Increased editing efficiency by co-delivery of rnp with nucleic acid

Abstract

The present invention relates to a method for increasing the efficiency of modifying at least one target nucleic acid segment, to a cell comprising at least one ribonucleoprotein and at least one carrier nucleic acid molecule, to a kit comprising at least one ribonucleoprotein and at least one carrier nucleic acid molecule, to the use of at least one ribonucleoprotein and at least one carrier nucleic acid molecule for modifying at least one target nucleic acid segment, and to a plant comprising a modified target nucleic acid, generated by the method according to the invention.

Description

[0001] Munich, 19 December 2023 Our Ref.: BM 5637-03WO DRE / ehr Applicant / Proprietor: BASF Agricultural Solutions Seed US LLC Serial Number: Subsequent application based on EP22215324.9 BASF Agricultural Solutions Seed US LLC 100 Park Avenue, 07932 Florham Park, United States of America BASF SE Carl-Bosch-Strasse 38 Ludwigshafen am Rhein Germany For Saint Kitts and Nevis only Increased editing efficiency by co-delivery of RNP with nucleic acid Technical Field The present invention relates to a method for increasing the efficiency of modifying at least one target nucleic acid segment, to a cell comprising at least one ribonucleoprotein and at least one carrier nucleic acid molecule, to a kit comprising at least one ribonucleoprotein and at least one carrier nucleic acid molecule, to the use of at least one ribonucleoprotein and at least one carrier nucleic acid molecule for modifying at least one target nucleic acid segment, and to a plant comprising a modified target nucleic acid, generated by the method according to the invention. Background of the invention CRISPR-Cas gene editing enables editing genomes in vivo very precisely, cheaply, and easily and is thus considered to be of utmost significance and a revolutionary tool in the field of biotechnology. CRISPR gene editing is widely used in the generation and production of new agricultural products, such as improved and genetically optimized crop plants. Research on identifying novel CRISPR-Cas systems is still developing rapidly. In 2022, Al- ^ *20^23^89^86^48^* ^^^^^^^BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Shayeb at al. (doi.org / 10.1016 / j.cell.2022.10.020) published a study identifying multiple new Cas9-like proteins and 44 protein families related to type V CRISPR-Cas systems. In plants, CRISPR-Cas12a (formerly known as Cpf1), a class II type V CRISPR-Cas system, is a commonly used genome editing system. CRISPR-Cas12a has been recognized as a suitable, and for certain applications even superior, alternative to more established CRISPR-Cas9 system due to some of its unique features. Cas12a is smaller and simpler as compared to Cas9. In comparison to Cas9, Cas12a is less prone to producing off-target effects, i.e. unspecific editing of genes other than the one(s) intended. Such off-target effects make it virtually impossible to attribute observed phenotypic changes to the modification of the originally intended target gene and furthermore pose a strong risk for producing undesired and possibly even fatal side effects. Moreover, Cas12a recognizes alternative protospacer-adjacent motif (PAM) sequences (T-rich PAM sequences) as compared to Cas9 making it suitable for different applications as this enables new targeting possibilities. Moreover, Cas12a cuts its respective target DNA further away from the respective PAM site as compared to Cas9. Cas12a has a pre-CRISPR RNA processing activity and does not require tracrRNA but instead only utilizes a single CRISPR RNA (crRNA). Furthermore, Cas12a creates 4 to 5 nucleotide long sticky ends rather than blunt ends at its cut sites. This confers several advantages for certain applications to Cas12a over Cas9 as sticky ends have unique properties during non-homologous end joining (NHEJ) and homologous repair of DNA, such as an enhanced efficiency of genetic insertions as well as an improved specificity. However, there are no well-established complete nickase variants of Cas12a currently available, which is why it is not widely utilized as part of base editors or prime editors. Traditionally, in the technical field of biotechnology, particularly crop plant improvement, CRISPR-Cas12a genome editing has been performed using transformation methods based on plasmid delivery. However, plasmid DNA-based delivery methods bears the critical risks of transgene integration as well as off-target effects. Accordingly, there was a steadily growing demand for improved CRSPR-Cas delivery methods. A method, which drastically reduces the aforementioned shortcomings of plasmid DNA-based delivery methods is the delivery of CRISPR nucleases in the form of ribonucleoproteins (RNPs), which prevents exogenous DNA integration, minimizes off-target effects, and thus drastically reduces cellular toxicity. However, RNP-based CRISPR delivery is still at its very early developmental stage in crop plants. For example, in 2022 Qi et al. (doi: 10.3389 / fgeed.2022.780238) demonstrated efficient genome editing using Cas12a delivered as RNPs using rice and citrus protoplasts. They demonstrated that RNP delivery of Cas12a resulted in higher editing efficiencies than traditional plasmid delivery. Four different Cas12a variants were investigated, two of which were obtained from Lachnospiraceae bacterium (LbCas12a) and the remaining two wereBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01obtained from Acidaminococcus sp. (AsCas12a). It was found that LbCas12a variants showed higher editing efficiencies than AsCas12a variants with this difference being most pronounced at low RNP concentrations. Moreover, it was found that crRNA modifications did not positively affect genome editing efficiency. Besides that, in 2022 Zhang et al. (doi: 10.3389 / fgeed.2021.760820) established an efficient and simplified protoplast-based genome editing platform for CRISPR-Cas RNP delivery with six Cas9 and Cas12a endonucleases in pennycress (Thlaspi arvense), soybean (Glycine max), and Setaria viridis. They analyzed the genome editing efficiency, specificity, and temperature sensitivity of these enzymes. They obtained editing efficiencies ranging from 8.7 % to 85.2 % with LbCas12a often exhibiting the highest editing activity while AsCas12a often showed the higher sequence specificity. They mostly used RNP quantities of 20 µg per transfection with 10 µg RNP per transfection being the lowest tested amount. It was thus a primary objective of the present invention to further improve upon known methods of RNP-based delivery methods of CRISPR-Cas genome editing systems in order to improve the genome editing efficiency without necessitating the use of high amounts of RNP to be delivered. It was a further objective of the present invention to provide a method for delivering a CRISPR-Cas genome editing system comprising an AsCas12a variant, wherein the activity, i.e. the genome editing efficiency, of the AsCas12a variant is increased while maintaining its high sequence specificity. Moreover, it was an objective of the present invention to provide a method for delivering a CRISPR-Cas genome editing system comprising an LbCas12a variant, wherein the required amount of LbCas12a can be reduced or even minimized while maintaining it high activity, i.e. genome editing efficiency. Furthermore, it was an objective of the present invention to provide an improved method for delivery of a CRISPR-Cas genome editing system, which allows for replacing LbCas12a in certain applications with AsCas12a without compromising activity, i.e. genome editing efficiency. Further, it was an objective of the present invention to provide an improved method for delivery of a CRISPR-Cas genome editing system, which is optimized in terms of cost- efficiency and / or procedural economy and / or sustainability.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Brief Description of Figures Fig.1 Indel frequency analysis via ddPCR of Brassica napus (oil seed rape) protoplasts. Protoplasts were transfected with 15 µg of AsCas12a as part of an RNP, 10 µg of AsCas12a as part of an RNP, or 5 µg of AsCas12a as part of an RNP. Said RNP was either transfected alone or co-delivered with 20 µg of carrier nucleic acid, i.e. a plasmid (pPSEGFP). A control was performed, in which only the carrier nucleic acid, i.e. the plasmid pPSEGFP, was transfected. Fig.2 Indel frequency analysis via ddPCR of Brassica napus (oil seed rape) protoplasts. Protoplasts were transfected with 15 µg of AsCas12a as part of an RNP, 10 µg of AsCas12a as part of an RNP, or 5 µg of AsCas12a as part of an RNP. Said RNP was either transfected alone or co-delivered with 20 µg of carrier nucleic acid, i.e. RNA (Sigma-Aldrich R7876 [10,000 units]; 15-19 unit / mg solid; solubility 2 mg / mL). Fig.3 Indel frequency analysis via ddPCR of Brassica napus (oil seed rape) protoplasts. Protoplasts were transfected with 10 µg of AsCas12a as part of an RNP, 5 µg of AsCas12a as part of an RNP, or 2.5 µg of AsCas12a as part of an RNP. Said RNP was either transfected alone or co-delivered with 20 µg of carrier nucleic acid, i.e. RNA (Sigma-Aldrich R7876 [10,000 units]; 15-19 unit / mg solid; solubility 2 mg / mL). Fig.4 Indel frequency analysis via ddPCR of Brassica napus (oil seed rape) protoplasts. Protoplasts were transfected with 2.5 µg of LbCas12a as part of an RNP, 1 µg of LbCas12a as part of an RNP, 0.5 µg of LbCas12a as part of an RNP, 0.25 µg of LbCas12a as part of an RNP, or 0.1 µg of LbCas12a as part of an RNP. Said RNP was either transfected alone (without DNA) or co-delivered with 20 µg of carrier nucleic acid (with DNA), i.e. a plasmid (pDE110). A control was performed, in which only the carrier nucleic acid, i.e. the plasmid, was transfected. Fig.5 Indel frequency analysis via ddPCR of Brassica napus (oil seed rape) protoplasts. Protoplasts were transfected with 0.25 µg of LbCas12a as part of an RNP. Said RNP was either transfected alone or co-delivered with 20 µg of carrier nucleic acid, i.e. a plasmid (pBas03172, or pBay01792, or pBas04657) or RNA (Sigma-Aldrich R7876 [10,000 units]). A control was performed, in which only the RNP without carrier nucleic acid was transfected. Fig.6 Cleavage efficiency analysis via NGS of Brassica napus (oil seed rape) protoplasts. Protoplasts were transfected with 10 µg of AsCas12a as part of an RNP. Said RNP was either transfected alone (- DNA) or co-delivered with 20 µg of carrier nucleic acid (+ DNA),BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01i.e. a plasmid (pPSEGFP). Cleavage was determined via ddPCR for four distinct target sites (sites 1 to 4). Fig.7 Indel frequency analysis via ddPCR of Brassica napus (oil seed rape) protoplasts. Protoplasts were transfected with 2.5 µg of LbCas12a as part of an RNP, 1 µg of LbCas12a as part of an RNP, 0.5 µg of LbCas12a as part of an RNP, 0.25 µg of LbCas12a as part of an RNP, or 0.1 µg of LbCas12a as part of an RNP. Said RNP was either transfected alone (-RNA) or co-delivered with 20 µg of carrier nucleic acid (+ RNA), i.e. RNA (Sigma-Aldrich R7876 [10,000 units]; 15-19 unit / mg solid; solubility 2 mg / mL). Fig.8 Indel frequency analysis via ddPCR of Brassica napus (oil seed rape) shoots. Shoots were transfected with 10 µg of AsCas12a (A) as part of an RNP, 5 µg of AsCas12a (B) as part of an RNP, or 2.5 µg of AsCas12a (C) as part of an RNP. Said RNP was either transfected alone ( dashed line) or co-delivered with 20 µg of carrier nucleic acid, i.e. RNA (Sigma-Aldrich R7876 [10,000 units]; 15-19 unit / mg solid; solubility 2 mg / mL; solid line). Fig.9 Indel frequency analysis via ddPCR of Brassica napus (oil seed rape) shoots. Protoplasts were transfected with LbCas12a as part of an RNP. The numbers given for the amounts of transfected RNP represent the amount of LbCas12a as part of an RNP. Said RNP was either transfected alone (-RNA) or co-delivered with 20 µg of carrier nucleic acid (+ RNA), i.e. RNA (Sigma-Aldrich R7876 [10,000 units]; 15-19 unit / mg solid; solubility 2 mg / mL). Bars represent the amount (percent) of shoots with InDels in all 4 alleles (black bar, % shoots with InDel% of 100%), shoots with InDels in 3 of 4 alleles (checkered bar, % shoots with InDel% of 75%), shoots with InDels in 2 of 4 alleles (dashed bar, % shoots with InDel% of 50%), shoots with InDels in 1 of 4 alleles (crossed bar, % shoots with InDel% of 25%), shoots with InDels in no allele (dotted bar, % shoots with InDel% of 0%, “#WT samples”). Brief Description of Sequences SEQ ID NO. Description LbCas12a – Amino acid sequence of wildtype Cas12a protein from 1 Lachnospiraceae bacterium AsCas12a – Amino acid sequence of wildtype Cas12a protein from 2 Acidaminococcus sp. (strain BV3L6) 3 FtCas12a – Amino acid sequence of wildtype Cas12a protein fromBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Francisella tularensis (WP_216370596.1)4FnCas12a (FnCpf1) – Amino acid sequence of wildtype Cas12a proteinfrom Francisella tularensis subsp. novicidaFn2Cas12a – Amino acid sequence of wildtype Cas12a protein from 5 Francisella tularensis subsp. novicida (strain U112) PcCas12a – Amino acid sequence of wildtype Cas12a protein from 6 Porphyromonas crevioricanis ErCas12a – Amino acid sequence of wildtype Cas12a protein from 7 Eubacterium rectale MmCas12a – Amino acid sequence of wildtype Cas12a protein from 8 Methanomethylophilus alvus MbCas12a – Amino acid sequence of wildtype Cas12a protein from 9 Moraxella bovoculi BsCas12a – Amino acid sequence of wildtype Cas12a protein from 10 Butyrivibrio sp. NC3005 TsCas12a – Amino acid sequence of wildtype Cas12a protein from 11 Thiomicrospira sp. XS5 Mb2Cas12a – Amino acid sequence of wildtype Cas12a protein from 12 Moraxella bovoculi Lb5Cas12a – Amino acid sequence of wildtype Cas12a protein from 13 Lachnospiraceae bacterium dLbCas12a – Amino acid sequence of DNase-dead mutant Cas12a 14 protein from Lachnospiraceae bacterium (D832A mutant protein) dLbCas12a – Amino acid sequence of DNase-dead mutant Cas12a 15 protein from Lachnospiraceae bacterium (E925A mutant protein) 16 dLbCas12a – Amino acid sequence of DNase-dead mutant Cas12aBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01protein from Lachnospiraceae bacterium (D832A / E925A mutant protein) dAsCas12a – Amino acid sequence of DNase-dead mutant Cas12a 17 protein from Acidaminococcus sp. (strain BV3L6; D908A mutant protein) dAsCas12a – Amino acid sequence of DNase-dead mutant Cas12a 18 protein from Acidaminococcus sp. (strain BV3L6; E993A mutant protein) dAsCas12a – Amino acid sequence of DNase-dead mutant Cas12a 19 protein from Acidaminococcus sp. (strain BV3L6; D908A / E993A mutant protein) dFtCas12a – Amino acid sequence of DNase-dead mutant Cas12a 20 protein from Francisella tularensis (WP_216370596.1; D917A mutant protein) dFtCas12a – Amino acid sequence of DNase-dead mutant Cas12a 21 protein from Francisella tularensis (WP_216370596.1; E1006A mutant protein) dFtCas12a – Amino acid sequence of DNase-dead mutant Cas12a 22 protein from Francisella tularensis (WP_216370596.1; D917A / E1006A mutant protein) dFnCas12a – Amino acid sequence of DNase-dead mutant Cas12a 23 protein from Francisella tularensis subsp. novicida (D917A mutant protein) dFnCas12a – Amino acid sequence of DNase-dead mutant Cas12a 24 protein from Francisella tularensis subsp. novicida (E1006A mutant protein) dFnCas12a – Amino acid sequence of DNase-dead mutant Cas12a 25 protein from Francisella tularensis subsp. novicida (D917A / E1006A mutant protein)BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01dFnCas12a (strain U112) – Amino acid sequence of DNase-dead 26 mutant Cas12a protein from Francisella tularensis subsp. novicida (strain U112; D917A mutant protein) dFnCas12a (strain U112) – Amino acid sequence of DNase-dead 27 mutant Cas12a protein from Francisella tularensis subsp. novicida (strain U112; E1006A mutant protein) dFnCas12a (strain U112) – Amino acid sequence of DNase-dead 28 mutant Cas12a protein from Francisella tularensis subsp. novicida (strain U112; D917A / E1006A mutant protein) 29 Forward primer for ddPCR analysis 30 Reverse Primer for ddPCR analysis 31 Reference probe (FAM) for ddPCR analysis 32 Drop-off probe (HEX) for ddPCR analysis 33 FAD2 target sequence 34 pPSEGFP 35 Target sequence 1 for NGS analysis of cleavage efficiency 36 Target sequence 2 for NGS analysis of cleavage efficiency 37 Target sequence 3 for NGS analysis of cleavage efficiency 38 Target sequence 4 for NGS analysis of cleavage efficiency 39 pDE110 RR PAM mutant of AsCas12a – Amino acid sequence of Cas12a protein 40 from Acidaminococcus sp. (strain BV3L6; S542R / K607R mutant protein) with altered PAM specificity RV PAM mutant of AsCas12a – Amino acid sequence of Cas12a protein 41 from Acidaminococcus sp. (strain BV3L6; S542R / K548V mutant protein) with altered PAM specificityBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01RVR PAM mutant of AsCas12a – Amino acid sequence of Cas12a 42 protein from Acidaminococcus sp. (strain BV3L6; S542R / K548V / N552R mutant protein) with altered PAM specificity PAM mutant of LbCas12a – Amino acid sequence of mutant Cas12a 43 protein from Lachnospiraceae bacterium (E795L mutant protein) with altered PAM specificity PAM mutant of LbCas12a – Amino acid sequence of mutant Cas12a 44 protein from Lachnospiraceae bacterium (D156R mutant protein) with altered PAM specificity 45 short single-stranded DNA molecule “Identity” and / or “homology” when used in respect to the comparison of two or more nucleic acid or amino acid molecules means that the sequences of said molecules share a certain degree of sequence similarity, the sequences being partially identical. Enzyme variants may be defined by their sequence identity when compared to a parent enzyme. Sequence identity usually is provided as “% sequence identity” or “% identity”. To determine the percent-identity between two amino acid sequences in a first step a pairwise sequence alignment is generated between those two sequences, wherein the two sequences are aligned over their complete length (i.e., a pairwise global alignment). The alignment is generated with a program implementing the Needleman and Wunsch algorithm (J. Mol. Biol. (1979) 48, p.443-453), preferably by using the program “NEEDLE” (The European Molecular Biology Open Software Suite (EMBOSS)) with the programs default parameters (gapopen=10.0, gapextend=0.5 and matrix=EBLOSUM62). The preferred alignment for the purpose of this invention is that alignment, from which the highest sequence identity can be determined. The following example is meant to illustrate two nucleotide sequences, but the same calculations apply to protein sequences: Seq A: AAGATACTG; length: 9 bases Seq B: GATCTGA; length: 7 bases Hence, the shorter sequence is sequence B. BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Producing a pairwise global alignment which is showing both sequences over their complete lengths results in The “I” symbol in the alignment indicates identical residues (which means bases for DNA or amino acids for proteins). The number of identical residues is 6. The symbol in the alignment indicates gaps. The number of gaps introduced by alignment within the Seq B is 1. The number of gaps introduced by alignment at borders of Seq B is 2, and at borders of Seq A is 1. The alignment length showing the aligned sequences over their complete length is 10. Producing a pairwise alignment which is showing the shorter sequence over its complete length according to the invention consequently results in: Producing a pairwise alignment which is showing sequence A over its complete length according to the invention consequently results in: Producing a pairwise alignment which is showing sequence B over its complete length according to the invention consequently results in: BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01The alignment length showing the shorter sequence over its complete length is 8 (one gap is present which is factored in the alignment length of the shorter sequence). Accordingly, the alignment length showing Seq A over its complete length would be 9 (meaning Seq A is the sequence of the invention). Accordingly, the alignment length showing Seq B over its complete length would be 8 (meaning Seq B is the sequence of the invention). After aligning two sequences, in a second step, an identity value is determined from the alignment produced. For purposes of this description, percent identity is calculated by %- identity = (identical residues / length of the alignment region which is showing the respective sequence of this invention over its complete length) *100. Thus, sequence identity in relation to comparison of two amino acid sequences according to this embodiment is calculated by dividing the number of identical residues by the length of the alignment region which is showing the respective sequence of this invention over its complete length. This value is multiplied with 100 to give “%-identity”. According to the example provided above, %-identity is: for Seq A being the sequence of the invention (6 / 9) * 100 = 66.7 %; for Seq B being the sequence of the invention (6 / 8) * 100 =75%. InDel is a term for the random insertion or deletion of bases in the genome of an organism associated with the repair of a DSB by NHEJ. It is classified among small genetic variations, measuring from 1 to 10000 base pairs in length. As used herein it refers to random insertion or deletion of bases in or in the close vicinity (e.g. less than 1000 bp, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 400 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, 50 bp, 40 bp, 30 bp, 25 bp, 20 bp, 15 bp, 10 bp or 5 bp up and / or downstream) of the target site. Detailed Description In a first aspect, the present invention relates to a method for increasing the efficiency of modifying at least one target nucleic acid segment, wherein said method may comprise (a) providing at least one target cell comprising at least one target nucleic acid segment; andBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01(b.1) providing at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof, wherein the endonuclease is selected from the group consisting of a CRISPR-Cas ribonucleoprotein comprising at least one suitable, functional guide RNA; a meganuclease; a Zn-finger nuclease; a TALEN; or (b.2) providing at least one nucleic acid molecule encoding at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof, wherein the endonuclease is selected from the group consisting of a meganuclease, a Zn-finger nuclease, a TALEN; (c) providing at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same; (d) optionally providing a protein of interest or a nucleic acid encoding a protein of interest; (e) introducing simultaneously the at least one carrier nucleic acid molecule provided in step (c), the endonuclease and / or the dead mutant thereof and / or the nickase mutant thereof as provided in step (b.1) or the nucleic acid molecule provided in step (b.2), and optionally the protein or nucleic acid provided in (d) into the target cell; (f) obtaining at least one cell comprising at least one modified target nucleic acid segment; wherein the method does not comprise treatment of the human or animal body by surgery or therapy and / or a diagnostic method practised on the human or animal body, and / or processes for modifying the germ line genetic identity of human beings. The term “target cell” as used herein describes a cell containing a nucleic acid sequence or part of a nucleic acid sequence, which is supposed to be subjected to modification via a method according to the present invention. According to the present invention, target cells can be eukaryotic and / or prokaryotic (including both bacterial and archaeal) cells. The term “target nucleic acid segment” as used herein, e.g. in the context of endonucleases, describes a nucleic acid sequence or part of a nucleic acid sequence, which can be subjected to one or more modification(s) via a method according to the present invention, wherein said target nucleic acid segment can be DNA and / or RNA,BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01preferably DNA, and wherein said modification(s) may include one or more deletion(s) of one or more nucleotide(s) and / or one or more insertion(s) of one or more nucleotide(s) and / or one or more substitution(s) of one or more nucleotide(s). The terms “target nucleic acid segment” and “target sequence” are used interchangeably herein. The target sequence, preferably according to any one of the SEQ ID NOs: 35, 36, 37, and 38, is preferably located in close proximity, preferably directly adjacent, to a TTTV PAM sequence. Thus, it is preferred that up to 20 nucleotides, preferably up to 15 nucleotides, preferably up to 10 nucleotides, preferably up to 9 nucleotides, preferably up to 8 nucleotides, preferably up to 7 nucleotides, preferably up to 6 nucleotides, preferably up to 5 nucleotides, preferably up to 4 nucleotides, preferably up to 3 nucleotides, preferably up to 2 nucleotides, preferably up to 1 nucleotides, preferably 0 nucleotides (i.e. directly adjacent), between the target sequence and the TTTV PAM sequence. Preferably, the TTTV PAM sequence is a TTTA PAM sequence. Preferably, the TTTV PAM sequence is a TTTT PAM sequence. Preferably, the TTTV PAM sequence is a TTTC PAM sequence. Preferably, the TTTV PAM sequence is a TTTG PAM sequence. In case of SEQ ID NO: 35, the TTTV PAM sequence preferably is a TTTG PAM sequence. In case of SEQ ID NO: 36, the TTTV PAM sequence preferably is a TTTC PAM sequence. In case of SEQ ID NO: 37, the TTTV PAM sequence preferably is a TTTG PAM sequence. In case of SEQ ID NO: 38, the TTTV PAM sequence preferably is a TTTA PAM sequence. Preferably, the term “the endonuclease is selected from a CRISPR-Cas ribonucleoprotein comprising at least one suitable, functional guide RNA” is to be understood such that the endonuclease is selected from the group consisting of CRISPR-Cas endonucleases, preferably CRISPR-Cas endonucleases, which are part of a ribonucleoprotein comprising at least one suitable, functional guide RNA. The term “dead mutant” as used herein, e.g. in the context of endonucleases, describes a mutant of any ortholog of any given enzyme harbouring at least one mutation significantly diminishing or abolishing at least one activity of the corresponding wildtype enzyme. In the specific context of endonucleases, the term “dead mutant” as used herein describes any ortholog of any given endonuclease harbouring at least one mutation significantly diminishing or abolishing at least the DNase acitivity of the corresponding wildtype endnuclease enzyme. Such dead mutants of any given endnuclease, or functional fragments thereof, may comprise one, two, three, or more mutations, especially preferably one or two mutations, rendering their respective DNase activity at least diminished or even abolished. Preferably, the one, two, three, or more mutations, especially preferably one or two mutations, rendering the respective nuclease activity non-functional are located in theBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01nuclease active site of the respective endonuclease enzyme, or functional fragment thereof. The term “nickase mutant” as used herein describes mutants of an endonuclease, preferably Cas12a, or functional fragments thereof, showing nickase activity and hence are capable of introducing a single-strand cut (“nick”), preferably with comparable or the same specificity as the respective wildtype endonucleases, preferably Cas12a nucleases, introduce double-strand breaks. In the art, nickase mutants of Cas12a variants have been described (e.g. WO2017 / 127807, WO2019 / 233990A1, and WO2018 / 176009). The term “functional fragment” refers to any nucleic acid or protein, which represents merely a part of the full length nucleic acid or full length protein, respectively, but still provides substantially the same function when expressed or repressed in a plant, respectively, or still has the same biological activity of the full length nucleic acid or full length protein. The term “functional guide RNA” as used herein describes a guide RNA (gRNA) molecule, which can associate with, i.e. attach to, a CRISPR nuclease and thus form a functionally associated complex with said CRISPR nuclease, which can be used in order to modify at least one target nucleic acid segment. A functional guide RNA may comprise two separate RNA molecules, i.e. a pre-crisprRNA (pre-crRNA) and a trans-activating crispr RNA (tracrRNA), which are partially complementary and therefore form an RNA duplex via base pairing. Said RNA duplex can be cleaved by RNase III, an RNA-specific ribonuclease, resulting in a crRNA / tracrRNA hybrid. Preferably, the functional guide RNA according to the present invention is a single guide RNA (sgRNA) molecule comprising both a tracrRNA component and a crRNA component joined by tetraloop. In the present disclosure, the terms guide RNA (gRNA) and single guide RNA (sgRNA) and crisprRNA (crRNA) can be used interchangeably. The skilled person in the relevant technical field is aware of the fact that a naturally occurring CRISPR nuclease and the cognate guiding RNA are mutually compatible. Further, the skilled person knows that a different CRISPR / Cas effector is guided by a different type of guiding RNA. The term “ribonucleoprotein” (RNP) as used herein describes complexes, particularly functionally associated complexes, comprising one or more protein(s) and one or more ribonucleic acid (RNA) molecule(s).BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01The terms “protein”, “polypeptide”, and “amino acid sequence” are used interchangeably herein. The terms “adenine” and “adenosine”, e.g. in the context of a nucleic acid, are used interchangeably herein. The terms “cytosine” and “cytidine”, e.g. in the context of a nucleic acid, are used interchangeably herein. The terms “guanine” and “guanosine”, e.g. in the context of a nucleic acid, are used inter- changeably herein. The terms “thymine” and “thymidine”, e.g. in the context of a nucleic acid, are used inter- changeably herein. In one embodiment of the method according to the present invention, the at least one target cell is a prokaryotic (including bacterial and archaeal) cell. In a preferred embodiment of the method according to the present invention, the at least one target cell is a eukaryotic cell. In a preferred embodiment of the method according to the present invention, the at least one target cell is a plant cell. In a preferred embodiment of the method according to the present invention, the plant cell is derived from a crop plant, such as oil seed crops, cereal crops, fiber crops, pulses or leguminous plants. The term “plant cell” as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs, and single cells thereof. Further, the plant cell may be selected from the group consisting of protoplasts, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores, preferably wherein the plant cell is from a plant that can be obtained, analyzed, treated in line with the disclosure provided herein. In a particularly preferred embodiment of the method according to the present invention, the at least one target cell is a plant cell, preferably a plant cell belonging to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including fodder or forage legumes, ornamental plants, food crops, trees or shrubs selected from the listBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01comprising Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tripsacum dactyloides, Triticosecale rimpaui, Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, or Ziziphus spp.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Preferred plants are Abelmoschus spp., Allium spp., Apium graveolens, Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Beta vulgaris, Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Capsicum spp., Citrullus lanatus, Cucumis spp., Cynara spp., Daucus carota, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hordeum spp. (e.g. Hordeum vulgare), Lactuca sativa, Medicago sativa, Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Pennisetum sp., Saccharum spp., Secale cereale, Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Zea mays. Especially preferred plants are Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Capsicum spp., Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Zea mays. In an especially preferred embodiment of the method according to the present invention, the at least one target cell is a plant cell belonging to the species Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]). In an especially preferred embodiment of the method according to the present invention, the at least one target cell is a plant cell belonging to canola. In an especially preferred embodiment of the method according to the present invention, the at least one target cell is a plant cell belonging to oilseed rape. In an especially preferred embodiment of the method according to the present invention, the at least one target cell is a plant cell belonging to turnip rape. Preferably, in step (b.1) at least one endonuclease protein is provided. Preferably, in step (b.1) at least one dead mutant of an endonuclease protein is provided. Preferably, in step (b.1) at least one nickase mutant of an endonuclease protein is provided.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In one embodiment of the method according to the present invention, the endonuclease protein is an RNA-guided endonuclease protein, preferably a CRISPR-associated protein (Cas), more preferably a Class 2 Cas protein. In a preferred embodiment of the method according to the present invention, the at least one endonuclease protein is a Cas9 protein. In a preferred embodiment of the method according to the present invention, the at least one endonuclease protein is a Cas12a (previously known as Cpf1) protein. Preferably, the, one, two, three or more or all of the at least one endonuclease protein(s) is / are selected from the group consisting of Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), Cas12a protein obtained from or isolated from Francisella tularensis (FtCas12a), Cas12a protein obtained from or isolated from Francisella tularensis (FnCas12a), Cas12a protein obtained from or isolated from Francisella (Fn2Cas12a), Cas12a protein obtained from or isolated from Porphyromonas crevioricanis (PcCas12a), Cas12a protein obtained from or isolated from Eubacterium rectale (ErCas12a), Cas12a protein obtained from or isolated from Methanomethylophilus alvus (MaCas12a), Cas12a protein obtained from or isolated from Moraxella bovoculi (MbCas12a), Cas12a protein obtained from or isolated from Butyrivibrio sp. (BsCas12a), and Cas12a protein obtained from or isolated from Thiomicrospira sp. (TsCas12a). Preferably, the, one, two, three or more or all of the at least one endonuclease protein(s) is / are selected from the group consisting of Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) according to SEQ ID NO: 1, Cas12a protein obtained from or isolated from Acidaminococcus sp. (strain BV3L6; AsCas12a) according to SEQ ID NO: 2, Cas12a protein obtained from or isolated from Francisella tularensis (WP_216370596.1; FtCas12a) according to SEQ ID NO: 3, Cas12a protein obtained from or isolated from Francisella tularensis subsp. novicida (FnCas12a) according to SEQ ID NO: 4, Cas12a protein obtained from or isolated from Francisella tularensis subsp. novicida (strain U112; Fn2Cas12a) according to SEQ ID NO: 5, Cas12a protein obtained from or isolated from Porphyromonas crevioricanis (PcCas12a) according to SEQ ID NO: 6, Cas12a protein obtained from or isolated from Eubacterium rectale (ErCas12a) according to SEQ ID NO: 7, Cas12a protein obtained from or isolated from Methanomethylophilus alvus (MaCas12a) according to SEQ ID NO: 8, Cas12a protein obtained from or isolated from Moraxella bovoculi (MbCas12a) according to SEQ ID NO: 9, Cas12a protein obtained from or isolated from Butyrivibrio sp. NC3005 (BsCas12a) according to SEQ ID NO: 10, Cas12a protein obtained from or isolated from Thiomicrospira sp. XS5 (TsCas12a) according to SEQ ID NO: 11, Cas12a protein obtained from or isolated from MoraxellaBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01bovoculi (Mb2Cas12a) according to SEQ ID NO: 12, and Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (Lb5Cas12a) according to SEQ ID NO: 13. In one embodiment of the method according to the present invention, the dead mutant of the at least one endonuclease protein is a dead mutant of an RNA-guided endonuclease protein, preferably a dead mutant of a CRISPR-associated protein (dCas). In a preferred embodiment of the method according to the present invention, the dead mutant of the at least one endonuclease protein is a dead mutant of a Cas9 protein (dCas9). In a preferred embodiment of the method according to the present invention, the dead mutant of the at least one endonuclease protein is a dead mutant of a Cas12a (previously known as Cpf1) protein (dCas12a). Preferably, the, one, two, three or more or all of the at least one dead mutant of an endonuclease protein(s) is / are selected from the group consisting of dead mutants of a wildtype Cas12a protein, preferably dead mutants of a wildtype Cas12a protein, which is selected from the list consisting of Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), Cas12a protein obtained from or isolated from Francisella tularensis (FtCas12a), Cas12a protein obtained from or isolated from Francisella tularensis (FnCas12a), Cas12a protein obtained from or isolated from Francisella (Fn2Cas12a), Cas12a protein obtained from or isolated from Porphyromonas crevioricanis (PcCas12a), Cas12a protein obtained from or isolated from Eubacterium rectale (ErCas12a), Cas12a protein obtained from or isolated from Methanomethylophilus alvus (MaCas12a), Cas12a protein obtained from or isolated from Moraxella bovoculi (MbCas12a), Cas12a protein obtained from or isolated from Butyrivibrio sp. (BsCas12a), and Cas12a protein obtained from or isolated from Thiomicrospira sp. (TsCas12a). Preferably, the, one, two, three or more or all of the at least one dead mutant of an endonuclease protein(s) is / are selected from the group consisting of dead mutant of Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) according to any one of SEQ ID NOs: 14 and / or 15 and / or 16, dead mutant of Cas12a protein obtained from or isolated from Acidaminococcus sp. (strain BV3L6; dAsCas12a) according to any one of SEQ ID NOs: 17 and / or 18 and / or 19, dead mutant of Cas12a protein obtained from or isolated from Francisella tularensis (WP_216370596.1; dFtCas12a) according toany one of SEQ ID NOs: 20 and / or 21 and / or 22, dead mutant of Cas12a protein obtained from or isolated from Francisella tularensis subsp. novicida (dFnCas12a) according to any one of SEQ ID NOs: 23 and / or 24 and / or 25, and deadBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01mutant of a Cas12a protein obtained from or isolated from Francisella tularensis subsp. novicida (strain U112; dFn2Cas12a) according to any one of SEQ ID NOs: 26 and / or 27 and / or 28. Preferably, the, one, two, three or more or all of the at least one endonuclease protein(s) is / are selected from the group consisting of Cas12a proteins obtained from or isolated from Lachnospiraceae bacterium with mutations leading to an altered PAM specificity according to any of the SEQ ID NOs: 43 and 44. Preferably, the, one, two, three or more or all of the at least one endonuclease protein(s) is / are selected from the group consisting of Cas12a proteins obtained from or isolated from Acidaminococcus sp. (strain BV3L6) with mutations leading to an altered PAM specificity according to any of the SEQ ID NOs: 40, 41 and 42. The term “PAM” as used herein describes a protospacer adjacent motif, which is a short nucleotide sequence, typically a DNA sequence, which typically is about 2 to 6 base pairs long and which is located within or in proximity to a given target site. Preferably, the PAM sequence and the target site are on the same nucleic acid strand. Preferably, the PAM sequence and the target site may be on opposite nucleic acid strands, wherein in this case a feature relating to a particular localization of the PAM sequence (in relation to the target site) may be determined in relation to the sequence complementary to the target site. Different types of nucleases recognize and bind to one or more specific PAM sequence(s). In case of Cas9 nucleases, Cas-9-mediated DNA cleavage occurs in the PAM-proximal sequence region. In case of Cas12a nucleases, Cas12a-mediated DNA cleavage occurs in a more distal region in relation to the respective PAM sequence. The terms “PAM” and “PAM sequence” are used interchangeably herein. Preferably, the, one, two, three or more or all of the at least one nickase mutant of an endonuclease protein(s) is / are selected from nickase mutants of Cas12a, preferably selected from nickase mutants disclosed in WO2017 / 127807, WO2019 / 233990A1, and WO2018 / 176009. In one embodiment of the present invention, the at least one endonuclease protein is a transcription activator-like effector nuclease (TALEN). In one embodiment of the present invention, the at least one endonuclease protein is a Zinc-finger nuclease (Zn-finger nuclease or ZNF).BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01The term “carrier nucleic acid molecule” as used herein describes a nucleic acid molecule selected from the group consisting of a linear single-stranded DNA molecule (ssDNA), a linear single-stranded RNA molecule (ssRNA), a linear double-stranded DNA molecule (dsDNA), a linear double-stranded RNA molecule (dsRNA), a circular single-stranded DNA molecule (ssDNA), a circular single-stranded RNA molecule (ssRNA), a circular double- stranded DNA molecule (dsDNA), and a circular double-stranded RNA molecule (dsRNA). A carrier nucleic acid molecule according to the present invention may or may not encode at least one protein or more than one protein(s). A carrier nucleic acid molecule according to the present invention may be selected from the group consisting of plasmid DNA, tRNA and dsRNA comprising at least a double stretch having a t-RNA-like or a hairpin-like structure. Preferably, the term “carrier nucleic acid molecule” as used herein describes a nucleic acid molecule selected from the group consisting of a linear double-stranded DNA molecule (dsDNA), a linear double-stranded RNA molecule (dsRNA), a circular double-stranded DNA molecule (dsDNA), and a circular double-stranded RNA molecule (dsRNA). Preferably, the term “carrier nucleic acid molecule” as used herein does not refer to a nucleic acid molecule, which is already present in the target cell provided in step (a). However, the carrier nucleic acid molecule may encode a protein or may correspond to a nucleic acid molecule, which is present in the target cell provided in step (a). Preferably, the term “carrier nucleic acid molecule” as used herein does not refer to a nucleic acid molecule, which is endogenous to the target cell provided in step (a). However, the carrier nucleic acid molecule may encode a protein or may correspond to a nucleic acid molecule, which is endogenous to the target cell provided in step (a). In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a circular double-stranded DNA molecule. Preferably, said circular double- stranded DNA molecule has a size of 10,000 nucleotides or less, preferably of 7,500 nucleotides or less, preferably of 5,000 nucleotides or less, especially preferably of 2,500 nucleotides or less, particularly preferably of 1,000 nucleotides or less, especially preferably of 500 nucleotides or less, particularly preferably of 300 nucleotides or less, particularly preferably of 150 nucleotides or less, preferably of 101 nucleotides or less. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a plasmid, which does not encode any protein. Preferably, said plasmid not encoding any protein has a size in the range of from 100 nucleotides to 50,000 nucleotides, preferably of from 200 nucleotides to 30,000 nucleotides, preferably of from 500 nucleotides to 20,000 nucleotides, especially preferably of from 3,000 nucleotides toBASF Agricultural Solutions Seed US LLC210986WO01 210986WO0117,500 nucleotides, especially preferably of from 4,000 nucleotides to 17,500 nucleotides, particularly preferably of from 8,000 nucleotides to 17,500 nucleotides, especially preferably of from 3,000 nucleotides to 8,000 nucleotides, particularly preferably of from 4,000 nucleotides to 8,000 nucleotides. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a plasmid, which encodes at least one protein. Preferably, said plasmid encoding at least one protein has size in the range of from 100 nucleotides to 50,000 nucleotides, preferably of from 200 nucleotides to 30,000 nucleotides, preferably of from 500 nucleotides to 20,000 nucleotides, especially preferably of from 3,000 nucleotides to 17,500 nucleotides, especially preferably of from 4,000 nucleotides to 17,500 nucleotides, particularly preferably of from 8,000 nucleotides to 17,500 nucleotides, especially preferably of from 3,000 nucleotides to 8,000 nucleotides, particularly preferably of from 4,000 nucleotides to 8,000 nucleotides. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a plasmid, which encodes more than one protein. Preferably, said plasmid encoding more than one protein has size in the range of from 100 nucleotides to 50,000 nucleotides, preferably of from 200 nucleotides to 30,000 nucleotides, preferably of from 500 nucleotides to 20,000 nucleotides, especially preferably of from 3,000 nucleotides to 17,500 nucleotides, especially preferably of from 4,000 nucleotides to 17,500 nucleotides, particularly preferably of from 8,000 nucleotides to 17,500 nucleotides, especially preferably of from 3,000 nucleotides to 8,000 nucleotides, particularly preferably of from 4,000 nucleotides to 8,000 nucleotides. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a linear single-stranded DNA molecule, i.e. a single-stranded DNA oligonucleotide. Preferably, said single-stranded DNA oligonucleotide has a size of 10,000 nucleotides or less, preferably of 7,500 nucleotides or less, preferably of 5,000 nucleotides or less, especially preferably of 2,500 nucleotides or less, particularly preferably of 1,000 nucleotides or less, especially preferably of 500 nucleotides or less, particularly preferably of 300 nucleotides or less, particularly preferably of 150 nucleotides or less, preferably of 101 nucleotides or less. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a circular single-stranded DNA molecule. Preferably, said circular single- stranded DNA molecule has a size of 10,000 nucleotides or less, preferably of 7,500 nucleotides or less, preferably of 5,000 nucleotides or less, especially preferably of 2,500 nucleotides or less, particularly preferably of from 1,000 nucleotides or less, especiallyBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01preferably of 500 nucleotides or less, particularly preferably of 300 nucleotides or less, particularly preferably of 150 nucleotides or less, preferably of 101 nucleotides or less. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a linear single-stranded RNA molecule, i.e. a single-stranded RNA oligonucleotide. Preferably, said single-stranded RNA oligonucleotide has a size of 10,000 nucleotides or less, preferably of 7,500 nucleotides or less, preferably of 5,000 nucleotides or less, especially preferably of 2,500 nucleotides or less, particularly preferably of 1,000 nucleotides or less, especially preferably of 500 nucleotides or less, particularly preferably of 300 nucleotides or less, particularly preferably of 150 nucleotides or less, preferably of 101 nucleotides or less. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a circular single-stranded RNA molecule. Preferably, said circular single- stranded RNA molecule has a size of 10,000 nucleotides or less, preferably of 7,500 nucleotides or less, preferably of 5,000 nucleotides or less, especially preferably of 2,500 nucleotides or less, particularly preferably of 1,000 nucleotides or less, especially preferably of 500 nucleotides or less, particularly preferably of 300 nucleotides or less, particularly preferably of 150 nucleotides or less, preferably of 101 nucleotides or less. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a linear double-stranded DNA molecule, i.e. a double-stranded DNA oligonucleotide. Preferably, said double-stranded DNA oligonucleotide has a size of 10,000 nucleotides or less, preferably of 7,500 nucleotides or less, preferably of 5,000 nucleotides or less, especially preferably of 2,500 nucleotides or less, particularly preferably of 1,000 nucleotides or less, especially preferably of 500 nucleotides or less, particularly preferably of 300 nucleotides or less, particularly preferably of 150 nucleotides or less, preferably of 101 nucleotides or less. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a circular double-stranded DNA molecule. Preferably, said double-stranded DNA molecule has a size of 10,000 nucleotides or less, preferably of 7,500 nucleotides or less, preferably of 5,000 nucleotides or less, especially preferably of 2,500 nucleotides or less, particularly preferably of 1,000 nucleotides or less, especially preferably of 500 nucleotides or less, particularly preferably of 300 nucleotides or less, particularly preferably of 150 nucleotides or less, preferably of 101 nucleotides or less. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a linear double-stranded RNA molecule, i.e. a double-stranded RNA oligonucleotide. Preferably, said linear double-stranded RNA oligonucleotide has a size ofBASF Agricultural Solutions Seed US LLC210986WO01 210986WO0110,000 nucleotides or less, preferably of 7,500 nucleotides or less, preferably of 5,000 nucleotides or less, especially preferably of 2,500 nucleotides or less, particularly preferably of 1,000 nucleotides or less, especially preferably of 500 nucleotides or less, particularly preferably of 300 nucleotides or less, particularly preferably of 150 nucleotides or less, preferably of 101 nucleotides or less. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a circular double-stranded RNA molecule. Preferably, said circular double- stranded RNA molecule has a size of 10,000 nucleotides or less, preferably of 7,500 nucleotides or less, preferably of 5,000 nucleotides or less, especially preferably of 2,500 nucleotides or less, particularly preferably of 1,000 nucleotides or less, especially preferably of 500 nucleotides or less, particularly preferably of 300 nucleotides or less, particularly preferably of 150 nucleotides or less, preferably of 101 nucleotides or less. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double- stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) isBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least oneBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according toBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a proteinBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01(dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) isBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least oneBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule orBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double- stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acidBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 or 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double- stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 or 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 or 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 or 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutantBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 and 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 and 13 and the at least oneBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 and 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 and 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which does not encode any protein.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a plasmid, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double- stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single- stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or aBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single- stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein or, respectively, a dead mutant thereof and / or a nickase mutant thereof, and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the atBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a), which has an amino acid sequence according to SEQ ID NO: 2 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) isBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Acidaminococcus sp. (dAsCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 17, 18, and 19 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double- stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single- stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single- stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 or 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double- stranded RNA molecule.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 or 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single- stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 or 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single- stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) andBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 and 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 and 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) isBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 1 and 13 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a) and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of aBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a double-stranded RNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded DNA molecule. In a preferred embodiment of the method according to the present invention, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]) and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) is a dead mutant of a Cas12a protein (dCas12a) obtained from or isolated from Lachnospiraceae bacterium (dLbCas12a), which has an amino acid sequence according to any of the SEQ ID NOs: 14, 15, and 16 and the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same according to step (c) is a single-stranded RNA molecule. Preferably, in the preferred embodiments described above, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to canola. Preferably, in the preferred embodiments described above, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to oilseed rape. Preferably, in the preferred embodiments described above, the at least one target cell comprising at least one target nucleic acid segment according to step (a) is a plant cell belonging to turnip rape. Preferably, in the preferred embodiments described above, the protein of interest according to step (d) of the method according to the present invention is a regeneration booster or a marker for selection. The person skilled in the art knows typical regenartion boosters andBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01selection markers to be used in the technical field of plant biotechnology, particularly in the field of genome editing of crop plants. Surprisingly, it was found that with a method according to the present invention the efficiency of modifying at least one target nucleic acid could be increased. Surprisingly, it was also found that with a method according to the present invention the efficiency of modifying at least one target nucleic acid could be increased in such a way that a poor efficiency of modifying at least one target nucleic acid could be avoided. Preferably, the term “poor efficiency” as used herein, e.g. in the context of modifying target nucleic acids, describes a modification efficiency of the total number of target nucleic acid sites of a given target nucleic sequence, which is smaller than or equal to 15%, preferably smaller than or equal to 10%, particularly preferably smaller than or equal to 5%. Modification efficiency can for example be determined by means of droplet digital PCR (ddPCR). The term “modification” as used herein, e.g. in the context of modifying target nucleic acid segments, describes (i) deletions of one or more nucleic acid residue(s), which are part of one or more target nucleic acid segment(s) and / or (ii) insertions of one or more nucleic acid residue(s) into one or more target nucleic acid segment(s) and / or (iii) substitutions of one or more nucleic acid residue(s), which are part of one or more target nucleic acid segment(s). Surprisingly, it was also found that with a method according to the present invention the efficiency of modifying at least one target nucleic acid could be increased in a particularly pronounced way when the at least one endonuclease protein is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and / or dead mutant thereof and / or nickase mutant thereof. Moreover, it was surprisingly found that providing at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same in step (c) of the method according to the present invention leads to an increased efficiency of modifying at least one target nucleic acid segment in the at least one target cell. Therefore, providing at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same in step (c) of the method according to the present invention allows for lowering, preferably even minimizing, the amounts used of the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.1) or of the at least one nucleic acid molecule encoding at least one endonuclease proteinBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01and / or dead mutant thereof and / or a nickase mutant thereof according to step (b.2) of the method according to the present invention without negatively affecting, i.e. decreasing, the efficiency of modifying at least one target nucleic acid segment. Advantageously, providing a double-stranded DNA molecule as the at least one carrier nucleic acid molecule leads to an increased efficiency of modifying at least one target nucleic acid segment in the at least one target cell for all tested dosages. The increased efficiency of modifying at least one target nucleic acid segment in the at least one target cell is particularly pronounced in case the at least one carrier nucleic acid molecule provided in step (c) is a plasmid, which encodes at least one protein and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof in step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a). For example, in case the at least one carrier nucleic acid molecule provided in step (c) is a plasmid, which encodes at least one protein and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof in step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a) and the at least one target cell in step (a) is a plant cell isolated or obtained from Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), it was found that the efficiency of modifying at least one target nucleic acid segment in the at least one target cell can show an at least a 3-fold increase or, respectively, an at least a 4-fold increase. Thus, providing double-stranded DNA, preferably a plasmid, as the at least one carrier nucleic acid molecule advantageously allows for using unusually low amounts, preferably even minimized amounts, of the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof in step (b.1) and / or of the at least one nucleic acid molecule encoding at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof in step (b.2) of the method according to the present invention without negatively affecting, preferably even while positively affecting, particularly preferably even while optimizing, the efficiency of modifying at least one target nucleic acid segment in the at least one target cell. Thus, by providing double-stranded DNA, preferably a plasmid, as the at least one carrier nucleic acid molecule in step (c) of the method according to the present invention, the method according to the present invention allows for an optimization of the cost-efficiency of gene editing procedures. Moreover, by providing double-stranded DNA, preferably a plasmid, as the at least one carrier nucleic acid molecule in step (c) of the method according to the present invention,BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01the method according to the present invention allows for an optimization of the procedural economy of gene editing procedures. Furthermore, by providing double-stranded DNA, preferably a plasmid, as the at least one carrier nucleic acid molecule in step (c) of the method according to the present invention, the method according to the present invention allows for an optimization of the sustainability of gene editing procedures. The term “dosage effect” as used herein in the context of efficiency of modifying at least one target nucleic acid segment, describes a correlation between the absolute and / or relative extent or magnitude or intensity of an observed effect and the quantity of the respective nucleic acid modifying tool. In this context, the respective nucleic acid modifying tool refers to the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof or the at least one nucleic acid molecule encoding the same, as defined herein and as provided in step (b.1) or, respectively, (b.2) and introduced in step (e) of the method according to the invention. Furhter, in this context, the observed effect refers to a change in the efficiency of modifying the at least one target nucleic acid segment and / or a phenotypic trait or metabolic impact resulting therefrom. Moreover, in this context, the quantity of the respective nucleic acid modifying tool refers to the amount of the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof or the at least one nucleic acid molecule encoding the same, which is introduced in step (e) of the method according to the invention. For example, the absolute and / or relative extent or magnitude or intensity of an observed effect can be more pronounced the higher the quantity of the respective nucleic acid modifying tool (and vice versa, less pronounced the lower the quantity). Alternatively, the absolute and / or relative extent or magnitude or intensity of an observed effect can be less pronounced the higher the quantity of the respective nucleic acid modifying tool (and vice versa, more pronounced the lower the quantity). Advantageously, providing single-stranded RNA and / or double-stranded RNA as the at least one carrier nucleic acid molecule leads to an increased efficiency of modifying at least one target nucleic acid segment in the at least one target cell with a pronounced dosage effect. In case single-stranded and / or double-stranded RNA is provided as the at least one carrier nucleic acid molecule, at least the relative increase in efficiency, preferably also theBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01absolute increase in efficiency, of modifying at least one target nucleic acid segment in the at least one target cell is more pronounced the lower the quantity, i.e. number of copies or the absolute amount, of a respective target nucleic acid segment in a given target cell. The increased efficiency of modifying at least one target nucleic acid segment in the at least one target cell is particularly pronounced in case the at least one carrier nucleic acid molecule provided in step (c) is a single-stranded RNA and / or double-stranded RNA and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof in step (b.1) is a Cas12a protein, particularly a Cas12a protein obtained from or isolated from either Acidaminococcus sp. (AsCas12a) or Lachnospiraceae bacterium (LbCas12a). For example, in case the at least one carrier nucleic acid molecule provided in step (c) is a single-stranded RNA and / or double-stranded RNA and the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof in step (b.1) is a Cas12a protein, particularly a a Cas12a protein obtained from or isolated from either Acidaminococcus sp. (AsCas12a) or Lachnospiraceae bacterium (LbCas12a), and the at least one target cell in step (a) is a plant cell isolated or obtained from Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), the efficiency of modifying at least one target nucleic acid segment in the at least one target cell can show a 3-fold increase or, respectively, an at least a 4-fold increase. Thus, providing single-stranded RNA and / or double-stranded RNA as the at least one carrier nucleic acid molecule advantageously allows for using unusually low amounts, preferably even minimized amounts, of the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof in step (b.1) and / or of the at least one nucleic acid molecule encoding at least one endonuclease pro-tein and / or dead mutant thereof and / or a nickase mutant thereof in step (b.2) of the method according to the present invention without negatively affecting, preferably even while positively affecting, particularly preferably even while optimizing, the efficiency of modifying at least one target nucleic acid segment in the at least one target cell. Thus, by providing single-stranded RNA and / or double-stranded RNA as the at least one carrier nucleic acid molecule in step (c) of the method according to the present invention, the method according to the present invention allows for an optimization of the cost- efficiency of gene editing procedures. Moreover, by providing single-stranded RNA and / or double-stranded RNA as the at least one carrier nucleic acid molecule in step (c) of the method according to the presentBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01invention, the method according to the present invention allows for an optimization of the procedural economy of gene editing procedures. Furthermore, by providing single-stranded RNA and / or double-stranded RNA as the at least one carrier nucleic acid molecule in step (c) of the method according to the present invention, the method according to the present invention allows for an optimization of the sustainability of gene editing procedures. In one embodiment, the method according to the present invention may further comprise the step of (c.2) providing at least one morphogenic protein or at least one nucleic acid molecule comprising or consisting of at least one morphogenic gene encoding said at least one morphogene, preferably selected from the group consisting of BBM, WUS, including WUS2, a WOX gene, a WUS or BBM homologue, Lec1, Lec2, WIND1, ESR1, PLT3, PLT5, PLT7, IPT, IPT2, Knotted1, RKD4, RolC, RolB, 6B, Tzs, AtSERK1, AtAGL15, GmAGL15, GhAGL15, AtWUS, BnSTM, BoSTM, BrSTM, BnBBM, AtBBM~GR, GmBBM, TcBBM, EgBBM, AtEMK, AtRKD4, AtLEC1, CsL1L, PaHAP3A, AtFUS3, AtLEC2, AtWUS, AtSTM, AtWOX5, ZmKN1, wherein in step (e), the at least one carrier nucleic acid molecule provided in step (c), the at least one morphogenic protein or the at least one nucleic acid molecule comprising or consisting of at least one morphogenic gene encoding said at least one morphogene provided in step (c.2) and the endonuclease provided in step (b) are introduced simultaneously into the target cell, and wherein the target cell is a plant cell. The term “morphogenic gene” as used herein refers to genes coding for morphogenic proteins, which are involved in developmental processes in plants, particularly embryogenesis, somatic embryogenesis meristem formation, meristem maintenance, and hormone metabolism which preferably stimulate growth of transgenic plants, for example due to overexpression, preferably ectopic overexpression. It has been found that when providing at least one morphogenic protein or at least one nucleic acid molecule comprising or consisting of at least one morphogenic gene encoding said at least one morphogene in step (c.2) of the method according to the present invention,BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01the efficiency of regenerating shoots, particularly the efficiency of regenerating shoots developing into fertile plants could be increased. In one embodiment of the method according to the present invention, the at least one carrier nucleic acid molecule may be DNA and / or RNA, wherein said DNA may be linear and / or circular and wherein said RNA may be single stranded, double stranded and / or circular. In one embodiment of the method according to the present invention, said DNA and / or said RNA of the at least one carrier nucleic acid molecule may be not functional in said target cell, and / or may not encode a gene of interest. The term “not functional in said target cell” as used herein in the context of DNA or RNA refers to DNA molecules or RNA molecules, which do not encode one or more gene(s) of interest and / or which do not interfere with the process of modifying at least one target nucleic acid segment according to the method of the present invention and / or which do not interfere with the metabolism of said target cell in an unintended (i.e. undesirable) way. The term “encoding a gene of interest” as used herein preferably refers to genes encoding a protein, which interferes with the target cell’s metabolism. Preferably, interfering with the target cell’s metabolism is understood such that the encoded protein binds to or interacts with a component of the cell’s metabolism, whereas requiring the cell’s resources for producing the protein is not included. For example, a reporter gene encoding e.g. GFP is preferably not encoding a gene of interest. In one embodiment of the method according to the present invention, the carrier nucleic acid molecule may be a super-coiled plasmid DNA. In one embodiment of the method according to the present invention, the carrier nucleic acid molecule may be a super-coiled plasmid DNA, which does not encode any protein. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a super-coiled plasmid DNA, which does not encode any protein and / or does not contain sequences transcribed in the target cell. Preferably, said super-coiled plasmid not encoding any protein has a size in the range of from 100 nucleotides to 50,000 nucleotides, preferably of from 200 nucleotides to 30,000 nucleotides, preferably of from 500 nucleotides to 20,000 nucleotides, especially preferably of from 3,000 nucleotides to 17,500 nucleotides, especially preferably of from 4,000 nucleotides to 17,500 nucleotides, particularly preferably of from 8,000 nucleotides to 17,500 nucleotides, especiallyBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01preferably of from 3,000 nucleotides to 8,000 nucleotides, particularly preferably of from 4,000 nucleotides to 8,000 nucleotides. In one embodiment of the method according to the present invention, the carrier nucleic acid molecule may be a super-coiled plasmid DNA, which encodes at least one protein. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a super-coiled plasmid DNA, which encodes at least one protein. Preferably, said super-coiled plasmid not encoding any protein has a size in the range of from 100 nucleotides to 50,000 nucleotides, preferably of from 200 nucleotides to 30,000 nucleotides, preferably of from 500 nucleotides to 20,000 nucleotides, especially preferably of from 3,000 nucleotides to 17,500 nucleotides, especially preferably of from 4,000 nucleotides to 17,500 nucleotides, particularly preferably of from 8,000 nucleotides to 17,500 nucleotides, especially preferably of from 3,000 nucleotides to 8,000 nucleotides, particularly preferably of from 4,000 nucleotides to 8,000 nucleotides. In one embodiment of the method according to the present invention, the carrier nucleic acid molecule may be a super-coiled plasmid DNA, which encodes more than one protein. In a preferred embodiment of the method according to the present invention, the carrier nucleic acid is a super-coiled plasmid DNA, which encodes more than one protein. Preferably, said super-coiled plasmid not encoding any protein has a size in the range of from 100 nucleotides to 50,000 nucleotides, preferably of from 200 nucleotides to 30,000 nucleotides, preferably of from 500 nucleotides to 20,000 nucleotides, especially preferably of from 3,000 nucleotides to 17,500 nucleotides, especially preferably of from 4,000 nucleotides to 17,500 nucleotides, particularly preferably of from 8,000 nucleotides to 17,500 nucleotides, especially preferably of from 3,000 nucleotides to 8,000 nucleotides, particularly preferably of from 4,000 nucleotides to 8,000 nucleotides. In one embodiment of the method according to the present invention, the carrier nucleic acid molecule may comprise or may consist of one or more nucleic acid sequences selected from the group consisting of SEQ ID NO: 34, SEQ ID NO: 39, and SEQ ID NO: 45 or a nucleic acid molecule sequence having at least 85%, preferably at least 86%, preferably at least 87%, preferably at least 88%, preferably at least 89%, preferably at least 90%, preferably at least 91%, preferably at least 92%, preferably at least 93%, preferably at least 94%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%, preferably at least 99% sequence identity to a sequence according to any of SEQ ID NO: 34, SEQ ID NO: 39, and SEQ ID NO: 45.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In one embodiment of the method according to the present invention, the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof (b.1) may comprise or may consist of a class 2, type V Cas protein, preferably a Cas12 protein, preferably a Cas12a protein, preferably a Cas12a protein selected from the group consisting of AsCas12a and LbCas12a, or, respectively, a dead mutant of any one of the foregoing or, respectively, a nickase mutant thereof. In one embodiment of the method according to the present invention, the CRISPR-Cas ribonucleoprotein (b.1) may comprise an active endonuclease, a nickase or may comprise a dead Cas protein fused to a polypeptide, wherein the obtained fusion construct is suitable for performing base editing, prime editing, and / or suitable for providing a reporting signal. The term “fusion construct suitable for performing base editing, prime editing” is to be understood such that the fusion construct is a base editor, prime editor, evolvR, RNA editor. The term “reporting signal” as used herein refers to characteristics of proteins, which allow for an easy identification of organisms expressing said proteins. Such characteristics include visually identifiable characteristics, such as fluorescence, luminescence and bioluminescence and metabolic, preferably catabolic, enzymatic activities leading to an easily identifiable and / or differentiable coloration of organisms expressing said proteins, e.g. in the presence of certain substrates, such as for example beta-galactosidase activity. Such characteristics further include selectable marker acitivities, such as resistance to antibiotics, for example resistance to chloramphenicol conferred by chloramphenicol acetyltransferase activity. In one embodiment of the method according to the present invention, the at least one endonuclease protein may be a CRISPR-Cas ribonucleoprotein comprising at least one suitable, functional guide RNA, wherein the endonuclease of the ribonucleoprotein may comprise or may consist of one or more amino acid sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, or an amino acid sequence having at least 85%, preferably at least 86%, preferably at least 87%, preferably at least 88%, preferably at least 89%, preferably at least 90%, preferably at least 91%, preferably at least 92%, preferably at least 93%, preferably at least 94%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%,BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01preferably at least 99% sequence identity to a sequence according to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, or SEQ ID NO: 28. In one embodiment of the method according to the present invention, said introduction in step e) may be obtained by one of lipid mediated transfection, calcium phosphate mediated transfection, cationic polymer mediated transfection, DEAE-dextran mediated transfection, polyalkyleneimine-alkoxylene polymer mediated transfection, cell penetrating peptide mediated transfection, magnetofection, electroporation or particle bombardment or Agrobacterium mediated introduction. In one embodiment of the method according to the present invention, said introduction in step e) may be obtained by cationic polymer mediated transfection, preferably by PEG mediated transfection. Advantageously, cationic polymer mediated transfection, preferably PEG mediated transfection, allows for an increased transfection efficiency in case a plasmid, preferably a supercoiled plasmid, is used as the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same in step (c) of the method according to the present invention and / or a single-stranded or a double-stranded RNA molecule s used as the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same in step (c) of the method according to the present invention. Accordingly, employing cationic polymer mediated transfection, preferably PEG mediated transfection, when introducing simultaneously the at least one carrier nucleic acid molecule provided in step (c), the endonuclease and / or the dead mutant thereof and / or the nickase mutant thereof as provided in step (b.1) or the nucleic acid molecule provided in step (b.2), and optionally the protein or nucleic acid provided in (d) into the target cell in step (e) of the method according to the present invention allows for an optimization of the cost-efficiency of gene editing procedures. Moreover, employing cationic polymer mediated transfection, preferably PEG mediated transfection, when introducing simultaneously the at least one carrier nucleic acid molecule provided in step (c), the endonuclease and / or the dead mutant thereof and / or the nickase mutant thereof as provided in step (b.1) or the nucleic acid molecule provided in step (b.2), and optionally the protein or nucleic acid provided in (d) into the target cell in step (e) of theBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01method according to the present invention allows for an optimization of the procedural economy of gene editing procedures. Furthermore, employing cationic polymer mediated transfection, preferably PEG mediated transfection, when introducing simultaneously the at least one carrier nucleic acid molecule provided in step (c), the endonuclease and / or the dead mutant thereof and / or the nickase mutant thereof as provided in step (b.1) or the nucleic acid molecule provided in step (b.2), and optionally the protein or nucleic acid provided in (d) into the target cell in step (e) of the method according to the present invention allows for an optimization of the sustainability of gene editing procedures. In one embodiment of the method according to the present invention, the increased efficiency of modifying of at least one target nucleic acid segment may be expressed as - an increased number of modified target cells for a given amount of endonuclease compared to the control without introduction of the at least one carrier nucleic acid molecule, or - a reduced amount of endonuclease required to obtain a given number of modified target cells compared to the control without introduction of the at least one carrier nucleic acid molecule, or - an increased percentage of plants or plant parts comprising a modified target cell compared to the control without introduction of the at least one carrier nucleic acid molecule. In one embodiment of the method according to the present invention, the increased efficiency of modifying of at least one target nucleic acid segment may furthermore encompass increased efficiency of regeneration of a modified target plant cell into a plant having said modification of at least one target nucleic acid segment compared to the control without introduction of a morphogene. Surprisingly, it was found that the provision of the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same in step (c) of the method according to the present invention not only leads to an increase in the efficiency of modifying at least one target nucleic acid segment in the at least one target cell provided in step (a) of the method according to the present invention, but also to an increase in the overall number of modified target nucleic acid segments in shoots regenerated from said at least one target cell provided in step (a) of the method according to the present invention. Said increase in the overall number of modified target nucleic acid segments in said regenerated shoots wasBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01particularly pronounced in case the at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same in step (c) is an RNA molecule. This advantageous effect of using RNA as carrier nucleic acid is particularly pronounced in combination with using AsCas12a as endonuclease. Surprisingly, it was also found that the overall number of modified target nucleic acid segments in shoots regenerated from said at least one target cell provided in step (a) of the method according to the present invention could be pronouncedly increased in case the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof in step (b.1) is a Cas12a protein obtained from or isolated from Acidaminococcus sp. (AsCas12a). It was also found that said increase in the overall number of modified target nucleic acid segments in said regenerated shoots was particularly pronounced in case the amount of said AsCas12a protein per transfection was at least 2.5 µg. Said increase in the overall number of modified target nucleic acid segments in said regenerated shoots was even more pronounced in case the amount of said AsCas12a protein per transfection was > 5 µg. Said increase in the overall number of modified target nucleic acid segments in said regenerated shoots was even more pronounced in case the amount of said AsCas12a protein per transfection was > 10 µg. This advantageous effect of using AsCas12a is particularly pronounced in combination with using RNA as carrier nucleic acid. Surprisingly, it was also found that the overall number of modified target nucleic acid segments in shoots regenerated from said at least one target cell provided in step (a) of the method according to the present invention could be pronouncedly increased in case the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof in step (b.1) is a Cas12a protein obtained from or isolated from Lachnospiraceae bacterium (LbCas12a). It was also found that said increase in the overall number of modified target nucleic acid segments in said regenerated shoots was particularly pronounced in case the amount of said LbCas12a protein per transfection was at least 0.1 µg. Said increase in the overall number of modified target nucleic acid segments in said regenerated shoots was even more pronounced in case the amount of said LbCas12a protein per transfection was > 0.25 µg. Said increase in the overall number of modified target nucleic acid segments in said regenerated shoots was even more pronounced in case the amount of said LbCas12a protein per transfection was > 0,5 µg. Said increase in the overall number of modified target nucleic acid segments in said regenerated shoots was even more pronounced in case the amount of said LbCas12a protein per transfection was > 1 µg. Said increase in the overall number of modified target nucleic acid segments in said regenerated shoots was even more pronounced in case the amount of said LbCas12a protein per transfection was > 2.5 µg. This advantageous effect of using LbCas12a is particularly pronounced in combination with using RNA as carrier nucleic acid.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01In one embodiment of the method according to the present invention, said CRISPR-Cas RNP may have one or more activities selected from nuclease activity, nickase activity, base editing, prime editing, RNA editing, transcriptional activation or repression, epigenome editing, or CRISPR-Combo activity. Said CRISPR-Cas RNP having base editing function may comprise one or more structural elements individually selected from the group consisting of nuclear localization signals (NLS sequences), adenosine deamination domains, cytosine deamination domains, guanosine deamination domains, thymine deamination domains, uracil deamination domains, linker domains, endonuclease domains. Typical nuclear localization signals as well as typical characteristics of nuclear localization signals, such as the presence of positively charged amino acids like e.g. lysine and arginine are known to the skilled person. Mechanisms of nuclear transport are also known to the skilled person. The skilled person is also aware of typical adenosine deamination domains, cytosine deamination domains, guanosine deamination domains, thymine deamination domains, uracil deamination domains, and linker domains, which are suitable to be part of an RNP having base editing function. In one embodiment of the method according to the present invention, the target cell may be a eukaryotic cell, including an insect cell, a mammalian cell or plant cell. In one embodiment of the method according to the present invention, the target cell may be a plant cell, including a plant protoplast. In one embodiment of the method according to the present invention, the target cell may be a plant cell, including a plant protoplast, originating from a plant selected from the group consisting of Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus,BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tripsacum dactyloides, Triticosecale rimpaui, Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, or Ziziphus spp. In an even further aspect, the present invention relates to a cell, which comprises: (a) at least one ribonucleoprotein comprising or consisting of (i) at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof, preferably wherein the endonuclease is a class 2, type V endonuclease; and (ii) at least one suitable, functional guide RNA; and (b) at least one carrier nucleic acid molecule,BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01wherein the at least one carrier nucleic acid molecule is selected from the group consisting of plasmid DNA, tRNA and dsRNA comprising at least a double stretch having a t-RNA-like or a hairpin-like structure; wherein the cell is a eukaryotic cell, including an insect cell, a mammalian cell or plant cell, including a plant protoplast, particularly preferably wherein the cell is a plant cell, including a plant protoplast; further preferably wherein the cell is a plant cell, including a plant protoplast, originating from a plant selected the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including fodder or forage legumes, ornamental plants, food crops, trees or shrubs; especially preferably wherein the cell is a plant cell, including a plant protoplast, originating from a plant selected from the group consisting of Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Panicum miliaceum,BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tripsacum dactyloides, Triticosecale rimpaui, Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, or Ziziphus spp. In yet another aspect, the present invention also relates to a kit; which may comprise (a) at least one ribonucleoprotein comprising or consisting of (i) at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof, preferably wherein the endonuclease is a class 2, type V endonuclease; and (ii) at least one suitable, functional guide RNA; and (b) at least one carrier nucleic acid molecule, wherein the at least one carrier nucleic acid molecule is selected from the group consisting of plasmid DNA, tRNA and dsRNA comprising at least a double stretch having a t-RNA-like or a hairpin-like structure. In another aspect, the present also relates to a use of (a) at least one ribonucleoprotein comprising or consisting of (i) at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof, preferably wherein the endonuclease is a class 2, type V endonuclease; and (ii) at least one suitable, functional guide RNA; andBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01(b) at least one carrier nucleic acid molecule, wherein the at least one carrier nucleic acid molecule may be selected from the group consisting of plasmid DNA, tRNA and dsRNA comprising at least a double stretch having a t-RNA-like or a hairpin-like structure; for modifying at least one target nucleic acid segment, preferably in a plant cell, wherein the use does not comprise treatment of the human or animal body by surgery or therapy and / or a diagnostic use practised on the human or animal body, and / or processes for modifying the germ line genetic identity of human beings. In one embodiment of the use according to the present invention, the modification of the at least one target nucleic acid segment may include optimizing or modifying a trait in a plant, preferably the optimization or modification of a yield-related trait, or a disease or pathogen resistance related trait, wherein the disease is caused by, or the pathogen is selected from a virus, a bacterium, a fungus, a nematode, or an insect, or a herbicide-resistance related trait, or an abiotic-stress related trait, including a salinity or drought stress related trait, and / or wherein the modification of the at least one target nucleic acid segment may include identifying at least one lead gene. In a further aspect, the present invention also relates to a plant comprising a modified target nucleic acid, generated by a method as described herein. Further aspects and preferred embodiments of the present invention are described below in the form of selected examples.

[0002] BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Examples Example 1: Methods Example 1.1: Oilseed rape protoplast isolation, culture and regeneration Seeds were sterilized for 15 min in a 10% ACROS bleach solution. After thoroughly rinsing with sterile water, seeds were sown in 1L Weckpots on ½ MS medium with 15g / L sucrose and solidified with 6g / L Micro Agar (Duchefa M1002) and incubated at ~22.5°C, 16h photoperiod at 1 to 10 µE m-2s-1. Leaves of 4-7 week-old in vitro grown seedlings were cut into small strips and transferred to a Petri-dish containing 10 mL of medium A consisting of the salts and vitamins of PCBr medium (Dovzhenko, 2001) supplemented with 1g / L MES (2-(N-morpholino)ethanesulfonic acid), 100 mg / L L-Glutamine and 0.4M mannitol (pH 5.8). After cutting, medium A was replaced with enzyme solution, consisting of medium A containing 0.25% Cellulase R10 and 0.25% Macerozyme R10. The dish with the leaf material was incubated overnight in the dark at 25°C on a shaker at 35 rpm. Protoplasts were filtered through a 40µm nylon cell strainer into a 50 mL Falcon tube, diluted with an equal volume of W5 solution (Negrutiu et al.1987) and centrifuged at 80g for 3 min. The pellet was resuspended in W5 solution, and the protoplast yield was determined using a hemacytometer. The protoplast density was adjusted to 2.5 x 105cells / ml in Protoplast Culture Medium (PCM) (Kao and Michayluk, 1975) with hormone combination 1mg / L 2.4- D + 0.1mg / L NAA + 0.1mg / L BAP. Equal volumes of the protoplast suspension and filter- sterilized alginate solution (Dovzhenko et al.,1988) were mixed to prepare alginate layers. The alginate solution consisted of 1.6-2% alginate, 0.4M mannitol, and 1 mM CaCl2 * 2H2O. The alginate layers were prepared according to Kielkowska and Adamus (2012) and cultured in 7 mL PCM and incubated at ~25°C, 16h photoperiod at 1 to 10 µE m-2s-1. Protoplast-derived colonies were picked and transferred to shoot induction medium (Murashige & Skoog, 1962) with a high cytokinin / auxin ratio i.e., 1mg / L BAP + 0.1mg / L NAA or BAP or 3 mg / L BAP + 0.1 mg / L NAA + 0.1 mg / L GA3. Further plant regeneration was as described by De Block et al. (1989). References: Dovzhenko, A., 2001, Towards plastid transformation in rapeseed (Brassica napus L.) and sugarbeet (Beta vulgaris L.). dissertation, Ludwig-Maximilians-University Munich. Negrutiu et al. 1987, Hybrid genes in the analysis of transformation conditions. Plant Molecular Biology volume 8, pages363–373 (1987).BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Kao and Michayluk, 1975, Nutritional requirements for growth of Vicia hajastana cells and protoplasts at a very low population density in liquid media. Planta volume 126, pages105– 110 (1975). Dovzhenko, A., 1998, Thin-alginate-layer technique for protoplast culture of tobacco leaf protoplasts: shoot formation in less than two weeks. Protoplasma (1998) 204: 114-118. Kielkowska and Adamus, 2012, An alginate-layer technique for culture of Brassica oleracea L. protoplasts. In Vitro Cell.Dev.Biol.—Plant (2012) 48:265–273. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15: 473-497. De Block et al., 1989, Transformation of Brassica napus and Brassica oleracea Using Agrobacterium tumefaciens and the Expression of the bar and neo Genes in the Transgenic Plants. Plant Physiol. (1989) 91, 694-701. Example 1.2: Preparation of Cas12a RNP complexes Purified Cas12a nuclease and crRNAs were ordered from IDT (Integrated DNA Technologies) for RNP assembly. - crRNA: custom and user-defined crRNA that binds to 23 bases on the DNA strand that is opposite to the TTTV, PAM sequence. - Lb Cas12a Ultra Nuclease (Alt-RTML.b.Cas12a(Cpf1)Ultra) Recombinant Lachnospiracaea bacterium ND2006 Cas12a nuclease, purified from E. coli strain expressing Cas12a. Contains C-terminal nuclear localization signal (NLS) and C-terminal 6-His tag. - As Cas12a Ultra Nuclease (Alt-RTMA.s.Cas12a(Cpf1)Ultra) Recombinant Acidaminococcus sp. BV3L6 nuclease, purified from an E. coli strain expressing Cas12a. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. For RNP complex assembly, the crRNA is mixed with the Cas12a nuclease in NEBuffer™ 2.1 (New England BioLabs) in an about 1:2 Cas12a:crRNA molar ratio. The mixture is incubated at room temperature for 50-60 min to assemble the RNP complexes. Example 1.3: Transfection of protoplasts After enzymatic digestion, protoplasts were collected by filtering the mixture through 40- μm nylon meshes and resuspended in W5 solution (Negrutiu et al.1987). The resuspended protoplasts were washed with W5 solution, after which the cell pellet was resuspended in MaMg solution (Negrutiu et al. 1987) at a density of 1.25 x 106protoplasts / ml. ForBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01transfection, 200 μl of protoplasts (2.5 x 105) were mixed with the RNP with or without the addition of a carrier nucleic acid molecule and 220 μl of freshly prepared polyethylene glycol solution [40% (w / v) PEG1500, 200 mM mannitol, 100 mM Ca(NO3)24H2O]. The mixture was incubated for 10 min in the dark at RT. After removing the PEG solution, the protoplasts were either resuspended in 2 mL W5, transferred into six-well plates, and incubated in the dark at 28°C for at least 48H to then collect the protoplasts by centrifugation at 12,000 rpm for 1 min at room temperature and to store the pelleted fraction at minus 80°C until further analysis, or the transfected protoplasts were embedded in alginate layers as described by Kielkowska and Adamus (2012) and incubated at ~25°C, 16h photoperiod at 1 to 10 µE m-2s-1(see example 1.1). Example 1.4: ddPCR analysis ddPCR assays were designed using Primer3Plus software with modified settings compatible with the applied master mix. To avoid loss of binding sites, primers and reference probe were designed away from the cut site. PCR primers were designed according to the following guidelines: primer length of 17-24 bases, primer melting temperature of 55 to 60°C with an ideal temperature of 58°C, melting temperatures of the two primers differ by no more than 2°C, primer GC content of 35-65%, amplicon size of 100-250 bases. Two kinds of probes, all located within one amplicon were designed. The first, a reference probe, is labelled with FAM and located away from the mutagenesis site. This probe counts all genomic copies of the target. The second, a so-called drop-off probe, is labelled with HEX and is located where the Cas12a nuclease cuts its target site. Drop- off probes were designed to lose their binding site where one or more base substitutions, insertions or deletions are introduced at the respective Target Site. Table 1 Primers and probes used for the ddPCR drop-off assay to determine editing frequencies at the FAD2 target site. All sequences are given in 5’ to 3’ orientation. Primer / probe type Sequence SEQ ID NO: Forward primer CTGTCGGAGAACTCAAGAA 29 Reverse Primer AGGCGAAGTAGGAGAGA 30 Drop-off probe (HEX) CATCTGGGACATCATCATAGCC 32 Reference probe (FAM) CCACCACTTACTTCCCTCTCCT 31 Example 2: Increasing the efficiency of modifying of at least one target nucleic acid segment in protoplastsBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Example 2.1: Co-delivery of AsCas12a and DNA Protoplasts of Brassica napus were isolated as described herein above (see Example 1.1). An RNP was prepared as described herein above (see Example 1.2) containing AsCas12a as the endonuclease enzyme and a crRNA guiding the AsCas12a nuclease to the FAD2 target sequence according to SEQ ID NO: 33. The protoplasts were transfected as described herein above (see Example 1.3). One group of protoplasts was simultaneously transfected with RNP and a carrier nucleic acid molecule. Another group of protoplasts was transfected only with RNP and without a carrier nucleic acid. The amounts of AsCas12a per transfection were 15 µg, 10 µg, or 5 µg and the carrier nucleic was a plasmid encoding one protein (pPSEGFP according to SEQ ID NO:34). The amount of carrier nucleic acid per transfection was 20µg. The transfected protoplasts were incubated in W5 solution and harvested after 2 days (see Example 1.3) for ddPCR analysis as described above (see Example 1.4). The indel frequency at the target site was analyzed as a means to assess the efficiency of modifying of at least one target nucleic acid segment. For all transfected amounts of RNP, the indel frequency at the target site was significantly higher in case the RNP was co- delivered with carrier nucleic acid, i.e. plasmid DNA (pPSEGFP; see Fig.1). When 15 µg or 10 µg AsCas12a as part of the RNP were transfected, the indel frequency in the respective target sites was approximately 3-fold higher in case the RNP was co-delivered with carrier nucleic acid, i.e. plasmid DNA (pPSEGFP; see Fig.1). In case 5 µg AsCas12a as part of the RNP were transfected, the indel frequency in the respective target sites was approximately 4-fold higher in case the RNP was co-delivered with carrier nucleic acid, i.e. plasmid DNA (pPSEGFP; see Fig.1). Hence, co-delivery of AsCas12a as part of the RNP and the carrier nucleic acid, i.e. the plasmid pPSEGFP, lead to a significant increase in efficiency of modifying of at least one target nucleic acid segment. Moreover, the above-described findings are corroborated when analyzing the cleaving efficiency at four distinct target sites via Next Generation Sequencing (NGS) analysis as a means to assess the efficiency of modifying of at least one target nucleic acid segment. For this analysis, protoplasts of Brassica napus were isolated as described herein above (see Example 1.1). RNPs were prepared as described herein above (see Example 1.2) containing AsCas12a as the endonuclease enzyme and a crRNAs guiding the AsCas12a to a target sequence according to any of the SEQ ID NOs: 35, 36, 37, and 38. The protoplasts were transfected as described herein above (see Example 1.3). One group of protoplasts was simultaneously transfected with RNP and a carrier nucleic acidBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01molecule. Another group of protoplasts was transfected only with RNP and without a carrier nucleic acid. The amounts of AsCas12a per transfection were 10µg and the carrier nucleic acid was a plasmid encoding one protein. (pPSEGFP according to SEQ ID NO: 34). The amount of carrier nucleic acid per transfection was 20µg. The transfected protoplasts were cultured as described above (see Example 1.4) and were harvested three days after transfection for ddPCR analysis. For each of the four target sites, a significant increase in cleavage efficiency was observed in case the RNP was co-delivered with a carrier nucleic acid, i.e. plasmid DNA (pPSEGFP; see Fig.6). For target site TS1, the increase in cleavage efficiency was approximately 2- fold. For target site TS2, the increase in cleavage efficiency was approximately 2.5-fold. For target site TS3, the increase in cleavage efficiency was approximately 3-fold. For target site TS4, the increase in cleavage efficiency was approximately 2.5-fold. Thus, analysis of cleavage efficiency at four distinct target sites also showed that co- delivery of AsCas12a as part of the RNP and the carrier nucleic acid, i.e. the plasmid pPSEGFP, lead to a significant increase in efficiency of modifying of at least one target nucleic acid segment. Example 2.2: Co-delivery of AsCas12a and RNA Protoplasts of Brassica napus were isolated as described herein above (see Example 1.1). An RNP was prepared as described herein above (see Example 1.2) containing AsCas12a as the endonuclease enzyme and a crRNA for guiding the AsCas12a nuclease to the FAD2 target sequence according to SEQ ID NO: 33. The protoplasts were transfected as described herein above (see Example 1.3). One group of protoplasts was simultaneously transfected with RNP and a carrier nucleic acid molecule. Another group of protoplasts was transfected only with RNP and without a carrier nucleic acid (see Fig.2). The amounts of AsCas12a as part of the RNP per transfection were 15 µg, 10 µg, or 5 µg and as carrier nucleic acid RNA was used, i.e.20 µg per transfection of a mixture of tRNAs obtained from wheat germ (Sigma-Aldrich R7876 [10,000 units]). The transfected protoplasts were cultured as described above (see Example 1.4) and were harvested 3 days after transfection for ddPCR analysis. The indel frequency at the target site was analyzed as a means to assess the efficiency of modifying of at least one target nucleic acid segment. For all transfected amounts of RNP, the indel frequency at the target site was significantly higher in case the RNP was co- delivered with carrier nucleic acid (see Fig.2). The lowest increase in indel frequency was observed for the highest amount of transfected RNP (i.e. 15 µg AsCas12a) while theBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01highest increase in indel frequency was observed for the lowest amount of transfected RNP (i.e.5 µg AsCas12a). Hence, co-delivery of AsCas12a as part of the RNP and the carrier nucleic acid, i.e. RNA, lead to a significant increase in efficiency of modifying of at least one target nucleic acid segment. A dosage effect could be observed in case RNA is used as carrier nucleic acid. Moreover, these findings could be corroborated when analyzing the indel frequency in pooled microcolonies derived from protoplasts of Brassica napus, which were transfected with RNP with or without RNA as carrier nucleic acid, wherein the amounts of AsCas12a as part of the RNP per transfection were 10 µg, 5 µg, or 2.5 µg and the amount of carrier nucleic acid was 20 µg (see Fig.3). For this analysis, protoplasts of Brassica napus were isolated as described herein above (see Example 1.1). An RNP was prepared as described herein above (see Example 1.2) containing AsCas12a as the endonuclease enzyme and the crRNA was designed for guiding the AsCas12a nuclease to the FAD2 target sequence according to SEQ ID NO: 33. The protoplasts were transfected as described herein above (see Example 1.3). One group of protoplasts was simultaneously transfected with RNP and a carrier nucleic acid molecule. Another group of protoplasts was transfected only with RNP and without a carrier nucleic acid. The amounts of AsCas12a as part of the RNP per transfection were 10 µg, 5 µg, or 2.5 µg and as carrier nucleic acid RNA was used, i.e.20 µg per transfection of a mixture of tRNAs obtained from wheat germ (Sigma-Aldrich R7876 [10,000 units]). The transfected protoplasts were cultured as described above (see Example 1.4) and pooled microcolonies were harvested 18 days after transfection for ddPCR analysis. The indel frequency at the target site was analyzed as a means to assess the efficiency of modifying of at least one target nucleic acid segment. For all transfected amounts of RNP, the indel frequency at the target site was significantly higher in case the RNP was co- delivered with carrier nucleic acid (see Fig.3). The lowest increase in indel frequency was observed for the highest amount of transfected RNP (i.e. 10 µg AsCas12a) while the highest increase in indel frequency was observed for the lowest amount of transfected RNP (i.e.2.5 µg AsCas12a). Thus, this analysis also shows that co-delivery of AsCas12a as part of the RNP and the carrier nucleic acid, i.e. RNA, leads to a significant increase in efficiency of modifying of at least one target nucleic acid segment in protoplast-derived microspores. Again, a dosage effect could be observed in case RNA is used as carrier nucleic acid.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Example 2.3: Co-delivery of LbCas12a and DNA Protoplasts of Brassica napus were isolated as described herein above (see Example 1.1). An RNP was prepared as described herein above (see Example 1.2) containing LbCas12a as the endonuclease enzyme and the crRNA was designed for guiding the AsCas12a nuclease to the FAD2 target sequence according to SEQ ID NO: 33. The protoplasts were transfected as described herein above (see Example 1.3). One group of protoplasts was simultaneously transfected with RNP and a carrier nucleic acid molecule. Another group of protoplasts was transfected only with RNP and without a carrier nucleic acid (see Fig.4). The amounts of LbCas12a as part of the RNP per transfection were 2.5 µg, 1 µg, 0.5 µg, 0.25 µg, or 0.1 µg and the carrier nucleic was a plasmid encoding one protein. (pDE110 according to SEQ ID NO: 39). The amount of carrier nucleic acid per transfection was 20 µg. The transfected protoplasts were cultured as described above (see Example 1.4). The transfected protoplasts were cultured as described above (see Example 1.4) and pooled microcolonies were harvested 18 days after transfection for ddPCR analysis. The indel frequency at the target site was analyzed as a means to assess the efficiency of modifying of at least one target nucleic acid segment. For all transfected amounts of RNP, the indel frequency at the target site was significantly higher in case the RNP was co- delivered with carrier nucleic acid, i.e. plasmid DNA (pDE110; see Fig.4). In case 2.5 µg, 1 µg, or 0.5 µg LbCas12a as part of the RNP was co-delivered with carrier nucleic acid, the measured indel frequency was close to 100 %. Hence, co-delivery of LbCas12a as part of the RNP and the carrier nucleic acid, i.e. the plasmid pDE110, lead to a significant increase in efficiency of modifying of at least one target nucleic acid segment. These results are supported when analyzing the indel frequency in case an RNP containing LbCas12a as the endonuclease enzyme is co-delivered with either a different plasmid (pBas03172, pBay01792, and pBas04657) or a short single-stranded DNA molecule (ss oligo; 100 bp; SEQ ID NO: 45) or a mixture of tRNAs obtained from wheat germ (Sigma- Aldrich R7876 [10,000 units]) as carrier nucleic acid (see Fig. 5). For this analysis, protoplasts of Brassica napus were isolated as described herein above (see Example 1.1). An RNP was prepared as described herein above (see Example 1.2) containing LbCas12a as the endonuclease enzyme and a crRNA for guiding the AsCas12a nuclease to the FAD2 target sequence according to SEQ ID NO: 33. The protoplasts were transfected as described herein above (see Example 1.3). The amount of LbCas12a as part of the RNP per transfection was 0.25µg. In case plasmids or a mixture of tRNAs were used as carrier nucleic acid, the amount of carrier nucleic acid per transfection was 20 µg. In case a single- stranded DNA molecule (ss oligo) was used as carrier nucleic acid, the amount of carrierBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01nucleic acid per transfection was 50 pmol for the ss oligo. The transfected protoplasts were cultured as described above (and harvested after about 3 weeks for ddPCR analysis. The indel frequency was always significantly higher in case the RNP was co-delivered with a carrier nucleic acid as compared to when the RNP was transfected without a carrier nucleic acid (see Fig.5). The increase in indel frequency was slightly higher in case the carrier nucleic acid was a plasmid or RNA as compared to a single-stranded DNA molecule (ss oligo). However, also using the single-stranded DNA molecule (ss oligo) yielded a significant increase in indel frequency as compared to when the RNP was transfected without a carrier nucleic acid (see Fig.5). Thus, these findings demonstrate that co-delivery of LbCas12a as part of the RNP and the carrier nucleic acid, i.e. a plasmid or RNA or a single-stranded DNA molecule, lead to a significant increase in efficiency of modifying of at least one target nucleic acid segment. Example 2.4: Co-delivery of LbCas12a and RNA Protoplasts of Brassica napus were isolated as described herein above (see Example 1.1). An RNP was prepared as described herein above (see Example 1.2) containing LbCas12a as the endonuclease enzyme and a crRNA guiding the AsCas12a nuclease to the FAD2 target sequence according to SEQ ID NO: 33. The protoplasts were transfected as described herein above (see Example 1.3). One group of protoplasts was simultaneously transfected with RNP and a carrier nucleic acid molecule. Another group of protoplasts was transfected only with RNP and without a carrier nucleic acid (see Fig.7). The amounts of LbCas12a as part of the RNP per transfection were 2.5 µg, 1 µg, 0.5 µg, 0.25 µg, or 0.1 µg and as carrier nucleic acid RNA was used, i.e.20 µg per transfection of a mixture of tRNAs obtained from wheat germ (Sigma-Aldrich R7876 [10,000 units]). The transfected protoplasts were cultured as described above (see Example 1.4) and were harvested 20 days after transfection for ddPCR analysis. The indel frequency at the target site was analyzed as a means to assess the efficiency of modifying of at least one target nucleic acid segment. For all transfected amounts of RNP, the indel frequency at the target site was significantly higher in case the RNP was co- delivered with carrier nucleic acid (see Fig. 7). In case 2.5 µg, or 1 µg, or 0.5 µg of LbCas12a as part of the RNP were transfected and co-delivered with carrier nucleic acid, i.e. RNA, the resulting indel frequency was close to 100 %. In case 0.25 µg or 0.1 µg of LbCas12a as part of the RNP were transfected and co-delivered with carrier nucleic acid, indel frequency could also be significantly increased (approximately 2-fold increase) as compared to transfections of the same amounts of RNP without the co-delivery of carrier nucleic acid (see Fig.7).BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Hence, co-delivery of LbCas12a as part of the RNP and the carrier nucleic acid, i.e. RNA, leads to a significant increase in efficiency of modifying of at least one target nucleic acid segment. Therefore, co-delivery of LbCas12a as part of the RNP and the carrier nucleic acid, i.e. RNA, allows for using unusually low amounts of LbCas12a for gene editing procedures without compromising the efficiency of modifying of at least one target nucleic acid segment. Example 3: Increasing the efficiency of modifying of at least one target nucleic acid segment in shoots Example 3.1: Co-delivery of AsCas12a and RNA Protoplasts of Brassica napus were isolated as described herein above (see Example 1.2). An RNP was prepared as described herein above (see Example 1.2) containing AsCas12a as the endonuclease enzyme and a crRNA guiding the AsCas12a nuclease to the FAD2 target sequence according to SEQ ID NO: 33. The protoplasts were transfected as described herein above (see Example 1.3). The amounts of AsCas12a as part of the RNP per transfection were 10 µg, 5 µg, or 2.5 µg and as carrier nucleic acid RNA was used, i.e. 20 µg per transfection of a mixture of tRNAs obtained from wheat germ (Sigma-Aldrich R7876 [10,000 units]). The transfected protoplasts were cultured as described above (see Example 1.4) and shoots were regenerated from said transfected protoplasts as described above (see Example 1.1). Regenerated shoots were harvested 56 days after the transfection for ddPCR analysis. The indel frequency at the target site was analyzed as a means to assess the efficiency of modifying of at least one target nucleic acid segment. For all transfected amounts of RNP, indel frequency in the shoots was significantly increased in case the RNP was co-delivered with carrier nucleic acid, i.e. RNA (see Fig.8). The highest indel frequency was achieved with the highest amount of transfected RNP (10 µg AsCas12a as part of the RNP) co- delivered with carrier nucleic acid. Accordingly, the lowest indel frequency was obtained with the lowest amount of transfected RNP (2.5 µg AsCas12a as part of the RNP) without co-delivery of carrier nucleic acid (see Fig.8). Hence, co-delivery of AsCas12a as part of the RNP and the carrier nucleic acid, i.e. RNA, leads to a significant increase in efficiency of modifying of at least one target nucleic acid segment in shoots.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Example 3.2: Co-delivery of LbCas12a and RNA Protoplasts of Brassica napus were isolated as described herein above (see Example 1.2). An RNP was prepared as described herein above (see Example 1.2) containing LbCas12a as the endonuclease enzyme and a crRNA guiding the AsCas12a nuclease to the FAD2 target sequence according to SEQ ID NO: 33. The protoplasts were transfected as described herein above (see Example 1.3). The amounts of LbCas12a as part of the RNP per transfection were 2.5 µg, 1 µg, or 0.5 µg or 0.1 µg and as carrier nucleic acid RNA was used, i.e.20 µg per transfection of a mixture of tRNAs obtained from wheat germ (Sigma- Aldrich R7876 [10,000 units]). The transfected protoplasts were cultured as described above (see Example 1.4) and shoots were regenerated from said transfected protoplasts as described above (see Example 1.4). Regenerated shoots were harvested 59 days after the transfection for ddPCR analysis. The indel frequency at the target site was analyzed as a means to assess the efficiency of modifying of at least one target nucleic acid segment. For all transfected amounts of RNP, indel frequency in the shoots was significantly increased in case the RNP was co-delivered with carrier nucleic acid, i.e. RNA (see Fig.9). In case 2,5 µg, 1µg, 0.5 µg or 0.1 µg of LbCas12a as part of the RNP were co-delivered with carrier nucleic acid, the number of shoots with an indel frequency of 100% could be increased as compared to the same amounts of transfected RNP without co-delivery of carrier nucleic acid (see Fig.9). The overall indel frequency could also be increased in case 0.25 µg or 0.1 µg of LbCas12a as part of the RNP were co-delivered with carrier nucleic acid as compared to the same amounts of transfected RNP without co-delivery of carrier nucleic acid (see Fig.9). Hence, co-delivery of LbCas12a as part of the RNP and the carrier nucleic acid, i.e. RNA, leads to a significant increase in efficiency of modifying of at least one target nucleic acid segment in shoots. Moreover, co-delivery of LbCas12a as part of the RNP and the carrier nucleic acid, i.e. RNA, allow for using unusually low amounts of LbCas12a for gene editing procedures without compromising the efficiency of modifying of at least one target nucleic acid segment.

Claims

BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01Claims 1. A method for increasing the efficiency of modifying at least one target nucleic acid segment, comprising (a) providing at least one target cell comprising at least one target nucleic acid segment; and (b.1) providing at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof, wherein the endonuclease is selected from the group consisting of a CRISPR- Cas ribonucleoprotein comprising at least one suitable, functional guide RNA; a meganuclease; a Zn-finger nuclease; a TALEN; or (b.2) providing at least one nucleic acid molecule encoding at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof, wherein the endonuclease is selected from the group consisting of a meganuclease, a Zn-finger nuclease, a TALEN; (c) providing at least one carrier nucleic acid molecule or a nucleic acid molecule encoding the same; (d) optionally providing a Protein of Interest or a nucleic acid encoding a Protein of Interest; (e) introducing simultaneously the at least one carrier nucleic acid molecule provided in step (c), the endonuclease and / or the dead mutant thereof and / or the nicakse mutant thereof as provided in step (b.1) or the nucleic acid molecule provided in step (b.2), and optionally the protein or nucleic acid provided in (d) into the target cell; (f) obtaining at least one cell comprising at least one modified target nucleic acid segment; wherein the method does not comprise treatment of the human or animal body by surgery or therapy and / or a diagnostic method practised on the human or animal body, and / or processes for modifying the germ line genetic identity of human beings.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO012. The method of claim 1, further comprising the step of (c.2) providing at least one morphogenic protein or at least one nucleic acid molecule comprising or consisting of at least one morphogenic gene encoding said at least one morphogene, preferably selected from the group consisting of BBM, WUS, including WUS2, a WOX gene, a WUS or BBM homologue, Lec1, Lec2, WIND1, ESR1, PLT3, PLT5, PLT7, IPT, IPT2, Knotted1, RKD4, RolC, RolB, 6B, Tzs, AtSERK1, AtAGL15, GmAGL15, GhAGL15, AtWUS, BnSTM, BoSTM, BrSTM, BnBBM, AtBBM~GR, GmBBM, TcBBM, EgBBM, AtEMK, AtRKD4, AtLEC1, CsL1L, PaHAP3A, AtFUS3, AtLEC2, AtWUS, AtSTM, AtWOX5, ZmKN1, wherein in step (e), the at least one carrier nucleic acid molecule provided in step (c), the at least one morphogenic protein or the at least one nucleic acid molecule comprising or consisting of at least one morphogenic gene encoding said at least one morphogene provided in step (c.2) and the endonuclease provided in step (b) are introduced simultaneously into the target cell, and wherein the target cell is a plant cell.

3. The method of claim 1 or 2, wherein the at least one carrier nucleic acid molecule is DNA and / or RNA, wherein said DNA is linear and / or circular and wherein said RNA is single stranded, double stranded and / or circular.

4. The method of claims 1 to 3, wherein said DNA and / or and said RNA of the at least one carrier nucleic acid molecule is not functional in said target cell, and / or does not encode a gene of interest.

5. The method of claims 1 to 4, wherein the carrier nucleic acid molecule is a super- coiled plasmid DNA.

6. The method of claims 1 to 5, wherein the carrier nucleic acid molecule comprises or consists of one or more nucleic acid sequences selected from the group consisting of SEQ ID NO: 34, SEQ ID NO:39, and SEQ ID NO: 45 or a nucleic acid molecule sequence having at least 85%, preferably at least 86%, preferably at least 87%, preferably at least 88%, preferably at least 89%, preferably at least 90%, preferably at least 91%, preferably at least 92%, preferably at least 93%, preferably at least 94%, preferably at least 95%, preferably at least 96%, preferably at least 97%,BASF Agricultural Solutions Seed US LLC210986WO01 210986WO01preferably at least 98%, preferably at least 99% sequence identity to a sequence according to SEQ ID NO: 34, SEQ ID NO:39, and SEQ ID NO:

45.

7. The method of claims 1 to 6, wherein the at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof (b.1) comprises or consists of a class 2, type V Cas protein, preferably a Cas12 protein, preferably a Cas12a protein, preferably a Cas12a protein selected from the group consisting of AsCas12a and LbCas12a, or, respectively, a dead mutant of any one of the foregoing or, respectively, a nickase mutant thereof.

8. The method of claims 1 to 7, wherein the CRISPR-Cas ribonucleoprotein (b.1) comprises an active endonuclease, a nickase or comprises a dead Cas protein fused to a polypeptide, wherein the obtained fusion construct is suitable for performing base editing, prime editing, and / or suitable for providing a reporting signal.

9. The method of claims 1 to 7, wherein the at least one endonuclease protein is a CRISPR-Cas ribonucleoprotein comprising at least one suitable, functional guide RNA, wherein the endonuclease of the ribonucleoprotein may comprise or may consist of one or more amino acid sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, or an amino acid sequence having at least 85%, preferably at least 86%, preferably at least 87%, preferably at least 88%, preferably at least 89%, preferably at least 90%, preferably at least 91%, preferably at least 92%, preferably at least 93%, preferably at least 94%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%, preferably at least 99% sequence identity to a sequence according to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, or SEQ ID NO: 28.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO0110. The method of any of claims 1 to 9, wherein said introduction in step e) is obtained by one of lipid mediated transfection, calcium phosphate mediated transfection, cationic polymer mediated transfection, DEAE-dextran mediated transfection, polyalkyleneimine-alkoxylene polymer mediated transfection, cell penetrating peptide mediated transfection, magnetofection, electroporation or particle bombardment or Agrobacterium mediated introduction.

11. The method of claim 10, wherein said introduction in step e) is obtained by cationic polymer mediated transfection, preferably by PEG mediated transfection.

12. The method according to claims 1 and 3 to 10 wherein the increased efficiency of modifying of at least one target nucleic acid segment is expressed as - an increased number of modified target cells for a given amount of endonuclease compared to the control without introduction of the at least one carrier nucleic acid molecule, or - a reduced amount of endonuclease required to obtain a given number of modified target cells compared to the control without introduction of the at least one carrier nucleic acid molecule, or - an increased percentage of plants or plant parts comprising a modified target cell compared to the control without introduction of the at least one carrier nucleic acid molecule.

13. The method according to claims 2 to 11, wherein the increased efficiency of modifying of at least one target nucleic acid segment furthermore encompasses increased efficiency of regeneration of a modified target plant cell into a plant having said modification of at least one target nucleic acid segment compared to the control without introduction of a morphogene.

14. The method according to any of the preceding claims, wherein said CRISPR-Cas RNP has one or more activities selected from nuclease activity, nickase activity, base editing, prime editing, RNA editing, transcriptional activation or repression, epigenome editing, or CRISPR-Combo activity.

15. The method according to any of the preceding claims, wherein the target cell is a eukaryotic cell, including an insect cell, a mammalian cell or plant cell.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO0116. The method according to any of the preceding claims, wherein the target cell is a plant cell, including a plant protoplast.

17. The method according to any of the preceding claims, wherein the target cell is a plant cell, including a plant protoplast, originating from a plant selected from the group consisting of Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, SolanumBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tripsacum dactyloides, Triticosecale rimpaui, Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, or Ziziphus spp.

18. A cell comprising: (a) at least one ribonucleoprotein comprising or consisting of (i) at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof, preferably wherein the endonuclease is a class 2, type V endonuclease; and (ii) at least one suitable, functional guide RNA; and (b) at least one carrier nucleic acid molecule, wherein the at least one carrier nucleic acid molecule is selected from the group consisting of plasmid DNA, tRNA and dsRNA comprising at least a double stretch having a t-RNA-like or a hairpin-like structure; wherein the cell is a eukaryotic cell, including an insect cell, a mammalian cell or plant cell, including a plant protoplast, particularly preferably wherein the cell is a plant cell, including a plant protoplast; further preferably wherein the cell is a plant cell, including a plant protoplast, originating from a plant selected the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including fodder or forage legumes, ornamental plants, food crops, trees or shrubs; especially preferably wherein the cell is a plant cell, including a plant protoplast, originating from a plant selected from the group consisting of Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, AvenaBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tripsacum dactyloides, Triticosecale rimpaui, Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, or Ziziphus spp.BASF Agricultural Solutions Seed US LLC210986WO01 210986WO0119. A kit comprising (a) at least one ribonucleoprotein comprising or consisting of (i) at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof, preferably wherein the endonuclease is a class 2, type V endonuclease; and (ii) at least one suitable, functional guide RNA; and (b) at least one carrier nucleic acid molecule, wherein the at least one carrier nucleic acid molecule is selected from the group consisting of plasmid DNA, tRNA and dsRNA comprising at least a double stretch having a t-RNA-like or a hairpin-like structure.

20. A use of (a) at least one ribonucleoprotein comprising or consisting of (i) at least one endonuclease protein and / or dead mutant thereof and / or a nickase mutant thereof, preferably wherein the endonuclease is a class 2, type V endonuclease; and (ii) at least one suitable, functional guide RNA; and (b) at least one carrier nucleic acid molecule, wherein the at least one carrier nucleic acid molecule is selected from the group consisting of plasmid DNA, tRNA and dsRNA comprising at least a double stretch having a t-RNA-like or a hairpin-like structure; for modifying at least one target nucleic acid segment, preferably in a plant cell, wherein the use does not comprise treatment of the human or animal body by surgery or therapy and / or a diagnostic use practised on the human or animal body, and / or processes for modifying the germ line genetic identity of human beings.

21. The use according to claim 20, wherein the modification of the at least one target nucleic acid segment includes optimizing or modifying a trait in a plant, preferablyBASF Agricultural Solutions Seed US LLC210986WO01 210986WO01the optimization or modification of a yield-related trait, or a disease or pathogen resistance related trait, wherein the disease is caused by, or the pathogen is selected from a virus, a bacterium, a fungus, a nematode, or an insect, or a herbicide- resistance related trait, or an abiotic-stress related trait, including a salinity or drought stress related trait, and / or wherein the modification of the at least one target nucleic acid segment includes identifying at least one lead gene.

22. A plant comprising a modified target nucleic acid, generated by the method of any of claims 1 to 18.

Images