8, 7, 6, 5, 4, 3, 2, or at most 1 transgenic elements (such as transgenes) introduced into it and not present in the referenced strain. In certain embodiments, at most 10, such as in increasing order of preference, at most 9, 8, 7, 6, 5, 4, 3, 2, or at most 1 gene of the functional mutant carries a non-synonymous mutation not present in the reference strain.
[0091] In certain embodiments, cells of two or more fungal strains as described in the present specification may be administered to the plant, the part thereof, the seed for growing the plant, or the locus of the plant.
[0092] In certain embodiments, the fungal cells as described in the present specification may be administered to the plant, the part thereof, the seed for growing the plant, or the locus of the plant in conjunction with one or more additional plant-beneficial microorganism. As used throughout the present specification, the term "microorganism" or "microbe" refers to any strain, any species or taxon of microorganism, including, but not limited to, archaea, bacteria, microalgae, fungi (including mold and yeast species), mycoplasmas, microspores, nanobacteria, oomycetes, and protozoa. In some embodiments, a microbe or microorganism is a bacterial strain. In some embodiments, a microbe or microorganism is a fungal strain. In some embodiments, a microbe or microorganism is an endophyte, for example a bacterial or fungal endophyte, which is capable of living within a plant. In some embodiments, a microbe or microorganism encompasses individual cells (e.g., unicellular microorganisms) or more than one cell (e.g., multi-cellular microorganism).
[0093] Diverse plant-associated microorganisms can positively impact plant health and physiology in a variety of ways. In particular, plant-beneficial microorganisms, when administered to a plant, plant part, a seed for growing a plant, or a locus of a plant may improve one or more traits of agronomic importance in a plant, such as one or more plant growth features. Where the improved trait can be quantified, any extent of an improvement is contemplated. For example, a plant-beneficial microorganism may provide an improved trait of agronomic importance in a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, at least 100%, between 100% and 150%, at least 150%, between 150% and 200%, at least 200%, between 200% and 300%, at least 300% or more, when compared with a reference plant grown under the same conditions. By means of an illustration, a plant-beneficial microorganism may be capable of increasing nutrient uptake and / or nutrient use efficiency of a treated plant as compared to an untreated plant, increasing the nitrogen fixating capacities or phosphorus uptake of a treated plant as compared to an untreated plant, increasing the amount of biomass of a treated plant as compared to an untreated plant, increasing the number of tillers per plant of a treated plant as compared to an untreated plant, increasing growth and / or yield of a treated plant as compared to an untreated plant, and / or helping a treated plant overcome stress conditions, such as nutrient stress, compared to an untreated plant; and the like. Further traits of agronomic importance that can be improved by plant-beneficial microorganisms may include disease resistance, drought tolerance, heat tolerance, cold tolerance, salinity tolerance, metal tolerance, herbicide tolerance, chemical tolerance, improved water use efficiency, improved phosphorus solubilization, improved phosphorus mobilization, improved nitrogen utilization, improved nitrogen fixation, pest resistance, herbivore resistance, pathogen resistance, increase in yield, increase in yield under water-limited conditions, health enhancement, vigor improvement, growth improvement, improved plant emergence, photosynthetic capability improvement, nutrition enhancement, altered protein content, altered oil content, increase in biomass, increase in number of tillers per plant, increase in shoot length, increase in root length, improved root architecture, increase in seed weight, altered seed carbohydrate composition, altered seed oil composition, increase in radical length, delayed senescence, stay-green, altered seed protein composition, increase in dry weight of mature plant reproductive elements, increase in fresh weight of mature plant reproductive elements, increase in number of mature plant reproductive elements per plant, increase in chlorophyll content, reduced number of wilted leaves per plant, reduced number of severely wilted leaves per plant, increase in number of non-wilted leaves per plant, and / or improved plant visual appearance, and the like.
[0094] By means of an illustration and without limitation, plant-beneficial microorganisms may include mycorrhizal fungi, including endomycorrhizal fungi and ectomycorrhizal fungi, such as fungi belonging to the divisions Basidiomycota, Ascomycota, and Zygomycota, bacteria of the family Rhizobiaceae, bacteria of the genera Frankia, Azotobacter, Azospirillum, Acetobacter, Azoarcus, Burkholderia, Herbaspirillum, Pseudomonas (e.g., Pseudomonas fluorescens, P. putida, P. gladioli), Bacillus (Bacillus subtilis, B. cereus, B. circulans), further bacteria such as Serratia marcescens, Flavobacterium spp., Alcaligenes sp., Agrobacterium radiobacter, and others. In certain embodiments, the plant-beneficial microorganisms are selected from those disclosed in W02018060519, W02020161351, and WO2020161352.
[0095] In certain embodiments, the one or more additional plant-beneficial microorganism may be selected to improve the efficacy of the fungal strain as taught herein, in particular efficacy in improving the plant growth feature acted on by the fungal strain. Hence, also provided is a method of improving the efficacy of the fungal strain as taught herein, comprising the selection of an additional plant-beneficial microorganism, whereby co-administration of the additional plant- beneficial microorganism with the fungal strain or strains to a plant, plant part, or seed improves the plant growth feature. In such embodiments, the administration of the plant-beneficial microorganism alone may but need not lead to an improvement in a plant trait.
[0096] In certain embodiments, the fungal cells can be comprised in or be part of an agricultural active composition. Hence, the methods may entail administering or applying such an agricultural active composition to the plant, the part thereof (e.g., roots), the seed for growing the plant, or the locus of the plant (e.g., to soil or plant growth medium surrounding the plant).
[0097] The term "composition" generally refers to a thing composed of two or more components, and more specifically denotes a combination or mixture of two or more materials, such as elements, molecules, substances, and / or microorganisms, as well as reaction products and decomposition products formed from the materials of the composition. The term may be interchangeably used with the terms "formulation" or "preparation". Agricultural active compositions typically comprise one or more agriculturally active ingredients and one or more agriculturally acceptable carrier or auxiliary. The terms "active ingredient" or "active component" can be used interchangeably and broadly refer to a material, such as an element, molecule, substance, and / or microorganism, which, when provided in an effective amount, achieves a desired outcome, such as achieves one or more effects on one or more traits of agronomic importance in plants. Typically, an active ingredient as intended herein may achieve such outcome(s) through interacting with and / or modulating the plant, part thereof, a seed for growing the plant, or the locus of the plant. The terms "agriculturally acceptable" or "agriculturally compatible" are consistent with the art and mean not deleterious to the recipient plant, such as not producing, having or causing any adverse effects when applied to a plant or to an organ, part or element of the plant, or adverse effects to the plant grown from that plant organ, part or element. The agriculturally active formulations may comprise materials which facilitate or enhance the stability, viability, storage, and / or administration of the fungal strain(s) and / or plant-beneficial microorganism(s) as disclosed herein, and / or the colonization of the plant thereby.
[0098] Compositions as typically used herein may be liquid, semi-solid, or solid, and may include solutions or dispersions. Non-limiting examples of the compositions as taught herein may be soluble powders, soluble granules, wettable granules, tablet formulations, dry flowables, aqueous flowables, wettable dispersible granules, oil dispersions, suspension concentrates, dispersible concentrates, emulsifiable concentrates, aqueous suspensions, fertilizer granules, sprayables, and the like. In certain embodiments, a composition may be composed of components that are provided to an end user as a mixture, i.e., the composition components are already admixed. In certain embodiments, a composition may be composed of components one or more of which are provided to an end user in a physically separated form (e.g., in separate containers or vials) from one or more other components of the composition, although typically as part of the same product package or dispensing device. By means of an example and without limitation, the composition may comprise one or more components provided in one container, and one or more components provided in another container. Such arrangement allows the end user to admix the components of the composition shortly before use. For example, the composition may comprise the fungal cells and optionally further plant beneficial microorganism(s) as taught herein provided in one container, and one or more auxiliaries provided in another container, to be admixed by the end user before use.
[0099] In certain embodiments, the composition comprises one or more agriculturally acceptable auxiliary. The terms "auxiliary", "auxiliary agent", "additive", or "adjuvant" may be used interchangeably herein. The auxiliaries may be natural or synthetic organic or inorganic materials which facilitate the administration of actives to plants, plant parts, seeds, or plant growth loci. In certain embodiments, the auxiliaries may be one or more of as a solvent, a carrier, a surfactant, a sticker, an antifreeze agent, a thickener, a buffering agent, an antifoaming agent, an antioxidant, a preservative, an aroma, or a colorant. Suitable auxiliary agents and inert agents are known in the art and are commercially available. In general, the fungal cells and optionally further plant- beneficial microorganism(s) can be combined with any solid, semi-solid or liquid additive customarily used for formulation purposes. A carrier is to be understood as meaning a natural or synthetic, organic or inorganic substance which is mixed or combined with the fungal cells and optionally further plant-beneficial microorganism(s) for better applicability, in particular for application to plants or plant parts such as seeds. The carrier, which may be solid, semi-solid, or liquid, is generally inert and suitable for use in agriculture or horticulture. For instance, liquid carriers may include water, organic solvents, and mineral oils and vegetable oils. Suitable liquefied gaseous extenders or carriers are liquids which are gaseous at ambient temperature and under atmospheric pressure, for example aerosol propellants, such as butane, propane, nitrogen and carbon dioxide. A sticker is to be understood as meaning an additive or adjuvant to improve adhesive properties of the composition to the plant or part thereof. Suitable surfactants are emulsifiers, dispersants or wetting agents having ionic or nonionic properties, or mixtures of these surfactants. It is possible to use colorants such as inorganic pigments, for example iron oxide, titanium oxide, Prussian blue, and organic dyes, such as alizarin dyes, azo dyes and metal phthalocyanine dyes, and trace nutrients, such as salts of iron, manganese, boron, copper, cobalt, molybdenum and zinc. Stabilizers, such as low-temperature stabilizers, preservatives, antioxidants, light stabilizers or other agents which improve chemical and / or physical stability may also be present.
[0100] In certain embodiments, the fungal cells and optionally further plant-beneficial microorganism(s) may be administered in combination with one or more other non-active or active ingredients that are non-toxic thereto. Such other ingredients may be an oil, an emulsifier, a spreader, a cryoprotectant, a binder, a dispersant, a surfactant, a buffer, a tackifier, a stabilizer, a microbial stabilizer, a bactericide, a fungicide (e.g., effective against fungi other than those administered), a complexing agent, a herbicide, a nematicide, an insecticide, a molluscicide, an algicide, a fertilizer, a micronutrient fertilizer material, a plant growth regulator, a rodenticide, a preservative, a polymer, a desiccant, a nutrient, an excipient, a wetting agent, a salt, or any combination thereof.
[0101] In certain embodiments, the fungal cells and optionally further plant-beneficial microorganism(s) may be co-administered and / or co-formulated with further biologicals or agrochemicals that stimulate plant growth and / or yield. In certain embodiments, particular strains may be selected on the basis of their compatibility with commonly used biologicals or agrochemicals. Plants, particularly agricultural plants, can be treated with a vast array of biologicals or agrochemicals. In some cases, particular strain may be selected to be compatible with biologicals or agrochemicals with complexing properties, to facilitate persistence of the strain in the plant. There also exist many complexing agents that do not penetrate the plant, at least at a concentration sufficient to interfere with the administered fungal cells. Where a systemic complexing agent is used in the plant, compatibility of the strain to be inoculated with such agents may be an important variable to consider. In an embodiment, purified fungal strains that are compatible with biologicals or agrochemicals can be used to inoculate plants, plant elements or growth media according to the methods described herein.
[0102] Fungicide-compatible strains can also be isolated by selection on liquid medium. The culture of strains can be plated on petri dishes without any forms of mutagenesis; alternatively, strains can be mutagenized using any means known in the art. For example, strain cultures can be exposed to UV light, gamma-irradiation, or chemical mutagens such as ethylmethanesulfonate (EMS), ethidium bromide (EtBr), dichlorvos (DDVP), methyl methane sulphonale (MMS), triethylphosphate (TEP), trimethylphosphate (TMP), nitrous acid, or DNA base analogs, prior to selection on fungicide comprising media. Alternatively or in addition, where the mechanism of action of a particular fungicide is known, the target gene can be specifically mutated (either by gene deletion, gene replacement, site-directed mutagenesis, etc.) to generate a strain that is resilient against that particular chemical. The above-described methods can be used to isolate strains that are compatible with both fungistatic and fungicidal compounds. The biological or agrochemical compatible strains generated can be detected in samples. For example, where a transgene was introduced to render the strain compatible with the biological (s) or agrochemical(s), the transgene can be used as a target gene for amplification and detection by PCR. In addition, where point mutations or deletions to a portion of a specific gene or a number of genes results in compatibility with the biological (s) or agrochemical(s), the unique point mutations can likewise be detected by PCR or other means known in the art. Such methods allow the detection of the strain even if it is no longer viable.
[0103] In certain embodiments, the composition is a liquid composition. The compositions may be a ready- to-use composition which can be administered or applied with a suitable apparatus, or the composition may be a concentrate or a concentrated formulation which is to be diluted in a solvent, such as water or an aqueous solution or buffer prior to use. In certain further embodiments, the composition is an aqueous composition. In certain embodiments, the composition is a sprayable liquid or a concentrate. In certain embodiments the composition is a spray, a sprayable liquid or a dip.
[0104] The compositions as intended herein can encompass an effective amount of the fungal cells and optionally further plant-beneficial microorganism(s), i.e., an amount sufficient to elicit the desired outcome, such as one or more effects on one or more traits of agronomic importance in plants, such as an increase in the biomass of a plant, or yield of a plant, or both biomass and yield of a plant compared to an untreated plant, that is being sought by the user, in either a single or multiple doses, preferably in a single dose.
[0105] In certain embodiments, the composition comprises the fungal cells at a concentration of at least about 10 CFU / ml. In certain embodiments, the composition comprises the fungal cells at a concentration of at least about 102CFU / ml. As used herein, a "colony forming unit" or "CFU" refers to a measure of viable microorganisms in a sample. A CFU is an individual viable cell capable of forming on a solid medium a visible colony whose individual cells are derived by cell division from one parental cell. The phrases "CFU", "CFU / ml", and "CFU / g" also encompass the reference to "spores", "spores / ml" or "spores / g", respectively, in case the microorganism lends itself to being administered in the form of spores.
[0106] In certain embodiments, the liquid composition comprises the fungal cells at a concentration of at least about 102CFU / ml. In certain embodiments, the liquid composition comprises the fungal cells at a concentration of at least about 103CFU / ml, at least about 104CFU / ml, at least about 105CFU / ml, at least about 106CFU / ml, at least about 107CFU / ml, at least about 108CFU / ml, at least about 109CFU / ml, at least about IO10CFU / ml, at least about 1011CFU / ml, or at least about 1012CFU / ml.
[0107] In certain embodiments, the liquid composition comprises the fungal cells at a concentration of from 1 x 102CFU / ml to 1 x 1012CFU / ml, or from 1 x 103CFU / ml to 1 x 1011CFU / ml, or from 1 x 103CFU / ml to 1 x IO10CFU / ml, or from 1 x 104CFU / ml to 1 x IO10CFU / ml, or from 1 x 105CFU / ml to 1 x IO10CFU / ml, or from 1 x 106CFU / ml to 1 x IO10CFU / ml, or from 1 x 106CFU / ml to 1 x 109CFU / ml, or from 1 x 107CFU / ml to 1 x IO10CFU / ml, or from 1 x 107CFU / ml to 1 x 109CFU / ml, or from 1 x 108CFU / ml to 1 x IO10CFU / ml, or from 1 x 108CFU / ml to 1 x 109CFU / ml.
[0108] In certain embodiments, the composition is a non-liquid composition. In certain preferred embodiments, the composition may be a solid composition or a powdered composition. In certain 1 preferred embodiments, the composition is a powder. The term "powder" refers to a dry, bulk solid composed of many very fine particles that may flow freely when shaken or tilted.
[0109] In certain embodiments, the non-liquid composition, such as the powder, comprises the fungal cells at an amount of at least about 10 CFU / g. In certain embodiments, the non-liquid composition, such as the powder, comprises the fungal cells at an amount of at least about 102CFU / g. In certain embodiments, the non-liquid composition comprises the fungal cells at an amount of at least about 102CFU / g. In certain embodiments, the non-liquid composition comprises the fungal cells at an amount of at least about 103CFU / g, at least about 104CFU / g, at least about 105CFU / g, at least about 106CFU / g, at least about 107CFU / g, at least about 108CFU / g, at least about 109CFU / g, at least about IO10CFU / g, at least about 1011CFU / g, or at least about 1012CFU / g.
[0110] In certain embodiments, the non-liquid composition comprises the fungal cells at an amount of from 1 x 102CFU / g to 1 x 1012CFU / g, or from 1 x 103CFU / g to 1 x 1011CFU / g, or from 1 x 103CFU / g to 1 x IO10CFU / g, or from 1 x 104CFU / g to 1 x IO10CFU / g, or from 1 x 105CFU / g to 1 x IO10CFU / g, or from 1 x 10sCFU / g to 1 x IO10CFU / g, or from 1 x 10sCFU / g to 1 x 109CFU / g, or from 1 x 107CFU / g to 1 x IO10CFU / g, or from 1 x 107CFU / g to 1 x 109CFU / g, or from 1 x 108CFU / g to 1 x IO10CFU / g, or from 1 x 108CFU / g to 1 x 109CFU / g.
[0111] In certain embodiments, the composition may comprise cells of two or more fungal strains as described in the present specification. In certain embodiments, the composition may comprise at least about 102CFU / ml or at least about 102CFU / g - such as the aforementioned more specific CFU / ml or CFU / g amount ranges - of fungal cells of all the strains collectively or preferably of each of the strains individually and independently.
[0112] In certain embodiments, the composition comprises the one or more optional further plant- beneficial microorganism, such as cells or spores of one or more plant-beneficial microorganism strain, at a concentration or an amount, collectively or each individually and independently, of at least about 102CFU / ml or 102CFU / g, at least about 103CFU / ml or CFU / g, at least about 104CFU / ml or CFU / g, at least about 105CFU / ml or CFU / g, at least about 10sCFU / ml or CFU / g, at least about 107CFU / ml or CFU / g, at least about 108CFU / ml or CFU / g, at least about 109CFU / ml or CFU / g, or at least about IO10CFU / ml or CFU / g. More preferably, the composition comprises the one or more optional further plant-beneficial microorganism, such as cells or spores of one or more plant- beneficial microorganism strain, at a concentration or an amount, collectively or each individually and independently, of between 103to IO10CFU / ml or CFU / g, between 104to IO10CFU / ml or CFU / g, between 105to IO10CFU / ml or CFU / g, between 106to IO10CFU / ml or CFU / g, between 106to 109CFU / ml or CFU / g, between 107to 109CFU / ml or CFU / g, or between 108to 109CFU / ml or CFU / g.
[0113] In certain embodiments, the fungal cells may be comprised by and administered as part of a fungal population. A fungal population may comprise fungal cells of one or more fungal strains as described in the present specification, such as of two, three or more strains as described in the present specification.
[0114] More generally, a fungal population may comprise one or more, preferably two or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more than 25) purified fungal strains, wherein the strains may originate from different families of fungi, or different genera of fungi, or from the same genera but different species of fungi. The taxonomically different fungal strains can be obtained from the same cultivar of plant, different cultivars of the same plant, or different species of the same type of plant. The fungal strains can be obtained from the soil wherein the plant is grown. In an embodiment in which one or more, preferably two or more purified fungal strains are used, each of the fungal strains can have different properties or activities, e.g., produce different metabolites, produce different enzyme, confer different beneficial traits.
[0115] In certain embodiments, the fungal population or composition may comprise cells of the one or more fungal strain as described in the present specification, and optionally one or more additional fungal strain. In certain embodiments, the cells of the one or more fungal strain as described herein may collectively constitute at least about 1% by CFU of all viable fungal cells constituting the fungal population or composition, such as at least about 2%, at least about 5%, at least about 10%, preferably at least about 20%, such as at least about 30%, or at least about 40%, more preferably at least about 50%, such as at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or even 100% by CFU of all viable cells constituting the fungal population or composition.
[0116] Where the fungal population or composition comprises cells of two or more fungal strains as described in the present specification, they may in certain embodiments be included in the population or composition in unequal amounts or preferably in about equal amounts. By means of an example and without limitation, the cells of each of the two or more fungal strains as described herein may, each independently, constitute at least about 1% by CFU of all viable cells constituting the fungal population or composition, such as at least about 2%, at least about 5%, at least about 10%, preferably at least about 20%, such as at least about 30%, or at least about 40%, more preferably at least about 50%, such as at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% of all viable cells constituting the fungal population or composition (where the sum of these amounts would exceed 100%, it shall be understood that the sum is capped at 100%).
[0117] Where the fungal population or composition comprises cells of the one or more fungal strain as described in the present specification and cells of one or more additional fungal strain, each fungal strain may in certain embodiments be included in the population or composition in unequal amounts or preferably in about equal amounts. By means of an example and without limitation, the cells of each of the fungal strains may, each independently, constitute at least about 1% by CFU of all viable cells constituting the fungal population or composition, such as at least about 2%, at least about 5%, at least about 10%, preferably at least about 20%, such as at least about 30%, or at least about 40%, more preferably at least about 50%, such as at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% of all viable cells constituting the fungal population or composition (where the sum of these amounts would exceed 100%, it shall be understood that the sum is capped at 100%).
[0118] In certain embodiments, the concentration or amount of each isolated fungal strain in the fungal population or composition may be at least about 102CFU / ml or CFU / g, at least about 103CFU / ml or CFU / g, at least about 104CFU / ml or CFU / g, at least about 105CFU / ml or CFU / g, at least about 106CFU / ml or CFU / g, at least about 107CFU / ml or CFU / g, at least about 108CFU / ml or CFU / g, at least about 109CFU / ml or CFU / g, or at least about IO10CFU / ml or CFU / g. More preferably, the concentration or amount of each isolated fungal strain in the fungal population or composition may be between 103to IO10CFU / ml or CFU / g, between 104to IO10CFU / ml or CFU / g, between 105to IO10CFU / ml or CFU / g, between 10sto IO10CFU / ml or CFU / g, between 10sto 109CFU / ml or CFU / g, between 107to 109CFU / ml or CFU / g, or between 108to 109CFU / ml or CFU / g.
[0119] Also provided in an aspect is a fungal population, such as in accordance with the aforementioned explanations, comprising the fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 10 December 2021 under Accession No. 58200, or a functional mutant thereof.
[0120] Further provided in an aspect is a fungal population, such as in accordance with the aforementioned explanations, comprising the fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 24 August 2022 under Accession No. 58316, or a functional mutant thereof.
[0121] Further provided in an aspect is a fungal population, such as in accordance with the aforementioned explanations, comprising the fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 17 January 2021 under Accession No. 58238, or a functional mutant thereof. Further provided in an aspect is a fungal population, such as in accordance with the aforementioned explanations, comprising the fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 27 November 2023 under Accession No. 58394, or a functional mutant thereof.
[0122] Further provided in an aspect is a fungal population, such as in accordance with the aforementioned explanations, comprising the fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 27 November 2023 under Accession No. 58395, or a functional mutant thereof.
[0123] Further provided in an aspect is a fungal population, such as in accordance with the aforementioned explanations, comprising the fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 27 November 2023 under Accession No. 58396, or a functional mutant thereof.
[0124] Further provided in an aspect is a fungal population, such as in accordance with the aforementioned explanations, comprising the fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 27 November 2023 under Accession No. 58397, or a functional mutant thereof.
[0125] Also provided is a fungal population, such as in accordance with the aforementioned explanations, comprising any two or more said strains.
[0126] Also provided in an aspect is an agricultural active composition, such as in accordance with the aforementioned explanations, comprising fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 10 December 2021 under Accession No. 58200, or a functional mutant thereof.
[0127] Also provided in an aspect is an agricultural active composition, such as in accordance with the aforementioned explanations, comprising fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 24 August 2021 under Accession No. 58316, or a functional mutant thereof.
[0128] Also provided in an aspect is an agricultural active composition, such as in accordance with the aforementioned explanations, comprising fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 17 January 2022 under Accession No. 58238, or a functional mutant thereof.
[0129] Also provided in an aspect is an agricultural active composition, such as in accordance with the aforementioned explanations, comprising fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 27 November 2023 under Accession No. 58394, or a functional mutant thereof.
[0130] Also provided in an aspect is an agricultural active composition, such as in accordance with the aforementioned explanations, comprising fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 27 November 2023 under Accession No. 58395, or a functional mutant thereof. Also provided in an aspect is an agricultural active composition, such as in accordance with the aforementioned explanations, comprising fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 27 November 2023 under Accession No. 58396, or a functional mutant thereof.
[0131] Also provided in an aspect is an agricultural active composition, such as in accordance with the aforementioned explanations, comprising fungal strain as deposited under the Budapest Treaty at BCCM™ / MUCL on 27 November 2023 under Accession No. 58397, or a functional mutant thereof.
[0132] Also provided is an agricultural active composition, such as in accordance with the aforementioned explanations, comprising any two or more said strains.
[0133] Fungal strains, combinations, populations, and compositions as discussed throughout the present specification can be employed in plants cultivation, in particular to facilitate an improvement or enhancement in a plant growth feature, such as preferably in seed (grain) yield.
[0134] The terms "plant" or "plant element" as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs. The terms "plant" or "plant element" also refer to plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores. Hence, when the term "plant" or "plant element" is used herein, the term is intended to encompass "a plant, part thereof, or plant cell". The term "plant cell" may encompass a non-propagating plant cell.
[0135] The phrases "part of a plant" or "plant part" as used herein refer to any one or more portions of a plant, such as to any one or more of the seeds, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs of a plant, such as for example meristematic tissue, ground tissue, vascular tissue, dermal tissue, etc. In addition, a "plant part" is intended to generically reference any part of a plant that is able to initiate other plants via either sexual or asexual reproduction of that plant, for example but not limited to: seed, seedling, root, shoot, cutting, scion, graft, stolon, bulb, tuber, corm, keikis, or bud.
[0136] In certain embodiments, the part of a plant may be any one or more of the seeds, shoots, stems, leaves, roots (including tubers), or flowers. In certain embodiments, the part of a plant may be the seeds. In certain embodiments, the part of a plant may be the shoots, stems, or leaves. In certain embodiments, the part of a plant may be the roots (including tubers). In certain embodiments, the part of a plant may be tissues or organs of a plant. In certain embodiments, the seeds, shoots, stems, leaves, roots (including tubers), flowers, tissues or organs of the plant, when treated according to the methods as taught herein, may be attached to (e.g., growing on) the whole plant. In certain embodiments, the seeds, shoots, stems, leaves, roots (including tubers), flowers, tissues or organs of the plant, when treated according to the methods as taught herein, may be detached from (e.g., not growing on) the whole plant. For instance, seeds may be detached from (e.g., not growing on) the whole plant when treated according to the methods as taught herein.
[0137] In some embodiments, plants may include wild plants and domesticated varieties. In certain embodiments, plants and plant parts may be developed by any technique, including but not limited to directed evolution, selection, marker assisted selection, hybridization, outcrossing, backcrossing, in-breeding, polyploidization, reverse breeding, doubled haploids, induced mutation, other genetic or epigenetic modifications, and combinations thereof.
[0138] The phrases "locus of a plant" or "locus of growth of a plant" as used herein refers to an area in close proximity of a plant (including parts thereof such as a seed). For instance, the locus of a plant may be a circular area around the plant, e.g., around the stem of a plant or around a seed, such as a circular area having a diameter of at most 1 meter, for instance at most 50 centimeters (cm), at most 40 cm, at most 30 cm, at most 20 cm, at most 10 cm, or at most 5 cm, around the plant, e.g., around the stem of a plant or around a seed. The locus of growth may include the growth medium (e.g., soil, hydroponic medium, or hydroculture medium) for cultivating the plant.
[0139] The reference to plants includes any plants. In certain embodiments, the plants may be an angiosperm. Particularly preferred are agricultural plants. The terms "agricultural plants", "crops" or "plants of agronomic importance" as used herein include plants that are cultivated by humans for but not limited to food, feed, fiber, fuel, gardening, and / or industrial purposes.
[0140] In certain embodiments, the plant is a monocotyledon. The terms "monocotyledon" or "monocot" refer to flowering plants (angiosperms) whose seeds typically contain only one embryonic leaf or cotyledon.
[0141] In certain preferred embodiments, the plant is a cereal plant. The terms "cereal" or "cereal plant" refer to any grass cultivated for the edible components of its grain (caryopsis), composed of the endosperm, germ, and bran.
[0142] In certain preferred embodiments, the plant is selected from the group consisting of wheat, maize, barley, rice, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo, and oats. In certain particularly preferred embodiments, the plant is wheat or maize. In certain particularly preferred embodiments, the plant is wheat (Triticum aestivum and related varieties). In further particularly preferred embodiments, the plant is maize (Zea mays and related varieties).
[0143] The plant may be a non-modified plant or a modified plant. As used herein, a plant may be "modified" when it comprises an artificially introduced genetic or epigenetic "modification". In some embodiments, the modification is introduced by a genome engineering technology. In some embodiments, the modification is introduced by a targeted nuclease. In some embodiments, targeted nucleases include, but are not limited to, transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZNF), clustered regulatory interspaced short palindromic repeats (CRISPR), CRISPR / Cas9, CRISPR / CPFL and combinations thereof. In some embodiments, the modification is an epigenetic modification. In some embodiments, the modification is introduced by treatment with a DNA methyltransferase inhibitor such as 5-azacytidine, or a histone deacetylase inhibitor such as 2-amino-7-methoxy-3H-phenoxazin-3-one. In some embodiments, the modification is introduced via tissue culture. In some embodiments, a modified plant may comprise a transgene. In certain embodiments, the plant may be a non-transgenic plant or a transgenic plant.
[0144] In certain preferred embodiments, the plant may be a non-transgenic plant or a transgenic plant. The terms "recombinant", "transgenic" or "transgene" as used herein, for example with regard to a plant, refer to those plants brought about by recombinant methods in which a nucleic acid sequence and / or genetic control sequence(s) which are operably linked to the nucleic acid sequence are not located in their natural genetic environment. The natural genetic environment is understood as meaning the natural genomic or chromosomal locus in the original plant. A naturally occurring nucleic acid sequence (e.g., a naturally occurring combination of the native promoter of a nucleic acid sequence, the corresponding native nucleic acid sequence encoding a protein, and the native transcription termination sequence of a nucleic acid sequence) becomes a recombinant nucleic acid when this nucleic acid is not integrated in the natural genetic environment but in a different genetic environment as a result of an isolation of said nucleic acid from its natural genetic environment and re-insertion at a different genetic environment.
[0145] In certain embodiments, the plant may be free of disease and / or pathogen pressure and / or pest organisms. In other embodiments, the plant may be affected with disease and / or pathogen pressure and / or pest organisms.
[0146] The products, methods and uses as taught herein can provide for advantages in plants treated therewith relative to untreated plants. An "untreated plant" refers to a plant of the same species as (e.g., which is isogenic to or genetically identical to) and grown under substantially the same conditions as (e.g., for the same amount of time, in the same climate, and cultivated according to the same methods using the same materials, with biomass, yield and other characteristics being measured according to the same methods) a plant which has been administered the fungal strain(s) (for reasons of brevity, the mention of fungal strain(s) henceforth encompasses the one or more fungal strain as envisaged herein, as well as the fungal strain combinations and fungal populations as disclosed herein, as well as the compositions comprising these, insofar the context does not indicate otherwise; these may also contain the optional further plant-beneficial microorganism(s)), except that the untreated plant has not been administered said fungal strain(s) to the plant, a part thereof, a seed for growing the plant, or locus of the plant. The term may be used synonymously to "reference plant" or "reference", a plant genetically identical to and handled in substantially identical ways to a treated plant, with the exception of the treatment under investigation, and which thus offers a meaningful and informative control for detecting the effects of said treatment. A treated plant and a control reference plant can thus be exposed to substantially the same environmental conditions. By means of an example, the treated plant and reference plant can both be observed under substantially identical conditions of drought stress, or the treated plant and reference plant can both be observed under substantially identical conditions of no drought stress.
[0147] In one example, two genetically identical maize plant embryos may be separated into two different groups, one receiving a treatment (such as administration of the fungal strain(s)) and one control, e.g., reference, that does not receive such treatment. Any phenotypic differences between the two groups may thus be attributed solely to the treatment and not to any inherency of the plant's genetic makeup. In another example, two genetically identical wheat seeds may be treated with a composition, one that introduces a fungal population and one that does not. Any phenotypic differences between the plants derived from (e.g., grown from or obtained from) those seeds may be attributed to the fungal treatment.
[0148] The term "untreated seed" refers to a seed of the same species as (e.g., which is isogenic to or genetically identical to) and obtained under substantially the same conditions (e.g., plants from which the seeds are obtained are grown for the same amount of time, in the same climate, and cultivated according to the same methods using the same materials, seeds are stored under the same conditions) as a seed which has been administered the fungal strain(s), except that the untreated seed has not been administered said fungal strain(s). The term "plant growth feature" is intended to broadly encompass any feature that relates in some way to plant growth. The feature may relate to or be observable with respect to an individual plant or to a population of plants. Examples of such features include, without limitation, plant wet or dry biomass, plant height, plant size, emergence %, emergence date, canopy cover, flowering status, seed yield, grain yield, fruit yield, number of tillers per plant, shoot length, root length, root architecture, seed weight, senescence, stay-green, number of mature plant reproductive elements per plant, visual appearance, etc.
[0149] The reference to an improvement encompasses any qualitative or quantitative change or modification in a plant growth feature that is industrially beneficial, in particular in the context of agriculture. To the extent a plant growth feature is quantifiable, an improvement may be synonymous to an increase or a reduction in that quantity, depending on the nature of the plant growth feature. By means of an example and without limitation, an increase may be desired in quantifiable features such as plant wet or dry biomass, plant height, plant size, canopy cover, seed yield, grain yield, fruit yield, number of tillers per plant, shoot length, root length, seed weight, etc.
[0150] In certain embodiments, the plant growth feature comprises seed (grain) yield.
[0151] As used herein, the "biomass" of a plant refers to the amount (e.g., as determined by mass or weight, e.g., measured in grams of air-dry or wet tissue) or quantity (numbers) of tissue produced from the plant. Unless specified otherwise, biomass comprises both aboveground biomass (i.e., aerial biomass, including but not limited to stem, leaves, fruits, and / or seeds) and / or belowground biomass (i.e., roots). The biomass refers to the biomass at a given time. The biomass of a plant that has been administered the fungal strain(s) can be measured according to known methods including weighing. Biomass may be given as weight per unit area. The term may also refer to all the plants or species in the community (community biomass). In certain embodiments, an increase in the biomass of a plant or part thereof may include an increase in the dry biomass, the wet biomass, the number of tillers, the height of the plant, the plant yield, the seed yield, the fruit yield, or a combination thereof.
[0152] In certain embodiments, the dry biomass of the plant may be measured according to the dry weight (DW) of the plant or part thereof in grams. The dry weight may be determined after drying the plant or part thereof until no residual water is left, e.g., after drying at 60°C for 1 week. In certain embodiments, the wet biomass of the plant may be measured according to the wet or fresh weight of the plant or part thereof in grams. The number of tillers may be determined by counting the tillers. The height of the plant may be determined by measuring the height. As used herein the phrase "yield" or "plant yield" refers to the amount, mass or weight (e.g., as determined by weight or size) or quantity (numbers) of tissues or organs produced per plant, per growing area, and / or per growing season.
[0153] The plant yield may be affected by various parameters including, but not limited to, plant biomass; plant vigor; growth rate; seed yield; seed or grain quantity; seed or grain quality; oil yield; content of oil, starch and / or protein in harvested organs (e.g., seeds or vegetative parts of the plant); number of flowers (florets) per panicle (expressed as a ratio of number of filled seeds over number of primary panicles); harvest index; number of plants grown per area; number and size of harvested organs per plant and per area; number of plants per growing area (density); number of harvested organs in field; total leaf area; carbon assimilation and carbon partitioning (the distribution / allocation of carbon within the plant); resistance to shade; number of harvestable organs (e.g. seeds), seeds per pod, weight per seed; and modified architecture.
[0154] As used herein the phrases "seed yield" or "grain yield" refer to the number or weight of the seeds per plant, seeds per pod, or per growing area or to the weight of a single seed. Hence seed yield can be affected by seed dimensions (e.g., length, width, perimeter, area and / or volume), number of (filled) seeds and seed filling rate. An increased seed yield per growing area could be obtained by increasing seed yield per plant, and / or by increasing the number of plants grown on the same growing area.
[0155] The term "seed" (also referred to as "grain" or "kernel") as used herein refers to a small embryonic plant enclosed in a covering called the seed coat (usually with some stored food). The seed is the product of the ripened ovule of gymnosperm and angiosperm plants which occurs after fertilization and some growth within the mother plant. The terms "seed", "plant seed", or "seed for growing the plant" may be used interchangeably herein.
[0156] The biomass of a plant and / or the yield of a plant that has been administered the fungal strain(s) can be measured at a timepoint that is between about 7 days to about 350 days, about 7 days to about 300 days, about 7 days to about 250 days, about 7 days to about 200 days, about 7 days to about 150 days, or about 10 days to about 100 days, such as about 15 days to about 75 days, about 20 days to about 60 days, or about 25 days to about 50 days following administration of said fungal strain(s) to the plant. In certain embodiments, the plant growth feature, such as seed or grain yield of a plant, such as a cereal plant, that has been administered the fungal strain(s) can be measured at the time that the plant is harvested to collect its grain or produce, i.e., at the time that the mature plant, such as a cereal plant, e.g., a wheat or maize plant, is gathered from a field. The biomass of a plant and / or the yield of a plant that has been administered the fungal strain(s) vs. a reference plant not so treated would be measured at the same time point.
[0157] The term "emergence" refers to the appearance of a seedling through the soil. For example, a treatment may advantageously increase the percentage of sown seeds from which plants which emerge per unit plot area. Emergence can be scored at a predetermined stage of plant development, e.g., at the three-leaf stage.
[0158] The term "increase" as used herein is intended to be synonymous with terms such as "upregulate", "enhance", "stimulate", or "boost". Any extent or degree of such increase is contemplated herein, in particular any agronomically meaningful increase. Typically, the term may in appropriate contexts, such as in experimental or agricultural contexts, denote a statistically significant increase relative to a reference. The skilled person is able to select such a reference, as also discussed elsewhere in this specification. For example, such increase may fall outside of error margins for the reference (as expressed, for example, by standard deviation or standard error, or by a predetermined multiple thereof, e.g., ±lxSD or ±2xSD, or ±lxSE or ±2xSE). Accordingly, while the respective improvements or increases may be observable at the level of individual plants, they are more usefully evaluated by comparing relevant population characteristics, such as average or median values of the respective traits, obtained using sample sizes of treated vs. untreated plants that allow for statistically meaningful conclusions, such as for example shown in the Examples section.
[0159] In certain embodiments, the plant growth feature, such as biomass, plant height, seed (grain) yield, and / or plant yield, of a plant may be increased by at least about 1% relative to (i.e., compared with) (i.e., the plant growth feature may be at least about 1.01-fold) the plant growth feature of an untreated plant, such as preferably by at least about 2% (i.e., 1.02-fold), by at least about 3% (i.e., 1.03-fold), by at least about 4% (i.e., 1.04-fold), by at least about 5% (i.e., 1.05-fold), by at least about 6% (i.e., 1.06-fold), by at least about 8% (i.e., 1.08-fold), by at least about 10% (i.e., 1.10-fold), by at least about 15% (i.e., 1.15-fold), by at least about 20% (i.e., 1.20-fold), or more, such as by at least about 25% (i.e., 1.25-fold), by at least about 30% (i.e., 1.30-fold), by at least about 35% (i.e., 1.35-fold), by at least about 40% (i.e., 1.40-fold), by at least about 45% (i.e., 1.45-fold), by at least about 50% (i.e., 1.50-fold), or more. For example, the plant growth feature, such as seed (grain) yield, of a plant may be increased by between 2% and 5%, between 5% and 10%, between 10% and 15%, between 15% and 20%, between 20% and 30%, between 30% and 40%, or between 40% and 50% relative to an untreated plant. As said above, these percentages or fold increases may conveniently reflect the relationships between averages for the respective traits in the treated vs. untreated populations, as determined by evaluating representative population samples.
[0160] Such enhanced plant growth feature, such as seed (grain) yield, may advantageously reduce or even abolish the need to treat the plants with agrochemicals such as fertilizers in the field and thereby advantageously leads to more sustainable agriculture.
[0161] As set forth elsewhere in the specification, the fungal strain(s) can thus be administered to the plant, a part of the plant, a seed for growing the plant, or locus of the plant in an amount effective to produce an improved plant growth feature, such as an increased seed (grain) yield compared to an untreated plant.
[0162] The phrase "administering" generally refers to man- and / or machine-driven or effected disposing, applying, delivering, or providing of a recited object, such as the fungal strain(s), to a recipient entity, such as the plant, a part thereof, a seed for growing the plant, or locus of the plant. The fungal strain(s) as taught herein may be administered by any known method wherein all or part of the plant is treated, such as by root, seed, or foliar inoculation. For example, the administration can be to the aerial portions of a plant, such as the leaves and stem, to the roots of the plant, to the seed of the plant prior to planting the seed in soil, or to the soil or plant growth medium surrounding the plant or plant seed. Application methods such as spraying, coating, covering, contacting, and / or immersion can be adopted. In certain embodiments, application may be to a surface, such as to the surface of growth medium (such as soil), plant, plant part, seeds, harvested crop, harvested seed crop, stored crops or crop parts. In certain embodiments, the administration may be to the plant, part thereof, or locus of the plant, present on the field. The terms "field" or "agricultural field" may be used interchangeably herein and refers to an area of land used for agricultural purposes such as cultivating crops, such as cultivating wheat plants or maize plants.
[0163] In certain embodiments, the fungal strain(s) may be applied to the part of the plant, when forming part of the plant. For instance, they may be applied to the part of the plant, such as to the leaf, when the part of the plant, such as the leaf, is present on or attached to (e.g., is growing on) the plant.
[0164] In certain embodiments, the fungal strain(s) may be applied to any one or more of the seeds, shoots, stems, leaves, roots (including tubers), flowers, tissues, or organs of a plant. In certain embodiments, the fungal strain(s) may be applied to (e.g., sprayed on) the whole of the aboveground part of the plant. Accordingly, in certain embodiments, the fungal strain(s) may be applied to (e.g., sprayed on) any one or more of the shoots, stems, leaves, or flowers of the plant. Preferably, the fungal strain(s) may be applied to (e.g., sprayed on) any one or more of the shoots, leaves, or flowers of the plant. In certain embodiments, the fungal strain(s) may be applied to (e.g., sprayed on) the shoots of the plant.
[0165] In certain embodiments, the fungal strain(s) may be administered to the locus of the plant, such as by inoculating the growth medium. Hence, in certain embodiments, the method comprises inoculating soil or a plant growth medium with the fungal cells and growing the plant in said soil or medium.
[0166] The terms "growth medium" or "plant growth medium" as used herein refer to a substrate or medium for culturing plants. In embodiments, the growth medium may be soil, compost, peat, coco-coir, wood fibers, a soil-mimicking substrate such as mineral lava or basalt substrate, textile, or a soil-less substrate. In certain embodiments, the grown medium may be sand, gravel, polysaccharide, mulch, peat moss, straw, logs, clay, or a combination thereof. In embodiments, the plant growth medium may also include a hydroculture system or an in vitro culture system. Hence, in certain embodiments, the plant growth medium is a hydroponic medium or a hydroculture medium. The skilled person understands that different types of growth media may be used for growing different types of plants. Inoculating a plant growth medium can be performed, by way of example using a liquid, a powder, a granule, a pellet.
[0167] Hydroculture, also encompassing hydroponics, is the growing of plants in a soil-less medium or an aquatic based environment, while in vitro culture system refers to the growing of plants or explants on or in a recipient with synthetic medium, in sterile conditions, in a controlled environment and in reduced space. Explants refer to parts of a plant, from all the aerial part to isolated cells, as parts of leaves, of roots, seeds, bulbs, tubers, buds. The inoculation of the plant growth medium with the fungal strain(s) may be performed before, during and / or after sowing or before, during and / or after the start of the plant growth cycle in case of hydroculture or in vitro culture. The inoculation can be performed once or multiple times during the plant growth cycle.
[0168] In certain embodiments, sprayable liquids may be applied by spraying the plant, part thereof, or locus of the plant by conventional spraying equipment as known in the art, such as airplanes, backpack sprayers, tractor mounted boom sprayers etc.
[0169] In certain embodiments, application of the fungal strain(s) to the plant, part thereof, or locus of growth of the plant may be carried out directly or by action on their surroundings or habitat using customary treatment methods, for example by dipping, drenching, spraying, coating, atomizing, irrigating, evaporating, dusting, fogging, broadcasting, foaming, painting, spreading-on, watering (drenching) or drip irrigating. In embodiments, the method may comprise spraying, sprinkling, showering, spritzing, spreading in droplets, spattering; dispersing, diffusing, or douching the plant, part thereof, or locus of growth of the plant with the fungal strain(s).
[0170] In certain embodiments, the fungal cells of the one or more fungal strain as taught herein may be applied to a locus where plants are or are to be grown, such as upon soil, such as upon a field or within a greenhouse, in an amount of from about 1 x 106CFU / hectare to about 1 x 1014CFU / ha, such as from about 1 x 107CFU / hectare to about 1 x 1013CFU / ha, or from about 1 x 108CFU / hectare to about 1 x 1012CFU / ha, or from about 1 x 109CFU / hectare to about 1 x 1011CFU / ha, preferably about 1 x 1011CFU / hectare
[0171] In certain embodiments, the application may be one-time (single) administration, repeated administration (i.e., more than one time administration) at the same or varying time intervals, or continuous administration. The fungal strain(s) can be administered at any point in the life cycle of the plant (e.g., before or after germination). For example, administration can be to a plant's seed prior to planting the seed in soil and prior to germination. Alternatively, administration can be to the plant (e.g. a seedling), the seed of the plant, or the soil surrounding the plant after germination has occurred. Once treated with the fungal strain(s), seeds can be planted in soil and cultivated using conventional methods for generating plant growth.
[0172] In certain embodiments, the fungal strain(s) may be applied at a temperature (e.g., air temperature) in the range from -1°C to 30°C. In embodiments, the application may be at a temperature in the range from 0°C to 30°C, from 1°C to 30°C, from 5°C to 25°C, or from 10°C to 20°C.
[0173] In certain embodiments, the fungal strain(s) may be applied to the part of the plant, when not forming part of the plant. For instance, they may be applied to the part of the plant, such as to a seed for growing the plant, when the part of the plant, such as the seed, is not present on or is detached from (e.g., is not growing on) the plant. For instance, they may be applied to seeds after they have been harvested from (e.g. mechanically or manually separated from) the plant. In certain embodiments, the method may comprise administering the fungal strain(s) to a seed of the plant, e.g., prior to planting the seed or with the seed at planting. Hence, in certain embodiments, the method comprises administering the fungal strain(s) to a seed of the plant. In certain embodiments, the fungal strain(s) are administered to the seed of the plant prior to planting the seed, or with the seed at planting, or after planting the seed and before germination of the seed.
[0174] In certain embodiments, the purified fungal strain(s) are capable of colonizing plants. Successful colonization can be confirmed by detecting the presence of the strain within the plant. For example, after applying the strain to the plant parts, high titers of the strain can be detected in the roots and shoots of the plants that germinate from said plant parts such as seeds. Detecting the presence of the strain inside the plant can be accomplished by measuring the viability of the strain after surface sterilization of the plant element or the plant: strain colonization results in an internal localization of the strain, rendering it resistant to conditions of surface sterilization. The presence and quantity of strain can also be established using other means known in the art, for example, immunofluorescence microscopy using microbe-specific antibodies, or fluorescence in situ hybridization. Alternatively, specific nucleic acid probes recognizing conserved sequences from an strain can be employed to amplify a region, for example by quantitative PCR, and correlated to CFUs by means of a standard curve.
[0175] Hence, in certain embodiments, microorganisms such as fungi are said to colonize a plant, plant part, root or seed, when they can exist in relationship with a plant or plant part during at least part of either the plant's or the microorganism's life cycle. In certain embodiments, microorganisms such as fungi are said to colonize a plant when they can be stably detected within the plant or plant part over a period time, such as one or more days, weeks, months or years. The compositions and methods described herein may comprise one or a plurality of fungal strains as taught herein and optionally one or more further plant-beneficial microorganism in amounts effective to colonize a plant.
[0176] In embodiments, the strains described herein may be capable of moving from one tissue type to another. For example, the detection and isolation of strains within the mature tissues of plants after treating the exterior of a plant part demonstrates their ability to move from the plant part into the vegetative tissues of a maturing plant. Therefore, in some embodiments, the population of fungal strains is capable of moving from the plant element exterior into the vegetative tissues of a plant. In some embodiments, the strain that is disposed onto the plant element of a plant is capable, upon germination of the plant part into a vegetative state, of localizing to a different tissue of the plant. For example, strains can be capable of localizing to any one of the tissues in the plant, including: the root, adventitious root, seminal root, root hair, shoot, leaf, flower, ear, spike, spikelet, bud, tassel, meristem, pollen, pistil, ovaries, stamen, fruit, stolon, rhizome, nodule, tuber, trichome, guard cells, hydathode, petal, sepal, glume, rachis, vascular cambium, phloem, and xylem. In an embodiment, the strain is capable of localizing to the root and / or the root hair of the plant. In another embodiment, the strain is capable of localizing to the photosynthetic tissues, for example, leaves and shoots of the plant. In other cases, the strain is localized to the vascular tissues of the plant, for example, in the xylem and phloem. In still another embodiment, the strain is capable of localizing to the reproductive tissues (flower, pollen, pistil, ovaries, stamen, fruit, spike, spikelet) of the plant. In another embodiment, the strain is capable of localizing to the root, shoots, leaves and reproductive tissues of the plant. In still another embodiment, the strain colonizes a fruit or plant element tissue of the plant. In still another embodiment, the strain is able to colonize the plant such that it is present in the surface of the plant (i.e. its presence is detectably present on the plant exterior). In still other embodiments, the strain is capable of localizing to substantially all, or all, tissues of the plant. In some cases, strains are capable of replicating within the host plant and colonizing the plant.
[0177] In further embodiments, following administration of the fungal strain(s), the plants are cultivated under conditions to promote plant growth and development. In other words, the present methods may further comprise cultivating the plant under conditions to promote plant growth and development.
[0178] In certain embodiments, the method comprises administering the fungal strain(s) to a seed of the plant, a whole plant, or a seedling, and optionally cultivating the seed, whole plant, or seedling under conditions to promote plant growth and development. In certain embodiments, the method comprises administering the fungal strain(s) to a seed of the plant, and optionally cultivating the seed under conditions to promote plant growth and development. Hence, in such latter embodiments, the plant is grown from a seed, in particular a seed planted in said soil or plant growth medium.
[0179] Cultivating the seed under conditions promoting plant growth and development, may but need not include growth to maturity and / or regeneration.
[0180] In certain embodiments, the method may comprise further propagating the plant treated with the fungal strain(s). Accordingly, the invention provides a plant growth feature, such as seed (grain) yield, of a plant grown from a seed compared to a plant grown from an untreated seed, the method comprising administering the fungal strain(s) to the seed for growing the plant. The invention also provides the use of the fungal strain(s) for increasing the plant growth feature, such as seed (grain) yield, compared to a plant grown from an untreated seed.
[0181] Also provided herein is a method of treating a seed of a plant comprising inoculating the seed with fungal cells of one or more fungal strain as taught herein, such that the fungal cells colonize a plant germinated from the inoculated seed and / or the soil or plant growth medium surrounding the growing plant, whereby a plant growth feature of the plant, such as seed (grain) yield of the plant, is improved compared to a plant germinated from an untreated seed. In certain embodiments, the seed is coated with the fungal cells, incubated with the fungal cells, or planted near the fungal cells. In certain embodiments, the seed is further inoculated with one or more additional plant-beneficial microorganism as taught herein.
[0182] In certain embodiments, the fungal cells of one or more fungal strain as taught herein may be contacted with seeds in an amount of between about 1 x 104CFU / kg seeds to about 1 x 1012CFU / kg seeds, such as between about 1 x 105CFU / kg seeds to about 1 x 1011CFU / kg seeds, or between about 1 x 106CFU / kg seeds to about 1 x IO10CFU / kg seeds, or between about 1 x 107CFU / kg seeds to about 1 x IO10CFU / kg seeds, preferably about 1 x 109CFU / kg seeds.
[0183] In certain embodiments, the cells of one or more fungal strain as taught herein may be coated on or present on or inoculated into seeds at a quantity of, on average, at least 10 CFU per seed, preferably at least 100 CFU per seed, more preferably at least 500 CFU per seed, and even more preferably at least 1000 CFU per seed, more preferably at least 1 x 104CFU per seed, such as between 1 x 103and 1 x 108CFU per seed, or between 1 x 104and 1 x 107CFU per seed, such as about 1 x 10sCFU per seed. Certain embodiments thus provide a plant seed comprising at least 10 CFU or spores, preferably at least 100 CFU or spores, more preferably at least 500 CFU or spores, and even more preferably at least 1000 CFU or spores, such as more preferably at least 1 x 104CFU or spores, or 1 x 105CFU or spores, or 1 x 10sCFU or spores, such as between 1 x 105and 1 x 107CFU or spores, preferably about 1 x 10sCFU or spores, of the cells of one or more fungal strain as taught herein. For example, the seed may be coated with the fungal cells or the composition as taught herein.
[0184] In certain embodiments, the cells of one or more fungal strain as taught herein can be cultured on a culture medium or can be adapted to culture on the culture medium. Said culture medium is sterile prior to being inoculated with the fungal strain and comprises all nutrients for growth and maintenance of the strain on the culture medium. In addition, the culture medium can be in a solid, semi-solid or liquid form.
[0185] In certain embodiments, the cells of one or more fungal strain as taught herein may be administered as a fungal sample, culture, or inoculum, spray dried fungi, freeze dried fungi, suspension of spray dried or freeze dried fungi, etc.
[0186] In certain embodiments, the cells of one or more fungal strain as taught herein may thus be administered as a whole cell broth, comprising the fungi as well as the medium in which the fungi have been grown. A further aspect provides a plant or part thereof treated with the fungal strain(s). Also provided is a plant or part thereof heterologously disposed with the fungal cells as taught herein. In certain embodiments, the plant part may be a seed, such as a seed coated with the fungal cells or the composition. The plant or part thereof or a plant grown from said plant part can display increased biomass as compared to an untreated plant or part thereof.
[0187] Hence, also disclosed is a plant seed, preferably a crop plant seed (e.g., the seed of a wheat plant or maize plant), treated with, such as coated with, the fungal strain(s), e.g., such that all or part of the seed has a coating or film comprising the fungal cells. The plant grown from the treated seed can display increased biomass as compared to a plant grown from an untreated seed.
[0188] Further provided is a plant grown from a plant or part thereof (e.g., seed) treated with the fungal strain(s).
[0189] In an embodiment, fungal cells of the one or more strain as taught herein may, collectively or preferably each of the strains individually and independently, be present in an amount of at least about 102CFU per treated plant or part thereof. In an embodiment, fungal cells of the one or more strain as taught herein may, collectively or preferably each of the strains individually and independently, be present in an amount of at least about 102CFU per plant grown from the treated plant or part thereof such as from a treated seed.
[0190] Preferably, fungal cells of the one or more strain as taught herein may, collectively or preferably each of the strains individually and independently, be present on the plant or part thereof in an amount effective to be detectable within a target tissue of the mature plant selected from a fruit, a seed, a leaf, or a root, or portion thereof. For example, in an amount of at least about 100 CFU, between 100 and 200 CFU, at least about 200 CFU, between 200 and 300 CFU, at least about 300 CFU, between 300 and 400 CFU, at least about 500 CFU, between 500 and 1,000 CFU, at least about 1,000 CFU, between 1,000 and 3,000 CFU, at least about 3,000 CFU, between 3,000 and 10,000 CFU, at least about 10,000 CFU, between 10,000 and 30,000 CFU, at least about 30,000 CFU, between 30,000 and 100,000 CFU, at least about 105CFU, between 105and 106CFU, at least about 106CFU or more in the mature plant.
[0191] In certain embodiments, the plant or part thereof, such as a seed, treated with (e.g. coated with) the fungal cells as taught herein may be shelf-stable. The fungal strain may be shelf-stable, where at least 0.01%, of the CFUs are viable after storage in desiccated form (i.e., moisture content of 30% or less) for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or greater than 10 weeks at 4°C or at room temperature. Optionally, a shelf-stable composition comprising the fungal cells may be in a dry composition, a powder composition, or a lyophilized composition. In an embodiment, the composition may be formulated to provide stability for the strains. In an embodiment, the plant or part thereof, such as a seed, treated with (e.g. coated with) the fungal cells may be substantially stable at temperatures between about -20°C and about 50°C for at least about 1, 2, 3, 4, 5, or 6 days, or 1, 2, 3 or 4 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months, or one or more years. In another embodiment, the plant or part thereof, such as a seed, treated with (e.g. coated with) the fungal cells may be substantially stable at temperatures between about 4°C and about 37°C for at least about 5, 10, 15, 20, 25, 30 or greater than 30 days. Preferably the plant or part thereof, such as a seed, treated with (e.g. coated with) the fungal cells is substantially stable at temperatures between about 4°C and about 37°C for at least one year or greater than one year.
[0192] In certain embodiments, the plant or part thereof, such as a seed, treated with (e.g. coated with) the fungal cells are confined within a suitable container, such as an object selected from the group consisting of: bottle, jar, ampule, package, vessel, bag, box, bin, envelope, carton, container, silo, shipping container, truck bed, and case.
[0193] In certain embodiments, the fungal cells as taught herein are heterologous to the plant or plant part to be treated or administered with the same. A bacterium or fungus is considered heterologous to the plant, plant part, seed for growing the plant, or locus of the plant if the plant, plant part, seed for growing the plant, or locus of the plant that is untreated (e.g., a seed that is not treated with a fungal strain described herein) does not contain detectable levels of the bacterium or fungus. A bacterium or fungus is considered "heterologously disposed" or "heterologous disposed" on the exterior surface of or within a plant or plant tissue when the bacterium or fungus is applied or disposed on the plant in a number that is not found on that plant before application of the bacterium or fungus. For example, a purified bacterial or fungal strain disposed on an exterior surface or within the seed can be an endophytic bacterium or fungus that may be associated with the mature plant, but is not found on the surface of or within the seed. As such, a bacterium or fungus is deemed heterologously disposed when applied on the plant that either does not naturally have the bacterium or fungus on its surface or within the particular tissue to which the bacterium or fungus is disposed, or does not naturally have the bacterium or fungus on its surface or within the particular tissue in the number that is being applied.
[0194] In certain embodiments, the strain is heterologous disposed, for example, on the surface of a reproductive element of a plant, in an amount effective to be detectable in the mature plant. In a particular embodiment, the strain is heterologous disposed in an amount effective to be detectable in an amount of at least about 100 CFU, between 100 and 200 CFU, at least about 200 CFU, between 200 and 300 CFU, at least about 300 CFU, between 300 and 400 CFU, at least about 500 CFU, between 500 and 1,000 CFU, at least about 1,000 CFU, between 1,000 and 3,000 CFU, at least about 3,000 CFU, between 3,000 and 10,000 CFU, at least about 10,000 CFU, between 10,000 and 30,000 CFU, at least about 30,000 CFU, between 30,000 and 100,000 CFU, at least about 100,000 CFU or more in the mature plant.
[0195] In a preferred embodiment, the fungal cells are heterologously disposed to a plant, part thereof, seed for growing the plant, or locus of the plant in an amount effective to improve the plant growth feature, such as increase the biomass, plant height, seed yield, and / or plant yield of the treated plant, relative to an untreated plant. In a preferred embodiment, the amount of the heterologous disposed strain to the plant, part thereof, seed for growing the plant, or locus of the plant is effective to maintain a critical population mass in the plant. In a further embodiment, the amount of the heterologous disposed strain to a seed for growing a plant is effective to maintain a critical population mass in the mature plant germinated from the seed. Hence, in certain embodiments, any of the fungal strains, fungal cell populations, or microbial active ingredients as contemplated herein may be heterologous disposed to the plant, plant part, or seed.
[0196] The present application also provides aspects and embodiments as set forth in the following Statements. In these statements, the wording "The [subject] according to Statement [number], wherein..." or "The [subject] according to any one of Statements [numbers], wherein..." also discloses and may be replaced by the simple wording "In certain embodiments...".
[0197] Statement 1. A method for improving a plant growth feature of a plant compared to an untreated plant, the method comprising administering cells of a fungal strain which comprises a nuclear ribosomal internal transcribed spacer (ITS) polynucleotide having at least 99.00% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 to the plant, a part thereof, a seed for growing the plant, or a locus of the plant.
[0198] Statement 2. The method according to Statement 1, wherein the fungal strain comprises an ITS polynucleotide having at least 99.10% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.
[0199] Statement 3. The method according to Statement 1, wherein the fungal strain comprises an ITS polynucleotide having at least 99.28% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.
[0200] Statement 4. The method according to Statement 1, wherein the fungal strain comprises an ITS polynucleotide having at least 99.46% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2. Statement 5. The method according to Statement 1, wherein the fungal strain comprises an ITS polynucleotide having at least 99.64% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.
[0201] Statement 6. The method according to Statement 1, wherein the fungal strain comprises an ITS polynucleotide having at least 99.82% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.
[0202] Statement 7. The method according to Statement 1, wherein the fungal strain comprises an ITS polynucleotide having 100.00% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.
[0203] Statement 8. The method according to Statement 1, wherein the fungal strain comprises an ITS polynucleotide as set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
[0204] Statement 9. The method according to any one of Statements 1 to 8, wherein the fungal strain is a Penicillium species strain.
[0205] Statement 10. The method according to any one of Statements 1 to 9, wherein the fungal strain is a Penicillium novae-zeelandiae strain.
[0206] Statement 11. A method for improving a plant growth feature of a plant compared to an untreated plant, the method comprising administering cells of a Penicillium novae-zeelandiae strain to the plant, a part thereof, a seed for growing the plant, or a locus of the plant.
[0207] Statement 12. The method according to any one of Statements 1 to 11, wherein the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 10 December 2021 under Accession No. 58200 (also referred to herein as MUCL 58200).
[0208] Statement 13. The method according to any one of Statements 1 to 11, wherein the fungal strain is a functional mutant of the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 10 December 2021 under Accession No. 58200.
[0209] Statement 14. The method according to any one of Statements 1 to 11, wherein the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 24 August 2022 under Accession No. 58316 (also referred to herein as MUCL 58316).
[0210] Statement 15. The method according to any one of Statements 1 to 11, wherein the fungal strain is a functional mutant of the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 24 August 2022 under Accession No. 58316.
[0211] Statement 16. The method according to any one of Statements 1 to 11, wherein the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 17 January 2022 under Accession No. 58238 (also referred to herein as MUCL 58238).
[0212] Statement 17. The method according to any one of Statements 1 to 11, wherein the fungal strain is a functional mutant of the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 17 January 2022 under Accession No. 58238.
[0213] Statement 18. The method according to any one of Statements 1 to 11, wherein the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58394 (also referred to herein as MUCL 58394).
[0214] Statement 19. The method according to any one of Statements 1 to 11, wherein the fungal strain is a functional mutant of the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58394.
[0215] Statement 20. The method according to any one of Statements 1 to 11, wherein the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58395 (also referred to herein as MUCL 58395).
[0216] Statement 21. The method according to any one of Statements 1 to 11, wherein the fungal strain is a functional mutant of the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58395.
[0217] Statement 22. The method according to any one of Statements 1 to 11, wherein the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on27 November 2023 under Accession No. 58396 (also referred to herein as MUCL 58396).
[0218] Statement 23. The method according to any one of Statements 1 to 11, wherein the fungal strain is a functional mutant of the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58396.
[0219] Statement 24. The method according to any one of Statements 1 to 11, wherein the fungal strain is the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on27 November 2023 under Accession No. 58397 (also referred to herein as MUCL 58397).
[0220] Statement 25. The method according to any one of Statements 1 to 11, wherein the fungal strain is a functional mutant of the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58397.
[0221] Statement 26. The method according to any one of Statements 1 to 25, wherein the plant growth feature comprises biomass, plant height, seed (grain) yield, and / or plant yield.
[0222] Statement 27. The method according to Statement 26, wherein the biomass, plant height, seed yield, and / or plant yield is increased by at least about 2%, or by at least about 3%, or by at least about 4%, or by at least about 5%, or by at least about 6%, or by at least about 8%, or by at least about 10%, or by at least about 15%, or by at least about 20%.
[0223] Statement 28. The method according to any one of Statements claims 1 to 10 and 12-25, comprising administering to the plant, the part thereof, the seed for growing the plant, or the locus of the plant cells of two or more fungal strains, each independently as defined in any one of Statements 1-10, preferably wherein one of the strains is as defined in Statement 12, 14, 16, 18, 20, 22 or 24; more preferably wherein one of the strains is as defined in Statement 12.
[0224] Statement 29. The method according to Statement 11, comprising administering to the plant, the part thereof, the seed for growing the plant, or the locus of the plant cells of two or more fungal strains, each independently as defined in Statement 11, preferably wherein one of the strains is as defined in Statement 12, 14, 16, 18, 20, 22 or 24, more preferably wherein one of the strains is as defined in Statement 12. Statement 30. The method according to any one of Statements claims 1 to 29, comprising administering to the plant, the part thereof, the seed for growing the plant, or the locus of the plant the fungal cells (for reasons of brevity, i.e., cells of the fungal strain as defined in any one of Statements 1-25; or cells of two or more fungal strains, each independently as defined in any one of Statements 1-14) in conjunction with one or more additional plant-beneficial microorganism.
[0225] Statement 31. The method according to any one of Statements 1 to 30, wherein the fungal cells are administered in an agricultural active composition.
[0226] Statement 32. The method according to Statement 31, wherein the composition further comprises one or more agriculturally acceptable auxiliary.
[0227] Statement 33. The method according to Statement 32, wherein the agriculturally acceptable auxiliary is selected from a group consisting of a solvent, a carrier, a surfactant, a sticker, an antifreeze agent, a thickener, a buffering agent, an antifoaming agent, an antioxidant, a preservative, an aroma, a colorant, and combinations thereof.
[0228] Statement 34. The method according to any one of Statements 31 to 33, wherein the composition is a liquid composition.
[0229] Statement 35. The method according to Statement 34, wherein the composition is an aqueous composition.
[0230] Statement 36. The method according to Statement 34 or 35, wherein the composition is a sprayable liquid or a concentrate.
[0231] Statement 37. The method according to any one of Statements 34 to 36, wherein the composition comprises the fungal cells at a concentration of at least about 102CFU / ml.
[0232] Statement 38. The method according to Statement 37, wherein the composition comprises two or more fungal strains, each independently as defined in any one of Statements 1-25, and the composition comprises at least about 102CFU / ml of cells of each of the strains individually, or at least about 102CFU / ml of cells of all the strains collectively.
[0233] Statement 39. The method according to any one of Statements 31 to 33, wherein the composition is a non-liquid composition.
[0234] Statement 40. The method according to Statement 39, wherein the composition is a powder.
[0235] Statement 41. The method according to Statement 39 or 40, wherein the composition comprises the fungal cells at an amount of at least about 102CFU / g. Statement 42. The method according to Statement 41, wherein the composition comprises two or more fungal strains, each independently as defined in any one of Statements 1-25, and the composition comprises at least about 102CFU / g of cells of each of the strains individually, or at least about 102CFU / g of cells of all the strains collectively.
[0236] Statement 43. The method according to any one of Statements 1 to 41, wherein the method comprises administering the fungal cells or the composition to a seed of the plant, a whole plant, or a seedling.
[0237] Statement 44. The method according to Statement 43, wherein the fungal cells or the composition are administered to the seed of the plant, such as prior to planting the seed, or with the seed at planting, or after planting the seed and before germination of the seed.
[0238] Statement 45. The method according to Statement 43 or 44, further comprising cultivating the seed, whole plant, or seedling under conditions to promote plant growth and development.
[0239] Statement 46. The method according to any one of Statements 1 to 45, wherein the method comprises inoculating soil or a plant growth medium with the fungal cells and growing the plant in said soil or medium.
[0240] Statement 47. The method according to Statement 46, wherein the plant growth medium is a hydroponic medium or a hydroculture medium.
[0241] Statement 48. The method according to Statement 46 or 47, wherein the plant is grown from a seed, in particular a seed planted in said soil or plant growth medium.
[0242] Statement 49. A method of treating a seed of a plant comprising inoculating the seed with cells of one or more fungal strain as defined in any one of Statements 1-25, such that the fungal cells colonize a plant germinated from the inoculated seed and / or the soil or plant growth medium surrounding the growing plant, whereby a plant growth feature of the plant is improved compared to a plant germinated from an untreated seed.
[0243] Statement 50. The method according to Statement 49, wherein the plant growth feature comprises seed (grain) yield.
[0244] Statement 51. The method according to Statement 50, wherein the biomass, plant height, seed yield, and / or plant yield is increased by at least about 2%, or by at least about 3%, or by at least about 4%, or by at least about 5%, or by at least about 6%, or by at least about 8%, or by at least about 10%, or by at least about 15%, or by at least about 20%. Statement 52. The method according to any one of Statements 49 to 51, wherein the seed is coated with the fungal cells, incubated with the fungal cells, or planted near the fungal cells.
[0245] Statement 53. The method according to any one of Statements 49 to 51, wherein the seed is further inoculated with one or more additional plant-beneficial microorganism.
[0246] Statement 54. A plant or part thereof treated with the fungal cells as defined in any one of Statements 1-25 or with the composition as defined in any one of Statements 31-42; or a plant or plant part grown therefrom.
[0247] Statement 55. A plant or part thereof heterologously disposed with the fungal cells as defined in any one of Statements 1-25; or a plant or plant part grown therefrom.
[0248] Statement 56. The plant or part thereof according to Statement 54 or 55, wherein the plant part is a seed.
[0249] Statement 57. The seed according to claim 56, which is coated with the fungal cells or the composition.
[0250] Statement 58. A plant seed comprising at least 10 CFU or spores of the fungus as defined in any one of Statements 1-25, optionally wherein the seed is coated with the fungal cells as defined in any one of Statements 1-25 or the composition as defined in any one of Statements 31-42.
[0251] Statement 59. A method comprising growing a plant from the seed as defined in Statement 58 and harvesting the plant or part of the plant, such as harvesting the seeds or grains of the plant.
[0252] Statement 60. A fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 10 December 2021 under Accession No. 58200, or a functional mutant thereof.
[0253] Statement 61. A fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 24 August 2022 under Accession No. 58316, or a functional mutant thereof.
[0254] Statement 62. A fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 17 January 2022 under Accession No. 58238, or a functional mutant thereof. Statement 63. A fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58394, or a functional mutant thereof.
[0255] Statement 64. A fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58395, or a functional mutant thereof.
[0256] Statement 65. A fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58396, or a functional mutant thereof.
[0257] Statement 66. A fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58397, or a functional mutant thereof.
[0258] Statement 67. A combination of any two or more strains as defined in Statements 60, 61, 62, 63, 64, 65 and 66.
[0259] Statement 68. A fungal cell population comprising the strain as defined in any of the Statements 60, 61, 62, 63, 64, 65 and 66 , preferably as defined in Statement 60, or comprising the combination of Statement 67.
[0260] Statement 69. An agricultural active composition comprising the strain as defined in any one of the Statements 60, 61, 62, 63, 64, 65 or 66, preferably as defined in Statement 60, or comprising the combination of Statement 67.
[0261] Statement 70. The composition according to Statement 69, further comprising one or more agriculturally acceptable auxiliary.
[0262] Statement 71. The composition according to Statement 70, wherein the agriculturally acceptable auxiliary is selected from a group consisting of a solvent, a carrier, a surfactant, a sticker, an antifreeze agent, a thickener, a buffering agent, an antifoaming agent, an antioxidant, a preservative, an aroma, a colorant, and combinations thereof. Statement 72. The composition according to any one of Statements 69 to 71, wherein the composition is a liquid composition.
[0263] Statement 73. The composition according to Statement 72, wherein the composition is an aqueous composition.
[0264] Statement 74. The composition according to Statement 72 or 73, wherein the composition is a sprayable liquid or a concentrate.
[0265] Statement 75. The composition according to any one of Statements 72 to 74, wherein the composition comprises the fungal cells at a concentration of at least about 102CFU / ml.
[0266] Statement 76. The composition according to any one of Statements 69 to 71, wherein the composition is a non-liquid composition.
[0267] Statement 77. The composition according to Statement 76, wherein the composition is a powder.
[0268] Statement 78. The composition according to Statement 76 or 77, wherein the composition comprises the fungal cells at an amount of at least about 102CFU / g.
[0269] Statement 79. The method according to any one of Statements 1 to 53 or 59, wherein the plant is a monocotyledon.
[0270] Statement 80. The method according to any one of Statements 1 to 53 or 59, wherein the plant is a cereal.
[0271] Statement 81. The method according to any one of Statements 1 to 53 or 59, wherein the plant is selected from the group consisting of wheat, maize, barley, rice, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo, and oats.
[0272] Statement 82. The method according to any one of Statements 1 to 53 or 59, wherein the plant is wheat or maize.
[0273] Statement 83. The method according to any one of Statements 1 to 53 or 59, wherein the plant is maize.
[0274] Statement 84. The plant or plant part according to any one of Statements 54 to 56, wherein the plant is a monocotyledon.
[0275] Statement 85. The plant or plant part according to any one of Statements 54 to 56, wherein the plant is a cereal. Statement 86. The plant or plant part according to any one of Statements 54 to 56, wherein the plant is selected from the group consisting of wheat, maize, barley, rice, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo, and oats.
[0276] Statement 87. The plant or plant part according to any one of Statements 54 to 56, wherein the plant is wheat or maize.
[0277] Statement 88. The plant or plant part according to any one of Statements 54 to 56, wherein the plant is maize.
[0278] The above aspects and embodiments are further supported by the following non-limiting examples.
[0279] EXAMPLES
[0280] Example 1: Storage, cultivation, and formulation of fungi according to certain embodiments of the invention
[0281] The fungal strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection under Accession No. MUCL 58200, MUCL 58238, or MUCL 58316, MUCL 58394, MUCL 58395, MUCL 58396, MUCL 58397 was stored at -75°C in Potato Dextrose Broth (PDB) general purpose medium (potato infusion 20% w / v, dextrose 2% w / v in distilled water, pH 5.6 ± 0.2) amended with 20% v / v glycerol and was cultured on Potato Dextrose Agar (PDA) general purpose medium (potato infusion 20% w / v, dextrose 2% w / v, agar 2% w / v, in distilled water, pH 5.6 ± 0.2) at 21-25°C until sporulation (can take up to a month). Potato infusion may be replaced with potato extract 4% w / v. PDA medium is also available from commercial sources, such as Merck KGaA / Sigma-Aldrich (Darmstadt, Germany) product number 70139. For storage, spores were cryopreserved at -80°C. To further propagate the strain, spores were harvested from the plate and mixed with PDB. 400 pl of this mixture was used to inoculate a new plate.
[0282] For field trial testing, per kg of seeds to be coated, 15 ml of a sticker solution in water containing 1% w / v methyl cellulose and 1% w / v colorant (Agrocer® Red 112, Clariant International, Muttenz, Switzerland) together with the fungal spores was added to the seeds. The seeds were treated using Wintersteiger AG (Ried im Innkreis, Austria) Hege 11 liquid seed treater. The final CFU per seed for the fungal strains with Accession No. MUCL 58240, MUCL 58238, MUCL 58326, MUCL 58394, MUCL 58395, MUCL 58396, MUCL 58397 was at least 1 x 10A2 spores per seed. Seeds were stored at ambient temperature before sowing. Example 2: Increased dry biomass, wet biomass, and plant height per plant in maize treated by a method according to embodiments of the invention
[0283] Per treatment, 5 x 9 maize seeds were treated with a formulation containing the fungal strain Accession MUCL 58200 and MUCL 58238 as deposited under the Budapest Treaty at the BCCM™ / MUCL (proposed taxonomic designation Penicillium novae-zeelandiae). Five planter boxes were filled with potting soil mix and saturated with water. As a control, 10 x 9 maize seeds were treated with a formulation without the fungal strain to compare (mock treatment). Seeds were sown in three rows of 3 seeds per planter box. Nutrients were being added to the planter boxes at two and three weeks after sowing. Plant height was measured 5 weeks after sowing from the maize plants obtained from seeds treated with said fungal strain. After 6 weeks of growth, shoots were cut off and fresh biomass (in g) was weighed per planter box (i.e., all 9 shoots together). Plant shoots were then dried at 70°C for 1 week and dry biomass (in g) was determined per planter box.
[0284] For all evaluated formulations, each containing a fungal strain according to an embodiment of the invention, an increase in dry biomass, wet biomass and an increase in plant height per plant was seen compared to the formulation without fungal strain. The results of two independent experiments of maize treated with a formulation containing the fungal strain with Accession MUCL 58200 or the fungal strain with Accession MUCL 58238 as deposited under the Budapest Treaty at the BCCM™ / MUCL (proposed taxonomic designation Penicillium novae-zeelandiae) are shown in Figure 1.
[0285] The graphs visualize the values of different parameters with 95% confidence intervals for MUCL 58200 and MUCL 58238 treated seeds and mock treated seeds. The dashed line in the graphs (right) represents the mock treatment. The increase of 22.2% and 12.4% in dry biomass respectively compared to a formulation without the fungal strain is visualized in Figure 1A. The increase of 17.6 and 13.0% in wet biomass, respectively, compared to a formulation without the fungal strain is visualized in Figure IB. The increase of 9.7% in plant height, from both two strains, per maize plant compared to a formulation without the fungal strain is visualized in Figure 1C.
[0286] Example 3: Increased seed yield (grain yield) and number of plants in maize treated by a method according to embodiments of the invention
[0287] Seeds were sown on 4 replicate plots (24 m2 plot size, 3 x 8 m, 4 rows per plot, distance between rows 75 cm) per field location using standard agricultural practices. Sowing density was 9 seeds m2. Sowing was done around mid of April and harvest happened mid October at BBCH 89. Fertilization was calculated based on soil analysis. Nitrogen fertilizer was applied before sowing at 50 or 100 % N level by means of liquid nitrogen fertilizer (Urean 39 % N) or granular fertilizer (KAS 27 % N). no additional P was added, potassium (KjO) was applied additionally at 100 % level by means of potassium chloride 60 % or Kornkali 60 %. At harvest the two middle rows per plot were harvested. Harvest was done with a Delta plot combine (Wintersteiger AG, Ried, Austria) and seed yield (grain yield) (kg / ha) was calculated based on the grain yield harvested at each individual plot and considering a seed moisture of 15%. Grain yield or the number of maize plants was compared with untreated seeds. The results are shown in Figure 2.
[0288] Figure 2A visualizes the value in grain yield of maize measured at a location in France in the season 2022 with a 50 % N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a wettable powder (WP) formulation containing Penicillium MUCL 58200 strain and colorant showed an increased yield of 5.2 % compared to the untreated seeds.
[0289] Figure 2B visualizes the value in grain yield of maize measured at a location in Germany in the season 2022 with a 100 % N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a WP formulation containing Penicillium MUCL58200 strain and colorant showed an increased yield of 4.4 % compared to the untreated seeds.
[0290] Figure 2C visualizes the value in grain yield of maize measured at a location in France in the season 2022 with a 100 % N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a WP formulation containing Penicillium MUCL58200 strain and colorant showed an increased yield of 4.2 % compared to the untreated seeds. Example 4: Increased dry biomass yield in silage maize treated by a method according to embodiments of the invention
[0291] Seeds were sown on 4 replicate plots (24 m2 plot size, 3 x 8 m, 4 rows per plot, distance between rows 75 cm) per field location using standard agricultural practices. Sowing density was 10,25 seeds m2. Sowing was done around the end of April and harvest happened in September-beginning of October (at phenological stage when the plant dry matter is in a range between 32-36%).
[0292] Fertilization was calculated based on soil analysis. Fertilizers were applied before sowing at 50 % level for Nitrogen and 100 % level for phosphorus. No additional P was added. Both solid manure (30 kg / ha available N, KAS 27% N) and liquid nitrogen fertilizer (Urean 39 % N; 41 kg / ha N) were applied to provide nitrogen. The solid manure also provided 35 kg P2O5, 117 kg K2O and 23 kg MgO to the crop. 60 kg / ha of potassium (K2O) was applied additionally at 100 % level by means of potassiumchloride 60 % or Kornkali 60 %. At harvest the two middle rows per plot were harvested. Harvest was done with a Fimaks maize chopper in combination with a Haldrup sample and weighing unit. Total fresh biomass was assessed of the two middle rows. Sampling happened on the full length of the plot, sample weight was 1000 g. Dry biomass yield was assessed after drying of the sample by 65°C until constant weight (duration +- 1 week).
[0293] Dry biomass yield of the treated seeds was compared with untreated seeds. The results are shown in Figure 3. Maize seeds treated with a formulation containing a Penicillium F13E1 or F10H2 strain and colorant showed an increased yield of 16,5 to 8,3 % compared to the untreated seeds.
[0294] Figure 3A visualizes the value in dry weight yield of silage maize measured at a location in Poland in the season 2021 with a 50 % N fertilizer regime. The graph on the left visualizes the values of dry weight yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in dry weight yield with its 95% confidence interval. Maize seeds treated with spores of Penicillium MUCL58200 strain and colorant showed an increased yield of 14.6 % compared to the untreated seeds.
[0295] Figure 3B visualizes the value in dry weight yield of silage maize measured at a location in Poland in the season 2021 with a 50 % N fertilizer regime. The graph on the left visualizes the values of dry weight yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in dry weight yield with its 95% confidence interval. Maize seeds treated with spores of Penicillium MUCL58238 strain and colorant showed an increased yield of 16.5 % compared to the untreated seeds.
[0296] Figure 3C visualizes the value in dry weight yield of silage maize measured at a location in France in the season 2021 with a 50 % N fertilizer regime. The graph on the left visualizes the values of dry weight yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in dry weight yield with its 95% confidence interval. Maize seeds treated with spores of Penicillium MUCL58238 strain (F10H2) and colorant showed an increased yield of 8.3 % compared to the untreated seeds.
[0297] Example 5: Increased grain yield in maize treated by a method according to embodiments of the invention
[0298] Seeds were sown on 4 replicate plots (30 m2plot size, 3 x 8 m, 4 rows per plot, distance between rows is 75 cm) per field location using standard agricultural practices. Sowing density was 6.5 to 10 seeds per m2. Sowing was done around end of April - beginning of May and harvest happened in mid October at BBCH 89. Fertilization was calculated based on soil analysis. Nitrogen fertilizer was applied before sowing at 50% N level by means of liquid nitrogen fertilizer (Urean 39% N) or granular fertilizer (KAS 27% N). No additional P was added, potassium (KjO) was applied additionally at 100% level by means of potassium chloride 60% of Kornkali 60%. Harvest was done with a Delta plot combine (Wintersteiger AG, Ried, Austria) and seed yield (grain yield) (kg / ha) was calculated based on the grain yield harvested at each individual plot and considering a seed moisture of 15%. Grain yield was compared with blank coated seeds. The results are shown in Figures 4A-B-C-D.
[0299] Figure 4A visualizes the value in grain yield of maize measured at a location in Northern Germany in the season 2023 with a 50% N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a WG formulation containing Penicillium MUCL 58200 strain (F13E1) and colorant showed an increased yield of 10.7% compared to the blank coated seeds.
[0300] Figure 4B visualizes the value in number of maize plants per ha measured at a location in Romania in 2023 with a 50% N fertilizer regime. The graph on the left visualizes the values of number of maize plants per ha with 95% confidence intervals for treated seeds an untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in number of plants per ha with its 95% confidence interval. Maize seeds treated with a WG formulation containing Penicillium MUCL 58200 strain (F13E1) and colorant showed an increased number of plants of 9% compared to the untreated seeds.
[0301] Figure 4C visualizes the value in grain yield of maize measured at a location in Poland in 2023 with a 50% N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a WG formulation containing strain MUCL 58396 (F5E4) and colorant showed an increased yield of 12.6% compared to the untreated seeds.
[0302] Example 6: Increased dry biomass yield in maize treated by a method according to embodiments of the invention
[0303] Seeds were sown on 4 replicate plots (24 m2 plot size, 3 x 8 m, 4 rows per plot, distance between rows is 75 cm) per field location using standard agricultural practices. Sowing density was 10 seeds m2. Sowing was done around the end of April and harvest happened at the beginning of October (at phenological stage when the plant dry matter is in a range between 32-36%).
[0304] Fertilization was calculated based on soil analysis. Fertilizers were applied before sowing at 50% N level. Both solid manure (30 kg / ha available N) and liquid nitrogen fertilizer (Urean 39%, 41 kg / ha N) were applied to provide nitrogen. The solid manure also provided 35 kg P2O5, 117 kg K2O and 23 kg MgO to the crop. 60 kg / ha of potassium (K2O) was applied additionally by means of potassium chloride 60%. At harvest, the two middle rows per plot were harvested. Harvest was done with a Fimaks maize chopper in combination with a Haldrup sample and weighing unit. Total fresh biomass was assessed of the two middle rows. Sampling happened on the full length of the plot, sample weight was 1000 g. Dry biomass yield was assessed after drying of the sample by 65°C until constant weight (duration ± 1 week).
[0305] Figure 5A visualizes the value in dry weight yield of maize measured at a location in Belgium in the season 2023 with a 50 % N fertilizer regime. The graph on the left visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Maize seeds treated with a WG formulation containing strain MUCL 58394 and colorant showed an increased yield of 2.4 % compared to the blank coated seeds.
[0306] Figure 5B visualizes the value in dry weight yield of maize measured at a location in Southern Germany in 2023 with a 50 % N fertilizer regime. The graph on the left visualizes the values of number of maize plants per ha with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in number of plants per ha with its 95% confidence interval. Maize seeds treated with a WG formulation containing strain MUCL 58395 and colorant showed an increased number of plants of 5.9 % compared to the untreated seeds.
[0307] Example 7: Colonization of maize plants treated by a method according to embodiments of the invention
[0308] We demonstrated colonization of maize plants by Penicillium novae zeelandiae strain MUCL58200 (F13E1) in pot experiments performed in the greenhouse using maize seeds coated with spores of strain MUCL58200. Maize seeds (variety LG.31.224) were coated either with sticker, colorant and spores of strain MUCL58200 in solid carrier material (MUCL58200 treatment) or coated with sticker, colorant and solid carrier material only (mock treatment). Coated seeds were sown in pots containing substrate and maintained in the greenhouse. Five replicate pots were set up for each treatment. Fourteen days after sowing, maize plants were carefully removed from the pots and the bulk soil surrounding the maize seed, as well as maize roots with rhizosphere soil still attached to them, were harvested. Roots with rhizosphere soil attached were placed in phosphate-buffered saline (PBS) buffer to retrieve the rhizosphere soil after centrifugation. Roots were transferred to fresh PBS buffer before centrifugation and washed with PBS buffer until all soil was removed. All samples were then stored at -80°C until DNA extraction. DNA was extracted using the DNeasy PowerSoil PRO (for bulk and rhizosphere samples) or the DNEeasy PowerPlant PRO DNA isolation kit (for root samples), according to the manufacturer's instructions. Microbiome mapping of the samples was then performed by fungal ITS2 amplicon sequencing. The relative abundance of the amplicon corresponding to strain MUCL58200 compared to all other ITS2 amplicons (as determined by next-generation sequencing) in the bulk soil surrounding the maize seeds, the maize rhizosphere soil, and maize roots of the MUCL58200 treatment is shown in Figure 6. The amplicon was not detected in samples collected from the mock treatment, indicating that strain MUCL58200 was not present in the substrate used for the greenhouse experiment. The results demonstrate that strain MUCL58200 is detected in the bulk soil in contact with the maize seeds coated with strain MUCL58200, and that strain MUCL58200 successfully colonizes the maize rhizosphere soil after seed coating.
[0309] Example 8. Increased dry biomass yield in maize treated by a method according to embodiments of the invention
[0310] The effect on dry biomass in maize after treatment with strain MUCL 58397 (F6A1 strain) was evaluated in pot experiments under drought conditions in the greenhouse performed with substrate. Coated maize seeds treated with strain MUCL 58397 were sown in araflats (51-holes). Germination was checked and registered 7 days after sowing (7DAS). Fourteen-days after sowing (14DAS) the young maize seedlings were transplanted into bigger planter boxes with 4kg of substrate and in each planter box 9 equally and homogeneously growing maize seedlings were transplanted. The height of the maize seedlings was measured directly after transplanting. The growing medium (BF-43875) delivered in 70L bags was put in the soil mixer and mixed during 2 minutes. The substrate with a moisture content of 40% (weight basis) after mixing was used to fill the 51 hole araflats and the planter boxes. The 14days old maize seedling (14DAS) maize were not watered after transplantation during approximately 28 days. After the drought period of 28 days, the plants were watered and recovery was followed up during 14 days. Increased surplus dry biomass effect of strain MUCL 58397 coated on maize seeds in comparison to mock-treated seeds was observed and represented an increase of 8.9% in comparison to the mock treatment with a p- value <0.00001.
[0311] Figure 7 visualizes the value in dry weight yield of maize from seeds treated with strain MUCL 58397 as compared to mock-treated seeds as described above. The graph visualizes the values of maize grain yield with 95% confidence intervals for treated seeds and untreated seeds. Maize seeds treated with a WG formulation containing strain MUCL 58397 showed an increased yield in dry biomass of 8.9 % compared to the blank coated seeds (p<0.0001).
[0312] DEPOSIT OF BIOLOGICAL MATERIAL
[0313] The purified fungal strains (proposed taxonomic designation presented in the Table 1) as taught herein have been deposited at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection (BCCM™ / MUCL) under the terms of the Budapest Treaty, under Accession No. 58200, 58238, 58316, 58394, 58395, 58396, 58397 (also referred to herein as MUCL 58200, MUCL 58238, MUCL 58316, MUCL 58394, MUCL 58395, MUCL 58396, MUCL 58397, respectively). Table 1A-B summarizes the requisite indications relating to this deposited microorganism.
[0314] Table 1A
[0315] Table IB
[0316] SEQUENCE LISTING
[0317] Throughout the description and examples, reference is made to the following sequences, as shown in Table 2:
[0318] SEQ ID NO: 1: Nucleotide sequence of the Internal transcribed spacer (ITS) polynucleotide from strains 58200, 58238, 58316, 58394, 58395, 58397.
[0319] SEQ ID NO: 2: Nucleotide sequence of the Internal transcribed spacer (ITS) polynucleotide from strain 58396. Table 2
Claims
CLAIMS1. A method for improving a plant growth feature of a plant compared to an untreated plant, the method comprising administering cells of a fungal strain which comprises a nuclear ribosomal internal transcribed spacer (ITS) polynucleotide having at least 99.00% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 to the plant, a part thereof, a seed for growing the plant, or a locus of the plant.
2. The method according to claim 1, wherein the fungal strain comprises, in an increasing order of preference, an ITS polynucleotide having at least 99.28%, at least 99.46%, at least 99.64%, at least 99.82%, or 100.00% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.
3. The method according to claim 1 or 2, wherein the fungal strain comprises an ITS polynucleotide as set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
4. The method according to any one of claims 1 to 3, wherein the fungal strain is a Penicillium species strain.
5. The method according to any one of claims 1 to 4, wherein the fungal strain is a Penicillium novae-zeelandiae strain.
6. A method for improving a plant growth feature of a plant compared to an untreated plant, the method comprising administering cells of a Penicillium novae-zeelandiae strain to the plant, a part thereof, a seed for growing the plant, or a locus of the plant.
7. The method according to any one of claims 1 to 6, wherein the strain is selected from the group consisting of:- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 10 December 2021 under Accession No. 58200, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58200;- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 24 August 2022 under Accession No. 58316, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58316;- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizalfungi collection on 17 January 2022 under Accession No. 58238, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58238;- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58394, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58394 ;- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58395, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58395;- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58396, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58396;- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58397, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58397; and- combinations thereof; preferably wherein the strain is the strain with Accession No. 58200.
8. The method according to any one of claims 1 to 7, wherein the plant growth feature comprises biomass, plant height, seed yield, and / or plant yield.
9. The method according to claim 8, wherein the biomass, plant height, seed yield, and / or plant yield is increased by at least about 2%, or by at least about 3%, or by at least about 4%, or by at least about 5%, or by at least about 6%, or by at least about 8%, or by at least about 10%, or by at least about 15%, or by at least about 20%.
10. The method according to any one of claims 1 to 9, comprising administering to the plant, the part thereof, the seed for growing the plant, or the locus of the plant:- cells of two or more fungal strains, each independently as defined in any one of claims 1 to 5 and 7, preferably wherein one of the strains is the strain with Accession No. 58200;- cells of two or more fungal strains, each independently as defined in claims 6 or 7 , preferably wherein one of the strains is the strain with Accession No. 58200; and / or- the fungal cells in conjunction with one or more additional plant-beneficial microorganism.
11. The method according to any one of claims 1 to 10, wherein the fungal cells are administered in an agricultural active composition, such as wherein:- the composition further comprises one or more agriculturally acceptable auxiliary, such as a solvent, a carrier, a surfactant, a sticker, an antifreeze agent, a thickener, a buffering agent, an antifoaming agent, an antioxidant, a preservative, an aroma, a colorant, or a combination thereof;- the composition is a liquid composition, such as an aqueous composition, such as a sprayable liquid or a concentrate, preferably wherein the composition comprises the fungal cells at a concentration of at least about 102CFU / ml; or- the composition is a non-liquid composition, such as a powder, preferably wherein the composition comprises the fungal cells at an amount of at least about 102CFU / g.
12. The method according to any one of claims 1 to 11, wherein the method comprises:- administering the fungal cells or the composition to a seed of the plant, a whole plant, or a seedling, such as to a seed prior to planting the seed, or with the seed at planting, or after planting the seed and before germination of the seed, and optionally cultivating the seed, whole plant, or seedling under conditions to promote plant growth and development; or- inoculating soil or a plant growth medium with the fungal cells and growing the plant, such as from a seed, in said soil or medium.
13. A method of treating a seed of a plant comprising inoculating the seed with cells of one or more fungal strain as defined in any one of claims 1 to 7, optionally in conjunction with one or more additional plant-beneficial microorganism, such that the fungal cells colonize a plant germinated from the inoculated seed and / or the soil or plant growth medium surrounding the growing plant, whereby a plant growth feature of the plant, such as the biomass, plant height, seed yield, and / or plant yield, is improved compared to a plant germinated from an untreated seed, optionally wherein the seed is coated with the fungal cells, incubated with the fungal cells, or planted near the fungal cells.
14. A fungal strain selected from the group consisting of:- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 10 December 2021 under Accession No. 58200, or a functional mutant thereof; preferably wherein the fungal strain is the strain with Accession No. 58200;- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 24 August 2022 under Accession No. 58316, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58316;- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 17 January 2022 under Accession No. 58238, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58238;- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58394, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58394;- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58395, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58395;- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58396, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58396; and- the strain as deposited under the Budapest Treaty at the Belgian Coordinated Collections of Microorganisms (BCCM™) / MUCL Agro-industrial fungi, yeasts and arbuscular mycorrhizal fungi collection on 27 November 2023 under Accession No. 58397, or a functional mutant thereof, preferably wherein the fungal strain is the strain with Accession No. 58397.
15. A combination of any two or more strains as defined in claim 14; or a fungal cell population comprising one or more strain or functional mutant thereof as defined in claim 14; or an agricultural active composition comprising one or more strain or functional mutant thereof as defined in claim 14, optionally wherein:- the composition further comprises one or more agriculturally acceptable auxiliary, such as a solvent, a carrier, a surfactant, a sticker, an antifreeze agent, a thickener, a buffering agent, an antifoaming agent, an antioxidant, a preservative, an aroma, a colorant, or a combination thereof;- the composition is a liquid composition, such as an aqueous composition, such as a sprayable liquid or a concentrate, preferably wherein the composition comprises the fungal cells at a concentration of at least about 102CFU / ml; or- the composition is a non-liquid composition, such as a powder, preferably wherein the composition comprises the fungal cells at an amount of at least about 102CFU / g.
16. A plant seed comprising at least 10 CFU or spores of the fungus as defined in any one of claims 1 to 7 or 14, optionally wherein the seed is coated with the fungal cells as defined in any one of claims 1 to 7 or 14 or the composition as defined in claim 11 or 15.
17. A method comprising growing a plant from the seed as defined in claim 16 and harvesting the plant or part of the plant, such as harvesting the seeds or grains of the plant.
18. The method according to any one of claims 1 to 13 or 17, or the plant seed according to claim 16, wherein the plant is a monocotyledon, preferably wherein the plant is a cereal, more preferably wherein the plant is selected from the group consisting of wheat, maize, barley, rice, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo, and oats, even more preferably wherein the plant is maize.