Compositions and methods for modulating sptlc1

Abstract

Aspects of the disclosure relate to compositions and methods for modulating translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject. The disclosure is based, in part, on isolated nucleic acids that bind to mRNA transcripts of genes involved in L-serine biosynthesis, for example serine palmitoyltransferase long chain base subunit 1 (SPTLCiy In some embodiments, compositions of the disclosure are useful for treating diseases or disorders associated with dysregulation of L-serine biosynthesis, such as retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, etc.), neurodegeneration (e.g., Parkinson's Disease, Friedreich's ataxia, motor neuron disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

Description

[0001] COMPOSITIONS AND METHODS FOR MODULATING SPTLC1

[0002] RELATED APPLICATIONS

[0003] The application claims the benefit under 35 U.S.C. 119(e) of U.S. Provisional Application number 63 / 489,247 filed on March 9, 2023, U.S. Provisional Application number 63 / 492,595 filed on March 28, 2023, U.S. Provisional Application number 63 / 507,959 filed on June 13, 2023, U.S. Provisional Application number 63 / 512,292 filed on July 7, 2023, U.S. Provisional Application number 63 / 580,819 filed on September 6, 2023, U.S. Provisional Application number 63 / 588,141 filed on October 5, 2023, U.S. Provisional Application number 63 / 611,369 filed on December 18, 2023, U.S. Provisional Application number 63 / 550,766 filed on February 7, 2024, and U.S. Provisional Application number 63 / 556,381 filed on February 21, 2024, each of which is herein incorporated by reference in its entirety.

[0004] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING The contents of the electronic sequence listing (L090770037WO00-SEQ-KZM.xml;

[0005] Size: 267,715 bytes; and Date of Creation: March 6, 2024) is herein incorporated by reference in its entirety.

[0006] BACKGROUND

[0007] L-serine is important for a number of biological processes in the central nervous system (CNS), for example lipid biosynthesis and production of D-serine. In the CNS, L-serine biosynthesis occurs in astrocytes. Mutations in genes associated with L-serine biosynthesis and lipid (e.g., sphingolipid) biosynthesis have been associated with certain diseases and disorders of the CNS, for example macular telangiectasia type 2 (MacTel2) and Hereditary sensory neuropathy type 1 (HSAN1).

[0008] SUMMARY

[0009] Aspects of the disclosure relate to isolated nucleic acids that bind to mRNA transcripts of genes involved in L-serine biosynthesis, for example serine palmitoyltransferase long chain base subunit 1 (SPTLCi In some embodiments, compositions of the disclosure are useful for treating diseases or disorders associated with dysregulation of L-serine biosynthesis, such as retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., Hereditary Sensory and Autonomic Neuropathy type 1(a), HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s Disease, Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia). The disclosure is based, in part, on compositions and methods for modulating a level, transcription, splicing, and / or translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject.

[0010] Accordingly, in some aspects, the disclosure provides an isolated nucleic acid that comprises a region of complementarity with a human SPTLC1 mRNA transcript, and upon binding to the mRNA transcript decreases a level, transcription, splicing, and / or translation of functional SPTLC1 protein from the mRNA transcript. In some embodiments, the isolated nucleic acid comprises a nucleic acid sequence that is at least 60% (e.g., 60-70%, 70-80%, 80- 90%, 90-95%, 95-99%, or 100%) identical to any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-299.

[0011] In some embodiments, the isolated nucleic acid comprises RNA. In some embodiments, the isolated nucleic acid is an antisense oligonucleotide (ASO).

[0012] In some embodiments, the isolated nucleic acid comprises or consists of between 10 and 40 nucleotides. In some embodiments, the isolated nucleic acid comprises or consists of between 18 and 25 nucleotides.

[0013] In some embodiments, the isolated nucleic acid comprises one or more chemical modifications. In some embodiments, the one or more chemical modifications comprise one or more nucleoside modifications and / or one or more sugar-phosphate backbone modifications. In some embodiments, the one or more nucleoside modifications comprises a 2’-O-methyl (2’- OMe) modification, 2’-fluoro modification, or a locked nucleic acid (LNA) modification. In some embodiments, the one or more sugar-phosphate backbone modifications comprises a phosphorothioate backbone modification. In some embodiments, the isolated nucleic acid is fully chemically modified (e.g., contains a fully modified sugar-phosphate backbone, and all nucleotides of the isolated nucleic acid are chemically modified).

[0014] In some embodiments, the isolated nucleic acid comprises one or more deoxyribonucleotides. In some embodiments, the isolated nucleic acid is a gapmer.

[0015] In some embodiments, the region of complementarity is located in an untranslated region of the SPLTC1 mRNA transcript. In some embodiments, the untranslated region comprises a 5’UTR, intron, or 3’UTR of the SPTLC1 mRNA transcript.

[0016] In some embodiments, the region of complementarity is located in a protein coding region of the SPTLC1 mRNA transcript. In some embodiments, the region of complementarity is located on an intron-exon boundary (e.g., the region of complementarity spans an intron exon boundary, such that the isolated nucleic acid hybridizes binds to both an intron and an exon at the same time) of the SPTLC1 mRNA transcript.

[0017] In some embodiments, the region of complementarity comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 continuous nucleotides of the sequence set forth in SEQ ID NO: 300.

[0018] In some embodiments, the isolated nucleic acid comprises the nucleotide sequence set forth in any one of the nucleotide sequences set forth in Table 1.

[0019] In some aspects, the disclosure provides a method for increasing L-serine biosynthesis in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof.

[0020] In some embodiments, the subject is characterized as having low serine.

[0021] In some embodiments, the subject comprises one or more mutations in a gene that is associated in L-serine biosynthesis. In some embodiments, the gene is SPTLC1.

[0022] In some embodiments, the cell or subject is a human cell or subject.

[0023] In some embodiments, the subject has or is suspected of having a disease or disorder associated with dysregulation of L-serine metabolism. In some embodiments, the disease or disorder is retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s Disease, Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

[0024] In some embodiments, the administration is systemic administration. In some embodiments, the systemic administration comprises intravenous injection.

[0025] In some embodiments, the administration comprises direct administration to a target tissue of the subject. In some embodiments, the direct administration comprises direct injection to the central nervous system (CNS) of the subject. In some embodiments, the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject. In some embodiments, the direct administration comprises direct administration to the eye of the subject (e.g., via intraocular injection, topical injection, etc.). In some embodiments, the administration comprises placing the subject in a Trendelenburg position during the administration.

[0026] In some aspects, the disclosure provides a method for decreasing deoxy-sphingolipid (deoxy-SL) biosynthesis in a cell or subject, the method comprising administering an isolated nucleic acid as described herein, to a subject in need thereof.

[0027] In some embodiments, the subject is characterized as having low serine

[0028] In some embodiments, the subject comprises one or more mutations in a gene that is associated in L-serine biosynthesis. In some embodiments, the gene is SPTLC1.

[0029] In some embodiments, the cell or subject is a human cell or subject.

[0030] In some embodiments, the subject has or is suspected of having a disease or disorder associated with dysregulation of L-serine metabolism. In some embodiments, the disease or disorder is retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s Disease, Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

[0031] In some embodiments, the administration is systemic administration. In some embodiments, the systemic administration comprises intravenous injection.

[0032] In some embodiments, the administration comprises direct administration to a target tissue of the subject. In some embodiments, the direct administration comprises direct injection to the central nervous system (CNS) of the subject. In some embodiments, the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject. In some embodiments, the direct administration comprises direct administration to the eye of the subject (e.g., via intraocular injection, topical injection, etc.).

[0033] In some embodiments, the administration comprises placing the subject in a Trendelenburg position during the administration.

[0034] In some aspects, the disclosure provides a method for preventing or treating a disease or disorder associated with dysregulation of L-serine biosynthesis in a subject in need thereof, the method comprising administering to the subject an isolated nucleic acid as described herein.

[0035] In some embodiments, the subject is a human. In some embodiments, the disease or disorder is retinal diseases (e.g., MacTel2 and Age- related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s Disease, Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

[0036] In some embodiments, the administration comprises direct administration to a target tissue of the subject. In some embodiments, the direct administration comprises direct injection to the central nervous system (CNS) of the subject. In some embodiments, the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject. In some embodiments, the direct administration comprises direct administration to the eye of the subject (e.g., via intraocular injection, topical injection, etc.).

[0037] BRIEF DESCRIPTION OF DRAWINGS

[0038] FIG. 1 shows a schematic depicting modulation of RNA (e.g., mRNA, such as mature mRNA or pre-mRNA) translation by antisense oligonucleotides (ASOs). Composition “A” represents an ASO that binds to the 5' untranslated region (5' UTR) of an RNA. Composition “B” represents an ASO that binds to an intron of an RNA. Composition “C” represents an ASO that binds to a splice boundary (e.g., a splice junction) between an exon and intron of an RNA. Composition “D” represents an ASO that binds to an exon (e.g., protein coding region) of an RNA. Composition “E” represents a combination of an ASO binding to a 3' UTR of an RNA, alone or with a trans-regulator. Composition “F” represents a “gapmer” ASO that binds to an exon (e.g., protein coding region) of an RNA and mediates RNaseH decay. Composition “G” represents a “gapmer” ASO that binds to a 3' UTR of an RNA, alone or with a trans-regulator, and mediates RNaseH decay. In some embodiments, ASOs binding to an RNA result in translation of a truncated protein that has a dominant negative effect on the wild-type, full-length protein.

[0039] FIGs. 2A-2C show representative data regarding expression profiling of human Serine palmitoyltransferase long chain base subunit 1 (SPTLC1). FIG. 2A shows bulk tissue gene expression of human SPTLC1; data indicate SPTLC1 mRNA is ubiquitously expressed. FIG. 2B shows a schematic depicting exons and introns present in the SPTLC1 gene (e.g., NCBI Ref. Seq. NM_006415.4). FIG. 2C shows representative data for exon expression analysis of human SPTLC1 splice variants in CNS tissue.

[0040] FIGs. 3A-3E show representative in vitro data for ASOs targeting SPTLC1 RNA. FIG. 3A shows a diagram of SPTLC1 RNA within which exons are indicated with boxes and introns are indicated with dashed lines. The 216 designed ASOs (grey and dark grey rectangles; Table 1) are indicated based on the location of their target region on SPTLC1 RNA. Twenty -three of the most potent ASOs of each chemistry are colored in dark grey. The region of SPTLC1 amplified in qPCR reactions is represented by rectangle labeled “qPCR Amplicon”. FIG. 3B shows SPTLC1 RNA levels after ASO treatment. Normalized levels of SPTLC1 RNA in U-l 18 MG cells, as measured by RT-qPCR 48 hours after transfection with non-targeting control ASOs (grey), siRNAs targeting SPTLC1 (grey), or ASOs targeting SPTLC1 at both 5 nM and 20 nM doses (chemistry 1 : indicated by set of light and dark shaded bars to the right of water and siRNA controls; chemistry 2: indicated by set of light and dark shaded bars at the far right), are presented. SPTLC1 expression was normalized to HPRT1 expression and presented as a percentage of the non-transfected controls. Means across biological replicates (N=2) are presented; error bars are standard deviation. FIG. 3C shows SPTLC1 RNA down-regulation by select ASOs. Normalized levels of SPTLC1 RNA in U-l 18 MG cells, as measured by RT-qPCR 48 hours after transfection with 20 nM non-targeting control ASO (grey) or the 23 ASOs showing a >50% decrease in SPTLC1 RNA levels at a 20 nM dose (chemistry 1 : indicated by set of light and dark shaded bars to the right of water and siRNA controls; chemistry 2: indicated by set of light and dark shaded bars at the far right) are presented. SPTLC1 expression was normalized to HPRT1 expression and presented as a percentage of the non-transfected controls. Means across biological replicates (N=2) are presented; error bars are standard deviation. FIG. 3D shows representative data from analyses of SPTLC1 RNA down-regulation following administration of select ASOs to U-251 MG cells at the indicated half maximal effective concentrations (EC50). SPTLC1 RNA in U-251 MG cells was measured by RT-qPCR at 48 hours after transfection with the indicated ASOs and normalized to HPRT1 expression. FIG. 3E shows representative results from analyses of U-251 MC cells that were administered select ASOs. The left panel shows levels of SPTLC1 RNA in ASO-treated U-251 MG cells relative to levels of SPTLC1 RNA in negative control-treated U-251 MG cells. The right panel shows levels of HPRT1 RNA in ASO-treated U-251 MG cells relative to levels of HPRT1 RNA in negative control-treated U-251 MG cells. RNA expression levels were measured at 48 hours after transfection with the indicated ASOs at a dose of 40 nM, 20 nM, 10 nM, 5 nM, 2.5 nM, 1.25 nM, 0.625 nM, or 0.3125 nM. In FIGs. 3D-3E, the ASOs shown include: an ASO comprising the nucleotide sequence of SEQ ID NO: 22, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 23 of Table 1; an ASO comprising the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 (alternatively referred to as “SPTLC1 ASO 2” herein); an ASO comprising the nucleotide sequence of SEQ ID NO: 152, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 153 of Table 1; an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein); an ASO comprising the nucleotide sequence of SEQ ID NO: 193, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 194 of Table 1; an ASO comprising the nucleotide sequence of SEQ ID NO: 221, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 222 of Table 1; and an ASO comprising the nucleotide sequence of SEQ ID NO: 254, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 255 of Table 1.

[0041] FIGs. 4A-4D shows high concordance of SPTLC1 knockdown in distinct cell types.

[0042] FIG. 4A shows representative results that were obtained when 61 ASOs targeting SPTLC1 were tested in U-251 MG cells and knockdown was compared with that observed previously in U-l 18 MG cells. U-251 MG cells were reverse transfected with ASOs at either a 5 nM dose or a 20 nM dose (chemistry 1 (skipmer): light and dark shaded circles and triangles, respectively; chemistry 2 (gapmer): light and dark shaded circles and triangles, respectively) and SPTLC1 expression was measured after 48 hours by RT-qPCR. The ASOs targeted sequences of SPTLC1 that are conserved in cynomolgus and / or mouse, or conserved in neither cynomolgus nor mouse, as indicated. The effect of tested ASOs on U-251 MG cells and U-l 18 MG cells was determined to be highly correlated (R = 0.86). FIG. 4B shows representative results that were obtained when an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) or a non-targeting ASO was transfected in COS-7 cells at varying concentrations. At 48 hours after transfection, SPTLC1 mRNA levels were measured by RT-qPCR and are presented as a percentage of vehicle control. Means are presented; error bars are standard deviation for N = 2 biological replicates. X-axis is in LoglO scale. FIG. 4C shows representative results that were obtained when water, a non-targeting ASO, an ASO comprising the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 (alternatively referred to as “SPTLC1 ASO 2” herein), or an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) was transfected in COS-7 cells at varying concentrations (2.5 nM, 5 nM, 10 nM, and 20 nM, shown left to right in the histogram bars above each treatment group). At 48 hours after transfection, SPTLC1 mRNA levels were measured by RT-qPCR and are presented as a percentage of vehicle (water) control. Means are presented; error bars are standard deviation for N = 2 biological replicates. X-axis is in LoglO scale. FIG. 4D shows representative results from treatments of human iPSC derived spinal motor neurons (left panel) and human iPSC derived spinal motor neurons (right panel) with an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) for 5 days via gymnotic delivery. SPTLC1 mRNA levels were measured using RT-qPCR. In human iPSC derived spinal motor neurons (left panel), a concentration-dependent potency with a low micromolar EC50 at 0.8uM was observed. Left graph shows mean + / - SD with x-axis in LoglO scale. N=2 wells. In human iPSC derived spinal motor neurons (right panel), a concentration-dependent potency with a low micromolar EC50 at 0. luM was observed. Right graph shows mean + / - SD with x-axis in LoglO scale. N=3 wells.

[0043] FIGs. 5A-5B show dose response of A7J7 / / ’ / -targeting ASOs in U-251 MG cells. ASOs were administered to U-251 cells in vitro at 8 doses: 40 nM, 20 nM, 10 nM, 5 nM, 2.5 nM, 1.25 nM, 0.625 nM, and 0.3125 nM. U-251 MG cells were treated in 96 well plate format by reverse transfection and SPTLC1 expression was assayed after 48 hours by RT-qPCR. ASO treatments were normalized to control transfected cells. Means across biological replicates (N=2) are presented; error bars are standard deviation. FIG. 5A shows representative expression data from assaying SPTLC1 mRNA levels after 6 distinct ASOs were administered to U-251 MG cells in vitro. The chemistry of assayed ASOs is indicated (chemistry 1 (skipmer): dark grey; chemistry 2 (gapmer): light grey). 0% knockdown and 50% knockdown are indicated by dashed lines (black and grey, respectively). The ASOs shown include: an ASO comprising the nucleotide sequence of SEQ ID NO: 46, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 47 of Table 1; an ASO comprising the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 (alternatively referred to as “SPTLC1 ASO 2” herein); an ASO comprising the nucleotide sequence of SEQ ID NO: 195, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 196 of Table 1; an ASO comprising the nucleotide sequence of SEQ ID NO: 233, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 234 of Table 1; an ASO comprising the nucleotide sequence of SEQ ID NO: 245, a skipmer structure, and the chemical modifications as set forth in Columns A and C of row 246 of Table 1; and an ASO comprising the nucleotide sequence of SEQ ID NO: 248, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 249 of Table 1. FIG. 5B shows representative expression data from assaying SPTLC1 mRNA levels 48 hours after two ASOs (an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein and an ASO comprising the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 (alternatively referred to as “SPTLC1 ASO 2” herein) were administered to U-251 MG cells in vitro. 0% knockdown is indicated by dotted black line, 20% knockdown is indicated by dashed black line, and 50% knockdown is indicated by dotted grey line.

[0044] FIGs. 6A-6D show representative in vitro data for ASOs targeting SPTLC1 RNA in induced pluripotent stem cell (iPSC)-derived neurons. FIG. 6A shows SPTLC1 RNA levels in iPSC-derived neurons after ASO treatment. iPSC-derived neurons were treated with 0 pM ASO (PBS control) or ASOs ranging from 0.3 pM to 10 pM. 50% knockdown of SPTLC1 expression is indicated by the dashed line. FIG. 6B shows HPRT1 RNA levels in iPSC-derived neurons after ASO treatment as in FIG. 6A. Effects of A7J / / / ’ / -targeting ASOs on HPRT1 expression were generally muted up to 1 pM ASO, with the greatest decrease in HPRT1 expression observed at the 10 pM ASO dose. FIG. 6C shows a comparison between SPTLC1 knockdown observed in iPSC-derived neurons treated with 3 pM ASO with that observed in U251-MG cells treated with 20 pM ASO. The effect of each dose on SPTLC1 expression in each respective cell type was determined to be highly correlated (r = 0.73). FIG. 6D shows representative data from analyses of WDR47 and ZFHX3 expression in human iPSC-derived cortical neurons treated with an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein). Means are presented; error bars are standard deviation for N = 3 biological replicates. X-axis is in LoglO scale.

[0045] FIG. 7 shows representative data for SPTLC1 mRNA levels in human iPSC-derived neurons comprising a clinical HSAN1 mutation. “WT” indicates wildtype human iPSCs. “Het KO” indicates human iPSCs heterozygous for SPTLC1 knockout. “Het KI C133W” and “Het KI” indicates human iPSCSs heterozygous for knock-in of an SPTCL1 allele encoding the C133W mutation seen in HSAN1 patients. “ASO 1” indicates treatment with an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein). “Myriocin.” indicates human iPSCs treated with the non-selective SPT inhibitor myriocin. *: p<0.05, **: p<0.01, ***: p<0.001 for Het C133W KI vs. treatment or different SPTLC1 genotype by One-way ANOVA followed by Dunnett test for post hoc comparison.

[0046] FIGs. 8A-8K show representative data for the effect of SPTLC1 ASO 1 which comprises the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 on toxic lipids in iPSC- derived neurons comprising a clinical HSAN1 mutation. FIG. 8A shows a sphingolipid biosynthetic pathway with non-limiting examples of toxic deoxy-sphinoglipids and sphingolipids associated with neurological diseases shown in boxes. FIG. 8B shows increased production of toxic 1 -deoxy sphingoid bases in human iPSCs derived from HSAN1 patients comprising the SPTLC1 C133W mutation. FIG. 8C shows production of 1 -deoxy sphinganine in human iPSC-derived neurons. FIG. 8D shows production of deoxy-sphingosine in human iPSC- derived neurons. FIG. 8E shows production of sphinganine in human iPSC-derived neurons. FIG. 8F shows production of sphingosine in human iPSC-derived neurons. FIG. 8G shows a heatmap representation of the data in FIGs. 8C-8F. “DSBs” indicates deoxysphingoid bases. “DHSph” indicates sphinganine. “Deoxy-DHSph” indicates 1-deoxysphinganine. “Sph” indicates sphingosine. “Deoxy-Sph” indicates 1 -deoxy sphingosine. FIG. 8H shows production of 1 -deoxy ceramide in human iPSC-derived neurons. FIG. 81 shows production of ceramide in human iPSC-derived neurons. FIG. 8J shows a heatmap representation of the data in FIGs. 8H- 81. “Deoxy-Cer” indicates 1 -deoxy ceramide. “Cer” indicates ceramide. For FIGs. 8C-8J, “WT” indicates wildtype human iPSCs. “Het KO” indicates human iPSCs heterozygous for SPTLC1 knockout. “Het KI C133W” and “Het KI” indicates human iPSCSs heterozygous for knock-in of an SPTCL1 allele encoding the C133W mutation seen in HSAN1 patient. “ASO 1” indicates treatment with SPTLC1 ASO1 which comprises the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1. “Lead myr.” indicates human iPSCs treated with the non-selective SPT inhibitor myriocin. FIG. 8K shows representative data indicating modulation of sphingolipid levels by SPTLC1 ASO 1 in human iPSC-derived cortical neurons. Human iPSC derived cortical neurons were treated with SPTLC1 ASO 1 for 5 days via gymnotic delivery. SPTLC1 mRNA levels were examined using RT-qPCR and sphingolipid profiles were analyzed using HPLC-MS / MS and normalized to total protein input. SPTLC1 ASO 1 treatment reduced SPTLC1 expression as well as total ceramide levels. For FIGs. 8C, 8E-8F, and 8H-8I: *: p<0.05, **: p<0.01, ***: p<0.001 for Het C133W KI vs. treatment or different SPTLC1 genotype by One-way ANOVA followed by Dunnett test for post hoc comparison.

[0047] FIGs. 9A-9D show representative data for in vivo reduction of SPTLC1 mRNA levels in mouse brain. FIG. 9A shows relative SPTLC1 mRNA levels in hippocampus tissues of mouse subjects seven days after a series of three weekly ICV injections of vehicle (artificial CSF), 3ug of myriocin, a non-specific ASO at a dose of 200ug (lOOug+lOOug) or 300ug (lOOug+lOOug+lOOug), or an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) or an ASO comprising the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 (alternatively referred to as “SPTLC1 ASO 2” herein) at a dose of 300ug (lOOug+lOOug+lOOug). FIG. 9B shows relative SPTLC1 mRNA levels in cortex tissues of mouse subjects seven days after a series of three weekly ICV injections of vehicle (artificial CSF), 3ug of myriocin, a non-specific ASO at a dose of 200ug (lOOug+lOOug) or 300ug (lOOug+lOOug+lOOug), or SPTLC1 ASO 1 or SPTLC1 ASO 2 at a dose of 300ug (lOOug+lOOug+lOOug). FIG. 9C shows relative SPTLC1 mRNA levels in hippocampus tissues of mouse subjects seven days after a series of three weekly ICV injections through a canula, of vehicle (artificial CSF) or 300ug (lOOug+lOOug+lOOug) of ASO. FIG. 9D shows relative SPTLC1 mRNA levels in cortex tissues of mouse subjects seven days after a series of three weekly ICV injections through a canula, of vehicle (artificial CSF) or 300ug (lOOug+lOOug+lOOug) of ASO. “SPTLC1 ASO 1” comprises the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 . “SPTLC1 ASO 2” comprises the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1.

[0048] FIGs. 10A-10B shows SPTLC1 ASO 1 pharmacokinetics (ASO levels) in cortex and hippocampus tissue samples obtained from injected mouse subjects. FIG. 10A shows SPTLC1 ASO 1 pharmacokinetics in cortex tissue samples obtained from injected mouse subjects that received a single intracerebroventricular (ICV) injection of either a control agent (“vehicle”, artificial CSF; a lOpg dose of a non-specific ASO; or a lOpg dose of SPTLC1 ASO 2) or a lOpg dose of SPTLC1 ASO 1. SPTLC1 ASO 1 levels were measured in cortex tissue samples collected from mouse subjects two weeks after injection, “ipsi cortex” refers to SPTLC1 ASO 1 measurements in tissue samples harvested from the same side (ipsilateral) of the cortex where ICV injection was performed. “Non-specific ASOs” indicates ASOs that do not target SPTLC1 mRNA. “All Non-specific ASOs” indicates the sum of all SPTLC1 ASO 1 measurements in samples obtained from subjects that underwent ICV injection with non-specific ASOs (x-axis). FIG. 10B shows SPTLC1 ASO 1 pharmacokinetics in cortex and hippocampus tissue samples obtained from injected mouse subjects that received a single intracerebroventricular (ICV) injection of either a control agent (vehicle) or a 300pg dose (three lOOpg injections administered 7 days apart) of SPTLC1 ASO 1. SPTLC1 ASO 1 levels were measured in cortex tissue samples collected from mouse subjects one week after injection. For both FIGs. 10A-10B, “SPTLC1 ASO 1” comprises the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1. “SPTLC1 ASO 2” comprises the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1. “Vehicle” refers to artificial CSF (aCSF). “pg / g” refers to micrograms of SPTLC1 ASO 1 per gram of tissue sample. Each dot on the graph represents a respective mouse subject. Bars indicate mean + / - standard deviation.

[0049] FIGs. 11A-11M show representative data for SPTLC1 ASO 1 pharmacokinetics (ASO levels), pharmacodynamics (SPTLC1 mRNA expression), and toxic sphingolipid levels in tissue samples obtained from injected non-human primate subjects. “SPTLC1 ASO 1” comprises the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1. For FIGs. 1 IB- 11 J, each dot on the graph represents a respective non-human primate subject. For FIGs. 1 ID-1 IK, “Assay 1” refers to samples analyzed with a RT-qPCR probe which binds SPTLC1 mRNA at a sequence located close to the SPTLC1 ASO 1 binding site and “Assay 2” refers to samples analyzed with a RT- qPCR probe which non-discriminately binds to all SPTLC1 mRNA isoforms including an alternative shorter transcript which lacks a domain critical for SPTLC1 activity and is not targeted by SPTLC1 ASO 1. FIG. 11A shows a non-limiting example of a study design wherein non-human primate subjects were administered a series of two intrathecal (IT) injections performed on days 1 and 14 of either vehicle (artificial CSF) or SPTLC1 ASO 1 at a dose of 40mg (20mg+20mg). N=2-3 non-human primate animal subjects. FIG. 11B shows SPTLC1 ASO 1 levels in frontal cortex (“Cortex”), hippocampus, and lumbar spinal cord tissue samples obtained from injected non-human primate subjects that underwent administration according to FIG. 11 A. Boxed values above each bar indicate the mean SPTLC1 ASO 1 concentration rounded to the nearest whole number in each tissue, “pg / g” refers to micrograms of SPTLC1 ASO 1 per gram of tissue sample. “Mean (pg / g)” refers to the mean micrograms of SPTLC1 ASO 1 per gram of tissue sample. Bars indicate mean + / - standard deviation. FIG. 11C shows SPTLC1 ASO 1 levels in frontal cortex, hippocampus, and lumbar spinal cord tissue samples obtained from injected non-human primate subjects that underwent administration according to FIG. 11 A. “Mean (pg / g)” refers to the mean micrograms of SPTLC1 ASO 1 per gram of tissue sample. Bars indicate mean + / - standard error of the mean. FIG. 11D shows RT-qPCR analysis data for SPTLC1 mRNA expression in frontal cortex tissue samples obtained from injected non- human primate subjects that underwent administration according to FIG. 11 A. *:p<0.05 for treatment vs. vehicle by unpaired T-test. Bars indicate mean + / - standard deviation. FIG. HE shows RT-qPCR analysis data which was obtained using two different SPTLC1 probes (dark and light shaded bars corresponding to Assay 2 and Assay 1 in FIG. 1 ID, respectively) measuring SPTLC1 mRNA expression in frontal cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF), a non-specific ASO at a dose of 20mg (lOmg + lOmg) or 40mg (20mg + 20mg), or SPTLC1 ASO 1 at a dose of 40mg (20mg + 20mg) according to FIG. 11 A. SPTLC1 mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean + / - standard deviation. FIG. HF shows a comparison of the data in FIG. 1 IE obtained by RT-qPCR analysis of SPTLC1 mRNA expression in frontal cortex tissue of non-human primate subjects that underwent administration according to FIG. 11 A. SPTLC1 mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. *:p<0.05 for treatment vs. vehicle by unpaired T-test. Bars indicate mean + / - standard of the mean. FIG. 11G shows RT- qPCR analysis data which was obtained using two different SPTLC1 probes (dark and light shaded bars corresponding to Assay 2 and Assay 1, respectively) measuring SPTLC1 mRNA expression in sensory cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF), a non-specific ASO at a dose of 20mg (lOmg + lOmg) or 40mg (20mg + 20mg), or SPTLC1 ASO 1 at a dose of 40mg (20mg + 20mg) according to FIG. 11 A. SPTLC1 mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean + / - standard deviation. N = 2-3 per group. FIG. 11H shows statistical analyses of the RT-qPCR data shown in FIG. 11G. Bars indicate mean + / - standard deviation; N = 2-3 per group. Treatment vs. Vehicle compared with ANOVA. **: p < 0.01 FIG. HI shows a comparison of the data in FIG. 11G obtained by RT- qPCR analysis of SPTLC1 mRNA expression in sensory cortex tissue of non-human primate subjects that underwent administration according to FIG. 11 A. SPTLC1 mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. *:p<0.05 for treatment vs. vehicle by unpaired T-test. Bars indicate mean + / - standard deviation. FIG. 11 J shows a comparison of the data in FIG. 1 II obtained by RT-qPCR analysis of SPTLC1 mRNA expression in sensory cortex tissue of non-human primate subjects that underwent administration according to FIG. 11 A. SPTLC1 mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. *:p<0.05 for treatment vs. vehicle by unpaired T-test. Bars indicate mean + / - standard error of the mean. FIG. HK shows a comparison of SPTLC1 ASO 1 pharmacodynamics in frontal cortex (left panel) and sensory cortex (right panel) tissue samples. RT-qPCR analyses were performed using Assay 1. *:p<0.05 for treatment vs. vehicle by unpaired T-test. Bars indicate mean + / - standard error of the mean. FIG. HL shows a table representation of the data shown in FIGs. 1 ID-1 IK. Mean knockdown levels are shown as the percent difference from the vehicle group. Mean knockdown levels were analyzed over a 95% confidence interval (“CI”) (lower and upper limits shown in brackets). P-values associated with the mean knockdown levels as determined from confidence interval analysis are shown in scientific notation. The “IDT” probe and the “Thermo” probe corresponds to the dark (Assay 2) and light (Assay 1) shaded bars, respectively, in FIGs. 1 ID, 1 IE, and 11G. FIG. 11M shows liquid chromatography-tandem mass spectrometry analyses of toxic sphingolipid levels in lumbar spinal cord samples obtained from non-human primate subjects that received IT injections of control or SPTLC1 ASO 1 at a dose of 40 mg (20 mg+20 mg). Each dot represents an animal. Bars show mean + / - standard error of the mean. N = 3 per group. *: p<0.05 for Treatment vs. Vehicle by unpaired t-test.

[0050] FIG. 12 shows a schematic depicting SPTCL1 ASO 1 which comprises the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 targeting of the 3’ untranslated region (UTR) present in the SPTLC1 transcript encoding the full-length canonical isoform of SPTLC1. A shorter transcript encoding a minor isoform of SPTLC1 lacks the sequence targeted by SPTLC1 ASO 1. The shorter isoform also lacks the catalytic domain critical for SPTLC1 activity while retaining the SPTLC1 inhibitory and dimerization domain. Also shown is the SPTLC1 transcript regions detected by the RT-qPCR probes used in Assay 1 and Assay 2 (see, e.g., FIGs. 1 ID-1 IK).

[0051] FIGs. 13A-13J show representative immunostimulatory effects of SPTLC1 ASOs on human peripheral blood mononuclear cells (huPBMCs) that were harvested from healthy donors. huPBMCs were either untreated (“mock” and “media”), treated with a cytokine / chemokine response control agent (XD-01024, CL097, R837, ODN2216, ODN2006, ODN2395, TL8-506, poly(l:c), or XD-00366), or treated with an SPTLC1 ASO at a concentration of IpM, 3pM, or lOpM for 24 hours (indicated on x-axes). Cytokine / chemokine levels were then analyzed using the MSD-U-Plex platform (indicated by y-axes). “SPTLC1 ASO 1 comprises the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (right side panels). “SPTLC1 ASO 2” comprises the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 (left side panels). Plots show mean + / - standard error. Each dot represents an individual donor. N=4 donors (2 male and 2 female). FIG. 13A shows analyses of IFN-a2a levels. FIG. 13B shows analyses of IFN-b levels. FIG. 13C shows analyses of IL- IB levels. FIG. 13D shows analyses of IL-6 levels. FIG. 13E shows analyses of IL-10 levels. FIG. 13F shows analyses of IP-10 levels. FIG. 13G shows analyses of MCP-1 levels. FIG. 13H shows analyses of MIP-la levels. FIG. 131 shows analyses of MIP-lb levels. FIG. 13J shows analyses of TNF-a levels.

[0052] FIG. 14 shows a non-limiting example of a study design wherein non-human primate subjects were administered a series of four intrathecal injections of either vehicle (artificial CSF) or ASO at a dose of 95 mg (30 mg + 25 mg + 20 mg + 20 mg). Each intrathecal injection was performed two weeks apart (days 0, 14, 28 and 42).

[0053] FIG. 15 show representative data from analyses of pharmacokinetics (ASO levels), pharmacodynamics (SPTLC1 mRNA expression), and toxic sphingolipid levels in tissue samples obtained from injected non-human primate subjects that received a series of four intrathecal (IT) injections of SPTLC1 ASO 1 which comprises the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1. Non-human primate subjects received SPTLC1 ASO 1 at a dose of 95 mg (30 mg + 25 mg + 20 mg + 20 mg) by intrathecal injection as illustrated in FIG. 14. The indicated samples were obtained at two weeks post-final injection of ASO (day 56). FIG. 15A shows ASO levels in prefrontal cortex, hippocampus, and lumbar spinal cord samples obtained from injected non- human primate subjects and assessed by liquid chromatography -tandem mass spectrometry (LC- MS / MS). Each dot represents a sample from obtained from a different non-human primate subject. N = 3 for each of the indicated groups of samples. Bars show mean + / - standard error of the mean. FIG. 15B shows ASO levels in dorsal root ganglion (DRG), hippocampus, lumbar spinal cord, motor cortex, prefrontal cortex, and temporal cortex samples obtained from injected non-human primate subjects and assessed by LC-MS / MS. Each dot represents a sample from obtained from a different non-human primate subject. N = 2-3 for each of the indicated groups of samples. Bars show mean + / - standard error of the mean. FIG. 15C shows RT-qPCR analysis data for SPTLC1 mRNA expression in prefrontal cortex tissue samples obtained from injected non-human primate subjects. Bars show mean + / - standard error of the mean. FIG. 15D shows liquid chromatography-tandem mass spectrometry analyses of toxic sphingolipid levels in cerebral spinal fluid (CSF) samples obtained from non-human primate subjects. Bars show mean + / - standard error of the mean. N = 3 per group. **: p<0.01 by ANOVA for SPTLC1 ASO 1 vs. Vehicle at day 56. (+): p<0.1 by paired t-test for day 56 vs baseline in SPTLC1 ASO 1-treated animals.

[0054] DETAILED DESCRIPTION

[0055] Aspects of the disclosure relate to compositions and methods for modulating a level, transcription, splicing, and / or translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject. The disclosure is based, in part, on isolated nucleic acids that bind to mRNA transcripts of genes involved in L-serine biosynthesis or lipid (e.g., sphingolipid) biosynthesis, for example serine palmitoyltransferase long chain base subunit 1 (SPTLC1). In some embodiments, compositions of the disclosure are useful for treating diseases or disorders associated with dysregulation of L-serine biosynthesis or lipid (e.g., sphingolipid) biosynthesis, such as retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s Disease, Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

[0056] L-serine and lipid biosynthesis

[0057] Serine is a non-essential amino acid important for a variety of biochemical processes. In some instances, canonical roles of serine relate to its function in metabolism. In some instances, serine is important for the biosynthesis of proteins, the amino acids glycine and cysteine, and purines and pyrimidines. Once incorporated into proteins, the side chain chemistry of serine can fulfill different roles including, but not limited to, serving as a nucleophile during protease cleavage, serving as a site for phosphorylation by protein kinases, and as an acceptor residue for ( -linked protein glycosylation.

[0058] In the mammalian central nervous system (CNS), L-serine is used in the production of lipids, such as sphingolipids, which are involved in signaling functions at the cell membrane of brain cells. Production of sphingolipids in the brain from serine typically occurs in astrocytes. In some instances, dietary L-serine can be used directly by cells for sphingolipid synthesis. In other instances, serine is synthesized from glucose. Biosynthesis of L-serine involves several enzymatic steps including, for example, conversion of 3 -phosphoglycerate derived from glucose into 3-phosphohydroxypyruvate by the enzyme phosphoglycerate dehydrogenase (PHGDH). Ultimately, 3 -phosphoglycerate is used as a substrate for a series of enzymatic reactions to produce L-serine.

[0059] Exogenous dietary and serine derived from glucose are used in the production of sphingolipids by condensation of L-serine with palmitoyl-CoA by the enzyme serine palmitoyl transferase (SPT). One subunit of SPT is provided by the SPTLC1 gene in humans which fulfills autoregulatory roles in the enzymatic activity of SPT. Autosomal dominant mutations in SPTLC1 result in atypical production of sphingolipids and are implicated in hereditary sensory neuropathy (HSAN1 and HSANl(a)) resulting from condensation of palmitoyl-CoA with alanine to form cytotoxic deoxysphingolipids. HSAN1 results in a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy- induced neuropathy or other forms of toxic peripheral neuropathy, etc.) manifesting as, in some instances, severe loss of sensation to temperature, pressure and pain. In some instances, longterm cases of HSAN1 leads to painless injuries, chronic skin ulcers, bone destruction, bone infections, amputation of digits, and motor dysfunction.

[0060] Aspects of the disclosure relate to the inventors’ recognition that certain nucleic acid molecules, for example isolated nucleic acids, such as RNA processing modulators (e.g., antisense oligonucleotides), can be used to tune transcription and / or translation of certain mRNA encoded by genes associated with L-serine biosynthesis.

[0061] A “gene associated with L-serine biosynthesis” refers to a gene encoding a gene product (e.g., an mRNA, protein, etc.) that is genetically, biochemically, or functionally associated with production of L-serine in a cell or subject. A “gene associated with lipid biosynthesis” refers to a gene encoding a gene product (e.g., an mRNA, protein, etc.) that is genetically, biochemically, or functionally associated with production of lipids in a cell or subject. In some embodiments, a gene associated with lipid biosynthesis is serine palmitoyltransferase long chain base subunit 1 (SPTLCP). In some embodiments, the lipid biosynthesis is sphingolipid biosynthesis or deoxysphingolipid (d-SL) biosynthesis.

[0062] In some embodiments, a gene associated with lipid biosynthesis encodes an mRNA encoding a subunit of an SPT protein, for example serine palmitoyltransferase long chain base subunit 1 (SPTLC1). In humans, SPTLC1 is encoded by the SPTLC1 gene, located on chromosome 9 (e.g., encoded by Ensembl ID NO: ENSG00000090054, Chromosome 9: 92,000,087-92,115,413 reverse strand). In some embodiments, SPTCL1 encodes a peptide that is represented by NCBI Reference Sequence NP 006406.1. In some embodiments, an SPTLC1 gene encodes an mRNA comprising the sequence set forth in NCBI Reference Sequence NM_006415.4. In some embodiments, an mRNA is encoded by an SPTLC1 gene comprising the sequence set forth below:

[0063] NM_006415,4

[0064] GGGACGCGCTTGTGACCCGCCTTCCGGAAGGAAGCGGCTAACTATGGCGACCGCCACGGAGCAGTGGGTTCTGGTGG AGATGGTACAGGCGCTTTACGAGGCTCCTGCTTACCATCTTATTTTGGAAGGGATTCTGATCCTCTGGATAATCAGA CTTCTTTTCTCTAAGACTTACAAATTACAAGAACGATCTGATCTTACAGTCAAGGAAAAAGAAGAACTGATTGAAGA GTGGCAACCAGAACCTCTTGTTCCTCCTGTCCCAAAAGACCATCCTGCTCTCAACTACAACATCGTTTCAGGCCCTC CAAGCCACAAAACTGTGGTGAATGGAAAAGAATGTATAAACTTCGCCTCATTTAATTTTCTTGGATTGTTGGATAAC CCTAGGGTTAAGGCAGCAGCTTTAGCATCTCTAAAGAAGTATGGCGTGGGGACTTGTGGACCCAGAGGATTTTATGG CACATTTGATGTTCATTTGGATTTGGAAGACCGCCTGGCAAAATTTATGAAGACAGAAGAAGCCATTATATACTCAT ATGGATTTGCCACCATAGCCAGTGCTATTCCTGCTTACTCTAAAAGAGGGGACATTGTTTTTGTAGATAGAGCTGCC TGCTTTGCTATTCAGAAAGGATTACAGGCATCCCGTAGTGACATTAAGTTATTTAAGCATAATGACATGGCTGACCT CGAGCGACTACTAAAAGAACAAGAGATCGAAGATCAAAAGAATCCTCGCAAGGCTCGTGTAACTCGGCGTTTCATTG TAGTAGAAGGATTGTATATGAATACTGGAACTATTTGTCCTCTTCCAGAATTGGTTAAGTTAAAATACAAATACAAA GCAAGAATCTTCCTGGAGGAAAGCCTTTCATTTGGAGTCCTAGGAGAGCATGGCCGAGGAGTCACTGAACACTATGG AATCAATATTGATGATATTGATCTTATCAGTGCCAACATGGAGAATGCACTTGCTTCTATTGGAGGTTTCTGCTGTG GCAGGTCTTTTGTAATTGACCATCAGCGACTTTCCGGCCAGGGATACTGCTTTTCAGCTTCGTTACCTCCCCTGTTA GCTGCTGCAGCAATTGAGGCCCTCAACATCATGGAAGAGAATCCAGGTATTTTTGCAGTGTTGAAGGAAAAGTGCGG ACAAATTCATAAAGCTTTACAAGGCATTTCTGGATTAAAAGTGGTGGGGGAGTCCCTTTCTCCAGCCTTTCACCTAC AACT GGAAGAGAGCACT GGGT CT CGCGAGCAAGAT GT CAGACT GCTT CAGGAAATT GTAGAT CAAT GCAT GAACAGA AGTATTGCATTAACTCAGGCGCGCTACTTGGAGAAAGAAGAGAAGTGTCTCCCTCCTCCCAGCATTCGGGTTGTGGT CACGGTGGAACAAACAGAGGAAGAACTGGAGAGAGCTGCGTCCACCATCAAGGAGGTAGCCCAGGCCGTCCTGCTCT AGGCAGAGTCCCGGGACCATGGCCTCCTGCCACACAACACGCAGAGAGGACTCAAGACTCCCGCTGGCCATGGAGTG GCCTGAAAGAGAGCAAGAACATGTGGATCTTTGATAGGATTGTTACCAAATGGTGTCAGTATGGACCAATTGTGTGA CCATGAGAAGGATGCTTATTTTTTTTAAAAAGAAAACACATCTAAAAGCCCAGGAACTGATTTTTTTAAGAGGAAAA CTAATGACAGTGTATAACTGATGTTTAAATTGTGCATTTAGTACTATTTAAATGTTTTCTTATACTAGTATTTTATA TTCTTTTGTTGTCGTTTAAAACTGGAGCTTCAGTGTCTCTTCCCTCCCTCTAATAGTAATGGTTCAGTAAGCACTCC TTAACTCCTTAGTATTTCATAGAAAAATGACTGCAACATTAAAGCTAAGAGGAACACTTCAACATATGTGGTACAAA TTTATATTGAAGATCTAAATAAACCACGTATTTTCCAGTCTTCGTTGTGTGAAGCTAAATGGTGGCTAAAAGGAACA CTTTTTGTGTGATTATTATAAACTTTGCATTGTATTTGAATCTTAGAACTTTTGTACACACTAAATATTGATGTCAC ACCATTTCTAATCTGAGCATCCTTAGCCAGAGAATATTCATTATACTTCCTAAGTGAGCAATAATTTAAATCAGAAG CTATTTTATTTTAATGTAATTAACCTTTCTTTACATTTCTTATGTGTTCACCTCTAATCTGTTTTAGGAAGAGAGTT GGTTATTATGTT GAT C C C AT AAT AT AAAT CAT AT CCTTTATATTT T AGAAT AT C T C AAAT GTATTCCTTTTTTGTAT GGTGGGTTTGCCTAGGGACGTGTAACTACAGGCTTTTACTAAGCCAAGGAAAAAGAGAATTTTTCTTTTCATCTTAC AAATTCCAGATATCTACAAAAGATGTGAAAGCACTAAAAATACCATTTTTAAGCAGTACTTTACCTGTTTTTTCTTT AGCAAACCAGGTTATGTGGTGTAAAGGTTTGTTATACGTGCCACAATATAGCATATAAATATTATGCCATCATTCCT TCTCTTGTTAAAGGTAGAAGAATAAAATTGTGATTTTTATAACCTGTGCTTATTACTCAAATGGTCTTCAACATCTT TTTAAACAACACATACTTTTTGAATGTTCAGTTTCTATTTTGCTTGAGGTATTTTGTACATATGTGCCTTGTGATTG CTGCTGCTTTAAAGGATAAAGTACTCTTTGGGGGATGAGTCTGGTTTGTTTTGTTTTATTTTTTAATGAAATAAACC

[0065] TATATTCCTGA ( SEQ ID NO : 300 )

[0066] The skilled artisan recognizes that when referring to a gene sequence encoding an mRNA, the sequence of the mRNA is identical to the recited gene sequence, except that each instance of “T” is replaced with “U”.

[0067] In some embodiments, an SPTLC1 gene (or an mRNA encoded by an SPTLC1 gene) comprises one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions relative to a wild type SPTLC1 gene (or mRNA encoded by a wild type SPTLC1 gene), and may be referred to as a “mutant” SPTLC1 gene or an SPTLC1 variant. The number of nucleotide substitutions, nucleotide insertions, and / or nucleotide deletions in a PHGDH or SPTLC1 variant may vary. In some embodiments, an SPTLC1 variant comprises between 1 and 20, 5 and 10, 2 and 15, 10 and 30, or 20 and 100 nucleotide substitutions, nucleotide insertions, and / or nucleotide deletions relative to a wild type SPTLC1 gene (or mRNA encoded by a wild type SPTLC1 gene). In some embodiments, the one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions results in an amino acid substitution in the protein encoded by the SPTLC1 variant. In some embodiments, the one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions results in a nonsense mutation (e.g., insertion of a premature stop codon) in an mRNA encoded by the SPTLC1 variant. In some embodiments, an SPTLC1 variant protein forms a part of a SPT protein complex that prefers alanine over serine for production of 3-keto-sphingamine.

[0068] In some embodiments, the one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions results in a frameshift mutation of the SPTLC1 variant relative to a wild type SPTLC1 gene. In some embodiments, a mutation or mutations present in an SPTLC1 variant result in the production of one or more splice variants of SPTLC1 mRNA. A “splice variant” may refer to a mRNA resulting from one or more mutations in a DNA sequence that occur at the boundary of an exon and an intron (splice site) of a gene. Splice site mutations generally disrupt RNA splicing and result in the loss of exons or the inclusion of introns and an altered protein-coding sequence (e.g., a “splice variant”).

[0069] Aspects of the disclosure relate to isolated nucleic acids, for example RNA processing modulators (e.g., ASOs) that bind to one or more target regions of an mRNA encoded by a gene associated with L-serine biosynthesis. In some embodiments, the isolated nucleic acids bind to more or more splice variants of an SPTLC1 gene (e.g., a human SPTLC1 splice variant). In some embodiments, an isolated nucleic acid described by the disclosure binds to a region of an SPTLC1 splice variant (e.g., mRNA encoded by an SPTLC1 variant) selected from an untranslated region (UTR). In some embodiments, the UTR is a 5' UTR. In some embodiments, the UTR is a 3' UTR. In some embodiments, the UTR is an intron. In some embodiments, an isolated nucleic acid described by the disclosure binds to an intron-exon boundary of an SPTLC1 splice variant (e.g., mRNA encoded by an SPTLC1 variant). An intron-exon boundary refers to a contiguous nucleotide sequence that includes portions of an intron and exon that are adjacent to one another in the mRNA transcript. In some embodiments, an isolated nucleic acid (e.g., antisense oligonucleotide) binds to an mRNA expressed from a particular allele of PHGDH (e.g., binds to a target mRNA in an allele-specific manner).

[0070] Isolated nucleic acids

[0071] In some embodiments of the present disclosure, a nucleic acid is an isolated nucleic acid. In some cases, nucleic acids are alternatively referred to as oligonucleotides. In some embodiments, an isolated nucleic acid comprises DNA (e.g., deoxyribonucleotides). In some embodiments, an isolated nucleic acid comprises RNA (e.g., ribonucleotides). In some embodiments, an isolated nucleic acid comprises both DNA (e.g., deoxyribonucleotides) and RNA (e.g., ribonucleotides), such as an isolated nucleic acid comprising a gapmer structure that comprises a region of deoxyribonucleotides which are flanked by regions of ribonucleotides. An isolated nucleic acid may be single stranded or double stranded. In some embodiments, the isolated nucleic acid is an RNA oligonucleotide. In some embodiments, the isolated nucleic acid is a single stranded RNA oligonucleotide (which may also be referred to as a single stranded RNA polynucleotide).

[0072] As used herein, the term “isolated” means artificially produced. Artificial production of an isolated nucleic acid may be achieved, for example, through amplification in vitro through polymerase chain reaction (PCR), recombinant cloning, or chemical synthesis. Methods of synthesizing isolated nucleic acids, for example RNAs, are known in the art, for example as described by Soukchareun et al. Preparation and characterization of antisense oligonucleotidepeptide hybrids containing viral fusion peptides. Bioconjug Chem. 1995 Jan-Feb;6(l):43-53. doi: 10.1021 / bc00031a004. PMID: 7711103.

[0073] The length of an isolated nucleic acid may vary. In some embodiments, an isolated nucleic acid (e.g., a single stranded RNA) is 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or up to 120 nucleotides in length. In some embodiments, an isolated nucleic acid ranges from about 1 to 100, 2 to 30, 5 to 20, 10 to 40, or 20 to 80 nucleotides in length. In some embodiments, an isolated nucleic acid is between 10 and 50 nucleotides in length. In some embodiments, an isolated nucleic acid comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some embodiments, an isolated nucleic acid is more than 50 nucleotides in length (e.g., 60, 70, 80, 90, 100, etc., nucleotides in length). In some embodiments, an isolated nucleic acid is no greater than 200 nucleotides in length.

[0074] In some embodiments, an isolated nucleic acid of the disclosure comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-299 (provided in Column A of Table 1). In some embodiments, an isolated nucleic acid of the disclosure comprises an antisense oligonucleotide comprising at least 15 nucleotides (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleotides) of the any one of the sequences set forth in SEQ ID NOs: 1-299 (provided in column A of Table 1).

[0075] In some embodiments of the present invention, an isolated nucleic acid is modified (e.g., comprises one or more modifications, for example chemical modifications, such as those in Column C of Table 1). A modified nucleic acid may refer to an oligonucleotide that has been structurally altered in a non-natural manner (e.g., a manner that does not occur in nature). Nucleic acid modifications may be used to endow the nucleic acid with specific functional characteristics relative to unmodified nucleic acids. In some embodiments, modification of an isolated nucleic acid promotes binding of the isolated nucleic acid to a target molecule or increases stability of the isolated nucleic acid (e.g., makes the isolated nucleic acid resistant to enzymatic degradation).

[0076] In some embodiments, the one or more modifications is between 1 and 50 modifications, 2 and 20, 5 and 30, 10 and 40, or 15 and 50 modifications. In some embodiments, an isolated nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 modifications. In some embodiments, an isolated nucleic acid comprises more than 50 modifications (e.g., 60, 70, 80, 90, 100, etc., modifications). In some embodiments, an isolated nucleic acid comprises more than 50 modifications (e.g., up to 60, 70, 80, 90, or 100, etc., modifications). In some embodiments, an isolated nucleic acid comprises chemical modifications on each nucleotide and each sugar-phosphate backbone linkage. Such a modified isolated nucleic acid may be referred to as a “fully modified” isolated nucleic acid. In some embodiments, less than all of the nucleotides of an isolated nucleic acid are modified.

[0077] A chemical modification may comprise a modification of a nucleobase or a nucleotide, and / or a modification of a sugar-phosphate backbone (e.g., modification of one or more sugarphosphate backbone linkages).

[0078] In some embodiments, an isolated nucleic acid of the disclosure comprises one or more chemical modification(s) listed in Column C of Table 1.

[0079] In some embodiments, an isolated nucleic acid comprises one or more modifications to a 5’ carbon atom (e.g., a 5’-carbon atom of a sugar) and / or one or more modifications to a 5- carbon of a nucleobase. Examples of modifications include, but are not limited to, 5-(2- amino)propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine, 5- carboxymethylaminomethyl-2-thiouracil, and 5-carboxymethylaminomethyl uracil. In other embodiments, the nucleic acid modification is targeted to the 6-carbon atom of a nucleobase. In some embodiments, an isolated nucleic acid comprises one or more modifications to a 6-carbon atom (e.g., a 6-carbon atom of a nucleobase) for example a 6-(2-amino)propyl uridine. In some embodiments, an isolated nucleic acid comprises one or more modifications to an 8-carbon atom (e.g., an 8-carbon atom of a nucleobase). Examples of 8 modifications include, but are not limited to, 8-bromo guanosine, 8-chloro guanosine, and 8-fluoroguanosine.

[0080] In some embodiments, an isolated nucleic acid comprises one or more modifications to a 2' carbon of the sugar group. Examples of modified sugar groups include, but are not limited to, D-ribose, 2'-O-alkyl (including 2'-O-methyl and 2'-O-ethyl), i.e., 2'-alkoxy, 2'-amino, 2'-S-alkyl, 2'-halo (including 2'-fluoro), 2'-2-O-methoxy ethoxy, 2'-allyloxy (-OCH2CH=CH2), 2'- propargyl, 2'-propyl, ethynyl, ethenyl, propenyl, and cyano and the like. In some embodiments, a modified sugar moiety comprises a hexose and incorporated into an oligonucleotide as described (Augustyns, K., et al., Nucl. Acids. Res. 18:4711 (1992)). Other examples of 2’ modifications include, but are not limited to, substitutions of the bound OH group with H, OR, R, F, Cl, Br, I, SH, SR, NH, NHR, NR, COOR, or OR, wherein R is a substituted or unsubstituted aliphatic group. Other 2’ modifications are found in the art. The term “aliphatic,” as used herein, includes both saturated and unsaturated, straight chain (i.e., unbranched), branched, acyclic, cyclic, or polycyclic aliphatic hydrocarbons, which are optionally substituted with one or more functional groups. As will be appreciated by one of ordinary skill in the art, “aliphatic” is intended herein to include, but is not limited to, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, and cycloalkynyl moieties.

[0081] In some embodiments, an isolated nucleic acid modification a sugar-phosphate backbone modification. One example of a phosphate group modifications is substitution of an oxygen atom with a sulfur atom. In other embodiments, the backbone of the nucleic acid is modified. Examples of backbone modifications include, but are not limited to, phosphorothioate, borano- phosphate, alkyl phosphonate nucleic acid, peptide nucleic acid, and morpholino. Morpholino backbones are described, for example by Corey and Abrams Genome Biol. 2001; 2(5): reviews 1015.1-reviews 1015.3.

[0082] Other examples of modified bases include N4,N4-ethanocytosine, 7-deazaxanthosine, 7- deazaguanosine, 8-oxo-N6-methyladenine, 4-acetylcytosine, dihydrouracil, inosine, N6- isopentenyl-adenine, 1 -methyladenine, 1 -methylpseudouracil, 1-methylguanine, 1- methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3 -methylcytosine, 5- methylcytosine, N6 -methyladenine, 7-methylguanine, 2-methylthio-N6-isopentenyladenine, pseudouracil, 5-methyl-2 -thiouracil, 2-thiouracil, 4-thiouracil, 2-thiocytosine, and 2,6- diaminopurine. Other examples of nucleic acid modifications are described for example by Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2): 117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5): 333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, Duffy. BMC Bio. 2020 Sep. 2(8): 112, and US Patent No. US5684143.

[0083] Additional modifications of isolated nucleic acids (e.g., ASOs) are described by Duffy et al. BMC Biology volume 18, Article number: 112 (2020), the entire contents of which are incorporated herein by reference.

[0084] In some embodiments, an isolated nucleic acid of the disclosure comprises a nucleic acid sequence from Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications) from Column C of Table 1, optionally where Columns A and C are from the same row of Table 1.

[0085] RNA processing modulators

[0086] Aspects of the disclosure relate to compositions (e.g., isolated nucleic acids, agents, etc.) that modulate mRNAs encoded by genes associated with L-serine biosynthesis or lipid (e.g., sphingolipid) biosynthesis. In some embodiments, the gene associated with lipid biosynthesis is SPTLC1 (e.g., a human SPTLC1 gene). In some embodiments, a composition comprises an RNA processing modulator. As used herein, an “RNA processing modulator” or “RPM” refers to an agent that binds to, and up-regulates, down-regulates, or otherwise change function or activity, of a target mRNA (e.g., an mRNA encoded by a gene associated with L-serine biosynthesis, such as SPTLC1, or a gene product, such as a protein encoded by the mRNA) by affecting a level, transcription, splicing, and / or translation of the mRNA. An RNA processing modulator may be an isolated nucleic acid or ASO as described herein. In some embodiments, an RNA processing modulator is an isolated nucleic acid that affects splicing, transcription or translation of the target mRNA (e.g., an mRNA encoded by a SPTLC1 gene). In some embodiments, an RNA processing modulator is an antisense oligonucleotide that affects transcription, levels, splicing, and / or translation of a target mRNA (e.g., an mRNA encoded by a SPTLC1 gene). In some embodiments, an mRNA (e.g., a target mRNA, such as an mRNA encoded by a SPTLC1 gene) is a pre-mRNA (e.g., an RNA that has been transcribed from a gene, such as a SPTLC1 gene, but has not been processed to remove introns, for example by splicing). In some embodiments, an mRNA is a mature mRNA that has been processed (e.g., an mRNA transcribed from a SPTLC1 gene and that has undergone processing).

[0087] In some embodiments, an RNA processing modulator upregulates transcription, levels, splicing, and / or translation of a target mRNA. Upregulation of transcription or translation may comprise binding to a regulatory region (e.g., an untranslated region, such as a 5' UTR or 3' UTR) of a target mRNA and reducing non-productive splicing or translation initiation from alternative start codons present in the target mRNA, for example through steric blocking of non- productive splice site(s) or alternative start codons (such as “upstream alternative start codons” located in the 5' UTR of the target mRNA), or causing a mRNA frameshift (e.g., a splice variant) resulting in translation of a protein variant from the target mRNA that lacks one or more inhibitory domains.

[0088] The amount of upregulation of transcription or translation mediated by an RNA processing modulator may vary. In some embodiments, an RNA processing modulator increases transcription or translation of a target mRNA transcript (e.g., increases relative to a cell or subject prior to the administration of the RPM, or increases relative to a control cell or subject) between 1-fold and 100-fold, 2-fold and 10-fold, 5-fold and 20-fold, 10-fold and 30-fold, 20- fold and 50-fold, or 25-fold and 100-fold, or any value therebetween. In some embodiments, an RNA processing modulator increases transcription or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400-fold, 500-fold, or 1000-fold. In some embodiments, an RNA processing modulator increases transcription, levels, splicing, and / or translation of a target mRNA transcript no more than 1000-fold. In some embodiments, upregulation of a level, transcription, splicing, and / or translation of a target mRNA is useful to increase expression of a desired (e.g., wild-type) allele encoding the target mRNA. In some embodiments, a desired allele encodes an SPTLC1 subunit that, when included in an SPT complex, the SPT complex prefers serine over alanine for production of 3-keto-sphingamine.

[0089] In some embodiments, an RNA processing modulator downregulates transcription or translation of a target mRNA. Downregulation of transcription or translation may comprise binding to a regulatory region (e.g., an untranslated region, such as a 5' UTR or 3' UTR) of a target mRNA and blocking transcription the target mRNA, for example through steric blocking of a transcription initiation site, binding to an mRNA and subsequently initiating RNAse IT- mediated degradation (e.g., in the context of a ‘gapmer’ RNA processing modulator), or causing an mRNA frameshift (e.g., a splice variant) resulting in translation of a protein variant from the target mRNA that is inactive, or has reduced function or activity (e.g., enzymatic activity, the ability to interact with other proteins to form protein complexes, etc.). In some embodiments, the resulting protein variant is a dominant negative protein variant. In some embodiments, downregulation of a level, transcription, splicing, and / or translation of a target mRNA is useful to increase expression of an undesirable (e.g., mutant, or disease-associated) allele encoding a target mRNA. In some embodiments, an undesirable allele of SPTLC1 encodes an SPTLC1 subunit that, when included in an SPT complex, the SPT complex prefers alanine over serine for production of 3-keto-sphingamine.

[0090] The amount of downregulation of transcription or translation mediated by an RNA processing modulator may vary. In some embodiments, an RNA processing modulator decreases transcription or translation of a target mRNA transcript between 1-fold and 100-fold, 2-fold and 10-fold, 5-fold and 20-fold, 10-fold and 30-fold, 20-fold and 50-fold, or 25-fold and 100-fold, or any value therebetween. In some embodiments, an RNA processing modulator increases transcription or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400-fold, 500-fold, or 1000-fold. In some embodiments, an RNA processing modulator decreases transcription, levels, splicing, and / or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400-fold, 500-fold, or 1000-fold. In some embodiments, an RNA processing modulator decreases transcription, levels, splicing, and / or translation of a target mRNA transcript no more than 1000-fold.

[0091] An RNA processing modulator may alter the number and / or character of splice variants of a target mRNA. In some embodiments, an RNA processing modulator increases (relative to natural transcription or translation of a target mRNA) the number of different splice variants of an mRNA, or the ratio between different splice variants of an mRNA. In some embodiments, an RNA processing modulator decreases (relative to natural transcription or translation of a target mRNA) the number of different splice variants of an mRNA, or the ratio between different splice variants of an mRNA. In some embodiments, contacting a target mRNA with an RNA processing modulator results in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more splice variants of the target mRNA being transcribed and / or translated. In some embodiments, contacting a target mRNA with an mRNA processing modulator results in a single splice variant of the target mRNA being transcribed and / or translated.

[0092] The binding location of an RNA processing modulator may vary. In some embodiments, an RNA processing modulator affects splicing of the target mRNA. For example, an RNA processing modulator may bind to the target mRNA at a splice junction (e.g., a location spanning an intron-exon boundary) and mediate skipping of one or more exons in the mRNA transcript. In some embodiments, skipping of one or more exons in the target mRNA results in production of a truncated protein variant of the protein encoded by the target mRNA. In another example, an RNA processing modulator may bind to the target mRNA at a splice junction and mediate alternative splicing in which an intron is translated, and a protein variant of the target gene is produced. In some embodiments, an RNA processing modulator binds a target mRNA at a location comprising a coding sequence (e.g., a protein coding sequence or an exon).

[0093] In some embodiments, an RNA processing modulator comprises an agent selected from the group consisting of nucleic acid, peptide (including polypeptide), and small molecule. Examples of small molecule RNA processing inhibitors include but are not limited to translational readthrough-inducing drugs (TRIDs), such as certain aminoglycosides, nonaminoglycoside antibiotics (e.g., negamycin), ataluren (PTC 124), and amlexanox. Examples of peptides include but are not limited to activator proteins (e.g., transcription factors), suppressor proteins (e.g., inducible cAMP early repressor (ICER), bZIP repressor, SP1 repressor, certain histone deacetylases, etc.), antibodies, etc. Examples of nucleic acids include but are not limited to suppressor tRNAs, dsRNA, siRNA, micro-RNA (miRNA), artificial miRNA (ami-RNA), aptamers, and antisense oligonucleotides. In some embodiments, an RNA processing modulator comprises an antisense oligonucleotide (ASO).

[0094] As used herein, the term, “antisense nucleic acid,” or “ASO” refers to a single stranded nucleic acid that has sequence complementarity to a target sequence and is specifically hybridizable, e.g., under stringent conditions, with a nucleic acid having the target sequence. An antisense nucleic acid is specifically hybridizable when binding of the antisense nucleic acid to the target nucleic acid is sufficient to produce complementary base pairing between the antisense nucleic acid and the target nucleic acid, and there is a sufficient degree of complementarity to reduce or avoid non-specific binding of the antisense nucleic acid to non-target nucleic acid under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. In some embodiments, an ASO is chemically synthesized. An ASO may be a DNA polynucleotide, an RNA polynucleotide, or a DNA / RNA polynucleotide (e.g., an ASO comprising a gapmer structure that comprises a region of deoxyribonucleotides flanked by regions comprising ribonucleotides).

[0095] Complementary refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an antisense nucleic acid is capable of hydrogen bonding with a nucleotide at the corresponding position of a target nucleic acid (e.g., target RNA), then the antisense nucleic acid and target nucleic acid are considered to be complementary to each other at that position. The antisense nucleic acid and target nucleic acid are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other through their bases. Thus, “complementary” is a term that is used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the antisense nucleic acid and target nucleic acid. However, it should be appreciated that 100% complementarity is not required. For example, in some embodiments, an antisense nucleic acid (e.g., an oligonucleotide) may be at least 80% complementary to (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) the consecutive nucleotides of a target nucleic acid (e.g., a target nucleic acid comprising an mRNA sequence encoded by SEQ ID NO: 300). Sequence identity, including determination of sequence complementarity for nucleic acid sequences, may be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g, gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. In some embodiments, the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (e.g., % homology=# of identical positions / total # of positions* 100), optionally penalizing the score for the number of gaps introduced and / or length of gaps introduced.

[0096] In some embodiments, an antisense oligonucleotide has a length in a range of 5 to 40 nucleotides, 5 to 30 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, or 15 to 25 nucleotides. In some embodiments of the disclosure, an antisense oligonucleotide comprises a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides.

[0097] In some embodiments, an antisense nucleic acid comprises a region of complementarity that is perfectly complementary to a portion of a target nucleic acid (e.g., 100% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by SEQ ID NO: 300)). However, it should be appreciated that in some embodiments, an antisense nucleic acid comprises less than 100% sequence complementarity with a target nucleic acid (e.g., 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by SEQ ID NO: 300)). In addition, to minimize the likelihood of off-target effects, an antisense nucleic acid may be designed to ensure that it does not have a sequence (e.g, of 5 or more consecutive nucleotides) that is complementary with an off-target nucleic acid (e.g., an mRNA that is not transcribed from an SPTLC1 gene).

[0098] In some embodiments, an antisense oligonucleotide comprises a region of complementarity with an mRNA encoded by (e.g., transcribed from) a SPTLC1 gene. In some embodiments, an antisense oligonucleotide comprises a region of complementarity with a pre- mRNA sequence encoded by a human SPTLC1 gene, for example (e.g., encoded by ENSG00000090054, Chromosome 9: 92,000,087-92,115,413 reverse strand). In some embodiments, the region of complementarity of the antisense nucleic acid hybridizes with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of a target nucleic acid (e.g., a pre-mRNA encoded by ENSG00000090054, Chromosome 9: 92,000,087-92,115,413 reverse strand). In some embodiments, the antisense oligonucleotide comprises a region of complementarity with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of an intron encoded by ENSG00000090054, Chromosome 9: 92,000,087-92,115,413 reverse strand. The skilled artisan recognizes that the forward strand of such a nucleic acid encoding a pre-mRNA transcript or mature mRNA transcript may also be targeted.

[0099] In some embodiments, an antisense oligonucleotide comprises a region of complementarity with an mRNA encoded by (e.g., transcribed from) an SPTLC1 gene. In some embodiments, an antisense nucleic acid oligonucleotide comprises a region of complementarity with an mRNA encoded by the sequence as set forth in SEQ ID NO: 300. In some embodiments, the region of complementarity of the antisense nucleic acid hybridizes with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of a target nucleic acid (e.g., an mRNA encoded by the sequence set forth in SEQ ID NO: 300). In some embodiments, an antisense oligonucleotide comprises a region of complementarity with a 5' UTR, 3' UTR, an exonic sequence, a splice donor sequence, a splice acceptor sequence or a lariat branch point encoded by a human SPTLC1 gene. In some embodiments, an oligonucleotide binds to an mRNA expressed from a particular allele of SPTLC1 (e.g., binds to a target mRNA in an allele-specific manner).

[0100] In some embodiments, an antisense oligonucleotide comprises a region of complementarity that is complementary with 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 continuous nucleotides of SEQ ID NO: 300. In some embodiments, an antisense oligonucleotide comprising a region of complementarity with an mRNA transcript encoded by SEQ ID NO: 300 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-299, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises a sequence of 10 or more contiguous nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, or more contiguous nucleotides) of any one of the sequences set forth in SEQ ID NOs: 1-299, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-299, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises a nucleotide sequence having one or more mismatches (e.g., one or more bases that is not complementary to the nucleotide at a given position of the target mRNA) relative to an mRNA transcript encoded by the sequence set forth in SEQ ID NO: 300. In some embodiments, an antisense oligonucleotide comprises a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches relative to an mRNA transcript encoded by the sequence set forth in SEQ ID NO: 300. In some embodiments, an antisense oligonucleotide comprising one or more mismatches relative to an mRNA transcript encoded by SEQ ID NO: 300 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a sequence of 10 or more contiguous nucleotides of any one of the sequences set forth in SEQ ID NOs: 1-299, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprising at least 60% sequence identity to a sequence of 10 or more contiguous nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, or more contiguous nucleotides) of any one of the sequences set forth in SEQ ID NOs: 1-299 differs at one or more nucleotide positions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide positions comprising a substitution, an insertion, or a deletion) relative to the sequence of 10 or more contiguous nucleotides of any one of the sequences set forth in SEQ ID NOs: 1-299, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprising one or more mismatches relative to an mRNA transcript encoded by SEQ ID NO: 300 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90- 95%, or more than 95% sequence identity) to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-299. In some embodiments, an antisense oligonucleotide comprising at least 60% sequence identity to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-299 differs at one or more nucleotide positions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide positions comprising a substitution, an insertion, or a deletion) relative to the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-299.

[0101] In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) are provided in a homogeneous preparation, e.g., in which at least 85%, at least 90%, at least 95%, or at least 99% of the RNA processing modulators (e.g., antisense oligonucleotides) are identical. For example, in some embodiments, homogeneous preparations of antisense oligonucleotides are provided in which at least 85%, at least 90%, at least 95%, or at least 99% of the oligonucleotides in the preparation are 10 to 25 nucleotides in length and comprise a region of complementarity that is complementary with at least 6 contiguous nucleotides of an mRNA transcript encoded by an SPTLC1 gene (e.g., an SPTLC1 gene comprising the nucleic acid sequence set forth in SEQ ID NO: 300). In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) are provided in a heterogeneous preparation, e.g., comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different RNA processing modulators (e.g., antisense oligonucleotides each targeting a different sequence of an SPTLC1 mRNA transcript).

[0102] RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may be modified to achieve one or more desired properties, such as, for example, improved cellular uptake, improved stability, reduced immunogenicity, improved potency, improved target hybridization, susceptibility to RNAse cleavage, etc. In some embodiments, an antisense nucleic acid is modified such that when present in a cell that contains an SPTLC1 gene, it is capable of hybridizing with RNA transcribed from the SPTLC1 gene without inducing cleavage of the RNA by an RNase. In some embodiments, an antisense nucleic acid is modified such that when present in a cell that contains an SPTLC1 gene, it is capable of hybridizing with RNA transcribed from the SPTLC1 gene and inducing cleavage of the RNA by an RNase.

[0103] RNA processing modulators (e.g., antisense oligonucleotides, e.g. a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-299, as recited in column A of Table 1) can be modified at a base moiety, sugar moiety and / or phosphate backbone. Accordingly, RNA processing modulators (e.g., antisense oligonucleotides) may have one or more modified nucleotides (e.g., a nucleotide analog) and / or one or more backbone modifications (e.g., a modified internucleotide linkage). RNA processing modulators (e.g., antisense oligonucleotides) may have a combination of modified and unmodified nucleotides. RNA processing modulators (e.g., antisense oligonucleotides) may also have a combination of modified and unmodified internucleotide linkages. RNA processing modulators (e.g., antisense oligonucleotides) may comprise one or more chemical modifications (or combinations of chemical modifications) from Column C of Table 1. In some embodiments, an RNA processing modulator comprises a nucleic acid sequence from Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications) from Column C of Table 1, where Columns A and C are from the same row of Table 1.

[0104] In some embodiments, the one or more modifications is between 1 and 50 modifications, 2 and 20, 5 and 30, 10 and 40, or 15 and 50 modifications. In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 modifications. In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises more than 50 modifications (e.g., 60, 70, 80, 90, 100, etc., modifications). In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises chemical modifications on each nucleotide and each sugar-phosphate backbone linkage. Such a modified RNA processing modulator (e.g., antisense oligonucleotide) may be referred to as a “fully modified” RNA processing modulator (e.g., antisense oligonucleotide). In some embodiments, a fully modified antisense oligonucleotide comprises the nucleic acid sequence of any one of SEQ ID NOs: 1- 299. In some embodiments, not all of the nucleotides of an antisense oligonucleotide are modified. RNA processing modulators (e.g., antisense oligonucleotides) may include ribonucleotides, deoxyribonucleotides, and combinations thereof (e.g., RNA processing modulators comprising a gapmer structure). Examples of modified nucleotides which can be used in antisense nucleic acids include, for example, 5-fluorouracil, 5 -bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1-methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3 -methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5- oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2 -thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2 -thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine.

[0105] In some embodiments, a modified nucleotide is a 2'-modified nucleotide. For example, the 2'-modified nucleotide may be a 2'-deoxy, 2'-fhioro, 2'-O-methyl, 2'-O-methoxy ethyl, 2'- amino and 2'-aminoalkoxy modified nucleotide. In some embodiments, the 2'-modified nucleotide comprises a 2'-O-4'-C methylene bridge, such as a locked nucleic acid (LNA) nucleotide. In some embodiments of a 2' modified nucleotide the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. In such embodiments, the linkage may be a methylene ( — CH2 — )ngroup bridging the 2' oxygen atom and the 3' or 4' carbon atom wherein n is 1 or 2. In some embodiments, a linkage comprises a cEt modification (e.g., a -CH3 replacing a hydrogen in the methylene group of the bridge).

[0106] RNA processing modulators (e.g., antisense oligonucleotides) may include combinations of LNA nucleotides and unmodified nucleotides. Antisense nucleic acids may include combinations LNA and RNA nucleotides. Antisense nucleic acids may include combinations LNA and DNA nucleotides. A further preferred oligonucleotide modification includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety.

[0107] RNA processing modulators (e.g., antisense oligonucleotides) acids may also include nucleobase-modified nucleotides, e.g., nucleotides containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Bases may be modified to block the activity of adenosine deaminase, for example. Examples of modified nucleobases include, but are not limited to, uridine and / or cytidine modified at the 5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and / or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6- methyl adenosine are suitable. It should be noted that the above modifications may be combined.

[0108] Within antisense nucleic acids e.g., antisense oligonucleotides) of the disclosure, as few as one and as many as all nucleotides can be modified. In some embodiments, a modified RNA processing modulator (e.g., antisense oligonucleotide) will contain as few modified nucleotides as are necessary to achieve a desired level of in vivo stability and / or bioaccessibility or other desired property.

[0109] Certain antisense oligonucleotides may include non-ionic DNA analogs, such as alkyland aryl-phosphonates (in which the charged non-bridging oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Nucleic acids which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation and may be used herein. In some embodiments, antisense nucleic acids may include at least one lipophilic substituted nucleotide analog and / or a pyrimidine-purine dinucleotide.

[0110] In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) may have one or two accessible 5' ends. It is possible to create modified oligonucleotides having two such 5' ends, for instance, by attaching two oligonucleotides through a 3 '-3' linkage to generate an oligonucleotide having one or two accessible 5' ends. The 3 '-3 '-linkage may be a phosphodiester, phosphorothioate, or any other modified internucleoside bridge. Additionally, 3 '-3 '-linked oligonucleotides where the linkage between the 3' terminal nucleosides is not a phosphodiester, phosphorothioate, or other modified bridge, can be prepared using an additional spacer, such as tri- or tetra-ethylenglycol phosphate moiety. In some embodiments, a triazole ring is used.

[0111] A phosphodiester internucleotide linkage of an RNA processing modulator (e.g., antisense oligonucleotide) can be replaced with a modified linkage. The modified linkage may be selected from, for example, phosphorothioate, phosphorodithioate, NRlR2-phosphoramidate, borano-phosphate, a-hydroxybenzyl phosphonate, phosphate-(Cl-C21) — O-alkyl ester, phosphate-[(C6-C12)aryl-(Cl-C21) — O-alkyl] ester, (Cl-C8)alkylphosphonate and / or (C6- C12)arylphosphonate bridges, and (C7-C12)-a-hydroxymethyl-aryl.

[0112] A phosphate backbone of the RNA processing modulators (e.g., antisense oligonucleotides) can be modified to generate peptide nucleic acid molecules. As used herein, the terms “peptide nucleic acids” or “PNAs” refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols, for example.

[0113] RNA processing modulators (e.g., antisense oligonucleotides) also be formulated as morpholino oligonucleotides. In such embodiments, the riboside moiety of each subunit of an oligonucleotide of the oligonucleotide reagent is converted to a morpholine moiety. Morpholinos may also be modified, e.g., as peptide conjugated morpholino, etc.

[0114] Aspects of the disclosure relate to RNA processing modulators (e.g., antisense oligonucleotides) comprising a “gapmer” structure. A “gapmer” refers to an antisense oligonucleotide comprising the following formula Xni-(Y)n2-(X)n3, where (X) is a ribonucleotide (e.g., an RNA base) and (Y) is a deoxyribonucleotide (e.g., DNA base), and where each of nl, n2, and n3 are an integer ranging from 1 to 50 (inclusive of all integers therebetween). In some embodiments, antisense oligonucleotides having a gapmer structure bind (e.g., hybridize) to a target mRNA (e.g., an mRNA encoded by an SPTLC1 gene) and induce ribonuclease Hl (RNAseHl)-mediated degradation of the target mRNA. Gapmer antisense oligonucleotides are known in the art, for example as described by Kasuya et al. Sci Rep. 2016; 6: 30377.

[0115] The number of DNA bases in a gapmer may vary. In some embodiments, a gapmer comprises between 1 and 10 DNA bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 DNA bases). In some embodiments, a gapmer comprises between 2 and 6 DNA bases (e.g., 2, 3, 4, 5, or 6 DNA bases). The DNA bases of a gapmer antisense oligonucleotide may be positioned toward to 5' end of the ASO (e.g., within 1, 2, 3, 4, 5, etc. nucleotides of the 5' terminal nucleotide of the ASO), toward the 3' end of the ASO (e.g., within 1, 2, 3, 4, 5, etc. nucleotides of the 3' terminal nucleotide of the ASO), or in the middle of the ASO (e.g., having an equal number of RNA bases flanking the DNA bases).

[0116] In other embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) can be linked to functional groups, such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane or the blood-brain barrier. For example, oligonucleotide reagents of the disclosure also may be modified with chemical moi eties (e.g., cholesterol) that improve the in vivo pharmacological properties of the RNA processing modulator. In some embodiments, a functional group comprises a peptide, small molecule, sugar, lipid, nucleic acid, or combination of any of the foregoing.

[0117] Sequences and chemical modifications of representative RNA processing modulators (e.g., antisense oligonucleotides) targeting SPTLC1 (e.g., an mRNA encoded by a SPTLC1 gene, such as a pre-mRNA or mature mRNA) are shown in Columns A and C, respectively, of Table 1. Table 1 : Representative RPMs targeting SPTLC1

[0118] In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises at least 18 continuous nucleotides (e.g., comprising or consisting of 18 nucleotides,

[0119] 19 nucleotides, or 20 nucleotides) of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-299 (see Column A of Table 1). In some embodiments, an RNA processing modulator consists of 18 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “18mers” in Column B of the same row in Table 1. In some embodiments, an RNA processing modulator comprises 18 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “18mers” in Column B of the same row in Table 1 and comprises one additional nucleotide (either at the 5' end or 3' end) or two additional nucleotides (either both at the 5' end, both at the 3' end, or one at the 5' end and the other at the 3' end) which are complementary to a target sequence in a SPTLC1 mRNA that hybridizes to the 18 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1. In some embodiments, an RNA processing modulator consists of 19 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column B of the same row in Table 1 and comprises one additional nucleotide either at the 5' end or 3' end which are complementary to a target sequence in a SPTLC1 mRNA that hybridizes to the 20 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1. In some embodiments, an RNA processing modulator comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column B of the same row in Table 1. In some embodiments, an RNA processing modulator comprises

[0120] 20 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column B of the same row in Table 1 and comprises one or more additional nucleotides either at the 5' end, at the 3' end, or both the 5' end and the 3' end which are complementary to a target sequence in a SPTLC1 mRNA that hybridizes to the 20 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-299 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1) comprises one or more chemical modifications as set forth in any one of the rows in Column B of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-299 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1) comprises a pattern of chemical modifications as set forth in any one of the rows in Column B of Table 1. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 22. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 46. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 147. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 152. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 162. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 193. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 195. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 221. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 233. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 248. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 254. In some embodiments, an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-299 reduces the levels of a SPTLC1 mRNA (e.g., a mature mRNA or a pre-mRNA) and / or a SPTLC1 protein by 50% or more (e.g., 50-60%, 60- 70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1- 299 reduces the levels of one or more lipids (e.g., toxic lipids, such as toxic deoxysphingolipids) by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 22, 46, 147, 152, 162, 193, 195, 221, 233, 248, or 254 reduces the levels of a SPTLC1 mRNA (e.g., a mature mRNA or a pre-mRNA) and / or a SPTLC1 protein by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95- 100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 22, 46, 147, 152, 162, 193, 195, 221, 233, 248, or 254 reduces the levels of one or more lipids (e.g., toxic lipids, such as toxic deoxysphingolipids) by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95- 100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.

[0121] In some embodiments, an RNA processing modulator comprises or consists of 18 continuous nucleotides, comprises or consists of 19 continuous nucleotides, or comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-299 (see Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue. In some embodiments, an RNA processing modulator comprises or consists of 18 continuous nucleotides, comprises or consists of 19 continuous nucleotides, or comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-299 (see Column A of Table 1), wherein each position comprising a “T” residue is substituted for a “U” residue. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-299 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue and wherein the RNA processing modulator comprises one or more chemical modifications as set forth in any one of the rows in Column B of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-299 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue and wherein the RNA processing modulator comprises a pattern of chemical modifications as set forth in any one of the rows in Column B of Table 1. In some embodiments, one or more positions in an RNA processing modulator comprising “U” residues comprises an uracil nitrogenous base or a chemically modified uracil nitrogenous base described herein and a deoxyribose sugar or a chemically modified deoxyribose sugar described herein. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 22, wherein one or more of positions in SEQ ID NO: 22 comprising a “T” residue (e.g., each position in SEQ ID NO: 22 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 46, wherein one or more of positions in SEQ ID NO: 46 comprising a “T” residue (e.g., each position in SEQ ID NO: 46 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 147, wherein one or more of positions in SEQ ID NO: 147 comprising a “T” residue (e.g., each position in SEQ ID NO: 147 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 152, wherein one or more of positions in SEQ ID NO: 152 comprising a “T” residue (e.g., each position in SEQ ID NO: 152 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 162, wherein one or more of positions in SEQ ID NO: 162 comprising a “T” residue (e.g., each position in SEQ ID NO: 162 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 193, wherein one or more of positions in SEQ ID NO: 193 comprising a “T” residue (e.g., each position in SEQ ID NO: 193 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 195, wherein one or more of positions in SEQ ID NO: 195 comprising a “T” residue (e.g., each position in SEQ ID NO: 195 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 221, wherein one or more of positions in SEQ ID NO: 221 comprising a “T” residue (e.g., each position in SEQ ID NO: 221 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 233, wherein one or more of positions in SEQ ID NO: 233 comprising a “T” residue (e.g., each position in SEQ ID NO: 233 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 248, wherein one or more of positions in SEQ ID NO: 248 comprising a “T” residue (e.g., each position in SEQ ID NO: 248 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 254, wherein one or more of positions in SEQ ID NO: 254 comprising a “T” residue (e.g., each position in SEQ ID NO: 254 comprising a “T” residue) is substituted for a “U” residue.

[0122] In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises a gapmer structure, wherein a region of 10 deoxyribonucleotides is flanked by regions each comprising 4 ribonucleotides (thereby totaling 8 ribonucleotides and 10 deoxyribonucleotides). In some embodiments, 1, 2, 3, or 4 ribonucleotides in each of the regions flanking the region of 10 deoxyribonucleotides comprise a 2'-O-methoxy ethyl (- OCH2CH2OCH3 (2' MOE)) modification. In some embodiments, 1, 2, 3, or 4 ribose sugars comprised in each region flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage or a phosphodiester linkage. In some embodiments, 1-10 deoxyribose sugars (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deoxyribose sugars) comprised in the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, one or more ribose sugars (e.g., 1, 2, 3, or 4 ribose sugars) comprised in each of the regions flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, 16 out of the 18 positions are linked by phosphorothioate linkages. In some embodiments, 16 out of the 18 positions are linked by phosphorothioate linkages, wherein the second position is linked to the third position (relative to the 5' terminal end) by a phosphodiester linkage and the sixteenth position is linked to the seventeenth position (relative to the 5' terminal end) by a phosphodiester linkage. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-299 (see Column A of Table 1). In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 22. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 46. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 147. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 152. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 162. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 193. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 195. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 221. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 233. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 248. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 254. In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of a SPTLC1 mRNA (e.g., a mature mRNA or a pre-mRNA) and / or a SPTLC1 protein by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95- 100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of one or more lipids (e.g., toxic lipids, such as toxic deoxysphingolipids) by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.

[0123] In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises a gapmer structure, wherein a region of 10 deoxyribonucleotides is flanked by regions each comprising 5 ribonucleotides (thereby totaling 10 ribonucleotides and 10 deoxyribonucleotides). In some embodiments, 1, 2, 3, 4, or 5 ribonucleotides in each of the regions flanking the region of 10 deoxyribonucleotides comprise a 2'-O-methoxy ethyl (- OCH2CH2OCH3 (2' MOE)) modification. In some embodiments, 1, 2, 3, 4, or 5 ribose sugars comprised in each region flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage or a phosphodiester linkage. In some embodiments, 1-10 deoxyribose sugars (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deoxyribose sugars) comprised in the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, one or more ribose sugars (e.g., 1, 2, 3, 4, or 5 ribose sugars) comprised in each of the regions flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, 16 out of the 20 positions are linked by phosphorothioate linkages. In some embodiments, 16 out of the 20 positions are linked by phosphorothioate linkages, wherein the second position and third position (relative to the 5' terminal end), third position and fourth position (relative to the 5' terminal end), seventeenth position and eighteenth position (relative to the 5' terminal end), and eighteenth position and nineteenth position (relative to the 5' terminal end) are each linked by a phosphodiester linkage. In some embodiments, 18 out of the 20 positions are linked by phosphorothioate linkages. In some embodiments, 18 out of the 20 positions are linked by phosphorothioate linkages, wherein the second position and third position (relative to the 5' terminal end) are linked by a phosphodiester linkage and the seventeenth position and eighteenth position (relative to the 5' terminal end) are linked by a phosphodiester linkage. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-299 (see Column A of Table 1). In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 46. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 162. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 193. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 195. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 233. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 248. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 254. In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of a SPTLC1 mRNA (e.g., a mature mRNA or a pre-mRNA) and / or a SPTLC1 protein by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95- 100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of one or more lipids (e.g., toxic lipids, such as toxic deoxysphingolipids) by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.

[0124] In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 1 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 2 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 3 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 4 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 5 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5, PO after 2'nd from 5'end, PO after 3rd from 3'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 6 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 7 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 8 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 9 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 10 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 11 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 12 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 13 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 14 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 15 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 16 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 17 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 18 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 19 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 20 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 21 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 22 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 23 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 24 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 25 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 26 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 27 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 28 and the following modification pattern: Full PS; 2'MOE; 18mer; 4- 10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 29 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 30 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 31 and the following modification pattern: Full PS; 2'MOE; 20mer; 5- 10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 32 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 33 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 34 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 35 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 36 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 37 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 38 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 39 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5, PO after 2'nd from 5'end, PO after 3rd from 3 'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 40 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 41 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 42 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 43 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 44 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 45 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 46 and the following modification pattern: Full PS; 2'MOE; 20mer; 5- 10-5, PO after 2'nd from 5'end, PO after 3rd from 3'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 47 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 48 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 49 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 50 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 51 and the following modification pattern: Full PS; 2'MOE; 20mer; 5- 10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 52 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5, PO after 2'nd from 5'end, PO after 3rd from 3'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 53 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 54 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 55 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 56 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 57 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 58 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 59 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 60 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 61 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 62 and the following modification pattern: Full PS; 2'MOE; 18mer; 4- 10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 63 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 64 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 65 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 66 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 67 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 68 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 69 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 70 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 71 and the following modification pattern: Full PS; 2'MOE; 20mer; 5- 10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 72 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 73 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 74 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 75 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 76 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 77 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 78 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4, PO after 2'nd from 5'end, PO after 3rd from 3 'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 79 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 80 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 81 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 82 and the following modification pattern: Full PS; 2'MOE;

[0125] 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 83 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 84 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 85 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 86 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 87 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 88 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 89 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 90 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 91 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 92 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 93 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 94 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 95 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 96 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 97 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 98 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 99 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 100 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 101 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 102 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 103 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 104 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 105 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 106 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 107 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 108 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 109 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 110 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 111 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 112 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4, PO after 2'nd from 5'end, PO after 3rd from 3'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 113 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 114 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 115 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 116 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 117 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 118 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 119 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 120 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 121 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 122 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 123 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 124 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 125 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5, PO after 2'nd from 5'end, PO after 3rd from 3'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 126 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 127 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 128 and the following modification pattern: Full PS;

[0126] 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 129 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 130 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 131 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 132 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 133 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 134 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 135 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 136 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 137 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 138 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 139 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 140 and the following modification pattern: Full PS;

[0127] 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 141 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 142 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 143 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 144 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 145 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 146 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 147 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4, PO after 2'nd from 5'end, PO after 3rd from 3'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 148 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 149 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 150 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 151 and the following modification pattern: Full PS;

[0128] 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 152 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 153 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 154 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 155 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 156 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 157 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 158 and the following modification pattern: Full PS;

[0129] 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 159 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 160 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 161 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 162 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; 4 POs after: 2nd base from 5', 3rd base from 5', 3rd base from 3', 4th base from 3' . In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 163 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 164 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 165 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 166 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 167 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 168 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 169 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 170 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 171 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 172 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 173 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 174 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 175 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 176 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 177 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 178 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 179 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 180 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 181 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 182 and the following modification pattern: Full PS;

[0130] 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 183 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 184 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 185 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 186 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 187 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 188 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 189 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 190 and the following modification pattern: Full PS;

[0131] 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 191 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5, PO after 2'nd from 5'end, PO after 3rd from 3'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 192 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 193 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 194 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 195 and the following modification pattern: Full PS;

[0132] 2'MOE; 20mer; 5-10-5, PO after 2'nd from 5'end, PO after 3rd from 3'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 196 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 197 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 198 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 199 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 200 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 201 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 202 and the following modification pattern: Full PS;

[0133] 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 203 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 204 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 205 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 206 and the following modification pattern: Full PS;

[0134] 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 207 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 208 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 209 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 210 and the following modification pattern: Full PS;

[0135] 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 211 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 212 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 213 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 214 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 215 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 216 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 217 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 218 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 219 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 220 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 221 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 222 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 223 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 224 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 225 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 226 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 227 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5, PO after 2'nd from 5'end, PO after 3rd from 3 'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 228 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 229 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 230 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 231 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 232 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 233 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5, PO after 2'nd from 5'end, PO after 3rd from 3'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 234 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 235 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 236 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 237 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 238 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 239 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 240 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 241 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 242 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 243 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 244 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5, PO after 2'nd from 5'end, PO after 3rd from 3'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 245 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 246 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 247 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 248 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5, PO after 2'nd from 5'end, PO after 3rd from 3'end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 249 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 250 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 251 and the following modification pattern: Full PS;

[0136] 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 252 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 253 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 254 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 255 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 256 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 257 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 258 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 259 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 260 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 261 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 262 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 263 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 264 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 265 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 266 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 267 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 268 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 269 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 270 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 271 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 272 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 273 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 274 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 275 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 276 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 277 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 278 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 279 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 280 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 281 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 282 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 283 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 284 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 285 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 286 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 287 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 288 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 289 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 290 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 291 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 292 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 293 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 294 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 295 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 296 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 297 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 298 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 299 and the following modification pattern: 20mer; Gapmer; 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end; Full PS; 2'MOE. In any of the foregoing embodiments: positions comprising “T” residues comprise a thymine (T) nitrogenous base bonded to the 1' carbon of either ribose or deoxyribose; isolated nucleic acids comprising a gapmer structure are indicated by structures denoted “(X)-(Y)-(X)”, wherein “(X)” refers to regions comprising an ‘X’ number of nucleotide positions having ribose and which flank a region referred to as “(Y)” comprising a ‘ Y’ number of nucleotide positions having deoxyribose; isolated nucleic acids comprising a skipmer structure (alternatively referred to herein as skippers) are indicated by the lack of notation reciting “(X)-(Y)-(X)” and each nucleotide position comprises ribose; “Full PS” refers to each nucleotide position linked by an internucleotide linkage comprising a phosphorothioate modification unless otherwise indicated by nucleotide positions comprising a phosphodiester group (PO) at the 3' carbon of ribose; “2'MOE” refers to the 2' carbon of ribose bonded to an oxygen atom which is bonded to a methoxyethyl group; “#mer” refers to the number of nucleotide positions; and “PO” refers to nucleotide positions, wherein the 3' carbon of ribose comprises a phosphodiester bond which links the nucleotide position to an immediately adjacent nucleotide position in the 3' direction, wherein nucleotide positions comprising a PO group (e.g., a position referred to as 2nd or 3rd from a 5’ or 3' terminal end) at the 3' carbon of ribose is indicated by the location of the PO group which is referred to either as being “at” or “after”.

[0137] In some embodiments, an RPM (e.g., an antisense oligonucleotide) comprises the structure set forth in Formula (I):

[0138] Formula (I)

[0139] Pharmaceutical Compositions

[0140] In some embodiments of the disclosure, RNA processing modulators (e.g., antisense oligonucleotides) are assembled into compositions for therapeutic purposes. In some embodiments, the compositions are designed to enhance the therapeutic effect of the RNA processing modulators, for example by increasing biocompatibility, targeting the RNA processing modulator to a site of interest in vivo, reducing clearance of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo, increasing the stability of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo, increasing uptake of an isolated nucleic acid (e.g., an antisense oligonucleotide) in target cells, or amplifying the intended effect of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo.

[0141] In some embodiments, the RNA processing modulator (e.g., antisense oligonucleotide) is provided in combination with a pharmaceutically acceptable carrier. A “pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function. Additional ingredients that may be included in the pharmaceutical compositions used in the practice of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.

[0142] In some embodiments, a composition comprising an RNA processing modulator (e.g., antisense oligonucleotide) comprises sterile artificial cerebrospinal fluid (CSF). In some embodiments, artificial CSF comprises a pH of about 6.8 to about 7.8. In some embodiments, the pH is between 6.9 and 7.7, between 7.0 and 7.6, or between 7.1 and 7.5. In some embodiments, artificial CSF comprises sodium phosphate buffer. In some embodiments, the sodium phosphate buffer is at a concentration of between 0.5 mM and 2.0 mM, such as 0.5-0.75 mM, 0.75-1.0 mM, 1.25-1.5 mM, 1.5-1.75 mM, or 1.75-2.0 mM. In some embodiments, the sodium phosphate buffer comprises a pH of about 6.90, 6.95, 7.00, 7.05, 7.10, 7.15, 7.20, 7.25, or 7.30. In some embodiments, artificial CSF comprises sodium chloride. In some embodiments, the concentration of sodium chloride is between 50 mM and 300 mM, such as between 75 mM and 250 mM, between 100 mM and 225 mM, or between 125 mM and 200 mM. In some embodiments, artificial CSF comprises potassium chloride. In some embodiments, the concentration of potassium chloride is between 0.5 mM and 5 mM, such as between 1 mM and 5 mM or between 2 mM and 5 mM. In some embodiments, artificial CSF comprises calcium chloride dihydrate. In some embodiments, the concentration of calcium chloride dihydrate is between 1.0 mM and 2.0 mM, such as between 1.1 mM and 1.9 mM, between 1.2 mM and 1.8 mM, or between 1.3 mM and 1.7 mM. In some embodiments, artificial CSF comprises magnesium chloride hexahydrate. In some embodiments, the concentration of magnesium chloride hexahydrate is between 0.1 mM and 1.5 mM, such as between 0.3 mM and 1.2 mM, 0.4 -n - mM and 1.1 mM, or between 0.5 mM and 1.0 mM. In some embodiments, artificial CSF is a sterile aqueous solution comprising any combination of sodium phosphate buffer, sodium chloride, potassium chloride, calcium chloride dihydrate, and magnesium chloride hexahydrate.

[0143] In some embodiments, a composition comprising an RNA processing modulator (e.g., antisense oligonucleotide) comprises a total volume of about 5 mL to about 30 mL. In some embodiments, the total volume is about 10 mL, 15 mL, 20 mL, or about 25 mL. In some embodiments, the total volume of the composition is comprised in a vial, such as a glass vial. In some embodiments, the composition is prepared using sterile filtration and filling under aseptic processing.

[0144] The disclosure also provides compositions comprising RNA processing modulators (e.g., antisense oligonucleotides) at a concentration of about 1 mg / mL to 20 mg / mL. In some embodiments, the concentration of RNA processing modulators (e.g., antisense oligonucleotides) in a composition is between 1 mg / mL and 15 mg / mL, between 3 mg / mL and 15 mg / mL, or between 5 mg / mL and 15 mg / mL. In some embodiments, the concentration of RNA processing modulators (e.g., antisense oligonucleotides) in a composition is greater than 5 mg / mL and less than 10 mg / mL.

[0145] Methods and Medical Uses

[0146] Aspects of the disclosure relate to methods of modulating a transcription, splicing, translation, function, or activity of genes associated with L-serine biosynthesis or lipid biosynthesis (e.g., sphingolipid biosynthesis) in a cell or subject. Also provided is an RNA processing modulator (e.g., antisense oligonucleotide) described by the disclosure for use as a medicament. The RNA processing modulators (e.g., antisense oligonucleotides) may be used in methods of modulating transcription, translation, function, or activity of genes associated with with L-serine biosynthesis or lipid biosynthesis (e.g., sphingolipid biosynthesis), e.g. in a cell or subject. In some embodiments, the methods comprise administering a composition comprising one or more RNA processing modulators (e.g., 1, 2, 3, 4, 5, or more RNA processing modulators, for example 1, 2, 3, 4, 5, or more antisense oligonucleotides) to a cell or subject. In some embodiments, administration of the compositions (e.g., RNA processing modulators) results in alteration of lipid (e.g., sphingolipid) biosynthesis in the cell or subject. The cell may be in vivo, ex vivo, or in vitro.

[0147] For example, in some embodiments, administration of an RNA processing modulator (e.g., an antisense oligonucleotide) targeting SPTLC1 mRNA results in an increase in production of sphingolipids (which utilize L-serine as a precursor molecule) in the cell or subject. In some embodiments, administration of an RNA processing modulator (e.g., an antisense oligonucleotide) targeting SPTLC1 mRNA results in a decrease in production of deoxysphingolipids (which result from mutations in certain genes involved in L-serine biosynthesis and / or lipid biosynthesis, for example SPTIX'l) in the cell or subject. The disclosure is based, in part, on the recognition that contacting a cell or subject with an RNA processing modulator that decreases a level, transcription, splicing, translation, function or activity of SPTLC1 protein results, in some embodiments, in decreased deoxy-sphingolipid production in the subject.

[0148] Accordingly, in some aspects, the disclosure provides a method for increasing sphingolipid biosynthesis in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-299 (provided in Column A of Table 1, optionally comprising one or more modifications in Column C of Table 1, and optionally wherein the sequence in Column A and the chemistry in Column C are provided in the same row of Table 1).

[0149] Generally, it is desirable to increase sphingolipid levels (or reduce deoxy-sphingolipids) in certain subjects (e.g., subjects having low serine, for example subjects having retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy- induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s Disease, Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia)). However, it should be appreciated that, in some embodiments, the disclosure provides a method for decreasing sphingolipid biosynthesis (or increasing deoxy-sphingolipid biosynthesis) in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-299 (provided in Column A of Table 1, optionally comprising one or more modifications in Column C of Table 1, and optionally wherein the sequence in Column A and the chemistry in Column C are provided in the same row of Table 1).

[0150] In some aspects, RNA processing modulators (e.g., antisense oligonucleotides) described by the disclosure are useful for treating a disease or disorder associated with dysregulation of L- serine biosynthesis. Thus, provided herein are RNA processing modulators (e.g., antisense oligonucleotides) described by the disclosure for use in a method of treating a disease or disorder associated with dysregulation of L-serine biosynthesis. A disease or disorder associated with dysregulation of L-serine biosynthesis refers to a disease or disorder in which the subject (e.g., patient) is 1) characterized as having low serine, and / or 2) has one or more mutations in one or more genes associated with L-serine biosynthesis, and / or 3) has one or more mutations in one or more genes that are involved in a metabolic pathway that utilizes serine (e.g., sphingolipid biosynthesis, which relies upon SPTLCP). A disease or disorder associated with dysregulation of L-serine biosynthesis refers to a disease or disorder in which the subject (e.g., patient) is characterized as having one or more mutations one or more genes associated with lipid (e.g., sphingolipid) biosynthesis, for example SPTLC1, or as having low serine that results in increased production of toxic deoxy-sphingolipids.

[0151] Methods of measuring serine levels in a subject are known in the art, for example as described by Meneret et al. Arch Neurol. 2012;69(7):908-911. In some embodiments, an L- serine level of a subject is determined by measuring the concentration of L-serine in a biological sample obtained from the subject, for example a blood sample, serum sample, cerebrospinal fluid (CSF) sample, etc. In some embodiments, a subject having “low serine” refers to a subject having a plasma serine level of below 0.66 mg / dL and / or a cerebrospinal fluid (CSF) serine level of below 0.21 mg / dL.

[0152] Examples of genes associated with L-serine biosynthesis include PHGDH, Phosphoserine aminotransferase (PSTATP), and Phosphoserine phosphatase (PSPH). In some embodiments, a subject having a disease or disorder associated with dysregulation of L-serine biosynthesis comprises one or more mutations in a gene selected from PHGDH, PSTAT1, and PSPH. In some embodiments, a subject has one or more mutations in a PHGDH gene. In some embodiments, a subject having one or more mutations in a PHGDH gene has (or is at risk of developing) MacTel2. Methods of detecting mutations in a subject’s genes are known in the art and include, for example DNA sequencing, RNA sequencing, microarray analysis, etc.

[0153] In some embodiments, a subject has a disease or disorder associated with dysregulation of lipid (e.g., sphingolipid) biosynthesis, and comprises one or more mutations in one or more genes that are involved in a metabolic pathway that utilizes serine (e.g., L-serine or D-serine). For example, L-serine is utilized in the production of sphingolipids by condensation of L-serine with palmitoyl-CoA by the enzyme serine palmitoyl transferase (SPT). One subunit of SPT is provided by the SPTLC1 gene in humans which fulfills autoregulatory roles in the enzymatic activity of SPT. Autosomal dominant mutations in SPTLC1 result in atypical production of sphingolipids and are implicated in hereditary sensory neuropathy (HSAN1) (including HSANl(a)) resulting from condensation of palmitoyl-CoA with alanine to form cytotoxic deoxysphingolipids. HSAN1 results in a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.) manifesting as, in some instances, severe loss of sensation to temperature, pressure and pain. In some instances, long-term cases of HSAN1 leads to painless injuries, chronic skin ulcers, bone destruction, bone infections, amputation of digits, and motor dysfunction. In some embodiments, a subject having one or more mutations in a gene encoding an SPT subunit may benefit from being administered an RNA processing modulator that increases transcription, translation, function, or activity of SPTLC1. Without wishing to be bound by any particular theory increased SPTLC1 levels or activity may result in restoration of proper spingolipid:deoxy-sphingolipid levels in the subject. Measurement of sphingolipid and deoxy-sphingolipid levels in a subject is known, for example as described by Johnson et al. Nature Communications volume 11, Article number: 2471 (2020), Weiss et al. Hum Mol Genet. 2021 Feb 25;29(24):3945-3953. doi: 10.1093 / hmg / ddaa248, and Clark et al. (2020) FEBS Lett, 594: 3579-3582.

[0154] Deoxy-sphingolipid production as a result of reduced SPT activity and an ensuing metabolic shift toward alanine utilization over L-serine is seen in other diseases and disorders. In some instances, diabetic neuropathy as a result of type 2 diabetes is associated with overproduction of deoxysphingolipids. In some instances, amyotrophic lateral sclerosis (ALS) is associated with over production of deoxysphingolipids.

[0155] Accordingly, in some aspects, the disclosure provides a method for treating a disease or disorder associated with dysregulation of lipid (e.g., sphingolipid) biosynthesis, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. Also provided is an RNA processing modulator (e.g., antisense oligonucleotide) described by the disclosure for use in a method of treating a disease or disorder associated with dysregulation of lipid (e.g., sphingolipid) biosynthesis. The method may comprise administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-299 (provided in Column A of Table 1, optionally comprising one or more modifications in Column C of Table 1, and optionally wherein the sequence in Column A and the chemistry in Column C are provided in the same row of Table 1). In some embodiments, the disease is selected from retinal diseases (e.g., MacTel2 and Age- related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s Disease, Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

[0156] As used herein “treat” or “treating” refers to preventing or delaying disease onset, reducing or preventing the development of symptoms associated with a disease, reducing the severity of a disease, and / or preventing the worsening of symptoms associated with a disease. Accordingly, in some aspects, the disclosure provides a method for treating a subject having or suspected of having a disease caused by dysregulated L-serine biosynthesis or dysregulated lipid biosynthesis (e.g., sphingolipid biosynthesis). Treatment of a subject involves administration of a composition to the subject (e.g., an RNA processing modulator, such as an antisense oligonucleotide) as described herein.

[0157] As used herein, the term “treating” refers to the application or administration of a composition (e.g., an RNA processing modulator, such as an antisense oligonucleotide as described herein) to a subject who has a disease or disorder associated with low levels of serine, or with dysregulation of L-serine biosynthesis or with dysregulation of lipid biosynthesis, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disorder, the symptom of the disease, or the predisposition toward a disease associated with dysregulation of L-serine biosynthesis.

[0158] Alleviating a disease associated with dysregulation of L-serine biosynthesis includes delaying the development or progression of the disease, or reducing disease severity. Alleviating the disease does not necessarily require curative results. As used therein, "delaying" the development of a disease (such as a disease associated with dysregulation of L-serine biosynthesis or a disease associated with dysregulation of lipid biosynthesis) means to defer, hinder, slow, retard, stabilize, and / or postpone progression of the disease. This delay can be of varying lengths of time, depending on the history of the disease and / or individuals being treated. A method that "delays" or alleviates the development of a disease, or delays the onset of the disease, is a method that reduces probability of developing one or more symptoms of the disease in a given time frame and / or reduces extent of the symptoms in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a number of subjects sufficient to give a statistically significant result.

[0159] "Development" or "progression" of a disease means initial manifestations and / or ensuing progression of the disease. Development of the disease can be detectable and assessed using standard clinical techniques as well known in the art. However, development also refers to progression that may be undetectable. For purpose of this disclosure, development or progression refers to the biological course of the symptoms. "Development" includes occurrence, recurrence, and onset. As used herein "onset" or "occurrence" of a disease associated with low serine levels and / or dysregulation of L-serine biosynthesis and / or dysregulation of lipid biosynthesis.

[0160] A subject may be a human, a mouse, a rat, a pig, a dog, a cat, or a non-human primate. In some embodiments, a subject has or is suspected of having a disease or disorder associated with low serine levels and / or dysregulation of L-serine biosynthesis and / or dysregulation of lipid biosynthesis. In some embodiments, a subject having a disease or disorder associated with low serine levels and / or dysregulation of L-serine biosynthesis and / or dysregulation of lipid biosynthesis comprises at least one SPTLC1 allele having a mutation, such as a loss of function mutation, or a mutation that changes substrate specificity of an SPT protein comprising the mutant SPTLC1 subunit to have a preference for alanine over serine. In some embodiments, an SPTLC1 allele having a mutation comprises a frameshift mutation, a splice site mutation, a missense mutation, a truncation mutation or a nonsense mutation. A subject may have two SPTLC1 alleles having the same mutations (homozygous state) or two SPTLC1 alleles having different mutations (compound heterozygous state).

[0161] The optimal course of administration or delivery of the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may vary depending upon the desired result and / or on the subject to be treated. As used herein “administration” refers to contacting cells with an RNA processing modulator and can be performed in vitro or in vivo. Compositions (e.g., pharmaceutical compositions) provided herein can be administered a number of routes including, but not limited to, by oral administration, intravenous administration (e.g., systemic intravenous injection / administration), administration to the brain and / or spinal cord, intracerebral injection, intraventricular injection, intraci sternal injection, intraparenchymal injection, intrathecal injection, and any combination of the foregoing. In some embodiments, administration comprises administration to cerebral spinal fluid, and / or direct administration to an affected site (e.g., a target tissue, for example eye tissue, central nervous system (CNS) tissue, or peripheral nervous system (PNS) tissue).

[0162] In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract), and / or the condition of the subject (e.g., whether the subject is able to tolerate oral administration, injection, etc.). In certain embodiments, a compound or pharmaceutical composition described herein is suitable for topical administration to the eye of a subject. In some embodiments, administration (e.g., injection) of a compound or pharmaceutical composition is performed on a patient in a Trendelenburg position. In some embodiments, compositions are administered to a subject through only one administration route. In some embodiments, multiple administration routes may be exploited (e.g., serially, or simultaneously) for administration of the composition to a subject.

[0163] In some embodiments, it may be desirable to deliver the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to the CNS of a subject. By “CNS” is meant all cells and tissue of the brain and spinal cord of a vertebrate. Thus, the term includes, but is not limited to, neuronal cells, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage and the like. RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may be delivered directly to the CNS or brain by injection into, e.g., the ventricular region, as well as to the striatum (e.g., the caudate nucleus or putamen of the striatum), spinal cord and neuromuscular junction, or cerebellar lobule, with a needle, catheter or related device, using neurosurgical techniques known in the art, such as by stereotactic injection (see, e.g., Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11 :2315-2329, 2000). In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intravenous injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intracerebral injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intracerebroventricular injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intrathecal injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by lumbar intrathecal injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intrastriatal injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by intracranial injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by cisterna magna injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by cerebral lateral ventricle injection. The skilled artisan will also recognize that the foregoing administration routes may be combined in a single subject (e.g., a subject may be administered RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure using a combination of two or more of the foregoing techniques).

[0164] In some embodiments, administration of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure results in delivery of RNA processing modulators (e.g., antisense oligonucleotides) to ocular tissue. Delivery of the RNA processing modulators (e.g., antisense oligonucleotides) to a mammalian subject may be by, for example, intraocular injection, subretinal injection, topical administration (e.g., an eye drop), or by injection into the eye of the mammalian subject to ocular tissues (e.g., intravitreal injection). As used herein, “ocular tissues” refers to any tissue derived from or contained in the eye. Non-limiting examples of ocular tissues include neurons, retina (e.g., photoreceptor cells), sclera, choroid, retina, vitreous body, macula, fovea, optic disc, lens, pupil, iris, aqueous fluid, cornea (e.g., keratocytes, corneal endothelial cells, corneal basal cells, corneal wing cells, and corneal squamous cells), conjunctiva ciliary body, and optic nerve. The retina is located in the posterior of the eye and comprises photoreceptor cells. These photoreceptor cells (e.g., rods, cones) confer visual acuity by discerning color, as well as contrast in the visual field.

[0165] In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA) is administered to a subject. In some embodiments, an effective amount of an RNA processing modulator (e.g., antisense oligonucleotide) is an amount sufficient to increase transcription, translation, function, or activity of a target mRNA. In some embodiments, an effective amount of an RNA processing modulator (e.g., antisense oligonucleotide) is an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA. The effective amount will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among animal and tissue.

[0166] In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1 ng-100 mg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1-1000 ng. In some embodiments, an effective amount of (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1-10, 10-50, 50-100, 100- 200, 200-300, 300-500, 500-750, or 750-1000 ng. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 0.1 pg-100.0 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) 0.1-1.0, 1.0-5.0, 5.0-20.0, 20.0-50.0, or 50.0-100.0 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1 pg-1000 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA) 100-250, 250-500, 500-750, or 750-1000 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) 0.1-1.0, 1.0-5.0, 5.0-20.0, 20.0-50.0, or 50.0-100.0 mg. In some embodiments, an effective amount is administered from a composition comprising a concentration of RNA processing modulator (e.g., antisense oligonucleotide) of about 1 mg / mL to 20 mg / mL. In some embodiments, the concentration of RNA processing modulators (e.g., antisense oligonucleotides) in the composition is between 1 mg / mL and 15 mg / mL, between 3 mg / mL and 15 mg / mL or between 5 mg / mL and 15 mg / mL. In some embodiments, the concentration of RNA processing modulators (e.g., antisense oligonucleotides) in the composition is greater than 5 mg / mL and less than 10 mg / mL.

[0167] In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 0.1-1.0, 1.0-20.0, 20.0-50.0, 50.0-200.0, or 200.0-500.0 mg. In some embodiments, an effective amount is administered from a composition comprising a concentration of RNA processing modulator (e.g., antisense oligonucleotide) of about 1 mg / mL to 50 mg / mL. In some embodiments, the concentration of RNA processing modulators (e.g., antisense oligonucleotides) in the composition is between 1 mg / mL and 45 mg / mL, between 10 mg / mL and 45 mg / mL or between 15 mg / mL and 45 mg / mL.

[0168] During the course of treatment, administration of the composition may be altered or adjusted accordingly. For example, expression of the protein encoded by the nucleic acid targeted by the isolated nucleic acid of the pharmaceutical composition may be monitored to inform methods of use of the composition. Expression information may be obtained, for example, through measuring changes in the levels of the protein or RNA products of the target nucleic acid. Alternatively, sequencing analyses of the target nucleic acid may be employed to determine if expression changes include alterations in the structure or sequence of the protein or RNA product of the target nucleic acid sequence.

[0169] The amount of the composition will vary depending on a number of factors such as, but not limited to, clinical features (e.g., disease severity, rate of disease progression, physical characteristics, etc.) of a subject and the mode of administration. Accordingly, the composition may, in certain instances, be administered once or more than one to a single subject. In certain instances, the composition may be administered to the same subject through different modes or routes at different times during the treatment process. In some embodiments, the composition is administered to a subject more than once. In some embodiments, the composition is administered twice, three times, four times, or more to a subject. In some embodiments, the composition is administered to a subject less than twelve times in a 12-month period. In some embodiments, the time between each administration of the composition is days, weeks, or months. In some embodiments, the time between each administration is 1-2 weeks, 2-4 weeks, or 1-4 months. In some embodiments, the time between each administration of the composition is the same. In other embodiments, the time between each administration of the composition can be different. In some embodiments, the time between a first administration and a second administration of the composition is 1-2 weeks. In some embodiments, the time between a second administration of the compositions and a third administration of the composition is 1-3 months.

[0170] EXAMPLES

[0171] Example 1: RNA Processing Modulators (RPMs)

[0172] This example describes the use of RNA Processing Modulators (RPMs) for modulating translation of one or more mRNA transcripts in a cell or subject. RPMs function by binding to a target-specific mRNA sequence and altering (e.g., upregulating or down-regulating) translation of protein of the mRNA sequence.

[0173] In some embodiments, an RPM is an antisense oligonucleotide (ASO). Antisense oligonucleotides (ASOs) typically range from about 10 to 30 nucleotides in length, and may comprise a non-natural sugar-phosphate backbone (e.g., phosphorodiamidate morpholino backbone, phosphorothioate backbone, etc.) and / or one or more modified sugar moieties (e.g., 2 '-O-m ethoxy ethyl ribose (2'-0-M0E) modifications, etc.).

[0174] In some embodiments, an RPM (e.g., an ASO) targets a structural element of an mRNA transcript, for example an untranslated region (UTR) to modulate the expression of the target (e.g., the target gene encoding the mRNA transcript) by increasing or decreasing transcription and / or translation of the protein encoded by the mRNA transcript (alternatively referred to as modulating expression in the up or the down direction). In another example, an RPM (e.g., an ASO) may target a regulatory region (and thus interfere with protein binding, such as ribosomal protein binding) of a UTR region to modulate the expression of the target in the up or the down direction. Alternatively, an RPM (e.g., an ASO) may target a splice site (e.g., a splice acceptor site or a splice donor site or one or more nucleotide positions thereof in a UTR region) to modulate the expression of the target in the up or the down direction (and thus generating novel protein variants). Additional examples of structural elements that can be targeted by RPMs (e.g., ASOs) include, but are not limited to, intronic regulatory sites, exonic regulatory sites, exonintron boundaries, antisense binding sites of a target mRNA transcript, long-non-coding RNA (LncRNA) binding sites of a target gene, and a retained exon of a canonical mRNA.

[0175] Non-limiting examples of ASOs targeting various structural elements of an mRNA are show in FIG. 1. Composition “A” represents an ASO that binds to the 5’ untranslated region (5’ UTR) of an RNA. Composition “B” represents an ASO that binds to an intron of an RNA. Composition “C” represents an ASO that binds to a splice boundary (e.g., a splice junction) between an exon and intron of an RNA. Composition “D” represents an ASO that binds to an exon (e.g., protein coding region) of an RNA. Composition “E” represents a combination of an ASO binding to a 3’ UTR of an RNA, alone or with a trans-regulator. Composition “F” represents a “gapmer” ASO that binds to an exon (e.g., a protein coding region) of an RNA and mediates RNaseH decay. Composition “G” represents a “gapmer” ASO that binds to a 3’ UTR of an RNA, alone or with a trans-regulator, and mediates RNaseH decay. In some embodiments, ASOs binding to an RNA result in translation of a truncated protein that has a dominant negative effect on the wild-type, full-length protein.

[0176] Example 2: L-Serine and Lipid Biosynthesis

[0177] This example describes diseases and disorders that area associated with L-serine biosynthesis, particularly diseases and disorders associated with dysregulation of L-serine biosynthesis in the central nervous system (CNS).

[0178] L-serine is typically classified as a non-essential amino acid. However, in the CNS, an external supply of L-serine is essential for the synthesis of sphingolipids and phosphatidylserine (PS), and for survival of neurons. In astrocytes, L-serine is normally synthesized from metabolism of glucose by several enzymes, including phosphoglycerate dehydrogenase PHGDEL). L-serine then interacts with serine palmitoyltransferase (SPT) to produce certain lipids (e.g., sphingolipids) that are exported to neurons for use in cellular membrane biosynthesis. L-serine also interacts with serine racemase to produce D-serine, which is exported to neurons. Dysregulation of L-serine biosynthesis (e.g., caused by a mutation in PHGDH, or SPTLC1, a gene encoding an SPT subunit) has been shown to cause accumulation of toxic deoxysphingolipids (deoxy-SLs), which can lead to inflammation and is also associated with certain CNS diseases and disorders. Broad lipidomics profiling has been useful in pointing to biomarkers associated with L- serine synthesis dysregulation and may provide means for detection of disease states associated with L-serine biosynthesis problems.

[0179] Recent data indicates that in the context of macular telangiectasia type 2 (MacTel2), PHGDH loss of function mutations (e.g., haploinsufficiency) and variants are an “allelic series” correlating reduction in enzyme level / activity with disease impact. Remarkably, even MacTel2 patients without severe PHGDH mutations have been observed to have low L-serine levels. These low serine levels have been observed to cause high deoxy-SLs through an established SPT pathway. Briefly, in the presence of low serine levels, the SPT enzyme is left to utilize alanine, rather than serine, to make complex sphingolipids (SLs), leading to production of deoxy-SLs. In some embodiments, administration of RNA processing modulators (RPMs) (e.g., antisense oligonucleotides) described herein results in translation of SPTLC1 protein isoforms that prefer serine over alanine, even in the presence of low serine in a subject.

[0180] Interestingly, SPT mutations have also been observed to cause MacTel2. For example, dominant mutations in SPT genes SPTLC1 or SPTLC2 have been observed to lead to preferential use of alanine, and also cause rare familial MacTel2. Low serine is also associated with oxidative stress. To this point, serine biosynthesis is an important antioxidant in the macula region of the eye and reduced PHGDH function leads to oxidative stress and reduced glutathione. SPT mutations additionally have been observed to cause Hereditary sensory neuropathy type 1 (HSAN1) (including HSANl(a)), and a subset of these HSAN1 patients get both diseases. Certain gain of function mutations in SPTLC1, such as SPTLC1 C133W, decrease substrate selectivity and cause production of deoxy-sphingolipids. In HSAN1 patients, levels of various toxic deoxy-SLs are elevated, such as 1 -deoxy sphinganine, 1 -deoxy sphingosine, and 1- deoxy ceramide.

[0181] Rare mutations in SPT have been observed to cause early onset ALS and to be associated with other neurodegenerative disease, such as Parkinson’s Disease and Alzheimer’s Disease. Interestingly, SPTLC1 mutations associated with ALS are different from those seen in MacTel2 or HSAN1. SPTLC1 variants associated with ALS are linked to decreased levels of SPTLC1 and ceramides in plasma, cerebrospinal fluid, and spinal cord tissue. Elevated ceramide levels have also been observed in Parkinson’s Disease and Alzheimer’s Disease subjects’ tissues, such as the plasma and cerebrospinal fluid, and other models of these diseases (e.g., patient cells) that carry mutations in SPTLC1 and other SPT subunits. In Alzheimer’s Disease patients, plasma ceramides levels positively correlate with baseline Neurofilament light chain (Nfl) plasma levels, but also longitudinal changes in Nfl. Similar to observations made in models of Parkinson’s Disease and Alzheimer’s Disease, lipid analyses have shown accumulation of ceramides in the general ALS population, including ceramides in patient plasma samples. Nonlimiting examples of SPTLC1 mutations associated with ALS include SPTLC1 A20S, SPTLC1 Y23F, SPTLC1 L38R, SPTLC1 L39 deletion, SPTLC1 F40 deletion + S41 deletion, SPTLC1 S331F, SPTLC1 S331Y, SPTLC1 exon 2 deletion, and SPTLC1 rs75431233. Different mutations in the SPTLC1 subunit, that increase the canonical activity of the enzyme and result in overaccumulation of sphingolipids, cause a monogenic form of ALS. In some embodiments, administration of an RNA processing modulator as described herein to a subject having ALS or Alzheimer’s disease results in reduction of Nfl plasma levels in the subject (e.g., relative to the Nfl plasma levels in the subject prior to the administration).

[0182] Adult-onset diabetes mellitus has also been observed to lead to reduced serine levels, perhaps due perhaps to excessive liver uptake. .

[0183] Thus, accumulation of toxic deoxy-SLs is seen across several disease indications and elevated non-deoxy-SLs (e.g., sphinganine, sphingosine, and ceramide) may play an important role in the pathophysiology of neurodegenerative diseases, such as Parkinson’s Disease, Alzheimer’s Disease, and ALS.

[0184] Dysregulated deoxy-SL production is associated with other conditions. For instance, in contrast to the role that dysregulated L-serine synthesis plays in the development of MacTel2 and HSAN1, upregulation of toxic deoxy-SLs may be a treatment approach for cancer. For instance, inhibition of PHGDH increases sensitivity of primary cultures of muller glia from cadaveric eyes to oxidative stress conditions. This suggests that increased deoxy-SLs is cytotoxic and makes cells from sensitive to other stresses. Separately, inhibition of SPT function is associated with reduced markers of atherosclerosis.

[0185] Existing drugs that inhibit SPT (e.g., myriocin and, reportedly, cycloserine) are likely not specific enough to mediate a therapeutic effect, and myriocin may have some toxicity associated with its use.

[0186] Example 3: Modulation of L-Serine and Lipid Biosynthesis

[0187] In some embodiments, an isolated nucleic acid described herein (e.g., an RNA processing modulator, such as an antisense oligonucleotide) is capable of modulating the levels of one or more non-deoxy-SLs (e.g., sphinganine, sphingosine, and / or ceramide) and / or one or more deoxy-SLs (e.g., deoxy-sphinganine and / or deoxy-ceramide) in a cell, such as a cell in a subject (e.g., a human subject). In some embodiments, modulating the levels of one or more non-deoxy-SLs and / or one or more deoxy-SLs comprises modulating the expression of a gene associated with L-serine biosynthesis and / or lipid biosynthesis using an isolated nucleic acid described herein. In some embodiments, modulating the expression of a gene associated with L- serine biosynthesis and / or lipid biosynthesis comprises increasing or decreasing the transcription and / or translation of an mRNA encoded by the gene using an isolated nucleic acid (e.g., an RNA-processing modulator, such as an antisense oligonucleotide) described herein.

[0188] In some embodiments, a gene associated with L-serine biosynthesis and / or lipid biosynthesis is a mutant SPTLC1 gene. In some embodiments, a mutant SPTLC1 gene comprises one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions relative to a wild type SPTLC1 gene (or mRNA encoded by a wild type SPTLC1 gene, such as one comprising a sequence set forth in SEQ ID NO: 300). In some embodiments, a mutant SPTLC1 gene encodes SPTLC1 C133W. In some embodiments, a mutant SPTLC1 gene encodes SPTLC1 A20S. In some embodiments, a mutant SPTLC1 gene encodes SPTLC1 Y23F. In some embodiments, a mutant SPTLC1 gene encodes SPTLC1 L38R. In some embodiments, a mutant SPTLC1 gene encodes SPTLC1 L39 deletion. In some embodiments, a mutant SPTLC1 gene encodes SPTLC1 F40 deletion + S41 deletion. In some embodiments, a mutant SPTLC1 gene encodes SPTLC1 S331F. In some embodiments, a mutant SPTLC1 gene encodes SPTLC1 S331 Y. In some embodiments, a mutant SPTLC1 gene comprises an SPTLC1 exon 2 deletion. In some embodiments, a mutant SPTLC1 gene comprises SPTLC1 rs75431233.

[0189] In some embodiments, a mutant SPTLC1 gene is associated with a disease or disorder described herein including, but not limited to, retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s Disease, Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia). In some embodiments, a mutant SPTLC1 gene is associated with Parkinson’s Disease, Alzheimer’s Disease, ALS, or HSANl.

[0190] In some embodiments, a mutant SPTLC1 gene comprises one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions relative to a wild type SPTLC1 gene (or mRNA encoded by a wild type SPTLC1 gene) that are associated with HSAN1 in a subject. In a subject having a mutated SPTLC1 gene, HSAN-1 can result in a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.) which manifests as, in some instances, severe loss of sensation to temperature, pressure and pain. In some instances, long-term cases of HSAN1 leads to painless injuries, chronic skin ulcers, bone destruction, bone infections, amputation of digits, and motor dysfunction. In some embodiments, a mutant SPTLC1 gene encoding SPTLC1 C133W is associated with HSAN1 in a subject.

[0191] In some embodiments, a mutant SPTLC1 gene comprises one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions relative to a wild type SPTLC1 gene (or mRNA encoded by a wild type SPTLC1 gene) that are associated with ALS in a subject. Amyotrophic lateral sclerosis (ALS) is a fatal, rapidly progressive neurodegenerative disease. In a subject having a mutated SPTLC1 gene, degeneration of upper and lower motor neurons results in spasticity, weakness, muscle atrophy, and eventually death due to involvement of the muscles of respiration. Most cases present with weakness in the limbs, but up to one-third may begin with bulbar symptoms. Cognitive and behavioral symptoms may include pseudobulbar affect and behavioral -variant frontotemporal dementia. In some embodiments, a mutant SPTLC1 gene encoding SPTLC1 C133W is associated with ALS in a subject. In some embodiments, a mutant SPTLC1 gene encoding SPTLC1 A20S is associated with ALS in a subject. In some embodiments, a mutant SPTLC1 gene encoding SPTLC1 Y23F is associated with ALS in a subject. In some embodiments, a mutant SPTLC1 gene encoding SPTLC1 L38R is associated with ALS in a subject. In some embodiments, a mutant SPTLC1 gene encoding SPTLC1 L39 deletion is associated with ALS in a subject. In some embodiments, a mutant SPTLC1 gene encoding SPTLC1 F40 deletion + S41 deletion is associated with ALS in a subject. In some embodiments, a mutant SPTLC1 gene encoding SPTLC1 S331F is associated with ALS in a subject. In some embodiments, a mutant SPTLC1 gene encoding SPTLC1 S331Y is associated with ALS in a subject. In some embodiments, a mutant SPTLC1 gene comprising an SPTLC1 exon 2 deletion is associated with ALS in a subject. In some embodiments, a mutant SPTLC1 gene comprising SPTLC1 rs75431233 is associated with ALS in a subject.

[0192] In some embodiments, an isolated nucleic acid (e.g., an RNA-processing modulator, such as an antisense oligonucleotide) described herein is administered to a subject (e.g., a mammalian subject, such as a human subject) having or suspected of having one or more mutations in a SPTLC1 gene. In some embodiments, the subject has or is suspected of having a disease or disorder described herein. In some embodiments, the disease or disorder is Parkinson’s Disease, Alzheimer’s Disease, ALS, or HSAN1. In some embodiments, administration of an isolated nucleic acid (e.g., an RNA-processing modulator, such as an antisense oligonucleotide) described herein is capable of modulating one or more non-deoxy- SLs (e.g., sphinganine, sphingosine, and / or ceramide) and / or one or more deoxy-SLs (e.g., deoxy-sphinganine and / or deoxy-ceramide) in a subject (e.g., a mammalian subject, such as a human subject). In some embodiments, administration of the isolated nucleic acid to the subject modulates the levels of one or more non-deoxy-SLs (e.g., sphinganine, sphingosine, and / or ceramide) and / or one or more deoxy-SLs (e.g., deoxy-sphinganine and / or deoxy-ceramide) in a biological sample obtained from the subject. In some embodiments, the biological sample is cerebrospinal fluid (CSF), plasma, or spinal cord tissue.

[0193] Example 4: ASOs targeting SPTLC1

[0194] This example describes design of RPMs (e.g., ASOs) that target human SPTLC1. In the context of diseases associated with dysregulation of L-serine biosynthesis, it is desirable to decrease protein levels of SPTLC1 (e.g., mutant SPTLC1), for example by decreasing translation of SPTLC1 mRNA or decreasing activity or function of SPT. In some embodiments, ASOs are designed to target regions of SPTLC1 mRNA that will result in decreased translation of SPTLC1 protein or SPT and / or decreased activity of SPTLC1 protein or SPT.

[0195] Expression profiling was performed on human Serine palmitoyltransferase long chain base subunit 1 (SPTLCP) (e.g., NCBI Ref. Seq. NM_006415.4). FIG. 2A shows bulk tissue gene expression of human SPTLC1. Data indicate SPTLC1 mRNA is ubiquitously expressed. The type and number of SPTLC1 mRNA splice variants was investigated (FIG. 2B). Data indicate eight isoforms of SPTLC1 protein are encoded by SPTLC1 splice variants. FIG. 2C shows representative data for exon expression analysis of human SPTLC1 splice variants in CNS tissue. Data indicate full length SPTLC1 is the most commonly expressed isoform in brain tissue. Table 1 shows representative RPM (e.g., antisense oligonucleotide) sequences targeting mRNA encoded by SPTLCP

[0196] Example 5: In vitro screening of ASOs

[0197] Cell lines (e.g., U-l 18 MG human glioblastoma cells) were cultured and maintained using appropriate media (e.g., Dulbecco's Modified Eagle's Medium containing 10% fetal bovine serum). When appropriate, several approaches were used to generate in vitro models of MacTel2 and HSAN1. For instance, cell lines may be engineered to stably express mutant forms of SPTLC1. Cells carrying mutations in SPTLC1 were verified by sequencing. When appropriate, serine-deficient media was optionally used to amplify the phenotypes of cells with dysregulated L-serine biosynthesis. A screen of ASOs targeting SPTLC1 RNA (Table 1, FIG. 3A) was performed in 96 well plate format, by seeding about 20,000 U-l 18 MG cells per well and treating with the ASOs at concentrations of 5 nM and 20 nM using the Lipofectamine protocol. Each concentration was transfected in 2 independent wells for biological duplicates. Two different ASO chemistries were assayed for targeting of SPTLC1 RNA. Short interfering RNAs (siRNAs) were used as a positive control for SPTLC1 expression measurements. A non-targeting ASO sequence with matched chemistry and length was used as a negative control, in addition to wells treated with PBS or water. Treated cells were incubated at 37 °C in a cell culture incubator for 48 hours before isolating total RNA for measurement of gene expression. Total RNA was isolated and converted (reverse-transcribed) to cDNA, then Taqman gene expression assays were used to quantify SPTLC1 gene modulation (e.g., TaqMan™ Fast Advanced Cells-to-CT™ kit (ThermoFisher #A35378)). The qPCR reaction was multiplexed with probes targeting SPTLC1 (FIG. 3 A; amplified region of SPTLC1 indicated by rectangle labeled “qPCR Amplicon”) and a human housekeeping gene, hypoxanthine guanine phosphoribosyltransferase 1 (HPRTP). Cycle threshold (Ct) values were generated for both SPTLC1 and HPRT1 and were used for analysis.

[0198] SPTLC1 gene expression levels were analyzed using the Delta-Delta Ct method. For each sample, SPTLC1 gene expression levels, provided as cycle threshold (Ct) values, were normalized to the housekeeping gene HPRT1 (2'('SPTLC1 Cl HPRTI ct)) SPTLC1 expression relative to controls was then calculated for each sample based on the mean values of non-transfected control wells treated with PBS or water within each plate and shown as a percentage ((Sample / Control Mean) * 100). Resulting values for all treatment groups are shown in FIG. 3B.

[0199] Five (5) of the tested ASOs targeting SPTLC1 resulted in a decrease in SPTLC1 RNA expression by more than 50% at the 5 nM dose and achieved knock-down comparable to the siRNA positive control. An additional seventeen (17) ASOs resulted in a decrease in SPTLC1 RNA expression by more than 50% at the 20 nM dose. SPTLC1 -targeting ASOs of each tested chemistry successfully resulted in a decrease in SPTLC1 RNA expression by more than 50% at the 20 nM dose. The effects of 23 of the most potent ASOs tested are shown in FIG. 3C.

[0200] U-251 MG cells were transfected with ASOs at a dose of 40 nM, 20 nM, 10 nM, 5 nM, 2.5 nM, 1.25 nM, 0.625 nM, or 0.3125 nM. At 48 hours after transfection, the effect of ASO administration on SPTLC1 RNA and the housekeeping control (HPRT1) was analyzed using RT-qPCR. SPTLC1 -targeting ASOs tested showed concentration-dependent knockdown of SPTLC1 mRNA. An EC50=3.25nM was observed following administration of an ASO comprising the nucleotide sequence of SEQ ID NO: 193, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 194 of Table 1 (FIGs. 3C-3E). An EC50=5.95nM was observed following administration of an ASO comprising the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 (alternatively referred to as “SPTLC1 ASO 2” herein) (FIGs. 3C-3E). An EC50=1.83nM was observed following administration of an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) (FIGs. 3C-3E).

[0201] The effect of these ASOs on levels of L-serine, SLs, and deoxy-SLs may further be tested by methods well known in the art. For instance, chemically extracted SLs and deoxy-SLs may be measured using liquid chromatography-mass spectrometry (LCMS). ASO efficacy may be determined by comparing the levels of L-serine, SLs, and deoxy-SLs between treated and untreated cells. Alternatively, L-serine biosynthesis may be measured through metabolic labelling experiments in either intact or lysed cells using reagents such as radioactive, fluorescent, and bio-orthogonal labels. Alternatively, SLs and deoxy-SLs may be measured through a flow cytometry platform, wherein intact cells are exposed to fluorescent antibodies that bind SLs and deoxy-SLs prior to flow cytometry analysis after gating on cells that are not exposed to fluorescent antibodies.

[0202] To further characterize ASO-dependent changes in L-serine biosynthesis and / or lipid biosynthesis, cytotoxicity may be measured to understand the physiological impact of changes in deoxy-SL levels. Cell viability may be measured by generating survival curves through manual counting of Trypan blue stained cells following ASO treatment. Alternatively, propidium iodide staining of cells followed by flow cytometry analysis may be used to measure cell death.

[0203] Example 6: In Vitro Dose Response of ASOs Targeting SPTLC1

[0204] To further characterize ASOs targeting SPTLC1, select ASOs (e.g., from Table 1) were assayed with a second cell line, U251-MG cells. U251-MG cells were selected for further study based on high endogenous levels of SPTLC1 expression. To assess the efficacy of SPTLC1- targeting ASOs in U251-MG cells, 61 ASOs (e.g., from Table 1) were selected for further study and tested at either a 5 nM dose or a 20 nM dose. The 61 ASOs included ASOs of either a gapmer chemistry or a skipmer chemistry. U251-MG cells were reverse transfected with 5 nM or 20 nM ASO using the Lipofectamine 2000 protocol, with 2 biological replicates per transfection condition, and plated in 96-well plates at 1.5xl04cells per well. Control cells were reverse transfected with water and a non-targeting control. After incubation at 37 °C for 48 hours, SPTLC1 gene expression levels were analyzed by RT-qPCR as described previously, with 3 technical replicates. The effect of A7J7 / .(’ / -targeting ASOs on SPTLC1 gene expression was compared against corresponding conditions previously tested in U118-MG cells. The tested ASOs were observed to effectively inhibit SPTLC1 expression in both cell types (FIG. 4A). Furthermore, the degree of knockdown was determined to be highly correlated across both cell types (R = 0.86). These results indicate high reproducibility of ASO effectiveness across these distinct cell lines and indicate that these ASOs would be effective across a variety of cell types. Further analyses indicated that an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 results in targeted knockdown SPTLC1 in non-human primate cells and human- derived iPSCs (alternatively referred to as “SPTLC1 ASO 1” herein) (FIGs. 4B-4D) whereas an ASO comprising the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 resulted in potent knockdown of both SPTLC1 in non-human primate cells and human-derived iPSCs and Sptlcl in mouse cells (alternatively referred to as “SPTLC1 ASO 2” herein) (FIG. 4C).

[0205] The efficacy of select ASOs was assayed further in U251-MG cells by testing ASOs across a range of concentrations. Six distinct ASOs (e.g., from Table 1) were selected for further study and tested at concentrations of 40 nM, 20 nM, 10 nM, 5 nM, 2.5 nM, 1.25 nM, 0.625 nM, and 0.3125 nM. As previously, U251-MG cells were reverse transfected with up to 40 nM ASO using the Lipofectamine 2000 protocol, with 2 biological replicates per transfection condition and plated in 96 well plates at 1.5 x 104cells per well. Control cells were reverse transfected with water and a non-targeting control. After incubation at 37 °C for 48 hours, SPTLC1 gene expression levels were analyzed by RT-qPCR as described previously, with 3 technical replicates. All assayed ASOs were observed to inhibit SPTLC1 expression in U251-MG cells, attaining >50% knockdown between 1.25 nM and 40 nM, with most ASOs attaining >50% knockdown around 10 nM (FIGs. 5 A and 5B).

[0206] Example 7: In Vitro Dose Response of ASOs Targeting SPTLC1 in Glutamatergic Neurons To further establish the efficacy of A7J77.C7-targeting ASOs on SPTLC1 gene expression levels across a range of cell types, a panel of 9 ASOs (e.g., as described in Table 1) were assayed in induced pluripotent stem cell (iPSC)-derived glutamatergic neurons. Briefly, iPSC- derived neurons were cultured and transfected with either 0 pM, 0.3 pM, 1 pM, 3 pM, or 10 pM of ASO and incubated at 37°C for 5 days. Control cells were treated with a non-targeting control in PBS. After incubation for 5 days, SPTLC1 gene expression levels were analyzed by RT-qPCR as described previously. All but one of the assayed ASOs achieved >50% knockdown at or around 1 pM, with several achieving >50% knockdown at or around 0.3 pM (FIG. 6A). The ,S7J77.C7-targeting ASOs generally had little if any effect on expression of the HPRT1 housekeeping gene at most dosages, however a pronounced effect on HPRT1 expression was generally observed at 10 pM, indicating that the highest dosage may be toxic to iPSC-derived neurons (FIG. 6B). Importantly, SPTLC1 knockdown at the 3 pM dose was observed to be highly correlated between iPSC-derived neurons and U251-MG cells previously tested at a 20 nM dose (FIG. 6C).

[0207] To assess the ability of an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) to enter neurons and reduce SPTLC1 in a relevant cell type, hiPSC-derived spinal motor neurons were treated with PBS or an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) (0.08pM, 0.31pM, 1.25pM, 5pM, 20pM) via gymnotic delivery. Five days after treatment, SPTLC1 mRNA levels were quantified by RT-qPCR and normalized to the housekeeping gene HPRTP Treatment with an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) led to a concentration dependent reduction in SPTLC1 mRNA levels with an EC50 below IpM (FIG. 6D). To confirm the effect observed in hiPSC-derived motor neurons in a second relevant cell type, hiPSC-derived cortical neurons were treated with PBS or an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) (0.08pM, 0.31pM, 1.25pM, 5pM, 20pM) via gymnotic delivery. After 5 days of treatment, SPTLC1 mRNA levels were quantified by RT-qPCR and normalized to the housekeeping gene HPRTP Treatment with an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) led to a concentration dependent reduction in SPTLC1 mRNA levels with an EC50 of 0.1 pM.

[0208] In silico off-target analysis identified two genes with two mismatches to an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein), WDR47 and ZFHX3. As both genes are expressed in the CNS, and since the primary effect of an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) will occur in the CNS after intrathecal administration, the effect of an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) on these two genes was evaluated in vitro in a neuronal cell type. HiPSC-derived cortical neurons were treated with PBS or an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) (0.08pM, 0.3 IpM, 1.25pM, 5pM, 20pM) via gymnotic delivery. After 5 days of treatment, WDR47 and ZFHX3 mRNA levels were quantified by RT-qPCR and normalized to the housekeeping gene HPRT1. The effect of an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) at reducing SPTLC1 (EC50=0.1pM) was 89-fold more potent than on WDR47 (EC50=8.9pM) and 273-fold more potent than on ZFHX3 (EC50=27.3pM). At the EC50 for SPTLC1, WDR47 and ZFHX3 mRNA levels were reduced by less than 20% (FIG.

[0209] 6D).

[0210] These results further confirm the efficacy of the A7J7 / .C / -targeting ASOs on SPTLC1 gene expression levels across a range of cell types, including non-cancerous cell types.

[0211] Example 8: In Vivo ASO Methods

[0212] Animals are maintained in a consistent light and dark cycle and allowed to acclimate for at least five days prior to experiments. Regular feedings are executed at a consistent time, frequency, and amounts each day. ASOs targeting SPTLC1 are administered to the animals by infusion. When multiple ASO infusions are performed, administration of the ASO is done at the same time each day to minimize changes in metabolism due to circadian rhythm. ASO infusions are either directly provided to the affected area or into the cerebral spinal fluid (CSF). Animals may be placed in the Trendelenburg position during and after the infusion to aid in distribution of the ASOs into the tissue (e.g., CNS tissue) of the animals. ASOs are solubilized in an appropriate buffer and sterilized prior to infusions. Following infusions, animals are maintained for a predetermined period of time prior to analysis. In some instances, animals are fed a diet with radioactive glucose to determine the extent of L-serine incorporation into SLs. To analyze the effect of ASO treatment, animals are anesthetized, and tissue is harvested. Harvested tissue samples are flash frozen in appropriate extraction buffers. Blood samples are isolated, when appropriate, and mixed with buffer for preservation purposes. Harvested tissue samples are cryosectioned and used for immunohistochemistry analysis. Blood samples are used for measuring blood serine levels.

[0213] Example 9: Toxic Lipid Analyses in iPSC-derived Neurons To characterize the effect of SPTLC1 mRNA knockdown on toxic lipid production in vitro, human iPSC-derived neuron lines were engineered to comprise a gain of function mutation in SPTLC1. The PGP1 human iPSC line comprising wildtype SPTLC1 was used to engineer two lines, wherein the “Het SPTLC1 KO” line was engineered to comprise a heterozygous knock-out of SPTLC1, and the “Het SPTLC1 C133W KI” line was engineered from Het SPTLC1 KO to comprise a heterozygous knock-in of an SPTLC1 gain of function (GOF) allele encoding the C133W mutation associated with HSAN1. The engineered human iSPC lines were verified by karyotyping and sequencing.

[0214] RT-qPCR analyses indicated Het SPTLC1 KO exhibited 64% decrease in SPTLC1 mRNA. SPTLC1 mRNA levels in Het SPTLC1 C133 KI were comparable to WT controls. Treatment with a non-selective serine palmitoyl transferase (SPT) inhibitor control, myriocin, had no effect of SPTLC1 mRNA levels. However, when treated with an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein), Het SPTLC1 C133 KI exhibited a 56% knockdown in SPTLC1 mRNA levels relative to untreated controls (FIG. 7).

[0215] Further analyses were used to assess production of toxic lipids as a result of SPTLC1 mutation and ASO treatment. Various lipid levels were assayed including toxic deoxysphingolipids (e.g., 1 -deoxy sphinganine, 1 -deoxy sphingosine, and 1 -deoxy ceramide) which are elevated in diseases, such as HSAN1, and also non-deoxy lipids (e.g., sphinganine, sphingosine, and ceramide) which are elevated in diseases, such as ALS (FIG. 8A). The lipid production assay was first validated in undifferentiated iPSCs derived from HSAN1 patients comprising SPTLC1 encoding the C133W mutation. Analysis of the human HSAN1 patient line showed increased production of toxic 1 -deoxy sphingoid bases (FIG. 8B).

[0216] To assess toxic lipid production in the engineered iPSC-derived neurons, single cells were seeded for an appropriate amount of time before being treated with either 30 nM of an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) or 20 uM of myriocin. After 72 hours, cells were harvested and assayed for toxic lipid production. A total of two replicates were performed in all treatments.

[0217] Very low to non-detectable levels of toxic deoxy sphingoid bases (DSBs) in wildtype and Het SPTLC1 KO iPSCs were detected. Het SPTLC1 KO iPSCs exhibited decreases in sphinganine and sphingosine levels by 40% and 55%, respectively, relative to wildtype iPSCs. Het SPTLC1 C133W KI iPSCs exhibited elevated levels of toxic DSBs relative to wildtype iPSCs. Myriocin positive control treatment of Het SPTLC1 C133W KI iPSCs decreased both sphingoid bases and toxic deoxy-sphingoid bases by greater than 90%. When SPTLC1 ASO 1 was administered, 1 -deoxy sphinganine levels were reduced by approximately -20% compared to Het SPTLC1 C133W KI iPSCs. Additionally, SPTLC1 ASO 1 treatment decreased sphinganine and sphingosine levels by 48% and 63%, respectively, which were comparable to levels observed in Het SPTLC1 KO iPSCs (FIGs. 8C-8G).

[0218] When ceramide and deoxy-ceramide levels were measured, an increase of 54% in 1- deoxy ceramide was observed in Het SPTLC1 C1233W KI iPSCs compared to wildtype and Het SPTLC1 KO iPSCs. An increase of 34% in ceramide was observed in Het SPTLC1 C133W KI iPSCs compared to wildtype iPSCs. Myriocin positive control treatment of Het SPTLC1 C133W KI iPSCs resulted in a 98% reduction in 1 -deoxy ceramide and ceramide levels. When SPTLC1 ASO 1 was administered, 1-deoxyceramide and ceramide levels were reduced by 21% and 29%, respectively (FIGs. 8H-8J).

[0219] These results indicated SPTLC1 knockout led to decreased sphingolipid production while SPTLC1 C133W mutation caused elevated production of toxic deoxy-sphingolipids. Moreover, these results indicated treatment with SPTLC1 ASO 1 or myriocin modulated sphingolipid production and reduced levels of toxic deoxy-sphingoid bases.

[0220] To confirm that the lipid effects observed in the hiPSC disease model study were applicable to neurons, a small study was performed in wild type hiPSC-derived cortical neurons. The primary focus for the sphingolipid readout was total ceremide levels. Multiple wells across 6 plates of hiPSC-derived cortical neurons were treated with PBS or SPTLC1 ASO 1 (5pM) via gymnotic delivery. After 5 days of treatment, wells from each treatment group were pooled together for mRNA and targeted lipid analysis. SPTLC1 mRNA levels were measured by RT- qPCR, and SPTLC1 ASO 1 treatment resulted in -90% reduction in SPTLC1 levels (FIG. 8K). Sphingolipid profiles were analyzed using LC / MS / MS and normalized to total protein input. STPCL1 ASO 1 treatment reduced total ceramide levels by >70% (FIG. 8K), which recapitulated the results observed in the hiPSC disease model. This further demonstrated that SPTLC1 ASO 1 is effective at reducing SPTLC1 in neurons and has a corresponding effect on reducing sphingolipid levels elevated in different diseases.

[0221] Example 10: In Vivo Knockdown of SPTLC1 mRNA in Mouse Subjects

[0222] This example describes in vivo knockdown of SPTLC1 mRNA using ASOs described herein. Briefly, C57BL / 6 mice were administered either a single ICV injection, or a repeated ICV injections of the ASOs, and mRNA levels were quantified in the brain tissue (samples harvested from Left Cortex 1 and Left Hippocampus). Frozen tissues were lysed and homogenized in RLT buffer using beads (MP Biomedical) before RNA extraction using RNeasy Mini Kit (Qiagen) in a QIAcube station (Qiagen). RNA concentration was evaluated a nanodrop spectrometer (ThermoFisher), integrity using 2100 Bioanalyzer LabChip (Agilent). 500ng of RNA was reverse-transcribed using SuperScript IV VILO Master Mix ezDNase (Invitrogen). qPCR was performed with TaqMan Fast Advance Master Mix (Invitrogen) in a Quantstudio thermocycler (Applied Biosystems) with 2 independent Taqman (VIC) assays for SPTLC1 (IDT TF Mm01339824_gl, TF Mm00447346_ml). Pgkl and PPIA levels were measured using a Taqman (FAM) assay (Mm00435617_ml, Therm ofi scher) for normalization using DeltaDeltaCt method.

[0223] FIGs. 9A-9D show representative data for in vivo reduction of SPTLC1 mRNA levels in the brain of C57BL / 6 mice. FIG. 9A shows relative SPTLC1 mRNA levels in hippocampus tissues of mouse subjects 3 weeks after a single bilateral stereotaxic ICV injection of vehicle (artificial CSF), 3ug of myriocin, a non-specific ASO at a dose of 200ug or 300ug, or an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) or an ASO comprising the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 (alternatively referred to as “SPTLC1 ASO 2” herein) at a dose of 300ug. FIG. 9B shows relative SPTLC1 mRNA levels in cortex tissues of mouse subjects 3 weeks after a single bilateral stereotaxic ICV injection of vehicle (artificial CSF), 3ug of myriocin, a non-specific ASO at a dose of 200ug or 300ug, or SPTLC1 ASO 1 or SPTLC1 ASO 2 at a dose of 300ug. FIG. 9C shows relative SPTLC1 mRNA levels in hippocampus tissues of mouse subjects one week after the last of three ICV injections through a canula, with 1 week interval, of vehicle (artificial CSF) or lOOug+lOOug+lOOug of ASO. FIG. 9D shows relative SPTLC1 mRNA levels in cortex tissues of mouse subjects one week after the last of three ICV injections through a canula, with 1 week interval, of vehicle (artificial CSF) or lOOug+lOOug+lOOug of ASO. “SPTLC1 ASO 1” corresponds to an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 . “SPTLC1 ASO 2” corresponds to an ASO comprising the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 . Values were averaged across 2 technical replicates and shown as a percentage of the vehicle-control group. Statistical analysis was performed using a linear model comparing treatment groups to the aCSF group and adjusting for RNA isolation batch (*:p<0.05, **:p<0.01, ***:p<0.001). FIGs. 9A-9D show representative data for in vivo reduction of SPTLC1 mRNA levels in mouse brain. FIG. 9A shows relative SPTLC1 mRNA levels in hippocampus tissues of mouse subjects seven days after a series of three weekly ICV injections of vehicle (artificial CSF), 3ug of myriocin, a non-specific ASO at a dose of 200ug (lOOug+lOOug) or 300ug (lOOug+lOOug+lOOug), or SPTLC1 ASO 1 or SPTLC1 ASO 2 at a dose of 300ug (lOOug+lOOug+lOOug). FIG. 9B shows relative SPTLC1 mRNA levels in cortex tissues of mouse subjects seven days after a series of three weekly ICV injections of vehicle (artificial CSF), 3ug of myriocin, a non-specific ASO at a dose of 200ug (lOOug+lOOug) or 300ug (lOOug+lOOug+lOOug), or SPTLC1 ASO 1 or STPCL1 ASO 2 at a dose of 300ug (lOOug+lOOug+lOOug). FIG. 9C shows relative SPTLC1 mRNA levels in hippocampus tissues of mouse subjects seven days after a series of three weekly ICV injections through a canula, of vehicle (artificial CSF) or 300ug (lOOug+lOOug+lOOug) of ASO. FIG. 9D shows relative SPTLC1 mRNA levels in cortex tissues of mouse subjects seven days after a series of three weekly ICV injections through a canula, of vehicle (artificial CSF) or 300ug (lOOug+lOOug+lOOug) of ASO. “SPTLC1 ASO 1” corresponds to an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 . “SPTLC1 ASO 2” an ASO comprising the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 .

[0224] In the repeated ICV injection study, some animals exhibited minor acute in-life observations post administration of myriocin, SPTLC1 ASO 1, or SPTLC1 ASO 2, which were largely resolved in 1-2 hours. No major effects on life were observed in animals that received administration of Myriocin or SPTLC1 ASOs.

[0225] Repeated ICV injection of SPTLC1 ASO 2 resulted in SPTLC1 mRNA knockdown by 19-22% in both the cortex and hippocampus, respectively (FIGs. 9C-9D). SPTLC1 ASO 2 exhibited cross-reactivity with mouse and non-human primate SPTLC1 mRNA. SPTLC1 ASO 1 resulted in significant SPTLC1 knockdown in the cortex in one assay (FIG. 9D). No significant effects on SPTLC1 mRNA were observed in subjects that were administered control treatments of vehicle, myriocin, or non-specific ASOs.

[0226] Further analyses determined pharmacokinetics (ASO levels) as a result of SPTLC1 ASO 1 administration via ICV injection to the cortex of mouse subjects. Briefly, mouse subjects received a single ICV injection of either a control agent (artificial CSF; a lOpg dose of a nonspecific ASO; or a lOpg dose of SPTLC1 ASO 2) or a lOpg dose of SPTLC1 ASO 1 as described herein. Mouse subjects were sacrificed at two weeks following ICV injection. SPTLC1 ASO 1 levels were measured using hybridization ELISA analysis of cortex tissue samples collected from the same side (ipsilateral) of the cortex where the single ICV injection was performed. No SPTLC1 ASO 1 levels were detected in cortex tissue samples obtained from mouse subjects that received a single ICV injection of artificial CSF, a non-specific ASO, or SPTLC1 ASO 2. The sum of all SPTLC1 ASO 1 level measurements in cortex tissue samples obtained from mouse subjects that received single ICV injection of non-specific ASOs was not significant. When cortex samples obtained from mouse subjects who received a single ICV injection of SPTLC1 ASO 1 were analyzed, high SPTLC1 ASO 1 levels were detected (FIG. 10A).

[0227] ASO1 exposure (PK) was evaluated in the mouse ipsilateral cortex and hippocampus by hybridization enzyme linked immunosorbent assay (hELISA) using custom capture and detection probes. Male C57BL / 6 mice (N=5 per group, 8-9 weeks of age) were dosed with lOOpL of vehicle (aCSF) or lOOpg of SPTLC1 ASO 1 once a week for three weeks via unilateral ICV administration. One week after the final dose, animals were sacrificed, and the pharmacokinetics (PK) of the mouse ipsilateral cortex and hippocampus were evaluated. hELISA data showed a mean exposure of 34.8 pg / g (16.9-45 pg / g) in the cortex and 53.3 pg / g (31.7-102 pg / g) in the hippocampus, indicating ASO 1 exposure in the CNS (FIG. 10B).

[0228] Example 11: In Vivo ASO Administration to Non-Human Primates

[0229] This example describes in vivo administration of SPTLC1 ASOs to cynomolgus monkey (Macaca fascicularis) subjects (also referred to as “non-human primate subjects). Briefly, nonhuman primate subjects received two intrathecal (IT) injections of either vehicle (artificial CSF) or an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein). Each group (vehicle-injected and ASO-injected) consisted of two male subjects and one female subject and each round of IT injection was performed two weeks apart (days 1 and 14). In both rounds of ASO IT injection, SPTLC1 ASO 1 was administered at a dose of 20mg to yield a total dose of 40mg of SPTLC1 ASO 1 administered over a 28-day period. At day 28 (two weeks after the last intrathecal injection) non- human primate subjects were sacrificed and samples of cerebrospinal fluid as well as brain (frontal cortex, sensory cortex, and hippocampus), lumbar spinal cord, dorsal root ganglion, kidney, liver, spleen, heart, stomach, and gonads tissues were collected. Additionally, serum and plasma were collected 3 days prior to day 1 and before day 14 (FIG. 11 A). Liquid chromatography-mass spectrometry analysis was used to measure SPTLC1 ASO 1 pharmacokinetics (ASO levels) and RT-qPCR was used to measure SPTLC1 ASO 1 pharmacodynamics (SPTLC1 mRNA expression). Then, SPTLC1 ASO 1 concentrations in frontal cortex, hippocampus, and lumbar spinal cord tissue samples were quantified to determine SPTLC1 ASO 1 levels as a result of administration through IT injection. Table 2. SPTLC1 ASO 1 Levels in Tissue Samples of Non-Human Primate Subjects

[0230] SPTLC1 ASO 1-treated subjects received an ASO comprising the nucleotide sequence of SEQ ID NO: 162 (*) and the chemical modifications (**) as set forth in Columns A and C, respectively, of row 163 of Table 1

[0231] No SPTLC1 ASO 1 was detected in tissue samples obtained from non-human primate subjects that underwent two IT injections with vehicle. No in-life safety signals were observed in non-human primate subjects who received two IT injections with vehicle or SPTLC1 ASO 1. In tissue samples obtained from non-human primate subjects that underwent two IT injections with ASO targeting SPTLC1 mRNA, SPTLC1 ASO 1 was detected at a mean concentration of approximately 14-55 pg / g tissue (FIG. 11B and Table 2). Additionally, ASO pharmacokinetics in tissue samples obtained from non-human primate subjects administered ASO via IT injection met or exceeded previously documented pharmacokinetic data in non-human primate ASO studies (see, e.g., Malatl ASO administration in Jafar-Nejad et al. (2021). Nucleic Acids Research. 49 (2): 657-673).

[0232] Further analyses indicated that two IT injections with SPTLC1 ASO 1 resulted in significant SPTLC1 mRNA knockdown (-30-40%) in frontal cortex and sensory cortex tissue samples obtained from non-human primate subjects (FIGs. 1 ID-1 IK). Injection with vehicle (artificial CSF) or a non-specific ASO had no significant effect on SPTLC1 mRNA knockdown (FIGs. 1 ID-1 IL). Additionally, no change in SPTLC1 mRNA expression was observed when RT-qPCR analysis was performed using a probe which non-discriminately binds to all SPTLC1 mRNA isoforms, including an alternative shorter transcript which lacks a domain critical for SPTLC1 activity and is not targeted by SPTLC1 ASO 1 (Assay 2 in FIGs. 1 ID-1 IL; see also FIG. 12). However, when SPTLC1 mRNA expression was analyzed by RT-qPCR using a probe which binds SPTLC1 mRNA at a sequence located close to the SPTLC1 ASO 1 binding site, an approximate 30-40% knockdown in SPTLC1 mRNA was observed (Assay 1 in FIGs. 1 ID-1 IL; see also FIG. 12). This indicates SPTLC1 ASO 1 specifically reduces expression of SPTLC1 encoded by the SPTLC1 canonical transcript in non-human primate frontal cortex and sensory cortex following repeated injection with a high dose of SPTLC1 ASO 1. Liquid chromatography -tandem mass spectrometry analyses of lumbar spinal cord samples indicated a reduction of toxic sphingolipid levels in samples also showing a high biodistribution levels of SPTLC1 ASO 1 and reduced levels of SPTLC1 mRNA (FIG. 1 IM).

[0233] The pharmacokinetic effects associated with a series of four IT injections of ASO were assessed in additional non-human primate subjects. Three male non-human primate subjects were administered a series of four IT injections of either vehicle (artificial CSF) or an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) at a dose of 95 mg (30 mg+25 mg+20 mg+20 mg). For all non-human primate subjects, each round of IT injection was performed two weeks apart (days 0, 14, 28, and 42). Samples of cerebrospinal fluid as well as brain (frontal cortex, sensory cortex, and hippocampus), lumbar spinal cord, dorsal root ganglion, kidney, liver, spleen, heart, stomach, and gonads tissues were collected at two weeks following the last IT injection (FIG. 14). Liquid chromatography-tandem mass spectrometry (LC-MS / MS) analysis was used to measure ASO pharmacokinetics (ASO levels) in tissue samples obtained from injected non-human primates and toxic sphingolipid levels in cerebral spinal fluid. ASO concentrations in tissue samples were quantified to determine SPTLC1 ASO 1 levels as a result of IT injection (FIGs. 15A-15B). Toxic sphingolipid levels in cerebral spinal fluid samples were quantified to determine effects of SPTLC1 ASO 1 administration via IT injection (FIG. 15D). In parallel, SPTLC1 mRNA levels were analyzed by RT-qPCR to correlate pharmacokinetics effects and reductions in ceramide levels in cerebral spinal fluid with pharmacodynamics effects of SPTLC1 ASO 1 administration (FIG. 15C). In SPTLC1 ASO 1 -treated subjects, a 32% reduction in SPTLC1 mRNA levels on average across all treated animals and a 44% reduction in SPTLC1 mRNA levels on average across the 2 animals with drug exposure was observed (FIGs. 15B-15C) as well as a 45% reduction in ceramide levels in CSF compared to baseline (FIG. 15D).

[0234] Example 12: Immunostimulatory Effects of ASOs In Vitro

[0235] This Example describes analyses of immunostimulatory effects of SPTLC1 ASOs in human peripheral blood mononuclear cells (huPBMCs).

[0236] All ASOs were prepared using in vivo quality grade material in manner that was consistent with analyses performed in animal subjects as described above. huPBMCs were harvested from healthy donors and went either untreated, treated with a cytokine / chemokine response control agent, or treated with an ASO comprising the nucleotide sequence of SEQ ID NO: 162, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 163 of Table 1 (alternatively referred to as “SPTLC1 ASO 1” herein) or an ASO comprising the nucleotide sequence of SEQ ID NO: 147, a gapmer structure, and the chemical modifications as set forth in Columns A and C of row 148 of Table 1 (alternatively referred to as “SPTLC1 ASO 2” herein) at a concentration of IpM, 3pM, or lOpM for 24 hours.

[0237] Cytokine / chemokine response control agents included: XD-01024, a cholesterol - conjugated ApoB siRNA which has TLR7 / 8 agonist effects; CL097, a water-soluble derivative of imidazoquinoline compound R848 which is a TLR7 / 8 ligand; Imiquimod (R837), an immune response modifier having potent antiviral activity and also induces production of cytokines and activates TLR7; ODN2216 a 20mer oligo containing unmethylated CpG and has TLR9 agonist effects; ODN2006 having preference towards TLR9, one or more CpGs, class B; ODN2395, TLR9, CpG with palindromic motif, class C; TL8-506, a benzoazepine compound which has TLR8 agonist effects; LMW poly(l:c) which has TLR3 agonist effects; and XD-00366, a 25mer double-stranded, unmodified, blunt-ended LacZ RNA duplex which has TLR7 / 8 agonist effects.

[0238] Following treatment of huPBMCs, the levels of IFN-a2a, IFN-b, IL-1B, IL-6, IL-10, IP- 10, MCP-1, MIP-la, MIP-lb and TNF-a were measured using the MSD-U-Plex platform. Representative data from these analyses are shown in FIGs. 13A-13J. Negative control cells exhibited minimal increases or no detectable increase in chemokine / cytokine levels following treatment. Treatment with TLR agonist positive controls resulted in increased chemokine / cytokine levels as expected. When compared relative to cell samples treated under negative or positive control conditions, immunogenic responses to SPTLC1 ASO 1 or SPTLC1 ASO 2 were either minimal or not detected (FIGs. 13A-13J).

[0239] EQUIVALENTS

[0240] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.

[0241] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0242] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

[0243] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”

[0244] The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

[0245] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0246] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0247] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0248] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of’ and “consisting essentially of’ shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of’ and “consisting essentially of’ the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B”, the disclosure also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B”.

Claims

CLAIMS1. An isolated nucleic acid that comprises a region of complementarity with a human SPTLC1 mRNA transcript, has at least 60% identity to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-299, and upon binding to the mRNA transcript decreases translation of functional SPTLC1 protein encoded by the mRNA transcript.

2. The isolated nucleic acid of claim 1, wherein the isolated nucleic acid comprises RNA.

3. The isolated nucleic acid of claim 1 or 2, wherein the isolated nucleic acid is an antisense oligonucleotide.

4. The isolated nucleic acid of any one of claims 1 to 3, comprising or consisting of between 10 and 40 nucleotides.

5. The isolated nucleic acid of claim 4, wherein the isolated nucleic acid comprises or consists of between 18 and 25 nucleotides.

6. The isolated nucleic acid of any one of claims 1 to 5, wherein the isolated nucleic acid comprises one or more chemical modifications.

7. The isolated nucleic acid of claim 6, wherein the one or more chemical modifications comprise one or more nucleoside modifications and / or one or more sugar-phosphate backbone modifications.

8. The isolated nucleic acid of claim 7, wherein the one or more nucleoside modifications comprises a 2'-O-methyl (2'-0Me) modification, a 2'-0-M0E modification, a 2'-O-fluoro modification, or a locked nucleic acid (LNA) modification.

9. The isolated nucleic acid of claim 7 or 8, wherein the one or more sugar-phosphate backbone modifications comprises a phosphorothioate backbone modification.

10. The isolated nucleic acid of any one of claims 1 to 9, wherein the isolated nucleic acid is fully chemically modified.

11. The isolated nucleic acid of any one of claims 1 to 10, wherein the isolated nucleic acid comprises one or more deoxyribonucleotides, optionally wherein the isolated nucleic acid is a gapmer.

12. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located in an untranslated region (UTR) of the SPTLC1 mRNA transcript.

13. The isolated nucleic acid of claim 12, wherein the untranslated region comprises a 5' UTR, an intron, or a 3' UTR of the SPTLC1 mRNA transcript.

14. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located in a protein coding region of the SPTLC1 mRNA transcript.

15. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located on an intron-exon boundary of the SPTLC1 mRNA transcript.

16. The isolated nucleic acid of any one of claims 1 to 15, wherein the region of complementarity comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides of the sequence set forth in SEQ ID NO: 300.

17. The isolated nucleic acid of any one of claims 1 to 16, comprising the nucleotide sequence set forth in any one of the nucleotide sequences set forth in Table 1.

18. A composition comprising the isolated nucleic acid of any one of claims 1 to 17, and a pharmaceutically acceptable excipient.

19. A method for increasing lipid biosynthesis in a cell or a subject, the method comprising administering the isolated nucleic acid of any one of claims 1 to 17 or the composition of claim 18 to a cell or a subject in need thereof.

20. The method of claim 19, wherein the subject is characterized as having low serine.

21. The method of claim 19 or 20, wherein the subject comprises one or more mutations in a gene that is associated with lipid biosynthesis, optionally wherein the gene is SPTLCP22. The method of any one of claims 19 to 21, wherein the cell is a human cell, optionally wherein the cell is in a subject.

23. The method of any one of claims 19 to 22, wherein the subject is a human subject.

24. The method of any one of claims 19 to 23, wherein the subject has or is suspected of having a disease or disorder associated with dysregulation of L-serine biosynthesis.

25. The method of claim 24, wherein the disease or disorder is a retinal disease (e.g.,MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s Disease, Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

26. The method of any one of claims 19 to 25, wherein the administration is systemic administration, optionally wherein the systemic administration comprises intravenous injection.

27. The method of any one of claims 19 to 25, wherein the administration comprises direct administration to a target tissue of the subject, optionally wherein the direct administration comprises direct injection to the central nervous system (CNS), direct injection to the peripheral nervous system (PNS), or direct administration to the eye.

28. The method of claim 27, wherein the administration comprises placing the subject in a Trendelenburg position during the administration.

29. A method for decreasing deoxy-sphingolipid (deoxy-SL) biosynthesis in a cell or a subject, the method comprising administering the isolated nucleic acid of any one of claims 1 to 17, or the composition of claim 18, to a cell or a subject in need thereof.

30. The method of claim 29, wherein the subject is characterized as having low serine.- I l l -31. The method of claim 29 or 30, wherein the subject comprises one or more mutations in a gene that is associated in L-serine biosynthesis, optionally wherein the gene is SPTLC1.

32. The method of any one of claims 29 to 31, wherein the cell or subject is a human cell or subject.

33. The method of any one of claims 29 to 32, wherein the subject has or is suspected of having a disease or disorder associated with dysregulation of L-serine metabolism.

34. The method of claim 33, wherein the disease or disorder is a retinal disease (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s Disease, Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

35. The method of any one of claims 29 to 34, wherein the administration is systemic administration, optionally wherein the systemic administration comprises intravenous injection.

36. The method of any one of claims 29 to 34, wherein the administration comprises direct administration to the central nervous system (CNS), optionally wherein the direct administration comprises direct injection to the CNS.

37. The method of claim 36, wherein the administration comprises placing the subject in a Trendelenburg position during the administration.

38. A method for preventing or treating a disease or disorder associated with dysregulation of L-serine biosynthesis in a subject in need thereof, the method comprising administering to the subject the isolated nucleic acid of any one of claims 1 to 17, or the composition of claim 18 to a subject in need thereof.

39. The method of claim 38, wherein the subject is a human.

40. The method of claim 38 or 39, wherein the disease or disorder is a retinal disease (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s Disease, Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

41. The method of any one of claims 38 to 40, wherein the administration comprises direct administration to a target tissue of the subject, optionally wherein the direct administration comprises direct injection to the central nervous system (CNS), direct injection to the peripheral nervous system (PNS), or direct administration to the eye.

Images